US Pat. No. 10,188,938

ACTION OR POSITION TRIGGERS IN A GAME PLAY MODE

Open Invention Network LL...

1. A method of interpreting a user motion sequence, the method comprising:capturing the user motion sequence as a plurality of images of a user body via a motion capturing device during a session;
during the user motion sequence, identifying the user motion sequence has stopped responsive to identifying a lack of movement of the user body for a predefined period of time;
responsive to the lack of movement of the user body, receiving the plurality of images and reducing user body position data of user arms and user legs to a plurality of data points;
identifying position changes of the user arms and the user legs based on the plurality of data points in each of the plurality of images;
processing, via a processor, the user motion sequence into a predetermined data format comprising a plurality of vector signatures;
comparing the processed user motion sequence to at least one predetermined motion sequence stored in a database comprising pre-stored vector signatures, by comparing the plurality of data points of the vector signatures of the user motion sequence to a plurality of data points of the pre-stored vector signatures to determine whether there is a match;
determining whether to perform at least one of interpreting the user motion sequence as a universal command and registering the user motion sequence as a new command;
identifying the user motion sequence as not having a match in the database responsive to the comparing of the vector signature of the user motion sequence to the pre-stored vector signatures; and
registering the user motion sequence as a new command when the user motion sequence was not discovered in the database.

US Pat. No. 10,188,937

PUZZLE BOOK

1. A mechanical puzzle book, comprising:a plurality of puzzle pages, including a first puzzle page and a last puzzle page and optionally one or more intermediate puzzle pages, each puzzle page forming a plane comprised of one or more parallel planar layers and containing a puzzle to be solved by mechanical movement of puzzle pieces within said plane;
one or more locking mechanisms for locking each puzzle page to a next puzzle page;
wherein solving a puzzle disengages the locking mechanism, allowing the unlocked puzzle page to be turned, thereby exposing the next puzzle page for solution,
wherein said locking mechanism further comprises a hook portion fixed to the next puzzle page and a moveable latching portion within a current puzzle page, wherein solving the puzzle causes the latching portion to move thereby disengaging from the hook portion, and
wherein said hook portion fits into an opening on a back side of said current puzzle page.

US Pat. No. 10,188,935

SYSTEM FOR A TOURING SKI-BINDING COMPRISING A FRONT UNIT AND A HEEL UNIT

Markus Steinko, Ascholdi...

1. A system for a touring ski-binding comprising a front unit and a heel unit comprising a heel member, wherein the heel member comprises a reception bowl for receiving a heel part of a ski boot,a biasing device for biasing the heel unit against a ski boot, wherein the heel member is pivotally disposed around a pivot axis, wherein the pivot axis runs horizontally, transverse to a longitudinal direction of a ski, and
a stopper plate for releasing a ski stopper, wherein the stopper plate is switchable between an adjacent position and a protruding position, wherein the stopper plate is configured to leave the adjacent position when the touring ski binding is released, wherein the heel unit is switchable between a starting position for providing a walking function and for receiving a ski boot, and a snap-in position for retaining the ski boot,
wherein the heel unit comprises a blocking element configured to block the stopper plate in the adjacent position, wherein the blocking element is configured to switch, with respect to the pivot axis, between a blocking position and a non-blocking position depending on the position of the heel member, wherein with respect to a downhill mode the front unit in a climbing mode of the touring ski-binding is displaced to the front in the longitudinal direction of the ski, so that a ski boot present in the touring ski-binding cannot contact the heel member of the heel unit.

US Pat. No. 10,188,934

ICE SKATE AND RUNNER THEREFOR

SPORT MASKA INC., Montre...

1. An ice skate comprising:a boot adapted for receiving therein a foot of a wearer of the skate;
a holder mounted to a sole of the boot and having at least one attachment point thereon; and
a runner mounted to the holder and secured in place thereon via the at least one attachment point, the runner being entirely metal and extending a length along a longitudinal axis between a front end and an opposed rear end of the runner, the runner having a height extending between an ice-contacting portion for engaging an ice surface and an opposed upper portion of the runner, opposed outer and inner side surfaces of the runner defining a datum runner thickness extending therebetween, and one or more regions of reduced thickness in the runner that are recessed inwardly from at least one of the outer and inner side surfaces thereof, the one or more regions having a local thickness less than the datum runner thickness, at least one of the one or more regions of reduced thickness having a closed periphery being entirely surrounded by regions having a thickness greater than the local thickness.

US Pat. No. 10,188,933

METHOD AND SYSTEM FOR DETERMINING BALL POSITIONS AND FIRST DOWNS IN A FOOTBALL GAME

1. A system for determining ball placement on an athletic football field, comprising:a first light projection device and a second light projection device adapted to travel parallel to the athletic field within a beveled elongated track having at least one slot that extends at least 100 yards, said track being positioned parallel to one sideline on a football field; wherein said first light projection device and said second light projection device are configured to project a light on the athletic field, and wherein the first light projection device is configured to track the location of a football during first down when the football is on a line of scrimmage during play of a football game, and wherein the second light projection device is configured to track the location of a first down demarcation on the field;
a remote control unit adapted to perform at least one of the following: turn said first light projection device on and off; adjust the angle of said first light projecting device; and effect the movement of said first light projection device;
wherein at least one of the first light projection device and the second light projection device have a camera mounted thereto;
wherein the first light projection device is adapted to project a light beam in a horizontal direction across a width of the athletic field;
a location sensor possessed by a referee, that communicates the location of the football; and wherein the referee sends a signal to the at least one of the first light projection device and the second light projection device, instructing said at least one of the first light projection device and the second light projection device to move into alignment with said location sensor;
wherein said first light projection device is associated with a first elongated member that extends along the length of a side-line of the field between a first end zone to a second end zone, said elongated member associated with a first pulley and a second pulley.

US Pat. No. 10,188,928

CONVERTIBLE GOLF ALIGNMENT AND MEASUREMENT DEVICE

1. A golf device comprising:a first elongated portion including a first hollow track extending in a lengthwise direction of the first elongated portion, a first end, and a second end, wherein the first elongated portion and the track are straight;
a second elongated portion including a second hollow track extending in a lengthwise direction of the second elongated portion, a first end, and a second end, wherein the second elongated portion and the track are straight;
a hinge securing the first end of the first elongated portion and the first end of the second elongated portion, wherein the first elongated portion and the second elongated portion are configured to form a 180 degree angle at the hinge in a first configuration and a 90 degree angle at the hinge in a second configuration; and
an arch portion, which is made from a flexible material, concealed inside the tracks when the first and second elongated portions are in the first configuration, wherein the arch portion includes a first slideable end having a first arch slide which is slideably engageable in the first track inside the first elongated portion in the lengthwise direction until reaching a first stop at the second end of the first elongated portion, wherein the arch portion includes a second slideable end having a second arch slide which is slideably engageable in the second track inside the second elongated portion in the lengthwise direction until reaching a second step at the second end of the second elongated portion, wherein the arch portion is exposed outside of the tracks by sliding the first slideable end along the first track toward the first stop and sliding the second slideable end along the second track toward the second stop when the first elongated portion is bent toward the second elongated portion at the hinge from the first configuration to the second configuration and wherein the arch portion forms an arch from the second end of the first elongated portion to the second end of the second elongated portion when the first slideable end reaches the second end of the first elongated portion, when the second slideable end reaches the second end of the second elongated portion, and when the first elongated portion and the second elongated portion form the 90 degree angle at the hinge, the arch having a constant radius with a length from the hinge to the arch portion.

US Pat. No. 10,188,926

MARTIAL ARTS TRAINING DEVICE

1. A martial arts training device comprising:a waist belt configured to be worn on a waist;
a first leg-strike unit movably connected to the waist-belt, the first leg-strike unit further including a first outer cover and a first buffer provided inside the first outer cover, wherein the first leg-strike unit has a cylinder shape;
a second leg-strike unit movably connected to the waist belt, the second leg-strike unit further including a second outer cover and a second buffer provided inside the second outer cover, wherein the second leg-strike unit has a cylinder shape;
a handle provided on each of the first and second outer covers;
an arm-supporting cushion disposed on each of the first and second outer covers above the handle to elastically support an arm; and
a wrist-protecting cushion provided on each of the first and second outer covers and integrally formed on a bottom portion of the arm-supporting cushion to support a wrist, wherein
the first and second outer covers are movably connected to the waist belt.

US Pat. No. 10,188,922

PUTTING SKILL GAME

1. A putting skill game device for putting a ball up an incline to sink the ball into a target, the device comprising:a game board with at least one target aperture providing passage of the ball through the game board;
a housing for placement of the board;
a ramp secured to the housing wherein the ramp provides the incline to launch the ball at the game board;
a putting surface providing a rigid surface leading to the ramp;
wherein the ramp pivotally attaches to the housing wherein the ramp pivots into and out of the housing;
wherein the putting surface pivotally attaches to the ramp wherein the putting surface folds onto the ramp;
a locking finger adjustably attached to the housing wherein the locking finger adjusts toward the ramp to contact the ramp, the locking finger secures to the housing in a locked position that contacts the ramp to secure the ramp within the housing.

US Pat. No. 10,188,917

WEIGHTED IRON SET

Acushnet Company, Fairha...

1. A set of golf clubs comprising at least a first club head having a loft between about 15 and 25 degrees, a second club head having a loft of between about 26 and 35 degrees, and a third club head having a loft of about 36 degrees or greater, wherein:the first, second and third club heads each comprise a heel, a toe, a topline, a sole, a hosel and a front face having a face center, each club head having a club head mass that is different than the previous club head by at least 5 grams, and wherein at least the first club head includes a back wall having an aperture and a weight member formed of tungsten and coupled to a toe portion of the back wall that comprises 15%-25% of the club head mass, wherein a mechanical fastener is inserted through the aperture from a face side of the club and extends through the aperture in the back wall to couple the weight member to the toe portion and a face member is welded to a face retaining surface forward of the mechanical fastener.

US Pat. No. 10,188,915

GOLF CLUB HEAD

TAYLOR MADE GOLF COMPANY,...

1. A golf club head, comprising:a body, defining an interior cavity and comprising:
a sole portion, positioned at a bottom region of the golf club head;
a crown portion, positioned at a top region of the golf club head;
a skirt portion, positioned around a periphery of the golf club head between the sole portion and the crown portion;
a forward region;
a rearward region, opposite the forward region;
a heel region; and
a toe region, opposite the heel region; and
a face portion, coupled to the body at the forward region of the body and comprising a strike plate; and
at least one stiffener comprising a discrete mass of polymeric material within the interior cavity and directly coupled to the face portion at a location with an x-axis coordinate, of a club head origin coordinate system of the golf club head, greater than 20 mm and less than 50 mm or greater than ?50 mm and less than ?20 mm, wherein the polymeric material of the at least one discrete mass has a hardness equal to or greater than about Shore 10D;
wherein:
the golf club head further comprises a retaining wall, coupled to the sole portion, protruding uprightly from the sole portion, and extending lengthwise in a heel-to-toe direction;
the discrete mass of polymeric material is coupled to the retaining wall and interposed between the retaining wall and the face portion;
the golf club head further comprises a slot, formed in the sole portion and extending lengthwise from the heel region to the toe region; and
the retaining wall forms part of the slot.

US Pat. No. 10,188,913

INTERCHANGEABLE SHAFT SYSTEM

Acushnet Company, Fairha...

1. A golf club, comprising:a golf club head including a hosel and a plurality of hosel alignment features, wherein the hosel defines a sleeve bore and the hosel alignment features are disposed adjacent a proximal end of the hosel;
an elongate shaft;
a shaft sleeve coupled to a distal end portion of the shaft, the shaft sleeve including a sleeve body defining a shaft bore, a plurality of sleeve alignment features, and a retainer, wherein the sleeve body is constructed from a non-metallic material and the retainer is a bump on the sleeve body that extends outward from the adjacent portions of the sleeve body between 0.25 mm and 1.0 mm and that is integrally formed with the sleeve body, wherein the shaft sleeve includes a threaded insert disposed in a distal portion of the sleeve body, wherein the threaded insert is constructed from a metallic material;
a tubular wedge member including a plurality of wedge alignment features, wherein the wedge member is rotatably and slidably coupled to the shaft sleeve so that it is interposed between the sleeve alignment features and the retainer, wherein the retainer creates an effective outer diameter of the shaft sleeve that is greater than a diameter of a bore defined by the tubular wedge member; and
a fastener that releasably couples the shaft sleeve to the club head,
wherein the wedge member provides a wedge angle between the shaft sleeve and the hosel, and
wherein the shaft sleeve provides a shaft angle between the shaft sleeve and the shaft.

US Pat. No. 10,188,910

GOLF BALL

SUMITOMO RUBBER INDUSTRIE...

1. A golf ball comprising a spherical core and at least one cover covering the spherical core, whereina hardness difference D1 (H75?H0) between a hardness H75 at a point located at a distance of 75% of a core radius from a center of the spherical core and a center hardness H0 of the spherical core is 15 or more and 35 or less in Shore C hardness,
a hardness difference D2 (Hs?H75) between a surface hardness Hs of the spherical core and the hardness H75 at the point located at the distance of 75% of the core radius from the center of the spherical core is ?1 or more and 3.5 or less in Shore C hardness,
a hardness difference D3 ((H0+H75)/2?H37.5) between a hardness of (the center hardness H0 of the spherical core+the hardness H75 at the point located at the distance of 75% of the core radius from the center of the spherical core)/2 and a hardness H37.5 at a point located at a distance of 37.5% of the core radius from the center of the spherical core is 0.5 or more and 6.5 or less in Shore C hardness, and
a hardness difference D5 (H75?H50) between the hardness H75 at the point located at the distance of 75% of the core radius from the center of the spherical core and a hardness H50 at a point located at a distance of 50% of the core radius from the center of the spherical core is 10 or more in Shore C hardness.

US Pat. No. 10,188,905

SYSTEM FOR PROCESSING EXERTION DATA DERIVED FROM EXERTION DETECTION DEVICES

Tri2Focus, Inc., Cypress...

1. A method for implementing an electronic feedback loop based on exertion data derived from one or more exertion sensors including at least one of a bicycle power meter, a heart rate monitor, or a global positioning satellite watch, the method comprising:generating, by an exertion sensor data processor, a workout schedule, wherein the generating includes
querying an electronic database for a race date, race performance goal, and athlete capability parameters;
determining a number of time units between a current date and the race date;
for each time unit of the number of time units
determining, by the workout processor, a prescribed stress level for the time unit;
generating by the workout processor, workouts that subject an athlete to the prescribed stress level for the time unit; and
storing the workouts in the workout schedule in the electronic database detecting, via the one or more exertion sensors, physical exertion during at least one of the workouts;
computing, by the exertion sensor data processor, an actual stress level for the at least one of the workouts, wherein the computing is based on the exertion data derived from the one or more exertion sensors;
querying, by the exertion sensor data processor, the electronic database for the prescribed stress level for the at least one of the workouts;
determining, by the exertion sensor data processor, that the actual stress level is less than the prescribed stress level for the at least one of the workouts;
in response to determining that the actual stress level is less than the prescribed stress level for the at least one of the workouts, modifying, by the exertion sensor data processor, the workout schedule; and
transmitting, over the electronic communications network, an electronic workout data file including the modified workout schedule for presentation on a remote display device.

US Pat. No. 10,188,902

SIGNAL ANALYSIS AND RECHARGING SYSTEM

1. A golf club impact analysis system, including:a first piezoelectric element embedded in a club face of a golf club;
a first signal divider that receives a first power signal that is output from the first piezoelectric element based on both impact of the golf club with an object and vibrations, the first signal divider having a first output and a second output, wherein the first output is coupled to signal processing circuitry and the second output is coupled to an energy storage assembly that includes a battery; and
a processor that is configured to dynamically adjust a ratio of a first amount of the first power signal the first signal divider sends through the first output to the signal processing circuitry versus a second amount of the first power signal the first signal divider sends through the second output to the energy storage assembly, wherein the processor is further configured to perform impact analysis of the impact of the golf club with the object.

US Pat. No. 10,188,898

PHYSICAL THERAPY DEVICE AND METHODS FOR USE THEREOF

1. A physical therapy device comprising:a back rest;
a right upper arm rest removably coupled to the back rest by a first connector;
a left upper arm rest removably coupled to the back rest by a second connector;
a right lower arm rest removably coupled to the right upper arm rest by a third connector;
a left lower arm rest removably coupled to the left upper arm rest by a fourth connector;whereineach lower arm rest comprises a handle,
the back rest, right and left upper arm rests, and right and left lower arm rests are constructed of a material selected from the group consisting of resin, fiberglass composite, carbon fiber, carbon fiber composite, metal, metal alloys, and combinations thereof, wherein said material is rigid enough to provide resistance when coupled,
the third and fourth connectors provide for at least flexion and extension while providing variable resistance to said flexion and extension, and
the right and left upper arm rests are configured to move toward the back rest at the first and second connectors, respectively, to fold flush against the back rest.

US Pat. No. 10,188,897

SLIDE HANDLE

JMC Engineering, LLC, Sa...

1. An exercise handle comprising:an elongated handle body having a top head, a bottom head, and a central bore extending along a longitudinal axis;
a top pulley coupled to the top head, the top pulley being rotatable around a top axis that is substantially perpendicular to the longitudinal axis;
a bottom pulley coupled to the bottom head, the bottom pulley being rotatable around a bottom axis that is substantially perpendicular to the longitudinal axis;
at least one secondary pulley associated with at least one of the top pulley and the bottom pulley;
a cord disposed on a circumferential surface of the top pulley, the cord passing through the central bore and being disposed on a circumferential surface of the bottom pulley, such that when the handle body is moved, the top and bottom pulleys rotate to allow the cord to move through the central bore.

US Pat. No. 10,188,895

WEIGHT EXERCISER WITH FLEXIBLE PERIMETER GRIP BAND

1. A dumbbell exercise device, comprising:a bar;
first and second end-weights at opposite ends of the bar, wherein the first and second end-weights each are of a shape including at least one flat side surface that extends along a longitudinal plane parallel or substantially parallel to the bar;
first and second housings receiving the first and second end-weights, respectively, wherein the first and second housings each include at least one flat inner surface of a sidewall engaging said at least one flat side surface along the longitudinal plane parallel or substantially parallel to the bar; and
a resistance band extending within the first and second housings laterally along the sidewalls and tautly extending parallel or substantially parallel to the bar between the first and second end-weights at or near a perimeter of the first and second end-weights.

US Pat. No. 10,188,894

BARBELL

1. A barbell comprising:a grip unit including two frames spaced apart from each other along a first direction, and a grip rod connected between said frames and configured to be gripped by a user's hand;
a support unit including two support members that are connected between said frames, that are spaced apart from said grip rod along a second direction transverse to the first direction, and that are configured to abut against a user's forearm, said support members being spaced apart from each other along a third direction transverse to the first and second directions, each of said support members extending along the first direction; and
a carrier unit including two hanging rods extending outwardly and respectively from said frames and located between said grip rod and said support members;
wherein said hanging rods extend along the first direction and are arranged in a straight line, and said grip rod is spaced apart from said hanging rods along the second direction by a distance greater than or equal to a distance between said support members and said hanging rods along the second direction; and
wherein each of said frames includes a main rod, a tubular sleeve sleeved on said main rod and connected to a respective one of said hanging rods and one end of said grip rod, and a supporting rod connected to said main rod and extending along the third direction, said support members being connected between said supporting rods of said frames, said tubular sleeve being movable relative to said main rod along the second direction to change its position on said main rod, said grip unit further including a fixing mechanism to fix said tubular sleeves of said frames to said main rods of said frames, respectively.

US Pat. No. 10,188,892

METHOD AND APPARATUS FOR MULTI-PURPOSE BOX TRAINING SYSTEM

1. A strength training apparatus comprising:a) a box member comprising:
i) a first planar side member having a first plurality of elongated apertures, wherein said first plurality of elongated apertures cooperate to define a first hand grip member between said first plurality of elongated apertures;
ii) a second planar side member oriented parallel to said first planar side member and having a second plurality of elongated apertures, wherein said second plurality of elongated apertures cooperate to define a second hand grip member between said second plurality of elongated apertures;
iii) a third planar side member attached to said first and second planar side members and oriented perpendicular to said first and second planar side members, and having at least one aperture therein;
iv) a fourth planar side member attached to said first and second planar side members and oriented perpendicular to said third planar side member, and having at least one aperture therein;
v) a planar back member attached to at least one of said first planar side member, said second planar side member, said third planar side member, or said fourth planar side member; and
b) a rigid post attached to said planar back member, and disposed between said first planar side member, said second planar side member, said third planar side member, and said fourth planar side member.

US Pat. No. 10,188,889

METHOD AND DEVICE FOR PHYSICAL TRAINING—A TRAINING MACHINE

1. A training device for physical exercises, comprising:a vertical monolithic console connected with a base and fastened to a floor;
a lower bushing disposed on the console at a lower end above the base;
an upper bushing disposed on the console at an upper end and connected immovably with the lower bushing through an intermediate bushing and bearing supports;
a mechanism for jump passing into the lower bushing through a first notch;
a mechanism for squat passing into the upper bushing through a second notch;
a lower system for adjustment disposed into the lower bushing and connected with the mechanism for jump;
an upper system for adjustment disposed into the upper bushing and connected with the mechanism for squat;
a system for drive disposed on the base and connected with the lower bushing by a pair of gears and a friction clutch; and
a system for emergency stop connected with the system for drive,
wherein the lower system for adjustment is disposed inside the lower bushing and comprises:
a lower guide, connected immovably at its both ends with the bushing,
an inside console connected immovably at an upper end of the lower guide,
a lateral console connected with an upper end of a lower bearing bush surrounding the lower guide,
a supporting bushing with a set screw surrounding the lower guide and disposed above the lower bearing bush for setting a pre-set height, and
a tension spring disposed between the inside console and the lateral console.

US Pat. No. 10,188,888

SPRING ENCLOSED TRAMPOLINE

1. A spring enclosure trampoline comprising:a. a trampoline bed connected across a horizontal frame member, wherein the trampoline bed is supported by a plurality of springs;
b. trampoline legs supporting the horizontal frame member above a ground surface;
c. a trampoline enclosure including a trampoline enclosure net supported from a spring enclosure netting support, wherein the trampoline enclosure surrounds the trampoline bed and wherein the trampoline enclosure is supported on a trampoline pole, wherein the spring enclosure netting support is formed as a leaf spring, wherein the leaf spring is flexible in a horizontal direction and in a vertical direction, wherein a leaf spring vertical dimension is greater than a leaf spring horizontal dimension, wherein the leaf spring is formed as an elongated strip; and
d. a horizontal spring constant of the leaf spring, and a vertical spring constant of the leaf spring, wherein the horizontal spring constant is less than the vertical spring constant so that the leaf spring is resiliently flexible in the vertical direction and in the horizontal direction, but is more stiff in the vertical direction; and
e. an enclosure sleeve of the trampoline enclosure, wherein the trampoline enclosure net is suspended from the enclosure sleeve.

US Pat. No. 10,188,887

AZEOTROPIC AND AZEOTROPE-LIKE COMPOSITIONS OF HFO-E-1,3,4,4,4-PENTAFLUORO-3-TRIFLUOROMETHYL-1-BUTENE AND USES THEREOF

THE CHEMOURS COMPANY FC, ...

1. A composition consisting essentially of:(a) HFO-E-1,3,4,4,4-pentafluoro-3-trifluoromethyl-1-butene; and
(b) HFO-E-1,1,1,4,4,4-hexafluoro-2-butene wherein the HFO-E-1,1,1,4,4,4-hexafluoro-2-butene is present in an effective amount to form an azeotropic composition with the HFO-E-1,3,4,4,4-pentafluoro-3-trifluoromethyl-1-butene.

US Pat. No. 10,188,885

HIGH NITROGEN AND OTHER INERT GAS ANTI-CORROSION PROTECTION IN WET PIPE FIRE PROTECTION SYSTEM

Engineered Corrosion Solu...

1. A method of operating a wet pipe fire protection sprinkler system having a pipe network, a source of water for the pipe network, at least one sprinkler head connected with the pipe network, a venting assembly configured to vent gas and not water from said pipe network, and a nitrogen source connected with the pipe network, the method comprising:supplying nitrogen gas from the nitrogen source to the pipe network to increase a pressure in the pipe network above atmospheric pressure;
supplying water to the pipe network, thereby filling the pipe network with water and compressing nitrogen gas in the pipe network; and
discharging gas including nitrogen gas from the pipe network via the venting assembly while supplying water to the pipe network.

US Pat. No. 10,188,884

STRUCTURALLY-INSTALLED ACCESS DEVICE FOR ACCEPTING CONNECTION BY A FIRE HOSE NOZZLE TO INTRODUCE FIREFIGHTING FLUID INTO AN ENCLOSED SPACE OF A STRUCTURE

GUARDIAN INVESTIGATION GR...

1. A nozzle access device configured to be installed in a structural element defining, at least in part, an enclosed space, the nozzle access device being configured to accept connection by a fire hose nozzle to introduce firefighting fluid into the enclosed space, the nozzle access device comprising:a housing configured to be inserted in a hole formed in the structural element, the housing comprising:
a first face surrounded by a first flange and having an opening in a central portion thereof, the opening being surrounded by a cylindrical socket extending from the first face in a first direction,
a cylindrical body portion extending from the first face in the first direction, and
a second face surrounded by a second flange and having an opening in a central portion thereof, the second flange being configured to attach to an end of the cylindrical body portion distal from the first face so that the first face, the second face, and the cylindrical body portion define an interior of the housing; and
a movable nozzle connector disposed within the interior of the housing, the nozzle connector having:
a tapered female connection portion having a seal and positioned to receive and surround an inserted fire hose nozzle in a locking connection, and
a cylindrical nozzle stop portion extending from the connection portion, the cylindrical nozzle stop portion being movably coupled within an interior of the cylindrical socket of the first face; and
a viewer panel attached to the first face of the housing and covering the opening in the first face, the viewer panel having a lens configured to provide a view of an exterior space on an exterior side of the structural element from within the enclosed space.

US Pat. No. 10,188,880

FILTER ASSEMBLY FOR A BREATHING APPARATUS

Cleanspace IP Pty Ltd, A...

1. A filter assembly for a breathing apparatus, the filter assembly comprising:a frame defining an aperture dimensioned to receive and retain a filter element;
a cover connected to the frame and dimensioned to cover the aperture;
a filter element; and
an indicator for indicating when the filter element is retained in the filter frame and the cover is arranged across the aperture, the indicator including a tab extending from each of the filter frame and the filter element;
wherein one of the tabs is arranged to overlay and substantially cover the other tab when the filter element is retained in the filter frame.

US Pat. No. 10,188,879

BREATHING CIRCUIT DEVICE

1. A breathing circuit device comprising:a breathing circuit line;
a carbon dioxide absorber in the breathing circuit line; and
a cooling means for cooling the breathing gas after the breathing gas leaves the CO2 absorber, the cooling means comprising a heat pump comprising:
a compressor for condensing a coolant;
a condenser, which receives the condensed coolant, cools the condensed coolant and releases heat to a surrounding area in the process; and
a heat exchanger body, which receives the cooled coolant and is in heat-conducting contact with a section of the breathing circuit line, wherein the breathing line comprises a breathing bag, the breathing bag being a flexible element, wherein a wall area of the breathing bag adapts flexibly to a shape of a surface of the heat exchanger body of the heat pump.

US Pat. No. 10,188,878

SMALL BEAM AREA, MID-VOLTAGE RADIOTHERAPY SYSTEM WITH REDUCED SKIN DOSE, REDUCED SCATTER AROUND THE TREATMENT VOLUME, AND IMPROVED OVERALL ACCURACY

31. A method for providing radiotherapy to a treatment volume, the method comprising:providing a radiotherapy system, the system comprising:
a gantry;
at least one X-ray tube mounted to the gantry, wherein the at least one X-ray tube operates at 350 kVp to 800 kVp and has a beam origin of 1.5 mm or less; and
a collimator associated with the at least one X-ray tube for collimating the X-ray beam from the X-ray tube to 30 mm or less;
wherein at least one of the gantry and the at least one X-ray tube are configured to move relative to the patient so that the X-ray beam from the at least one X-ray tube is always centered on a treatment volume; and
radiating the treatment volume using the X-ray beam, with the X-ray tube being moved so that the skin entrance portal of the X-ray beam is moved on the body during therapy so that the total area of the skin entrance portals is 20 to 100 times the X-ray beam area.

US Pat. No. 10,188,877

FIDUCIAL MARKER/CANCER IMAGING AND TREATMENT APPARATUS AND METHOD OF USE THEREOF

1. A method for determining a position of a tumor in a patient for treatment of the tumor using positively charged particles in a treatment room, comprising the steps of:providing a set of fiducial indicators, comprising:
a set of fiducial markers, a first fiducial marker of said set of fiducial markers mechanically affixed to a first object of a set of objects in the treatment room, a second fiducial marker of said set of fiducial markers affixed to a second object of said set of objects; and
a set of fiducial detectors configured to detect photons from said set of fiducial markers, wherein at least one reference element of a union of said set of fiducial markers and said set of fiducial detectors comprises a mechanical connection to an element of said set of objects;
using a known position of the reference element of said set of objects in establishing a reference line;
determining relative positions, using a controller, of each object in the treatment room relative to the reference line using all of said reference element, said set of fiducial markers, and said set of fiducial detectors;
targeting the tumor of the patient with the positively charged particles using the determined relative positions of each object in the treatment room; and
connecting a synchrotron to an exit nozzle with a first beamline, said reference line defined relative to a zero-vector path of the positively charged particles passing through said exit nozzle absent electromagnetic steering in said exit nozzle.

US Pat. No. 10,188,874

THREE DIMENSIONAL LOCALIZATION AND TRACKING FOR ADAPTIVE RADIATION THERAPY

Elekta, Inc., Atlanta, G...

1. A method for locating a three-dimensional (3D) target in a region of interest in a patient undergoing image-guided radiation therapy, the method comprising:receiving, from an image acquisition device, a two-dimensional (2D) slice of the region of interest, the 2D slice being based on a direction of motion with respect to the target in the patient;
receiving an adaptive filter model for a region of interest in the patient, the adaptive filter model being based on the target to be located;
generating a 2D patch for each 2D slice, where each 2D patch includes an associated offset value reflecting a distance between the target and a position in the corresponding 2D slice;
determining, by a processor, a correlation between the adaptive filter model and the 2D slice;
determining, by the processor, a 2D location of the target on the 2D slice based on the adaptive filter model and the determined correlation; and
estimating, by the processor, a 3D location of the target within the patient based on the offset value and the 2D slice having the determined 2D location of the target.

US Pat. No. 10,188,872

LIGHT-EMITTING DEVICE AND METHOD FOR PROVIDING PHOTOTHERAPY TO THE BRAIN

Pthera LLC, Newark, DE (...

1. An apparatus for irradiating at least a portion of a patient's brain with electromagnetic radiation to treat stroke, Parkinson's disease, Alzheimer's disease, or depression, the apparatus comprising:a source of the electromagnetic radiation;
an output optical element comprising a rigid and substantially thermally conductive material, the output optical element comprising a first surface configured to face towards the patient's scalp and to be in thermal communication with the patient's scalp during treatment and a second surface configured to face away from the patient's scalp during treatment;
a cooler thermally coupled to the second surface of the output optical element to remove heat from the output optical element through the second surface; and
a heat sink thermally coupled to the cooler, wherein the heat sink is positioned so that the electromagnetic radiation from the source propagates through the heat sink and through the output optical element.

US Pat. No. 10,188,869

HARDWARE/SOFTWARE INTEGRATED DESIGN FOR A 3D TREMOR DETECTOR USING TMS IN PARKINSON'S DISEASE AND RELATED DISORDERS

The Florida International...

1. A system comprising:a Transcranial Magnetic Stimulation (TMS) machine;
a Transcranial Stimulation Biofeedback (TSB) Detector device;
a software component comprising instructions stored on one or more non-transitory computer readable media that, when executed by a computing device, direct the computing device to:
receive waveforms from the TSB Detector device;
compute a determination factor based on the waveforms; and
when the determination factor is outside a predetermined range, send an abort signal such that the TMS machine ceases providing magnetic stimulation, and when the determination factor is not outside the predetermined range, allow the TMS machine to continue providing magnetic stimulation,
the TSB Detector device comprising:
a three-axis accelerometer sensor configured to provide three-dimensional signals;
a three-channel analog amplifier configured to receive the three-dimensional signals; and
a capacitor and a resistor connected between the three-axis accelerometer and the three-channel analog amplifier and configured to generate a cut-off frequency, and
three-dimensional tremor signals detected by the TSB Detector device being synchronized with the TMS machine via a dual communication link.

US Pat. No. 10,188,868

DEVICE SUPPORT APPARATUS

Nexstim Oyj, Helsinki (F...

21. A system for Transcranial Magnetic Stimulation (TMS) comprising:a TMS coil device having at least one cable extending therefrom,
a chair with a back portion and a seat portion,
a first arm having a device attachment portion at one end configured to lockably receive the TMS coil device, said first arm further having a cable attachment portion configured to receive the at least one cable extending from the TMS coil device;
a second arm supporting the first arm by a coupling;
a base attached to a portion of the chair, said base comprising a curved portion and having the second arm mounted directly on the curved portion at an attachment point, wherein the curved portion is at least in part formed in the shape of a curve, the attachment point being configured to move along a length of the curve of the curved portion while remaining directly mounted on the curved portion, the shape of the curved portion enabling movement of the transcranial magnetic stimulation device to different sides of a head.

US Pat. No. 10,188,867

METHOD AND APPARATUS FOR BEAT ACQUISITION DURING TEMPLATE GENERATION IN A MEDICAL DEVICE HAVING DUAL SENSING VECTORS

Medtronic, Inc., Minneap...

1. A medical device for generating a template, comprising:a plurality of electrodes configured to sense a cardiac signal;
a storage device comprising a plurality of subgroups for storing beats; and
a processor configured to:
identify a plurality of beats in the sensed cardiac signal,
determine that a first beat of the plurality of beats is an initial beat to be stored in the first subgroup of the plurality of subgroups,
set the first beat as a first subgroup template beat in response to the first beat being the initial beat,
determine, for each remaining beat of the plurality of beats, whether to store the beat within a subgroup of the plurality of subgroups of the storage device,
determine whether a number of beats stored in one of the plurality of subgroups exceeds a subgroup threshold, and in response to the number of beats stored in the one of the plurality of subgroups exceeding the subgroup threshold, and
generate a template beat using one or more beats of the one of the plurality of subgroups that exceeds the subgroup threshold.

US Pat. No. 10,188,866

SIMPLE CONTROL OF COMPLEX BIO-IMPLANTS

Impulse Dynamics NV, Wil...

1. A method of adjusting the operation of an implantable medical device, comprising:receiving access to selectively activate from among a plurality of technical parameter sets preconfigured for use with the implantable medical device, wherein the parameter sets are ordered according to their effect on a clinical parameter affected by operation of the device;
monitoring the response of the clinical parameter to activation of a first of the preconfigured parameter sets ordered between at least two others of the preconfigured parameter sets; and
activating one of the other two preconfigured parameter sets, based on the ordering of the parameter sets, the monitoring of the clinical parameter and a clinical target for the clinical parameter.

US Pat. No. 10,188,865

SYSTEMS AND METHODS OF COMBINED TONIC DBS AND RANDOM DBS

PACESETTER, INC., Sylmar...

1. A method of applying a combination of tonic stimulation and random stimulation using a deep brain stimulation (DBS) lead including a plurality of contacts to treat Parkinson's Disease (PD) in a patient, the method comprising:reducing PD-related tremor in the patient by delivering tonic stimulation using one contact of the plurality of contacts, wherein the tonic stimulation comprises a plurality of pulses with pulse parameters selected to reduce PD-related tremor in the patient; and
reducing PD-related rigidity and bradykinesia in the patient by delivering random stimulation using a subset of the remaining contacts of the plurality of contacts, wherein the random stimulation is delivered using respective bursts of multiple pulses applied to randomly or pseudo-randomly selected contacts of the subset and wherein the random stimulation comprises pulses with pulse parameters selected to reduce PD-related rigidity and bradykinesia.

US Pat. No. 10,188,860

SYSTEMS, METHODS AND DEVICES FOR A SKULL/BRAIN INTERFACE

NeuroPace, Inc., Mountai...

1. A system for introducing a form of neuromodulation to a patient, the system comprising:at least one transcranial channel configured to be implanted in an aperture in the skull of the patient, and comprising an outer wall defining an interior cavity, and an ion-permeable substance at least partially filling the interior cavity, the ion-permeable substance configured to facilitate conduction of the form of neuromodulation;
at least one scalp electrode pad comprising an orienting feature configured to engage an ear of the patient to thereby position the at least one scalp electrode pad in a vicinity of the at least one transcranial channel near a target area of neural tissue;
a stimulation source electrically coupled to the at least one scalp electrode pad and configured to generate the form of neuromodulation and deliver the form of neuromodulation to the patient through the at least one scalp electrode pad and the at least one transcranial channel; and
a securing feature coupled to the at least one scalp electrode pad and configured to secure the at least one scalp electrode pad at the vicinity of the at least one transcranial channel.

US Pat. No. 10,188,858

METHOD AND DEVICE FOR TREATING A TISSUE WITH A HIGH FREQUENCY ELECTROMAGNETIC FIELD

University Of Cincinnati,...

1. A method of treating a wound in a tissue, the method comprising:covering the wound with a dressing consisting of a hydrogel; and
exposing the tissue having the wound to a high frequency electric field at a frequency in a range between 1 GHz and 10 GHz
continuously for a duration of at least 20 minutes per day in a non-thermal manner to induce wound healing.

US Pat. No. 10,188,856

IMPLANTABLE DEVICE FOR PROVIDING ELECTRICAL STIMULATION OF CERVICAL VAGUS NERVES FOR TREATMENT OF CHRONIC CARDIAC DYSFUNCTION

Cyberonics, Inc., Housto...

1. A vagus nerve neurostimulator for treating chronic cardiac dysfunction, comprising:an implantable neurostimulator comprising:
a pair of helical electrodes;
a nerve stimulation therapy lead electrically coupled to the pair of helical electrodes;
a pulse generator configured to deliver electrical therapeutic stimulation comprising a stimulation waveform applied to both of the helical electrodes via the nerve stimulation therapy lead, the stimulation waveform comprising a form that causes propagation of action potentials in both an afferent direction and an efferent direction within neuronal fibers of a cervical vagus nerve; and
a recordable memory within which is stored stimulation parameters configured to define a periodic duty cycle comprising a percentage of time that the pulse generator delivers the electrical therapeutic stimulation,
wherein the periodic duty cycle is between a lower predefined percentage and an upper predefined percentage,
wherein the pulse generator is further configured to operate under the stimulation parameters stored in the recordable memory.

US Pat. No. 10,188,855

LEAD FIXATION DEVICE FOR SECURING A MEDICAL LEAD IN A HUMAN PATIENT

NeuroPace, Inc., Mountai...

1. A lead fixation device for securing a medical lead, the lead fixation device comprising:a single-piece structure integrally formed of a first biocompatible material and a second biocompatible material, wherein the first biocompatible material is stiffer than the second biocompatible material, the single-piece structure formed to include:
a cap partially formed of the second biocompatible material, and having a top surface defining an outer perimeter of the single-piece structure;
an annular base defining an inner perimeter of the single-piece structure, and having a first arcuate portion formed of the first biocompatible material and a second arcuate portion formed of the second biocompatible material, wherein the first arcuate portion comprises an approximately C-shaped section having a first end and a second end, and the second arcuate portion extends between the first end and the second end;
a central bore extending through the cap and the annular base; and
a retention tract formed in a portion of the cap and extending generally radially outward from the central bore to the outer perimeter, wherein:
the retention tract is configured to retain a portion of a body of the medical lead,
the portion of the cap comprising the retention tract is formed of the second biocompatible material to thereby facilitate compression of the portion including the retention tract from a relaxed position to an under tension position, and
the second arcuate portion of the annular base formed of the second biocompatible material is aligned with the portion of the cap comprising the retention tract.

US Pat. No. 10,188,795

BLOOD GLUCOSE CONTROL SYSTEM

Trustees of Boston Univer...

1. A sensor-driven glucose control system, comprising:an insulin delivery device operative in response to an insulin dose control signal to infuse insulin into the subject; and
a controller operative to generate the insulin dose control signal by:
(1) continually administering priming doses of insulin at respective times, each priming dose being of a respective amount and having a prescribed interval of action;
(2) receiving information regarding total amounts of insulin administered during the prescribed intervals of action, each total amount including an aggregation of total doses administered in response to a glucose level signal; and
(3) automatically adapting the amounts of the priming doses in response to a mathematical relationship, over respective periods each spanning multiple prescribed intervals of action, between the amounts of the priming doses and the total amounts of insulin administered during the prescribed intervals of action.

US Pat. No. 10,188,758

ORGANIC COMPOUNDS

INTRA-CELLULAR THERAPIES,...

1. A compound of Formula I:in free or salt form, wherein:R1 and R2 are independently H or C1-4 alkyl; and
R3 is —O—C2-4 alkyl optionally substituted with hydroxy.

US Pat. No. 10,188,746

PYRROLOBENZODIAZEPINES AND CONJUGATES THEREOF

MEDIMMUNE LIMITED, Cambr...

1. A conjugate of formula (A):
and salts and solvates thereof, wherein:
D represents either group D1 or D2:

the dotted line indicates the optional presence of a double bond between C2 and C3;
when there is a double bond present between C2 and C3, R2 is selected from the group consisting of:
(ia) C5-10 aryl group, optionally substituted by one or more substituents selected from the group comprising: halo, nitro, cyano, ether, carboxy, ester, C1-7 alkyl, C3-7 heterocyclyl and bis-oxy-C1-3 alkylene;
(ib) C1-5 saturated aliphatic alkyl;
(ic) C3-6 saturated cycloalkyl;
(id)
wherein each of R31, R32 and R33 are independently selected from H, C1-3 saturated alkyl, C2-3 alkenyl, C2-3 alkynyl and cyclopropyl, where the total number of carbon atoms in the R2 group is no more than 5;(ie)
wherein one of R35a and R35b is H and the other is selected from: phenyl, which phenyl is optionally substituted by a group selected from halo, methyl, methoxy; pyridyl; and thiophenyl; and(if)
where R34 is selected from: H; C1-3 saturated alkyl; C2-3 alkenyl; C2-3 alkynyl; cyclopropyl; phenyl, which phenyl is optionally substituted by a group selected from halo, methyl, methoxy; pyridyl; and thiophenyl;(ig) halo;
when there is a single bond present between C2 and C3,
R2 is
where R36a and R36b are independently selected from H, F, C1-4 saturated alkyl, C2-3 alkenyl, which alkyl and alkenyl groups are optionally substituted by a group selected from C1-4 alkyl amido and C1-4 alkyl ester; or, when one of R16a and R16b is H, the other is selected from nitrile and a C1-4 alkyl ester;R6 and R9 are independently selected from H, R, OH, OR, SH, SR, NH2, NHR, NRR?, NO2, SnMe3 and halo;
either
(a) R10 is H, and R11 is OH or ORA, where RA is C1-4 alkyl; or
(b) R10 and R11 form a nitrogen-carbon double bond between the nitrogen and carbon atoms to which they are bound; or
(c) R10 is H and R11 is OSOZM, where z is 2 or 3 and M is a monovalent pharmaceutically acceptable cation; or
(d) R11 is OH or ORA, where RA is C1-4 alkyl and R10 is selected from:
where Rz is selected from:(z-i)

(z-ii) OC(?O)CH3;
(z-iii) NO2;
(z-iv) OMe;
(z-v) glucoronide;
(z-vi) —C(?O)—X1—NHC(?O)X2—NH—RZC, where —C(?O)—X1—NH— and —C(?O)—X2—NH— represent natural amino acid residues and Rzc is selected from Me, OMe, OCH2CH2OMe;
Y is selected from formulae A1 and A2:

Z1 is a C1-3 alkylene group;
Z2 is a C1-3 alkylene group;
Q is:
where QX is such that Q is an amino-acid residue, a dipeptide residue or a tripeptide residue;L is a linker connected to a cell binding agent;
CBA is the cell binding agent;
n is an integer between 0 and 48;
R and R? are each independently selected from optionally substituted C1-12 alkyl, C3-20 heterocyclyl and C5-20 aryl groups, and optionally in relation to the group NRR?, R and R? together with the nitrogen atom to which they are attached form an optionally substituted 4-, 5-, 6- or 7-membered heterocyclic ring;
R8 is either:
(a) independently selected from H, R, OH, OR, SH, SR, NH2, NHR, NRR?, NO2, SnMe3 and halo; or
(b) of formula A*:
wherein:D? represents either group D?1 or D2:

wherein the dotted line indicates the optional presence of a double bond between C2? and C3?;
R17 is independently selected from H, R, OH, OR, SH, SR, NH2, NHR, NRR?, NO2, SnMe3 and halo;
R? is a C3-12 alkylene group, which chain may be interrupted by one or more heteroatoms, e.g. O, S, N(H), NMe and/or aromatic rings, e.g. benzene or pyridine, which rings are optionally substituted; and
X and X? are independently selected from O, S and N(H); and
R22, R16, R19, R20 and R21 are as defined for R2, R6, R9, R10 and R11 respectively.

US Pat. No. 10,188,727

BIFUNCTIONAL MOLECULES WITH ANTIBODY-RECRUITING AND ENTRY INHIBITORY ACTIVITY AGAINST THE HUMAN IMMUNODEFICIENCY VIRUS

YALE UNIVERSITY, New Hav...

1. A compound according to the chemical structure:

wherein n is 5 and n? is 4, or
a pharmaceutically acceptable salt thereof.

US Pat. No. 10,188,643

COMPOSITIONS OF BUPRENORPHINE AND ? ANTAGONISTS

Alkermes Pharma Ireland L...

1. A method of treating a depressive disorder selected from major depressive disorder, chronic depression, severe unipolar recurrent major depressive episodes, dysthymic disorder, depressive neurosis and neurotic depression, melancholic depression, atypical depression, reactive depression, treatment resistant depression, seasonal affective disorder and pediatric depression; premenstrual syndrome, premenstrual dysphoric disorder, hot flashes, bipolar disorders or manic depression, bipolar I disorder, bipolar II disorder and cyclothymic disorder comprising administering a composition comprising a 1:1 ratio by weight of buprenorphine to Compound-1 to a patient in need thereof, wherein Compound-1 has the structure:

US Pat. No. 10,188,618

TREATMENT OF CANCER WITH SPECIFIC RXR AGONISTS

IO Therapeutics, Inc., S...

1. A method of treating a hematologic malignancy, wherein the hematologic malignancy is a leukemia or a lymphoma, comprising administering to a patient in need of such treatment a retinoid X receptor (RXR) agonist at a dose below its Retinoic Acid Receptor (RAR) activating threshold and at or above its RXR effective dose, the RXR agonist has a chemical structure
where R is H, lower alkyl or 1 to 6 carbons, or a pharmaceutically acceptable salt of the compound, and the dose of the RXR agonist is from about 0.1 to about 20 mg/m2/day.

US Pat. No. 10,188,599

ANTI-INFLAMMATORY ACTIVITY WITH SYNERGISM OF HERBAL ESSENTIAL OILS

BORDOLOI BIOTECH, LLC, B...

1. A topical synergistic anti-inflammatory formulation comprising a blend of essential oils, wherein the blend includes at least three essential oils selected from:(A) Cymbopogon citratus oil (CC oil),
(B) Zanthoxylum armatum oil (ZA oil),
(C) Hedychium spicatum oil (HS oil), and
(D) a fourth essential oil obtained from basil, caraway, carrot seed, celery seed, chamomile, citronella, clary sage, clove, cumin, lemon, marjoram, nutmeg, orange, sage, sandalwood, spearmint, and/or thyme.

US Pat. No. 10,188,583

PORT CONFIGURATIONS FOR A FLUIDS CONTAINER

BAXTER INTERNATIONAL INC....

1. A container closure for use in dispensing fluids from a container, comprising:a base constructed and arranged for being attached to a mouth of the container;
a first port disposed on said base and in fluid communication with the mouth;
a second port disposed on said base in fluid communication with the mouth; and
said first and second ports being visually differentiated from each other,
wherein axes of both generally-cylindrical ports relative to said base are not parallel and do not intersect and lie in uncommon planes, and the orientation of said second port relative to the first port is described by two independent angles.

US Pat. No. 10,188,568

COMPACT PROFILE ACTUATION SYSTEM FOR AN ADJUSTABLE BED

Ergomotion, Inc., Goleta...

1. An articulating bed comprising:a support frame with a head end and having side frame members;
a carriage having a seat support and carried by the side frame members, said carriage mounted with wheels engaging the side frame members to translate from a first position through a range progressing toward the head end to a fully translated position;
a first actuator connected to a foot end of the support frame and operably engaging the carriage for translation;
a first elevating frame rotating about an axle attached to the side frame members, said first elevating frame concealed within a depth profile of the side frame members in an unrotated position;
first rollers carried by the carriage and engaging lower profile surfaces of the elevating frame;
a second roller carried by the first elevating frame and engaging a lower surface of an upper body support pivotally attached to the seat support, whereby translation of the carriage from the first position to the fully translated position rotates the first elevating frame about the axle as the lower profile surfaces roll over the first rollers to articulate the upper body support.

US Pat. No. 10,188,536

STENT-VALVE, DELIVERY APPARATUS, AND STENT-HOLDER THEREFOR

SYMETIS SA, Ecublens (CH...

1. A delivery device for delivering a stent-valve to an anatomical site for implantation, the delivery device comprising:a stent-holder; and
at least one projection extending radially away from an exterior surface of the stent-holder at a first distance, each projection being disposed within an individual recess formed in a body of the stent-holder wherein the body at least partially surrounds each projection;
wherein:
the at least one projection includes a trunk portion having a first thickness and a ramp portion having a second thickness,
wherein the trunk portion extends radially outward from the exterior surface,
the ramp portion comprises a web of material extending along and from the exterior surface up to or adjacent the first distance, and the ramp portion faces, or is provided on a side of the projection that faces, at least one of a proximal direction of the device and away from a distal end of the device, and
the ramp portion extends laterally from the trunk portion, and the second thickness is less than the first thickness.

US Pat. No. 10,188,488

SCREWLESS DENTAL IMPLANT CONNECTION

Biomet 3I, LLC, Palm Bea...

1. A dental restoration system comprising:a driver tool including a driving head;
an implant having a tip, a cylindrical body and an open end having an annular shoulder, the cylindrical body including a retention component chamber having a retention component wall;
a retention component seated in the retention component chamber of the implant, the retention component including a driver section for interfacing with the driving head of the driver tool and a dental component engagement section with a threaded surface, wherein the threaded surface is an interior surface of the retention component;
a dental component including a retention component interface surface with threads and a bore therethrough, wherein the threads on the retention component interface is an external surface of the dental component; and
wherein the dental component engages the retention component via the threaded surface of the dental component engagement section interlocks with the threads of the retention component interface surface when the dental component is inserted in the implant, the driving head of the driver tool engaging the driver section of the retention component to allow rotation of the retention component via the driver tool to engage the dental component apically such that the retention component moves, relative to the implant, in a coronal direction toward the annular shoulder as the dental component moves, relative to the implant, in an apical direction toward the tip, the retention component contacting the retention component wall and the dental component contacting the annular shoulder of the open end of the implant when the dental component is fully attached to the implant.

US Pat. No. 10,188,450

BLADE DEPLOYMENT MECHANISMS FOR SURGICAL FORCEPS

COVIDIEN LP, Mansfield, ...

1. A forceps, comprising:a first shaft member having a jaw member at a distal end thereof;
a second shaft member having a jaw member at a distal end thereof,
the first and second shaft members pivotally coupled to each other about a pivot to move the jaw members between an open position and a closed position;
a trigger disposed on one of the first or second shaft members;
a blade operatively coupled to the trigger such that actuation of the trigger translates the blade;
an interference member engaged with the trigger when the jaw members are in the open position to prevent actuation of the trigger, one of the first or second shaft members configured to contact the interference member to move the interference member out of engagement with the trigger when the jaw members are moved to the closed position to permit actuation of the trigger;
an actuator disposed within a recess formed in the first shaft member such that the actuator is recessed from an outer surface of the first shaft member, the actuator configured to supply electrosurgical energy to at least one of the jaw members; and
a tab extending from the second shaft member and configured to be received within the recess upon approximation of the first and second shaft members to depress the actuator.

US Pat. No. 10,188,405

DEVICE FOR USE IN ORTHOPAEDIC SURGERY

DEPUY IRELAND UNLIMITED C...

1. A device for use in orthopaedic surgery, the device comprising:a metallic central member; and
an outer portion comprising a polymer, wherein the outer portion surrounds the metallic central member and has a profiled outer surface for removing bone;
wherein the metallic central member comprises one or more engagement features for resisting movement of the metallic central member relative to the outer portion during impaction of the device and wherein at least one of the engagement features comprises an aperture passing through the metallic central member.

US Pat. No. 10,188,383

SUTURE CLIP DEPLOYMENT DEVICES

Edwards Lifesciences Corp...

1. A device for successively deploying a plurality of preloaded suture clips onto sutures, comprising:a proximal handle portion comprising an actuation mechanism;
a mandrel having an inner lumen for receiving sutures, a proximal end portion coupled to the actuation mechanism, and a distal end portion having a distal opening in communication with the inner lumen, wherein the mandrel defines an axial dimension extending between the distal end portion and the proximal end portion, and a radial dimension perpendicular to the axial dimension, and wherein the mandrel is configured to receive at least one suture extending through the distal opening and into the inner lumen; and
a plurality of annular suture clips mounted around the distal end portion of the mandrel, the annular suture clips being generally disk shaped and having a diameter oriented in the radial dimension and a thickness oriented in the axial dimension, wherein the thickness is smaller than the diameter;
wherein the actuation mechanism causes the mandrel to move proximally relative to the suture clips, such that a distal-most one of the suture clips slides off of a distal end of the mandrel and onto one or more sutures extending into the distal opening of the mandrel; and
wherein, after the distal-most one of the suture clips is deployed onto one or more sutures, the actuation mechanism causes the mandrel and a remaining portion of the suture clips to move distally relative to the handle portion such that a distal-most one of the remaining portion of the suture clips is ready to be successively deployed;
the device further comprising a retainer positioned at least partially around the mandrel and coupled to the actuation mechanism independently of the mandrel, the retainer configured to restrict the suture clips from moving proximally relative to the handle portion when the mandrel moves proximally relative to the handle portion;
wherein the retainer comprises at least one axially extending slot that includes a plurality of circumferentially extending notches.

US Pat. No. 10,188,370

ULTRASOUND IMAGING SYSTEM AND METHOD

Koninklijke Philips N.V.,...

1. An ultrasound imaging system, comprising:an ultrasound probe configured to acquire a sequence of ultrasound data of an imaging region of a subject when a contrast agent is perfused in the imaging region;
a time-intensity curve calculator configured to calculate a time-intensity curve of the contrast agent for each region unit of a plurality of region units of the imaging region, based on the acquired sequence of ultrasound data, each region unit comprising one or more points of the imaging region;
a reference selector configured to select, among the plurality of region units, a first, second and third set of region units respectively corresponding to normal tissue, vessel and background noise, based on the time-intensity curves, and wherein the reference selector is further configured to divide the imaging region into a plurality of segments, each segment being located at a different depth level and to select the one or more region units from the first set of region units, the one or more region units being located in the segment where the region of interest is located;
a perfusion parameter calculator configured to calculate a perfusion parameter for each of one or more region units of the first set of region units and a perfusion parameter for a region of interest in the imaging region, based on the calculated time-intensity curves;
a reference perfusion parameter calculator configured to calculate a reference perfusion parameter, based on the perfusion parameters of the one or more region units located in the segment where the region of interest is located; and
a ratio calculator configured to calculate a ratio value for the region of interest as a ratio of the perfusion parameter of the region of interest and the reference perfusion parameter.

US Pat. No. 10,188,368

IMAGE GUIDED INTRAVASCULAR THERAPY CATHETER UTILIZING A THIN CHIP MULTIPLEXOR

1. An intravenous ultrasound catheter having a distal tip and comprising:(a) a forward-facing array of ultrasound elements near to said distal tip of said device;
(b) an integrated circuit (IC) die, abutting and proximal to said ultrasound elements, having a thickness of less than 80 ?m, and having:
(i) a first face, facing said forward-facing array, and having an array of ultrasound element driving and receiving contacts, in mating arrangement to said array of ultrasound elements, so that said array of ultrasound element driving and receiving contacts collectively physically abut and electrically connect to each of said ultrasound elements;
(ii) a second face, opposed to said first face, and having a set of input-output signal contacts, said set being fewer in number than said array of ultrasound element driving and receiving contacts and being collectively switchable into contact with any one of a set of predefined blocks of said ultrasound element driving and receiving contacts, said second face also having a set of control contacts, wherein inputs received by said control contacts positively collectively command some aspect of operation of said IC die; and
(iii) wherein said ultrasound element driving and receiving contacts can send and receive signals from a first one of said blocks of said driving and receiving contacts and can then be switched to send and receive signals from a second one of said blocks of said driving and receiving contacts, different from said first one of said blocks;
(c) a flex circuit assembly, proximal to said integrated circuit and including coax cables and a contact portion, having a set of contact pads abutting and electrically connecting said input-output signal contacts of said IC die, to said coax cables;
(d) backing material, abutting and directly proximal to said contact portion, thereby forming an interface and wherein said backing material and said contact portion material have equal acoustic impedance, thereby preventing reflection at said interface; and
(e) a tubular flexible protective covering, covering said array of ultrasound elements, said integrated circuit die, said flex circuit assembly and said backing material.

US Pat. No. 10,188,367

ULTRASOUND DIAGNOSTIC DEVICE, ULTRASOUND IMAGE PROCESSING METHOD, AND NON-TRANSITORY COMPUTER-READABLE RECORDING MEDIUM

KONICA MINOLTA, INC., To...

1. An ultrasound diagnostic device that transmits ultrasound waves towards a subject via an ultrasound probe and acquires frame signals generated at different time points by receiving ultrasound waves reflected by the subject via the ultrasound probe, the ultrasound diagnostic device comprising:an ultrasound image processing circuit that includes:
a signal acquirer that acquires, via the ultrasound probe, the frame signals;
a map generator that generates, by using the acquired frame signals, a first motion map which is a motion map composed of a plurality of pixel areas which make up an entire frame area of the acquired frame signals, and which indicates a motion in each of the plurality of pixel areas in the entire frame area, the motion indicating an inter-frame signal change and calculated from corresponding pixel areas of the acquired frame signals;
a weight provider that provides a weight to each motion in the first motion map, and outputs the first motion map whose motions have been weighted, wherein the weight provider provides the weight to each motion in the first motion map by comparing, to a predetermined value, a luminance value of a pixel area corresponding to each motion in one of the acquired frame signals which is used to calculate the first motion map, and providing the weight in accordance with the luminance value of the corresponding pixel area such that the weight increases in accordance with an increase in luminance value of the corresponding pixel area in said one of the acquired frame signals, wherein when the luminance value of the corresponding pixel area is lower than the predetermined value, the weight provider provides the weight to the motion in the first motion map by using zero as a weighting coefficient, and when the luminance value of the corresponding pixel area is greater than or equal to the predetermined value, the weight provider provides the weight to the motion in the first motion map by using a number greater than zero as a weighting coefficient;
a map calculator that holds a second motion map and creates a third motion map by performing a calculation using motions in the first motion map output by the weight provider and the second motion map, wherein each of the second motion map and the third motion map is a motion map composed of a plurality of pixel areas which make up an entire frame area of the acquired frame signals, and which indicates a motion in each of the plurality of pixel areas in the entire frame area;
an emphasis adder that adds emphasis to at least one of the acquired frame signals by using the third motion map and generates an ultrasound image from said at least one of the acquired frame signals to which emphasis has been added; and
a display controller that controls a display to display the generated ultrasound image, wherein, after the third motion map is calculated using the motions in the first motion map and the second motion map, the map calculator holds the created third motion map as a new second motion map for performing a subsequent calculation to create a new third motion map.

US Pat. No. 10,188,366

X-RAY IRRADIATION CONTROLLING DEVICE

Rayence Co., Ltd., Gyeon...

1. An X-ray irradiation controlling device comprising:a pre-shot radiography condition determiner determining a radiography condition;
a reference pixel value acquirer acquiring a reference pixel value from a pre-shot radiograph obtained under the pre-shot radiography condition;
an interrelation acquirer acquiring interrelation between a radiography condition and a radiograph signal on the basis of the reference pixel value; and
a main-shot radiography condition determiner determining a main-shot radiography condition using the interrelation,
wherein the radiography condition is a radiation dose, and
wherein the main-shot radiography condition determiner determines the main-shot radiography condition such that the reference pixel value shows a desired target pixel value in a main-shot radiograph obtained under the main-shot radiography condition.

US Pat. No. 10,188,364

RADIATION IMAGING CONTROL APPARATUS, RADIATION IMAGING APPARATUS, AND STORAGE MEDIUM STORING PROGRAM

CANON KABUSHIKI KAISHA, ...

1. A radiation imaging control apparatus comprising:a managing unit configured to, in a case where a radiation imaging apparatus performs wireless communication, manage whether to operate the radiation imaging control apparatus controlling the radiation imaging apparatus as a master unit or a slave unit; and
an obtaining unit configured to, in a case where the radiation imaging control apparatus operates as the slave unit when performing the wireless communication with the radiation imaging apparatus, obtain reception information of radio wave in the radiation imaging control apparatus,
wherein at least one of the managing unit and the obtaining unit is implemented by a central processing unit, a memory and a communication circuit.

US Pat. No. 10,188,358

SYSTEM AND METHOD FOR SUBJECT SHAPE ESTIMATION

General Electric Company,...

1. A non-transitory computer readable storage medium having stored thereon a computer program comprising instructions, which, when executed by a computer, cause the computer to:acquire shape estimation information with a shape estimation system that includes a plurality of light emitting sources distributed circumferentially about a bore of a gantry and a plurality of light detectors distributed circumferentially about the bore of the gantry, wherein the light emitting sources are arranged in at least two rings disposed about the bore of the gantry, wherein the at least two rings include a first ring and a second ring disposed on opposite sides of at least one detector unit attached to the gantry, wherein each light emitting source emits light at a different time instance, wherein the gantry does not include an x-ray tube;
emit light from the at least two rings of the light emitting sources disposed about the bore of the gantry;
detect which light detectors, attached with the bore of the gantry, received each instance of emitted light at each time instance;
determine a subject shape estimation of a subject of a medical imaging system with the information, wherein the subject shape estimation is of an external outline of a subject being imaged;
develop an image acquisition scenario with the subject shape estimation and a requested imaging operation;
configure a physical location of the at least one detector unit attached to the gantry based on the developed image acquisition scenario; and
acquire Single Photon Emission Computed Tomography (SPECT) image information with the at least one detector unit, wherein the at least one detector unit used to acquire the SPECT image information is distinct from the shape estimation system.

US Pat. No. 10,188,357

SUPPORT UNIT, SUPPORT DEVICE, AND EMISSION TOMOGRAPHY DEVICE USING SUPPORT DEVICE

1. A support unit for an emission tomography device, characterized in that it comprises:a support body, provided with an accommodation space running through the support body therein, wherein the support body comprises a plurality of support positions that are distributed along a circumferential direction of the accommodation space;
a plurality of fastening means, connected to at least a portion of the plurality of support positions, for fixing detectors of the emission tomography device, wherein at least a portion of the plurality of fastening means are movable between contraction positions and extension positions along radial directions of the accommodation space,
wherein the fastening means are used for forming a first detector fastening ring with a first diameter when at the contraction positions and forming a second detector fastening ring with a second diameter which is smaller than the first diameter when at the extension positions,
wherein the plurality of support positions are configured that when a predetermined number of the support units are arranged side by side along the axial direction of the accommodation space, support positions on different support units are staggered and arranged alternately along the circumferential direction, in order for the fastening means on the predetermined number of the support units to form the first detector fastening ring alternately.

US Pat. No. 10,188,356

RADIATION SYSTEMS

VARIAN MEDICAL SYSTEMS, I...

1. A radiation system, comprising:a treatment device having a structure, and a first radiation source coupled to the structure, wherein the first radiation source is configured to rotate about an axis and to deliver a treatment radiation beam;
a rail system associated with the structure; and
a MRI device moveably coupled to the rail system;
wherein the rail system is configured to guide the MRI device from a first position to a second position, the second position being closer to the treatment device than the first position;
wherein the treatment device is at an operative position for delivering the treatment radiation beam; and
wherein when the treatment device is at the operative position, and when the MRI device is at the second position, the MRI device is next to the treatment device so that a spacing between the MRI device and treatment device is less than a thickness of the MRI device or the treatment device, and the MRI device is behind the treatment device along the axis.

US Pat. No. 10,188,355

BACKGROUND-SUPPRESSED, REDUCED FIELD-OF-VIEW RADIAL MAGNETIC RESONANCE IMAGING

Siemens Healthcare GmbH, ...

1. A computer-implemented magnetic resonance imaging (MRI) method for acquiring images of a patient, the method comprising:receiving, by an input processor, user input comprising an indication of a field of view (FOV) that encompasses only an anatomy of interest of the patient, the anatomy of interest smaller than a full dimension of the patient;
shimming, by a processor configured to communicate with the input processor, on the anatomy of interest within the FOV;
applying, by the processor, a radial quiescent-interval slice-selective (QISS) pulse sequence including a magnetization preparation pulse to the shimmed FOV to acquire images of the anatomy of interest; and
generating, at a display processor configured to communicate with the processor, data representing the acquired images of the anatomy of interest.

US Pat. No. 10,188,353

SYSTEMS AND METHODS FOR MONITORING AUTONOMIC HEALTH

Cardiac Pacemakers, Inc.,...

1. A method, comprising:delivering an autonomic neural stimulation (ANS) dose over a plurality of burst periods, including delivering a burst stimulation pulses within a portion of each burst period to evoke physiological responses and not delivering stimulation pulses within another portion of each burst period;
recording physiological parameter values, including:
recording first population data, the first population data including evoked response (ER) values corresponding to the evoked physiological responses to the burst of stimulation pulses for the plurality of burst periods; and
recording second population data, the second population data including reference values that include no effect (NE) values corresponding to times without an evoked physiological response;
calculating evoked response metrics (ERMs) using the first and second population data, each of the ERMs being dependent on background autonomic activity;
analyzing the ERMs to provide ERM analysis; and
providing an indication of autonomic health using the ERM analysis.

US Pat. No. 10,188,352

ACNE-AFFECTED SKIN DETERMINATION METHOD AND ACNE-AFFECTED SKIN DETERMINATION DEVICE

FUJIFILM Corporation, Mi...

1. An acne-affected skin determination method comprising:setting an upper region and a lower region so as to vertically divide the face of a subject into two regions,
acquiring amount of moisture of a plurality of measurement sites in the lower region;
acquiring amount of moisture of a plurality of measurement sites in the upper region;
calculating an average value of the amounts of moisture of the plurality of measurement sites in one of the upper region or the lower region as a target moisture value, setting a region including the other of the upper region and the lower region as a reference region and calculating an average value of the amounts of moisture of the plurality of measurement sites;
obtaining a difference in moisture of the target moisture value with respect to the reference moisture value; and
determining the ease of generation of acne in the face of the subject based on the difference in moisture obtained.

US Pat. No. 10,188,346

CUBITAL TUNNEL INFOMATIC MONITOR

Focal Wellness, Inc., Ca...

1. A device for monitoring Cubital tunnel syndrome (“CuTS”), the device comprising:a body configured to be worn on an arm of a user;
a plurality of sensors;
a processor positioned within the body and in communication with the plurality of sensors;
a vibration mechanism positioned within the body and in communication with the processor; and
a power source positioned within the body and in communication with the processor;
wherein the plurality of sensors monitors a position of the user's upper arm and forearm to prevent CuTS wherein a resistance of the plurality of sensors changes when the user's elbow is bent;
wherein a voltage from the plurality of sensors is monitored by the processor;
wherein the processor of the article is configured to determine if the user's upper arm and forearm are in a CuTS position and the processor is configured to activate an alert signal when a pre-determined change in the value of the voltage from the plurality of sensors is sent to the processor to alert the user to the CuTS position.

US Pat. No. 10,188,345

METHOD AND APPARATUS FOR PROVIDING BIOFEEDBACK DURING MEDITATION EXERCISE

Fitbit, Inc., San Franci...

1. A method of operating a wearable device, the wearable device comprising a processor, one or more biometric sensors and a graphical user interface, the biometric sensors including a motion sensor and an optical biometric sensor configured to detect features of a user's cardiac signal, the method comprising:determining, via the processor based on output of the motion sensor, that the user's movements are within a tolerance range for movement;
prompting the user, via the graphical user interface, to perform a meditation exercise in response to the determining that the user's movements are within the tolerance range for movement, the meditation exercise being associated with a target physiological metric related to the physiology of the user;
measuring, based on output of at least the optical biometric sensor, a physiological metric of the user during the meditation exercise, wherein the tolerance range for movement includes one or more values defined such that changes in the physiological metric are due to the meditation exercise rather than the user's movement;
determining, via the processor, a performance score indicating the user's performance during the meditation exercise based on comparing the measured physiological metric with the target physiological metric; and
providing, via the graphical user interface, based on the performance score, feedback information indicative of the user's performance during the meditation exercise the feedback information being provided to the user concurrently with the prompting of the user to perform the meditation exercise.

US Pat. No. 10,188,343

METHODS OF MONITORING EFFECTS OF NEUROSTIMULATION

Cardionomic, Inc., New B...

1. A method of monitoring effect of neurostimulation on left ventricle contractility, the method comprising:positioning a neurostimulator in a pulmonary artery;
positioning a plurality of pressure sensors in a right ventricle;
activating the neurostimulator to apply neurostimulation to a nerve proximate to a pulmonary artery, wherein the neurostimulation increases contractility of the left ventricle;
measuring contractility of the right ventricle using the plurality of pressure sensors;
determining contractility of the left ventricle based on the measured contractility of the right ventricle;
monitoring the effect of the neurostimulation on the left ventricle contractility based on the measured contractility of the right ventricle; and
using closed loop control to alter the neurostimulation.

US Pat. No. 10,188,342

METHODS, APPARATUSES AND SYSTEMS FOR TRANSCRANIAL STIMULATION

THE UNIVERSITY OF NORTH C...

1. A method of modulating cortical activity in a subject, comprising:detecting cortical oscillations and/or coherence between cortical oscillations in the subject via an electrocardiogram, a pupilometer and/or a functional near-infrared spectrometer; and
passing an oscillating electric current through the skull of the subject responsive to the cortical oscillations and/or coherence detected.

US Pat. No. 10,188,335

PLASMA OR SERUM PRODUCTION AND REMOVAL OF FLUIDS UNDER REDUCED PRESSURE

Seventh Sense Biosystems,...

21. A device for receiving blood from a subject and processing the blood to form plasma or serum, the device comprising:an inlet for introduction of a bodily fluid from the subject into the device;
a storage chamber for receiving plasma or serum;
a first membrane that is substantially impermeable to cells, wherein the first membrane separates the inlet from the storage chamber and is capable of separating blood passing through to produce a portion enriched in plasma or serum;
a vacuum chamber, separate from the storage chamber, having a pressure less than ambient pressure; and
a second membrane that is gas permeable but is substantially liquid impermeable, wherein the second membrane separates the storage chamber from the vacuum chamber.

US Pat. No. 10,188,331

NON-INVASIVE PHYSIOLOGICAL SENSOR COVER

MASIMO CORPORATION, Irvi...

1. A partially opaque sensor cover for use with a pulse oximeter sensor, the partially opaque sensor cover comprising:a partially opaque portion attachable to the sensor and configured to block optical readings by the sensor; and
a tab portion that protrudes from the sensor to facilitate removal of the partially opaque sensor cover,
wherein the sensor comprises:
a light source configured to emit light from one or more emitters of the sensor; and
a detector configured to receive at least a portion of the light emitted by the one or more emitters after the light has passed through a tissue site, and
wherein the partially opaque portion at least partially prevents the detector from receiving light during sensor activation.

US Pat. No. 10,188,330

METHODS AND SYSTEMS FOR DETERMINING A LIGHT DRIVE PARAMETER LIMIT IN A PHYSIOLOGICAL MONITOR

Covidien LP, Mansfield, ...

1. A method for driving a medical sensor for use on a subject, comprising:generating a light drive signal with a variable current below a first maximum current limit, the light drive signal being configured to produce an emitted light in a medical sensor;
receiving a sensor signal from the medical sensor, in response to the emitted light;
determining a parameter based on the received sensor signal;
changing the maximum current limit based on the parameter; and
generating the light drive signal in accordance with the changed maximum current limit.

US Pat. No. 10,188,326

FOLDOVER SENSORS AND METHODS FOR MAKING AND USING THEM

MEDTRONIC MINIMED, INC., ...

1. An analyte sensor apparatus comprising:a base substrate comprising a planar sheet of a flexible material adapted to transition from a first configuration to a second configuration when the base substrate is folded to form a fixed bend;
a working electrode, a counter electrode and a reference electrode disposed upon a first surface of the base substrate;
a plurality of contact pads disposed upon the first surface of the base substrate;
a plurality of electrical conduits disposed upon the first surface of the base substrate, wherein the plurality of electrical conduits are adapted to transmit electrical signals between the working electrode, the counter electrode or the reference electrode and the plurality of contact pads separated by the fixed bend;
an analyte sensing layer disposed over the working electrode, wherein the analyte sensing layer detectably alters the electrical current at the working electrode in the presence of an analyte; and
an analyte modulating layer disposed over the analyte sensing layer, wherein the analyte modulating layer modulates the diffusion of analyte therethrough;wherein:the base substrate comprises the fixed bend so as to form an configuration characterized in that:
at least one working electrode, counter electrode or reference electrode is disposed on a first side of the fixed bend; and
at least one working electrode, counter electrode or reference electrode is disposed on a second side of the fixed bend.

US Pat. No. 10,188,322

METHOD AND APPARATUS FOR DETERMINING THE ORIENTATION OF AN ACCELEROMETER

KONINKLIJKE PHILIPS N.V.,...

1. A method of determining the orientation of an accelerometer that is being carried or worn by a user, the method comprising:measuring acceleration using the accelerometer as the user moves;
processing the measured acceleration to determine a step frequency of the movements by the user; and
processing the measured acceleration to identify a lateral component of acceleration as a component of acceleration having a high response at a frequency corresponding to half the step frequency.

US Pat. No. 10,188,316

SYSTEMS AND METHODS FOR MODULAR INTRALUMINAL DEVICE POWER TRANSFER

Elwha LLC, Bellevue, WA ...

1. An intraluminal traveling modular system, comprising:a first intraluminal device, the first intraluminal device including
a body structure dimensioned and structured to travel through a biological lumen of a subject;
a sensor coupled to the body structure, the sensor oriented to detect at least one characteristic of the biological lumen and to generate one or more sense signals in response thereto;
a processor operably coupled to the sensor, the processor configured to receive the one or more sense signals;
a data transmitter coupled to the body structure and configured to wirelessly transmit one or more data signals associated with the one or more sense signals responsive to instruction by the processor; and
an energy storage module configured to power at least one of the sensor, the processor, or the data transmitter; and
a second intraluminal device, the second intraluminal device including
a second body structure dimensioned and structured to travel through the biological lumen of the subject;
an energy storage device coupled to the second body structure, the energy storage device configured to transfer energy stored in the energy storage device to the energy storage module of the first intraluminal device; and
a docking structure coupled to the second body structure, the docking structure configured to couple the first intraluminal device with the second intraluminal device, the energy storage device configured to transfer the energy when the first intraluminal device and the second intraluminal device are coupled via the docking structure, the docking structure further configured to automatically decouple the first intraluminal device and the second intraluminal device subsequent to transfer of the energy from the energy storage device of the second intraluminal device to the energy storage module of the first intraluminal device,
wherein the first intraluminal device further includes
a wall-engaging structure capable of engaging a wall of the biological lumen to secure the first intraluminal device with respect to the wall of the biological lumen; and
a second sensor configured to measure a proximity between the first intraluminal device and the second intraluminal device, and
wherein the processor is configured to direct the wall-engaging structure to secure the first intraluminal device with respect to the wall of the biological lumen until the measured proximity between the first intraluminal device and the second intraluminal device is within a threshold proximity.

US Pat. No. 10,188,314

SYSTEM AND METHOD FOR DETECTING SHEATHING AND UNSHEATHING OF LOCALIZATION ELEMENTS

St. Jude Medical, Cardiol...

1. A method of detecting a localization element/sheath state change with a localization system, comprising:establishing a localization field using a plurality of localization field generators;
obtaining a first localization signal from a first catheter-borne localization element positioned within the localization field via an introducer sheath, the first localization signal including a first in-phase component and a first quadrature component;
obtaining a second localization signal from a second catheter-borne localization element positioned within the localization field via the introducer sheath, the second localization signal including a second in-phase component and a second quadrature component;
comparing the second quadrature component to the first quadrature component; and
detecting a localization element/sheath state change for the second catheter-borne localization element based on the comparison between the second quadrature component and the first quadrature component.

US Pat. No. 10,188,310

PROBE FOR DETERMINING MAGNETIC MARKER LOCATIONS

Health Beacons, Inc., Co...

1. A method for determining a distance and direction between a probe and a magnetic marker, the method comprising:providing the probe, wherein the probe comprises
a first sensor including a first magnetometer having a first range within which a magnetic marker can be detected and a first accelerometer, and
a second sensor including a second magnetometer having a second range within which the magnetic marker can be detected and a second accelerometer,
wherein the first sensor is separated from the second sensor by a distance that is greater than the first range and the second range such that the magnetic marker can only be detected by one of the first magnetometer and the second magnetometer at a time;
wherein the probe is configured to determine a position, in three-dimensional space, of the magnetic marker;
balancing the probe while the probe is positioned away from the magnetic marker such that the magnetic marker is not within the first range of the first magnetometer or the second range of the second magnetometer;
moving the balanced probe so that the magnetic marker is within the first range of the first magnetometer and not within the second range of the second magnetometer; and
determining the distance and direction between the probe and the magnetic marker by comparing an output of the first sensor with an output of the second sensor.

US Pat. No. 10,188,309

SYSTEMS, ARTICLES, AND METHODS FOR ELECTROMYOGRAPHY SENSORS

NORTH INC., Kitchener (C...

1. A differential electromyography (“EMG”) sensor comprising:a first sensor electrode formed of an electrically conductive material;
an amplifier;
a first electrically conductive pathway that communicatively couples the first sensor electrode and the amplifier;
a first capacitor electrically coupled in series between the first sensor electrode and the amplifier in the first electrically conductive pathway;
a first resistor electrically coupled in series between the first sensor electrode and the amplifier in the first electrically conductive pathway;
a ground electrode formed of an electrically conductive material;
a second electrically conductive pathway that communicatively couples to the ground electrode;
a third electrically conductive pathway that communicatively couples the first electrically conductive pathway and the second electrically conductive pathway;
a second capacitor electrically coupled in the third electrically conductive pathway in between the first electrically conductive pathway and the second electrically conductive pathway;
a fourth electrically conductive pathway that communicatively couples the first electrically conductive pathway and the second electrically conductive pathway;
a second resistor electrically coupled in the fourth electrically conductive pathway in between the first electrically conductive pathway and the second electrically conductive pathway;
a second sensor electrode formed of an electrically conductive material;
a fifth electrically conductive pathway that communicatively couples the second sensor electrode and the amplifier;
a third capacitor electrically coupled in series between the second sensor electrode and the amplifier in the fifth electrically conductive pathway;
a third resistor electrically coupled in series between the second sensor electrode and the amplifier in the fifth electrically conductive pathway;
a sixth electrically conductive pathway that communicatively couples the fifth electrically conductive pathway and the second electrically conductive pathway;
a fourth capacitor electrically coupled in the sixth electrically conductive pathway in between the fifth electrically conductive pathway and the second electrically conductive pathway;
a seventh electrically conductive pathway that communicatively couples the fifth electrically conductive pathway and the second electrically conductive pathway; and
a fourth resistor electrically coupled in the seventh electrically conductive pathway in between the fifth electrically conductive pathway and the second electrically conductive pathway.

US Pat. No. 10,188,307

SHIELDED MULTI-CHANNEL EEG HEADSET SYSTEMS AND METHODS

Bio-Signal Group Corp., ...

1. An EEG sensor headset comprising:a plurality of electrodes;
an elongated central strip defining one or more electrode-ports and including at least some of the plurality of electrodes and a first connector, the elongated central strip being sized to cover at least a portion of a center line from a nasal bridge to a spinal column of a patient, and being at least partially coated with a first adhesive on a patient side;
an anterior member including a first left wing and a first right wing, each of the first left wing and the first right wing extending from the central strip, the first left wing and the first right wing each having at least two of the plurality of electrodes, at least a portion of the anterior member being coated with the first adhesive on the patient side; a left-end portion of the first left wing and a right-end portion of the first right wing being coated with a second adhesive on the patient side;
a second anterior member including a second left wing and a second right wing each having an electrode of the plurality of the electrodes, each of the second left wing and the second right wing extending from the central strip; at least a portion of the second anterior member being coated with the first adhesive on the patient side, a left-end portion of the second left wing and a right-end portion of the second right wing being coated with the second adhesive on the patient side;
a right side member extending from the central strip and including an electrode of the plurality of electrodes, at least a portion of the right side member being coated with the first adhesive on the patient side;
a right contact member coupled to the right side member by a first lateral flex joint, the right contact member being coated with the second adhesive on the patient side;
a left side member extending from the central strip and including an electrode of the plurality of electrodes; a portion of the left side member being coated with the first adhesive on the patient side;
a left contact member coupled to the left side portion by a second lateral flex joint, the left contact member being coated with the second adhesive on the patient side;
a posterior member coated with the first adhesive on the patient side, the posterior member including:
a third left wing extending from the central strip and having at least three of the plurality of electrodes on the patient side, and an upper and a lower external adhesion location coated with the second adhesive on an outer side opposite the patient side, and
a third right wing extending from the central strip and having at least three of the plurality of electrodes on the patient side, and an upper and a lower external adhesion location coated with the second adhesive on the outer side;
the first connector disposed between the anterior member and the posterior member, the first connector electrically coupled to at least some of the plurality of electrodes by respective traces, the first connector including a terminal corresponding to respective electrodes; and
a shield plane including at least a portion coupled to the central strip, the shield plane coupled to a flexible outer substrate opposite the patient side, the flexible outer substrate providing a dielectric material disposed between the shield plane and the plurality of electrodes.

US Pat. No. 10,188,304

INTEGRATED OPTICAL NEURAL PROBE

Diagnostic Biochips, Inc....

1. A neural probe comprising a headstage connected to one or more elongated shanks, whereinthe headstage comprises a high-intensity LED;
each elongated shank is formed from MEMS silicon and comprises at least one optical fiber, at least one groove, and at least one SUB waveguide, wherein each optical fiber is aligned in one groove to one waveguide; and
the LED is connected to each optical fiber via a coupler, wherein the coupler comprises ceramic, stainless steel, and brass, and wherein the coupler is fixed onto the LED with a UV-curable adhesive.

US Pat. No. 10,188,302

METHODS FOR DYNAMIC VISUALIZATION OF CLINICAL PARAMETERS OVER TIME

The University of Vermont...

8. A non-transitory computer readable medium containing program instructions executable by a processor, the computer readable medium comprising:program instructions for generating a thrombin generation profile of a subject from measurements of the concentrations of factors II, V, VII/VIIa, VIII, IX, and X, tissue factor pathway inhibitor (TFPI), protein C (PC), and antithrombin (AT) in a biological sample from the subject;
program instructions for obtaining the parameters: maximum level of thrombin generation, maximum rate of thrombin generation, total thrombin generated, and clot time, the parameters are derived from the measurements of factors II, V, VII/VIIa, VIII, IX, and X, TFPI, PC, and AT; and
program instructions for determining the propensity of the patient for blood clotting and bleeding, the determination is based on the parameters; and
program instructions for displaying the thrombin generation profile in a visual form;
wherein a thrombin generation profile comprising a greater than 3-fold decrease in clot time and greater than 3-fold increase in maximum level of thrombin generation, maximum rate of thrombin generation, and total thrombin generated, relative to a respective reference for each of said parameters comprising the thrombin generation profile, indicates a propensity of the subject for blood clotting; and
wherein a thrombin generation profile comprising a greater than 3-fold increase in clot time and a greater than 3-fold decrease in maximum level of thrombin generation, maximum rate of thrombin generation, and total thrombin generated, relative to the respective reference for each of said parameters comprising the thrombin generation profile, indicates a propensity of the subject for bleeding.

US Pat. No. 10,188,301

MEDICAL PROBE AND METHOD OF USING SAME

St. Jude Medical, Cardiol...

1. A system for monitoring luminal esophageal temperatures in a patient, comprising:a probe adapted to be inserted into an esophagus of the patient, the probe extending between a proximal end and a distal end;
a plurality of electrodes and a plurality of temperature sensors extending along a length of the probe to enable continuous monitoring of temperatures in an area of the esophagus subject to formation of atrial-esophageal fistulas during a cardiac ablation;
a controller having software executing thereon;
a temperature sensor interface coupled to the probe remote from the distal end of the probe, the temperature sensor interface being in communication with the plurality of temperature sensors;
an electrode interface coupled to the probe remote from the distal end of the probe, the electrode interface being in communication with the plurality of electrodes;
wherein the electrode interface is connected to the controller and the controller is adapted to receive signals from the electrode interface;
wherein the temperature sensor interface is connected to the controller and the controller is adapted to receive signals from the temperature sensor interface;
a video monitor in communication with the controller;
wherein the controller is configured to display on the monitor an anatomic map of the esophagus based at least in part on the signals received from the electrode interface;
wherein the controller is configured to display on the monitor a thermal map of the esophagus based at least in part on the signals received from the temperature sensor interface; and
wherein the thermal map is overlaid on the anatomic map.

US Pat. No. 10,188,299

SYSTEM CONFIGURED FOR MEASURING PHYSIOLOGICAL PARAMETERS

Omni Medsci, Inc., Ann A...

1. A system comprising:a light source comprising a plurality of light emitting diodes, each of the light emitting diodes configured to generate an output optical beam having one or more optical wavelengths, wherein at least a portion of the one or more optical wavelengths is a near-infrared wavelength between 700 nanometers and 2500 nanometers;
a lens positioned to receive at least a portion of at least one of the output optical beams and to deliver a lens output beam to tissue;
a detection system located to receive at least a portion of the lens output beam reflected from the tissue and configured to generate an output signal based on the received portion of the lens output beam reflected from the tissue, the output signal having a signal-to-noise ratio, wherein the detection system is further configured to be synchronized to the light source;
a personal device comprising a wireless receiver, a wireless transmitter, a display, a microphone, a speaker, one or more buttons or knobs, a microprocessor, and a touch screen, the personal device configured to receive and process at least a portion of the output signal, wherein the personal device is configured to store and display the processed output signal, and wherein at least a portion of the processed output signal is configured to be transmitted over a wireless transmission link; and
a remote device configured to receive over the wireless transmission link an output status comprising the at least a portion of the processed output signal, to process the received output status to generate processed data, and to store the processed data;
wherein the output signal is indicative of one or more physiological parameters, and the remote device is configured to store a history of at least a portion of the one or more physiological parameters over a specified period of time;
the light source configured to improve the signal-to-noise ratio of the output signal by increasing light intensity relative to an initial light intensity from at least one of the plurality of light emitting diodes and by increasing pulse rate relative to an initial pulse rate of at least one of the plurality of light emitting diodes;
wherein the detection system includes a plurality of spatially separated detectors, wherein at least one analog to digital converter is coupled to at least one of the spatially separated detectors and is configured to generate at least two data signals, and the system is configured to further improve the signal-to-noise ratio by differencing two of the at least two data signals; and
wherein the detection system further comprises one or more spectral filters positioned in front of at least some of the plurality of spatially separated detectors.

US Pat. No. 10,188,293

METHOD AND APPARATUS FOR FIXATION MEASUREMENT AND REFRACTION ERROR MEASUREMENT USING WAVE-FRONT ERROR

REBIScan, Inc., Cambridg...

1. An apparatus for fixation measurement for diagnosing strabismus, the apparatus comprising:an image projector configured to project a stimulus onto both eyes of a patient, wherein the stimulus is simultaneously projected onto the retinas of both eyes of the patient and simultaneously reflected onto a pair of image sensing devices
the pair of image sensing devices being disposed conjugate to the retinas, wherein the image sensing devices are configured to capture reflected images including light reflected from the retinas in response to the stimulus, wherein the reflected images include a reflected stimulus comprising one or more of: the stimulus as perceived on the retinas or the stimulus as transformed by a curvature of the retinas, and wherein differences between the stimulus and the reflected stimulus indicate fixation of the eyes; and
one or more computing devices configured to determine a misalignment in the fixation of the eyes corresponding to strabismus.

US Pat. No. 10,188,291

DEVICE FOR SCREENING CONVERGENCE INSUFFICIENCY AND RELATED METHODS

1. A device for screening a person for convergence insufficiency (CI), the device comprising:a binocular viewer comprising a first eyepiece to receive a first eye of the person, a second eyepiece to receive a second eye of the person, a first image sensor adjacent said first eyepiece, and a second image sensor adjacent said second eyepiece;
a display adjacent said binocular viewer; and
a processor and associated memory cooperating with said display and configured to
record, with said first image sensor, movement of the first eye,
record, with said second image sensor, movement of the second eye,
display on said display a first visual stimulus and a second visual stimulus,
cause, in alternating fashion, convergent movement and divergent movement in the first visual stimulus and the second visual stimulus along a visual stimulus path,
record with the first image sensor, dynamic movement of the first eye along the visual stimulus path,
record with the second image sensor, dynamic movement of the second eye along the visual stimulus path,
determine respective centroid positions of the second eye and the first eye during the convergent and divergent movement of the first visual stimulus and the second visual stimulus based on the recorded dynamic movements of the first eye and the second eye, and
calculate from the respective centroid positions a plurality of interpupillary distances (IPDs) over time, and from the plurality of the IPDs, generate dynamic IPDs over time, and
compare the dynamic IPDs with the visual stimulus path to serve as an indicator for whether the person has CI.

US Pat. No. 10,188,286

TOMOGRAPHIC IMAGE CAPTURING DEVICE

KOWA COMPANY, LTD., (JP)...

1. A tomographic image capturing device comprising:a tomographic image capturing means that scans measurement light on a subject's eye fundus to capture tomographic images of the subject's eye fundus; and
an image processing means that compresses a picture of the captured tomographic images in a scan direction to generate a new tomographic picture.

US Pat. No. 10,188,285

IMAGING APPARATUS

Canon Kabushiki Kaisha, ...

1. An imaging apparatus comprising:a light-source unit configured to emit light while sweeping a frequency of the light;
an interference unit configured to separate the light emitted from the light-source unit into illuminating light to be applied to a fundus and reference light, and to generate interfering light formed of reflected light, which is light applied to the fundus and reflected by the fundus, and the reference light;
a scanning unit configured to scan the fundus with the illuminating light;
a detecting unit configured to detect the interfering light; and
an information-acquiring unit configured to acquire information on the fundus from the interfering light,
wherein the scanning unit is configured such that an angle of linear scanning of the fundus with the illuminating light is 68 degrees or greater in the air,
wherein the light-source unit in hides a surface-emitting laser, the surface-emitting laser including a first reflector, a second reflector, and an active layer provided between the first reflector and the second reflector,
wherein, when at least one of the first reflector and the second reflector is driven, a distance between the first reflector and the second reflector changes and the frequency of the light emitted changes,
wherein a coherence length of the surface-emitting laser during the sweeping of the frequency of the light is 23 mm or longer, and
wherein a range of a depth of a tomographic image of the fundus to be obtained using the information on the fundus is 3.2 mm or more.

US Pat. No. 10,188,276

CLEANING AUXILIARY TOOL

OLYMPUS CORPORATION, Tok...

1. A cleaning auxiliary tool to be inserted into a bottomed cylinder having a bottomed cylindrical shape with one end opened and other end closed, the bottomed cylinder having a first opening through which a fluid from a first conduit is introduced, the first conduit being inserted through an endoscope, a second opening through which the fluid is led out into the first conduit, a third opening through which the fluid from a second conduit is introduced, the second conduit running in parallel with the first conduit in the endoscope, and a fourth opening through which the fluid is led out into the second conduit, the cleaning auxiliary tool comprising:a lid portion that closes an opening of the bottomed cylinder;
a shaft portion having a first end portion connected to the lid portion and a second end portion extending into the bottomed cylinder;
a first plate member fixed to the shaft portion, the first plate member having a first outer diameter smaller than an inner diameter of the bottomed cylinder;
a second plate member fixed to the shaft portion and arranged closer to the first conduit than the first plate member, the second plate member having a second outer diameter smaller than the inner diameter of the bottomed cylinder; and
a partition portion provided between the first plate member and the second plate member and positioned between the first opening and the third opening and between the second opening and the fourth opening, that partitions a side of the first conduit and a side of the second conduit in a state of being in close contact with an inner wall of the bottomed cylinder, moves toward the second end portion of the shaft portion by receiving an internal pressure on the side of the first conduit when the internal pressure on the side of the first conduit becomes higher than an internal pressure on the side of the second conduit, and moves toward the first end portion of the shaft portion by receiving the internal pressure on the side of the second conduit when the internal pressure on the side of the second conduit becomes higher than the internal pressure on the side of the first conduit, the partition portion,
when moving toward the second end portion and when moving toward the first end portion, contacts the inner wall with an outer circumferential portion of the partition portion, and axially moves along the shaft portion a distance sufficient to allow the fluid to contact the entire inner wall disposed between the first plate member and the second plate member.

US Pat. No. 10,188,275

SMALL DIAMETER VIDEO CAMERA HEADS AND VISUALIZATION PROBES AND MEDICAL DEVICES CONTAINING THEM

MEDIGUS LTD., Omer (IL)

1. A video camera head comprising an objective lens assembly and a CMOS sensor;wherein the CMOS sensor comprises an array of photosensitive elements and electronics adapted to deal with the output signals of the photosensitive elements the electronics implemented together with the array of photosensitive elements on a silicon substrate and in that the silicon substrate comprises no more than two, three, or four electrical connecting pads configured to allow video signals to be sent from the electronics and power to be supplied to the electronics.

US Pat. No. 10,188,264

DISHWASHER COMPRISING A SORPTION DRYING DEVICE

1. A dishwasher, comprising:a washing container;
an air-guiding channel to generate an air flow;
a sorption drying system to dry items to be washed, wherein the sorption drying system has a sorption container with reversibly dehydratable sorption material, the sorption container connected to the washing container by the air-guiding channel; and
a heater disposed in the sorption container and arranged upstream of the reversibly dehydratable sorption material for desorption of the reversibly dehydratable sorption material;
wherein the air-guiding channel includes an inlet connecting piece connected to the sorption container and which diverts incoming air flow from an inflow direction by between 45° to 135° into a through-flow direction through the heater and the reversibly dehydratable sorption material,
wherein the through-flow direction through the heater and through the reversibly dehydratable sorption material is the same direction, such that the through-flow direction runs from a bottom portion to a top portion of the sorption container, and
wherein the sorption container includes a through-flow cross-sectional area for the reversibly dehydratable sorption material of substantially between 80 cm2 and 800 cm2.

US Pat. No. 10,188,244

DISPENSER AND METHOD OF REPLENISHING A DISPENSER

1. A dispenser for dispensing a sheet of web material from a stack of folded web material, the dispenser comprising:a web material storage section arranged to hold and support the stack of folded web material, in a generally vertical direction during dispensing of the web material;
the web material storage section comprising
an upper end portion from which the web material is arranged to be lead for dispensing thereof,
a lower end portion, opposite to the upper end portion and being arranged to support the stack of folded web material in said generally vertical direction, at least when the dispenser is in said dispensing position,
said upper end portion and lower end portion being arranged in a fixed spatial relationship;
wherein:
the lower end portion of the web material storage section comprises
a loading opening and
a supporting arrangement, arranged to be movable between
a support position wherein the supporting arrangement extends at least partially over said loading opening enabling said support of the stack of folded web material, and
an insert position, wherein the supporting arrangement is at least partially removed from the loading opening;
wherein said supporting arrangement is arranged to be movable from said support position to said insert position by pushing a stack to be introduced in the loading opening towards the supporting arrangement in a direction towards the upper end portion of the web material storage section.

US Pat. No. 10,188,242

PARTITIONABLE PAPER PRODUCT

GPCP IP Holdings LLC, At...

1. A partitionable folded napkin product comprising:a base sheet having a basis weight of at least about 31 g/sq. meter;
wherein the napkin product comprises at least one fold in the machine direction; and
wherein the napkin product comprises at least one perforation line in the machine direction, MD;
wherein a ratio of a CD tensile strength of the paper to the tensile strength of a MD perforation line is from about 30% to about 70%; and
wherein at least one perforation line in the machine direction and the at least one fold in the machine direction are coextensive.

US Pat. No. 10,188,237

MULTISIZE CAPSULE HANDLING WITH SERIAL ACTUATION

Nestec S.A., Vevey (CH)

1. A machine comprising a frame and a capsule handling device configured to handle an capsule and mounted in and/or on the frame, the capsule handling device comprising:a first part;
a second part that is movable relative to the frame from a transfer position for inserting and/or removing the capsule to an extraction position for extracting the capsule and vice versa, the second part comprising:
a capsule receptacle defining a cavity for receiving the capsule and for forming in the extraction position an extraction chamber with the first part, and
a first portion and a second portion that are relatively movable between a first relative position and a second relative position to change at least one dimension of the cavity and of the extraction chamber;
an actuator connected to the second part for driving the second part between the transfer position and the extraction position, the actuator is connected to the first portion and/or the second portion of the second part to relatively move the first portion and the second portion between a first relative position and a second relative position; and
a mechanical transmission connecting the actuator to the second part and to the first portion and the second portion of the second part for driving:
the second part between the transfer position and the extraction position; and
the first portion and/or the second portion of the second part to relatively move the first portion and the second portion between the first relative position and the second relative position.

US Pat. No. 10,188,231

FLEXIBLE MEMBRANE DRINKING CUP LID

1. A lid device for a beverage cup, said device comprising:an annular structure comprising an inner flexible material surrounded by an outer ring of substantially rigid material, said outer ring configured to reversibly attach to a rim of a beverage cup;
said inner flexible material having a central structure, said central structure comprising an opening with an axis that, in the absence of applied force, is substantially perpendicular to a top surface of said central structure;
said central structure configured to allow a drinking straw to pass through said central structure and into an interior of said beverage cup, said drinking straw comprising a radius;
said opening further comprising an opening radius between 1 and 2 times said radius of said drinking straw;
said inner flexible material and said central structure further configured to allow a human user of said straw, using a hand force of 5 Newtons or less on said drinking straw, to displace any of:
a: an orientation of said axis by at least +/?20 degrees from a no force resting state;
b: a location of said opening by at least 2× said radius of said drinking straw from a no force resting state;wherein said inner flexible materials, said outer ring of substantially rigid material, and said central structure are securely attached to each other so as to prevent rotation of any of said inner flexible material, substantially rigid material, or central structure relative to each other.

US Pat. No. 10,188,208

DRIVE MECHANISM FOR A MOVABLE FURNITURE PART

Julius Blum GmbH, Hoechs...

1. A drive device for moving a movable furniture part, the drive device comprising:an entrainment member configured to be mounted to one of a furniture carcass and the movable furniture part;
a force-actuated drive element configured to be mounted to the other one of the furniture carcass and the movable furniture part so as to be movable in a drive movement direction, the drive element having a drive limit stop by which the entrainment member is moved during a drive movement in the drive movement direction, and the drive element including a passing ramp on a side facing away from the drive limit stop, the passing ramp being configured to allow the entrainment member to pass over the drive element in the drive movement direction; and
a catch lever for catching the entrainment member, the catch lever facing towards the drive limit stop such that the entrainment member is configured to be positioned between the drive limit stop and the catch lever during the drive movement in the drive movement direction, and the catch lever being pivotably supported on a base part of the drive element such that a distance between the catch lever and the drive limit stop changes as the catch lever is pivoted.

US Pat. No. 10,188,168

SHOCK-ABSORBENT JUNCTION APPARATUS AND FACEMASK SYSTEM

1. A shock absorbing junction comprising:a first plate;
a second plate;
a resilient material comprising at least three springs having a triangular configuration;
a clip comprising an opening for receiving a portion of a facemask;
a button shaped to mate with a slot in a helmet;
wherein said resilient material is located between said first plate and said second plate;
wherein said first plate comprises a first top face and a first bottom face;
wherein said second plate comprises a second top face and a second bottom face;
wherein each of the at least three springs comprises a first end and a second end;
wherein each first end is connected to said first bottom face and each second end is connected to said second top face;
wherein the clip is coupled to the first top face; and
wherein the button is coupled to the second bottom face.

US Pat. No. 10,188,156

ASYMMETRIC ATHLETIC APPAREL AND METHODS OF USE THEREFOR

NEW BALANCE ATHLETICS, IN...

1. An asymmetric garment for at least a portion of an upper body of a wearer, the garment comprising:a torso section extending around a torso portion of the upper body of the wearer;
a first sleeve connected to the torso section at a first seam and comprising a first arm region at least partially covering a first arm of the wearer; and
a second sleeve connected to the torso section at a second seam and comprising (i) a second arm region at least partially covering a second arm of the wearer and (ii) a second shoulder region covering at least a portion of a second shoulder of the wearer, the second shoulder region comprising a front section and a back section that each extend only partially over a torso of the wearer proximate the second arm region, wherein the second seam is arranged asymmetrically with respect to the first seam so as to provide reduced resistance to asymmetrical shoulder and arm motion at the second shoulder region, and wherein the garment further comprises:
a single expanse of material comprising first and second material portions joined at the second seam, a combination of which further results in the asymmetrical garment providing, at a body portion subject to resistance, reduced resistance to asymmetrical shoulder and arm motion,
the first material portion comprising a first material, the first material portion comprising at least a portion of the torso section extending from the second seam to the first seam; and
the second material portion comprising a second material differing in at least one material property from the first material and adapted to provide reduced resistance to asymmetrical shoulder and arm motion at the second shoulder region, the second material portion comprising a single unitary expanse of material, extending from the second seam and comprising the shoulder region and at least a portion of the second arm region of the second sleeve and, at the second arm region, extending completely around the second arm of the wearer.

US Pat. No. 10,188,145

PERSONAL VAPORIZER HAVING REVERSING AIR FLOW

1. A personal vaporizer having a distal end and a proximal end, a distal direction defined moving axially from the proximal end toward the distal end, a proximal direction being opposite the distal direction, comprising:an atomizer module comprising an atomizer cup having a distal wall and a side wall extending in the proximal direction from the distal wall to a proximal edge, a heating element being arranged in or adjacent the atomizer cup, the cup being configured to accept a vaporizing medium so that the vaporizing medium is atomized when the heating element is energized;
a vaporizing chamber defined in part by the distal and side walls of the atomizer cup, the vaporizing medium being contained within the vaporizing chamber;
a flow body selectively attachable to a proximal side of the atomizer module, the flow body comprising an inlet passage through a side of the flow body, the inlet passage communicating with a delivery passage that extends in the distal direction from the inlet passage to a delivery opening, the delivery passage and delivery opening being defined by the flow body, the delivery opening being distal of the inlet passage and proximal of the vaporizing chamber, and being configured to direct intake air into the vaporizing chamber;
an exit passage communicating with the vaporizing chamber and defined by the flow body adjacent the delivery passage, and an exit opening communicating with the exit passage and being proximal of the vaporizing chamber; and
a mouthpiece having a mouthpiece outlet that is in communication with the exit passage, the mouthpiece being proximal of the flow body;
wherein a vaporizing chamber flow path is defined within the vaporizing chamber between the delivery opening and the exit passage, and atomized vaporizing medium becomes entrained in the air flowing along the vaporizing chamber flow path so as to form a vapor; and
wherein the vaporizer is configured so that as air is drawn out of the mouthpiece outlet, air is drawn in through the inlet passage and flows along the vaporizing chamber flow path.

US Pat. No. 10,188,144

AEROSOL-FORMING MEMBER COMPRISING A SHEET OF MATERIAL HAVING A NON-PLANAR INNER MAJOR SURFACE

Batmark Limited, London ...

1. An aerosol-forming member comprising:a sheet of material configured to wick and to heat a solution, the sheet of material comprising a non-planar inner major surface having a capillary structure configured to emit vapor during use, and an outer major surface that is configured to emit less vapor than the inner major surface during use, wherein the inner major surface of the aerosol-forming member forms a channel.

US Pat. No. 10,188,119

METHOD FOR TREATING A SUBSTANCE WITH WAVE ENERGY FROM PLASMA AND AN ELECTRICAL ARC

Foret Plasma Labs, LLC, ...

1. A method for processing a material comprising the steps of:providing a vessel having (a) an interior defined by a cylindrical portion disposed between a first end and a second end, (b) an outlet in the first end that is aligned with a longitudinal axis of the cylindrical portion, (c) at least one inlet in the first end to receive the material, (d) a first wave energy source comprising a first electrode disposed at least partially within the outlet and aligned with the longitudinal axis, and a second electrode disposed at least partially within the second end, aligned with the longitudinal axis and spaced apart from the first electrode, (e) a second wave energy source comprising a set of radio frequency coils or windings disposed around or within the cylindrical portion, and (f) two or more jets mounted tangentially in the cylindrical portion;
generating a plasma within the interior using the first and second plasma sources;
directing a fluid or a gas into the interior via the two or more jets to create angular momentum in the plasma to form a plasma vortex that circulates around a central void substantially aligned with the longitudinal axis; and
processing the material by directing the material into the plasma vortex via the inlet such that the plasma vortex reacts with the material and the material is irradiated with one or more wave energies produced by the first and second wave energy sources.

US Pat. No. 10,188,118

CUTTER FOR MANUFACTURING THREE-DIMENSIONAL NOODLES

1. A three-dimensional noodle cutter comprising:rotation shafts (10, 11) arranged in parallel with each other and driven by a motor;
first roller (20) and second roller (21) provided on an outer peripheral surface of the rotation shafts (10, 11) in a form of a cylinder and driven to rotate in close contact with each other; and
a molding groove (30) depressed inwardly along an outer peripheral surface of the first roller (20) and the second roller (21),
wherein edges of dough introduced in the molding groove (30) are cut by friction between the first roller (20) and the second roller (21), thereby producing noodles, wherein the molding groove (30) is formed in a space between a first curved part (31) and a second curved part (32) alternatively arranged in a longitudinal direction of the rotation shafts (10, 11), a small space part (33) and a large part (34) formed in the first roller, and the first curved part (31) and the second curved part (32) formed in the second roller (21) are arranged to be engaged with each other and rotate so that the first curved part (31) and the second curved part (32) of the first curved part (31) are aligned with the first curved part (31) and the second curved part (32) of the second curved part (31), respectively, whereby dough introduced in the molding grove (30) is produced into noodles (50) having an embossed three-dimensional shapes,
wherein both ends of first and second rollers (20, 21) are attached with the first and second control saw teeth (40, 41), which precisely control a contact of the first and second curved part (31, 32) formed by the first and second rollers (20, 21), and on an inside of each of the first and second control saw teeth (40, 41) is an alignment pin (43) which fastens a coupling of the rollers and saw teeth; outsides of the first and second control saw teeth (40, 41) are marked with first and second contact points (42a, 42b) to easily identify when the first and second rollers (20, 21) break away from one another and are loosened and make necessary adjustments to the first and second control saw teeth (40, 41).

US Pat. No. 10,188,030

CUTTING MECHANISM FOR WHOLE PLANT HARVESTING

1. A cutting mechanism for the harvesting of whole plants, comprising:a frame, extending transverse to a forward direction;
a plurality of rotatable mowing elements positioned on a front side of the cutting mechanism and distributed over a width of the cutting mechanism, each of the plurality of rotatable mowing elements configured to rotate about a rotational axis and comprising a lower cutting disk configured to cut off crops from the ground and a conveyor rotor located above the lower cutting disk, the conveyor rotor configured to rotate around the rotational axis, coaxial to the cutting disk;
first and second transverse conveyors, located on sides of the cutting mechanism, configured to convey the crops cut off by the mowing elements to a middle of the cutting mechanism; and
a delivery conveyor located in the middle of the cutting mechanism configured to receive crops from the first and second transverse conveyors and convey the crops to a rear delivery opening of the cutting mechanism;
wherein the lower cutting disks of the mowing elements work together with one or more frame-affixed counter-blades and are driven together with the corresponding conveyor rotors by a shaft;
wherein the shafts of the mowing elements are driven by a gear arrangement that extends, on the front side, over the width of the cutting mechanism;
wherein the frame comprises a middle part and first and second lateral parts configured to swivel on the middle part between a horizontal operating position and a raised transporting position; and
wherein the first and second transverse conveyors are wider than the corresponding first and second lateral parts in the horizontal operating position and are within the width of the first and second lateral parts before being raised to the transporting position.
US Pat. No. 10,189,924

HIGH DENSITY ROTOMOLDING RESIN

NOVA Chemicals (Internati...

1. A polyethylene resin comprising from 0.7 to 1.2 weight % of 1-octene and the balance ethylene, having a density from 0.948 to 0.953 g/cc, a melt index determined according to ASTM1238 under a load of 2.16 kg at a temperature of 190° C. (I2) from 1.0 to 1.5 g/10 minutes; a melt index determined according to ASTM1238 under a load of 21.6 kg at a temperature of 190° C. (I21) from 32 to 55 g/10 minutes; a weight average molecular weight (Mw) determined by gel permeation chromatography from 95,000 to 120,000; a number average molecular weight determined by gel permeation chromatography (GPC) from 20,000 to 40,000; a z average molecular weight (Mz) from 240,000 to 360,000; an Mw/Mn from 2.7 to 4.3; an Mz/Mw from 2.5 to 3.5; and having a CBDI (50) from 80 to 95, the molecular weight distribution determined by GPC of said polymer being deconvoluted into at least two components comprising:from 20 to 40 weight % of a first component having a calculated weight average molecular weight (Mw) being from 200,000 to 250,000; a calculated number average molecular weight from 90,000 to 140,000; a z average molecular weight 390,000 to 520,000 and an estimated density from 0.921 to 0.930 g/cc;
from 60 to 80 weight % of a second component having a calculated weight average molecular weight (Mw) being from 20,000 to 57,000; a calculated number average molecular weight (Mn) from 10,000 to 27,000; a z average molecular weight from 30,000 to 72,000 and an estimated density from 0.948 to 0.953 g/cc, provided that the difference in calculated density between component two and component one is less than 0.030 g/cc.
US Pat. No. 10,190,183

METHOD FOR DESULFURIZING

Almamet GmbH, Ainring (D...

1. A method for desulfurizing comprising the step ofadding a desulfurization agent to a melt of at least one of a molten pig iron and a molten steel, said agent containing calcium oxide, bitumen as well as between 0.01 and 10% by weight of at least one flux agent, wherein the at least one flux agent is selected from the group of members consisting of multivalent alcohols, bituminous coal, silicone oils and mixtures thereof, and wherein the agent does not contain any calcium carbide, any magnesium or any magnesium alloy.
US Pat. No. 10,188,672

COMPOSITIONS AND METHODS FOR TISSUE REGENERATION

Orbis Health Solutions LL...

1. A composition consisting essentially of tetraethyl orthosilicate and at least one oil selected from the group consisting of jojoba oil, almond oil, cocoa butter, bees wax, and sweet almond oil,wherein the tetraethyl orthosilicate is present in a concentration from 25% to 40% by total weight of the composition, and wherein the composition is presented as a cream or an ointment.
US Pat. No. 10,188,676

ANTI-INFLAMMATORY SOLUTION

Hypo-Stream Limited, Mel...

1. A method for treating an inflammatory response in burns in a mammal comprising administering an effective amount of a dilute stabilized hypochlorite solution to said mammal in need thereof, wherein the dilute hypochlorite solution consists of:(i) water; sodium hypochlorite in a concentration range of 0.05-0.1 wt %; and sodium chloride in a concentration range of 0.5-1.5 wt %; or,
(ii) water; sodium hypochlorite in a concentration range of 0.05-0.1 wt %; sodium chloride in a concentration range of 0.5-1.5 wt %; and an indicator.
US Pat. No. 10,189,959

HYDROPHOBIC ADDITIVE FOR USE WITH FABRIC, FIBER, AND FILM

TECHMER PM, LLC, Rancho ...

1. A master batch for use in preparing a non-woven fabric in order to increase the hydrophobicity of the non-woven fabric, the master batch comprising:a carrier polymer selected from the group consisting of polyolefin, polyester, polylactic acid, poly-3-hydroxybutyrate, polyamide, and copolymers thereof; and
a triglyceride ester comprising 10-40 wt. % of the master batch, wherein when a fabric is prepared with the master batch, the fabric has a contact angle ranging from 100° to 125° when measured according to test method ASTM D2578.
US Pat. No. 10,188,680

TUMOR LYSATE LOADED PARTICLES

Orbis Health Solutions LL...

1. A composition comprising a yeast cell wall particle and a tumor lysate, wherein about 200 ?g to about 500 ?g tumor lysate is loaded within about 109 yeast cell wall particles.
US Pat. No. 10,189,972

MOLDING MATERIAL

The Gillette Company LLC,...

1. A shaving razor comprising:a blade cartridge unit having at least one blade; and
a handle having a frame and a blade cartridge connecting assembly operatively connected to the frame and the blade cartridge unit, the blade cartridge connecting assembly comprising:
a docking station releasably attached to the blade cartridge unit
a pod operably coupled to the frame to rotate relative to the frame, and;
an ejector button, wherein the blade cartridge connecting assembly is configured to rotate about an axis of rotation that is substantially perpendicular to the frame and wherein the blade cartridge unit is configured to rotate about an axis of rotation that is substantially parallel to the blade and substantially perpendicular to the handle.
US Pat. No. 10,189,976

CURABLE COMPOSITION COMPRISING AN ETHYLENE POLYMER, A MONOPEROXYCARBONATE AND A T-ALKYL HYDROPEROXIDE

ARKEMA FRANCE, Colombes ...

1. A curable composition comprising:(a) at least one ethylene polymer,
(b) at least one monoperoxycarbonate, and
(c) from 0.05 to less than 0.4 part by weight of at least one t-alkyl hydroperoxide for 100 parts by weight of constituent (b).
US Pat. No. 10,188,703

METHOD FOR TREATING DIABETES MELLITUS BY A COMPOSITION COMPRISING INSULIN AND A GLP-1/GLUCAGON DUAL AGONIST

HANMI PHARM. CO., LTD., ...

1. A method for treating diabetes mellitus, comprising administering a pharmaceutical composition to a subject at high risk of or having the diabetes mellitus, wherein the composition comprises a long-acting insulin conjugate and a long-acting glucagon-like peptide (GLP-1)/glucagon dual agonist conjugate,wherein the long-acting insulin conjugate is a conjugate in which insulin is linked to an immunoglobulin Fc region via a non-peptidyl polymer; and
wherein the long-acting GLP-1/glucagon dual agonist conjugate is a conjugate in which a GLP-1/glucagon dual agonist is linked to an immunoglobulin Fc region via a non-peptidyl polymer.
US Pat. No. 10,188,965

HYDROPHOBIC CHARGE INDUCTION CHROMATOGRAPHIC DEPLETION OF A PROTEIN FROM A SOLUTION

CSL BEHRING GMBH, Marbur...

1. A pharmaceutical formulation comprising a solution of fibrinogen and an effective amount of a stabilizer, wherein the fibrinogen is recovered by the method of:(i) passing a feedstock comprising fibrinogen through a hydrophobic charge-induction chromatographic resin equilibrated at a pH from 6.5 to 8.5, wherein at least one protein selected from the group consisting of plasminogen, tissue plasminogen activator, and other protease(s) present in the feedstock binds to the resin; and
(ii) recovering a solution comprising at least 80% total protein of fibrinogen which passes through the resin,
wherein the concentration of tissue plasminogen activator is less than 50 pg/mg and the concentration of plasminogen is less than 1 ?g/mg in the recovered fibrinogen solution.
US Pat. No. 10,189,992

RESIN COMPOSITION AND SEAL MEMBER USING SAME

MITSUBISHI CABLE INDUSTRI...

1. A resin composition for a resin sealing member, comprising(b) 1 part by weight-7 parts by weight of a powder of a compound having a layer crystal structure, and
(c) 8 parts by weight-27 parts by weight of a native polytetrafluoroethylene powder, per (a) 100 parts by weight of polyether sulfone.
US Pat. No. 10,188,712

TUMOR ANTIGENS FOR DETERMINING CANCER THERAPY

BIONTECH AG, (DE)

1. A method for treating triple negative breast cancer in a patient comprisinga) detecting the expression pattern of a set of tumor antigens in a sample from the patient, wherein the set of tumor antigens comprises CXorf61, CAGE1, and PRAME;
b) diagnosing the patient as needing a cancer therapy regimen when CXorf61, CAGE1, and PRAME are expressed; and
c) treating the patient with an immunotherapeutic that targets the set of tumor antigens expressed in the patient.
US Pat. No. 10,190,000

SYSTEMS FOR PRODUCING A PLURALITY OF COATING COMPOSITIONS HAVING PREDETERMINED VOC CONTENTS AND METHODS FOR MAKING SUCH SYSTEMS

AXALTA COATING SYSTEMS IP...

1. A three-component system for producing a plurality of coating compositions, the plurality of coating compositions having a predetermined VOC content, the three-component system comprising the following components that are stored separate from one another:1) a binder solution comprising a resin and a solvent;
2) reducer consisting of at least 96 wt.-% solvent and optionally a resin; and
3) least three temperature adjusters 3a), 3b), and 3c), which are stored separate from one another, wherein each of the at least three temperature adjusters comprises a resin and has the predetermined VOC content or less, and wherein each of the at least three temperature adjusters comprises a different solvent or a different amount of a solvent compared to the others of the at least three temperature adjusters,
whereby a coating composition formed from a mixture of components 1) and 2) and one of the at least three temperature adjusters 3a)-3c) is configured for application within a different ambient temperature range,
wherein temperature adjuster 3a) comprises an amount and type of solvent that is configured for application within a first temperature range having a first lower temperature and a first upper temperature, wherein temperature adjuster 3b) comprises an amount and type of solvent that is designed for application within a second temperature range having a second lower temperature that is greater than the first lower temperature and a second upper temperature that is greater than the first upper temperature, and wherein temperature adjuster 3c) comprises an amount and type of solvent that is designed for application within a third temperature range having a third lower temperature that is greater than the second lower temperature and a third upper temperature that is greater than the second upper temperature, and
wherein each of the at least three temperature adjusters 3a)-3c) has no less than 1 wt. % solids based on a total weight of the temperature adjuster and no more than 14 wt. % solids based on the total weight of the temperature adjuster.
US Pat. No. 10,188,721

RECOMBINANT ADENOVIRUS VECTORED FMDV VACCINES AND USES THEREOF

Merial, Inc., Duluth, GA...

1. A composition or vaccine comprising a recombinant viral vector that, when expressed, expresses a foot and mouth Disease Virus (FMDV) antigen comprising a polypeptide sequence selected from any one of SEQ ID NOS: 2, 4, 6, and 8.
US Pat. No. 10,188,725

HYBRID CORE FELINE VACCINES

Elanco US Inc., Greenfie...

1. A non-adjuvanted immunogenic composition comprising:a. Feline Rhinotracheitis virus;
b. Feline Calicivirus;
c. Virulent Systemic Feline Calicivirus; and
d. Feline Panleukopenia virus;
wherein the Feline Calicivirus and the Virulent Systemic Feline Calicivirus are inactivated; and
wherein the Feline Rhinotracheitis virus is attenuated.
US Pat. No. 10,188,734

REDUCED FOAMING VACCINE COMPOSITIONS

MERIAL, INC., Duluth, GA...

1. A stable vaccine composition comprising:i) at least one anhydrous antigenic component comprising a stabilizer susceptible to foaming when the composition is mixed with liquid diluent; and
ii) an effective amount of a foam controlling agent which is a sugar alcohol, and
iii) an effervescent agent,wherein:the effective amount of sugar alcohol is about 25% to 40% by weight of the composition,
the antigenic component is newcastle disease virus, infectious bronchitis virus, fowl pox virus, avian encephalomyelitis virus, marek's disease virus, trichophyton verrucosum, avian paramyxovirus, mycobacterium paratuberculosis, meleagrid herpesvirus, orf virus, or sheep pox virus, and
upon dissolution of the composition, the effervescent agent reacts and gas is formed in situ.
US Pat. No. 10,190,018

DI- AND MONO(METH)ACRYLATE BASED ORGANIC THIN FILM INK COMPOSITIONS

Kateeva, Inc., Newark, C...

1. A process of forming a polymeric thin film layer on a substrate, the method comprising:providing an inert processing environment;
providing an OLED device substrate;
providing an ink composition, the ink composition comprising:
40 wt. % to 60 wt. % polyethylene glycol dimethacrylate monomer, polyethylene glycol diacrylate monomer, or a combination thereof, wherein the polyethylene glycol dimethacrylate monomer and the polyethylene glycol diacrylate monomer have number average molecular weights in the range from about 230 g/mole to about 430 g/mole;
25 wt. % to 50 wt. % monoacrylate monomer, monomethacrylate monomer, or a combination thereof, having a viscosity in the range from about 10 cps to about 27 cps at 22° C.;
4 wt. % to 10 wt. % multifunctional acrylate crosslinking agent, a multifunctional methacrylate crosslinking agent, or a combination thereof; and
0.1 wt. % to 10 wt. % crosslinking photoinitiator,
the ink composition having a surface tension of between about 32 dynes/cm and about 45 dynes/cm at 22° C.;
printing a layer of the ink composition over a defined area of the substrate, and
curing the layer of printed ink, wherein an organic polymeric thin film is formed.
US Pat. No. 10,188,999

PROCESS FOR ENCAPSULATING A LIQUID

Fondazione Istituto Itali...

1. Process for the production of globular microstructures comprising a liquid core and a solid shell that envelops the core, in which said solid shell is impervious to water and is formed from hydrophobic polymeric micro- or nanofibres, the method comprising:dropping droplets of liquid on a mat of polymeric micro- or nanofibres obtained by electrospinning, and
rolling said droplets on said mat of fibres, so as to extract micro- or nanofibres that are not intertwined with one another from said mat and form said shell on the surface of the liquid core.
US Pat. No. 10,191,326

FILM FOR BACKLIGHT UNIT AND BACKLIGHT UNIT AND LIQUID CRYSTAL DISPLAY INCLUDING SAME

SAMSUNG ELECTRONICS CO., ...

1. A semiconductor nanocrystal-polymer composite, comprisinga semiconductor nanocrystal and a matrix polymer in which the semiconductor nanocrystal is dispersed,
wherein the matrix polymer comprises a polymerization product of a multifunctional photo-curable oligomer, a mono-functional photo-curable monomer, and a multifunctional photo-curable cross-linking agent,
a content by weight (A1) of a first structural unit derived from the multifunctional photo-curable oligomer, a content by weight (A2) of a second structural unit derived from the mono-functional photo-curable monomer, and a content by weight (A3) of a third structural unit derived from the multifunctional photo-curable cross-linking agent satisfy Equation 1:
A1<(A2+A3).  Equation 1
US Pat. No. 10,189,023

METHODS FOR CONDUCTING MULTIPLEXED ASSAYS

MESO SCALE TECHOLOGIES, L...


wherein the oligonucleotide is modified with a linking agent comprising a biotin, streptavidin, avidin, amino group, thiol group, aldehyde group, hydrazide group, azide group, alkyne group, maleimide group, or iodoacetamide group.
US Pat. No. 10,190,084

METHOD OF CULTURING EUKARYOTIC CELLS

Genentech, Inc., South S...

1. A method for culturing Chinese hamster ovary (CHO) cells comprising:(i) providing cell culture inoculant comprising CHO cells in about 6 L of a bicarbonate-containing culture liquid to a vessel to achieve a target cell density of about 7.5×105 CHO cells/mL, wherein said vessel has a volume of about 50 L and has walls that encapsulate said cell culture and a gas phase head space above said cell culture, and wherein said vessel comprises at least one port that provides an entrance and an egress of gas to and from said head space;
(ii) providing gas to said head space through said port, wherein said gas contains CO2 in an amount of 8% (v/v) of said gas on day 1, in an amount of 5% (v/v) of said gas on day 2, and in an amount of 2% (v/v) of said gas thereafter, thereby modulating the pH of said cell culture to maintain the pH of the culture between pH 6.8 and 7.2;
(iii) providing fresh culture medium to said vessel to achieve a volume of about 20 L;
(iv) providing gas to said head space through said port, wherein said gas contains CO2 in an amount of 8% (v/v) of said gas on day 1, in an amount of 5% (v/v) of said gas on day 2, and in an amount of 2% (v/v) of said gas thereafter, thereby modulating the pH of said cell culture to maintain the pH of the culture between pH 6.8 and 7.2;
(v) perfusing fresh culture medium into said vessel and removing spent culture medium from said vessel at a perfusion rate of about 1 volume per day; and
(vi) providing gas to said head space through said port to sweep accumulated CO2 from the head space of the vessel, wherein said gas contains O2 in an amount of 30% (v/v) of said gas 48 hours after the start of perfusion, thereby maintaining dissolved O2 to a level greater than 20% of air saturation,
wherein the fresh culture medium has a pH of 7.2, the clearance rate of the head space is between 0.002 and 0.1 head space volume per minute (hvm), the vessel is agitated by rocking the vessel at a rock rate between 15 and 30 rocks per minute (rpm) at a rock angle of between 5° and 15°, and wherein the method does not require monitoring and feedback control of pH and dissolved O2.
US Pat. No. 10,190,100

CHEMICAL MODIFICATION OF GLUCOSE OXIDASE AND ITS APPLICATION TO BIOSENSORS

Verily Life Sciences LLC,...

1. A modified glucose oxidase comprising a glucose oxidase wherein at least one amino group is substituted with a methacrylate through a hydrophilic linker comprising at least one ethylene or propylene oxide unit.
US Pat. No. 10,191,380

COMPOSITION FOR RESIST PATTERNING AND METHOD FOR FORMING PATTERN USING SAME

AZ Electronic Materials (...

1. A resist pattern treatment composition comprising:(A) a nitrogen-containing compound showing basicity when dissolved in water and having a boiling point of 48° C. or more, and said nitrogen-containing compound is selected from the group consisting of:polyvinylamine, polyvinylimidazole, polyallylamine, polydiallylamine, poly(allylamine-co-diallylamine) and polyethyleneimine;
(B) an anionic surfactant having a sulfo or carboxyl group, and
(C) water.
US Pat. No. 10,188,053

HYBRID TOMATO VARIETY 72-195 RZ

RIJK ZWAAN ZAADTEELT EN Z...

1. A Solanum lycopersicum plant designated 72-195 RZ, representative seed of which having been deposited under NCIMB Accession No. 42734.
US Pat. No. 10,190,623

SLIDING ELEMENT

Federal-Mogul Wiesbaden G...

1. A sliding element with a substrate and with at least one layer of a sliding layer material applied to the substrate, wherein the sliding element is for fluid lubricated applications,wherein the sliding layer material is a sliding lacquer with at least one cross-linkable bonding agent consisting of polyamideimide (PAI), polyimide (PI), polybenzimidazole (PBI) and/or silicone resin or a sliding lacquer with at least one high-melting thermoplastic material consisting of polyarylates and/or polyether sulfone (PES), the sliding layer material contains Fe2O3, and the proportion of Fe2O3 related to the total sliding layer material is 0.1 to 15% by volume,
or the sliding layer material is a material with a matrix of at least one high-melting thermoplastic material consisting of polyarylates, and/or polyether sulfone (PES) or a material with a matrix of at least one duroplastic material consisting of polyamideimide (PAI), polyimide (PI), polybenzimidazole (PBI) and/or silicone resin, and wherein the sliding layer material contains Fe2O3.
US Pat. No. 10,190,116

MODULATION OF EXON RECOGNITION IN PRE-MRNA BY INTERFERING WITH THE SECONDARY RNA STRUCTURE

ACADEMISCH ZIEKENHUIS LEI...

1. A method for inducing the skipping of exon 51 of the human dystrophin pre-mRNA in a patient or cell derived from the patient, said method comprising providing to said patient or said cell, an oligonucleotide of 15 to 24 nucleotides in length comprising at least 15 consecutive bases of a base sequence of the sequence UCAAGGAAGAUGGCAUUUCU (SEQ ID NO: 27), wherein said oligonucleotide induces exon 51 skipping in the human dystrophin pre-mRNA in the patient or a cell derived from the patient.
US Pat. No. 10,190,121

APTAMERS AGAINST EGFR AND THERAPEUTIC USES THEREOF

Avvinity Therapeutics Lim...

1. A ribonucleic acid molecule comprising a nucleotide sequence:5?-mGmG mG mAfUfU fUAA fUfCmG fCfCmG fUmAmG AmAmA AmGfC mAfUmG fUfCmA AAmG fCfCmG mGmAA fCfCfC-3? (ALT102139.01) (SEQ ID NO: 79), wherein “m” represents a 2?-O-methyl substituted nucleotide and “f” represents a 2?-fluoro substituted nucleotide.
US Pat. No. 10,190,135

CHIMERIC POST-TRANSCRIPTIONAL REGULATORY ELEMENT

Celltheon Corporation, U...

1. A polynucleotide comprising:(a) a first fragment consisting of the nucleic acid sequence of SEQ ID NO: 7 or a nucleic acid sequence having at least 95% sequence identity to SEQ ID NO: 7,
(b) a second fragment consisting of the nucleic acid sequence of SEQ ID NO: 9 or a nucleic acid sequence having at least 95% sequence identity to SEQ ID NO: 9, and
(c) a third fragment consisting of the nucleic acid sequence of SEQ ID NO: 3 or a nucleic acid sequence having at least 95% sequence identity to SEQ ID NO: 3.
US Pat. No. 10,189,888

VIRAL VECTORS ENCODING RECOMBINANT FVIII VARIANTS WITH INCREASED EXPRESSION FOR GENE THERAPY OF HEMOPHILIA A

Baxalta Incorporated, Ba...

1. A polynucleotide comprising a nucleotide sequence encoding a Factor VIII polypeptide, the Factor VIII polypeptide comprising a light chain, a heavy chain, and a polypeptide linker joining the C-terminus of the heavy chain to the N-terminus of the light chain,wherein the heavy chain of the Factor VIII polypeptide is encoded by a first nucleotide sequence having at least 99% identity over the entire length of SEQ ID NO: 3;
wherein the light chain of the Factor FVIII polypeptide is encoded by a second nucleotide sequence having at least 99% identity over the entire length of SEQ ID NO: 4; and
wherein the polypeptide linker comprises a furin cleavage site and a glycosylation peptide having an amino acid sequence of SEQ ID NO:55.
US Pat. No. 10,189,890

VARIANTS OF TISSUE INHIBITOR OF METALLOPROTEINASE TYPE THREE (TIMP-3), COMPOSITIONS AND METHODS

Amgen Inc., Thousand Oak...

1. An isolated TIMP-3 mutein having a mature region that comprises the amino acid sequence of the mature region of TIMP-3 set forth in SEQ ID NO:2, wherein the mutein has(a) a mutation K45S, and
(b) a mutation F57N.
US Pat. No. 10,190,156

METHODS AND SYSTEMS FOR USING BUILT-IN STANDARD CURVE TO MEASURE MOLECULAR NUMBERS OF BIOLOGICAL COMPONENTS

W2 Biosolutions, LLC, Be...

1. A method of determining absolute quantity of at least one sample target, comprising:i) providing a solid support having a series of control partner 1 and one of at least one sample probe and at least one sample target attached thereon, wherein the series of control partner 1 and the one of the at least one sample probe and the at least one sample target are at separate locations of the solid support, and each of the series of control partner 1 has a different and known copy number;
ii) contacting the solid support with at least one control partner 2 and another of the at least one sample target and the at least one sample probe, wherein:
the series of control partner 1 are configured to recognize and bind the at least one control partner 2, resulting directly or indirectly in a series of detectable control signals, wherein an intensity of each detectable control signal correlates with the known copy number of the each of the series of control partner 1, and a copy number of each of the at least one control partner 2 is no less than the known copy number of the each of the series of control partner 1; and
the at least one sample probe is configured to recognize and bind the at least one sample target in a corresponding manner, resulting directly or indirectly in at least one detectable sample signal, wherein an intensity of each detectable sample signal correlates with a copy number of each of the at least one sample target, and a copy number of each of the at least one sample probe is no less than the copy number of the each of the at least one sample target;
iii) detecting the series of detectable control signals and the at least one detectable sample signal;
iv) making a standard curve relating the intensity of each of the series of detectable control signals with the known copy number of the each of the series of control partner 1; and
v) determining the copy number of each of the at least one sample target by using the standard curve to translate the intensity of the each of the at least one detectable sample signal to the copy number of the each of the at least one sample target.
US Pat. No. 10,188,619

SOLID SOLUTION COMPOSITIONS AND USE IN CHRONIC INFLAMMATION

Infirst Healthcare Limite...

1. A solid solution pharmaceutical composition comprising:a) one or more acetic acid derived non-steroidal anti-inflammatory drugs (NSAIDs) in an amount of about 1% to about 30% by weight of the pharmaceutical composition;
b) one or more pharmaceutically-acceptable hard fats comprising one or more glycerolipids, one or more pharmaceutically-acceptable hard fats in an amount of at least 30% by weight of the pharmaceutical composition;
c) one or more pharmaceutically-acceptable liquid lipids comprising one or more monoglycerides, the one or more pharmaceutically-acceptable liquid lipids in an amount of at least 25% by weight of the pharmaceutical composition, and
d) one or more stability agents in an amount of about 5% to about 18% by weight of the pharmaceutical composition
wherein the solid solution pharmaceutical composition is formulated to have a melting point temperature of about 25° C. or higher.
US Pat. No. 10,189,901

METHODS FOR IMPROVING CARDIAC FUNCTION BY ADMINISTERING AN ANTIBODY THAT ACTIVATES APLNR

Regeneron Pharmaceuticals...

1. A method for inducing vasodilation and/or angiogenesis in a subject, the method comprising administering a pharmaceutical composition to a subject in need thereof, wherein the pharmaceutical composition comprises an isolated antibody, antibody-fusion protein or antigen-binding fragment, wherein the antibody, antibody-fusion protein or antigen-binding fragment thereof comprises complementarity determining regions HCDR1-HCDR2-HCDR3-LCDR1-LCDR2-LCDR3 having the amino acid sequences of SEQ ID NOs: 382-383-384-377-385-386, respectively, and wherein the antibody, antibody-fusion protein or antigen-binding fragment thereof activates apelin receptor (APLNR)-mediated inhibition of cAMP accumulation with at least 39% of maximum apelin dose response activation.
US Pat. No. 10,188,620

TREATMENT FOR NAFLD AND NASH

CymaBay Therapeutics, Inc...

1. A method for treating a disease that is non-alcoholic fatty liver disease (NAFLD) or non-alcoholic steatohepatitis (NASH) in a subject having metabolic syndrome, comprising administering a therapeutically effective amount of seladelpar or a salt thereof to the subject.
US Pat. No. 10,189,902

ANTIBODIES TO TIGIT

Bristol-Myers Squibb Comp...

1. An isolated antibody, or antigen binding fragment thereof, that binds to human TIGIT (human T cell immunoreceptor with Ig and ITIM domains) comprising:a) a heavy chain comprising a heavy chain variable domain comprising:
i) CDRH1 comprising the sequence of SEQ ID NO.: 20;
ii) CDRH2 comprising the sequence of SEQ ID NO.: 21; and
iii) CDRH3 comprising the sequence of SEQ ID NO.: 22;
and
b) a light chain comprising a light chain variable domain comprising:
iv) CDRL1 comprising the sequence of SEQ ID NO.: 23;
v) CDRL2 comprising the sequence of SEQ ID NO.: 24; and
vi) CDRL3 comprising the sequence of SEQ ID NO.: 25.
US Pat. No. 10,189,903

BISPECIFIC CHIMERIC ANTIGEN RECEPTORS AND METHODS OF USE THEREOF TO TREAT CANCER

1. A bispecific chimeric antigen receptor, comprising:a. at least two antigen-specific targeting regions;
b. an extracellular spacer domain;
c. a transmembrane domain;
d. at least one co-stimulatory domain; and
e. an intracellular signaling domain,
wherein each antigen-specific targeting region comprises a single-domain antibody.
US Pat. No. 10,189,904

ANTIBODIES THAT BIND AND BLOCK TRIGGERING RECEPTOR EXPRESSED ON MYELOID CELLS-1 (TREM-1)

1. An isolated antibody or fragment thereof, which competes with mAb 0170 for binding to a triggering receptor expressed on myeloid cells-1 (TREM-1) having an amino acid sequence set forth as SEQ ID NO: 1 (human TREM-1), SEQ ID NO: 12 or SEQ ID NO: 21 (cynomolgus monkey TREM-1),wherein the antibody or fragment thereof comprises a heavy chain variable region that comprises CDR1, CDR2, and CDR3 domains; and a light chain variable region that comprises CDR1, CDR2, and CDR3 domains, and
wherein the heavy chain variable region CDR1 domain comprises amino acid residues 31 to 35 of SEQ ID NO: 4, the heavy chain variable region CDR2 domain comprises amino acid residues 50 to 68 of SEQ ID NO: 4, the heavy chain variable region CDR3 domain comprises amino acid residues 101 to 110 of SEQ ID NO: 4, the light chain variable region CDR1 domain comprises amino acid residues 24 to 38 of SEQ ID NO: 5, the light chain variable region CDR2 domain comprises amino acid residues 54 to 60 of SEQ ID NO: 5, and the light chain variable region CDR3 domain comprises amino acid residues 93 to 101 of SEQ ID NO: 5.
US Pat. No. 10,190,160

METHODS FOR PREDICTING ANTI-CANCER RESPONSE

The Technical University ...

1. A method of administering an anti-cancer treatment to a human patient, comprising:(a) detecting in a sample from a human patient, a plurality of chromosomal aberrations in chromosomal segments comprising a plurality of loci,
wherein chromosomal aberrations are detected in at least one pair of human chromosomes of a cancer cell of the patient,
wherein each of the chromosomal aberrations is at least 12 Mb in length, extends to and involves the telomere but does not cross the centromere, and
(b) calculating a telomeric imbalance score (NtAI) by summing the number of chromosomal aberrations detected in step (a);
(c) detecting an NtAI of at least 8; and
(d) administering to said patient an anti-cancer therapy selected from the group consisting of: platinum-comprising therapy, DNA damaging agent-comprising therapy, anthracycline-comprising therapy, topoisomerase I inhibitor-comprising therapy and PARP inhibitor-comprising therapy.
US Pat. No. 10,188,111

PHARMACEUTICALLY ACCEPTABLE COMPOSITION COMPRISING DILUTE SODIUM HYPOCHLORITE SOLUTION

Hypo-Stream Limited, Mel...

1. A method of treating infection, preventing infection or aiding healing in a mammal comprising administering to said mammal an effective amount of a composition comprising dilute stabilized sodium hypochlorite solution and a dye to show that the dilute stabilized sodium hypochlorite solution is fresh and active by means of a color change within a period of one hour after said dilute stabilized sodium hypochlorite solution is prepared, wherein said dye selected from the group consisting of azafloxin, basic blue (nil blue sulphate), bismarck brown, basic red (rhodamine 6G), bengal red, brilliant crysyl blue, eosin, fluorescein, gentian violet, indocyanine green, janus green, methylene green, methylene blue, neutral red, trypan blue, and trypan red.
US Pat. No. 10,188,624

ENTERIC SOFT CAPSULES COMPRISING POLYUNSATURATED FATTY ACIDS

Patheon Softgels Inc., H...

1. A method for treating or reducing symptoms of a cardiovascular-related disease comprising administering to a subject in need thereof an oral pharmaceutical dosage form comprising an enteric soft capsule shell comprising:gelatin and an enteric polymer;
wherein a weight ratio of enteric polymer to gelatin is 1:2.6; and
the shell encapsulates a fill comprising at least 70% by weight eicosapentaenoic free fatty acid (EPA), wherein upon administration, the enteric soft capsule reduces onset or ameliorates symptoms of gastrointestinal side effects comprising one or more of eructation, abdominal discomfort, nausea, diarrhea or fishy odor.
US Pat. No. 10,189,906

ANTIBODY THAT BINDS CD269 (BCMA) SUITABLE FOR USE IN THE TREATMENT OF PLASMA CELL DISEASES SUCH AS MULTIPLE MYELOMA AND AUTOIMMUNE DISEASES

1. A method for the treatment of a medical disorder in a human subject, wherein the medical disorder is associated with the presence of pathogenic B cells expressing B cell maturation antigen (BCMA), the method comprising administering to the human subject an isolated monoclonal antibody or an antigen binding fragment thereof that binds CD269 (BCMA), wherein said antibody or antigen binding fragment thereof comprises:(i) a VH domain, wherein said VH domain comprises CDR H1 comprising SEQ ID No. 1 (RYWMS) or SEQ ID No. 15 (DYWMS), CDR H2 comprising SEQ ID No. 2 (EINPDSSTINYAPSLKD) or SEQ ID No. 16 (EINPDSSTINYAPSLKG) and CDR H3 comprising SEQ ID No. 3 (SLYYDYGDAMDYW), and
(ii) a VL domain, wherein said VL domain comprises CDR L1 comprises SEQ ID No. 4 (KASQSVDSNVA), CDR L2 comprises SEQ ID No. 5 (SASLRFS) or SEQ ID No. 17 (SDDLRFS) and CDR L3 comprises SEQ ID No. 6 (QQYNNYPLTFG),
wherein the medical disorder associated with the presence of pathogenic B cells is a cancer of plasma cells or a cancer of B lymphocytes.
US Pat. No. 10,188,112

PERSONAL CLEANSING COMPOSITIONS CONTAINING ZINC AMINO ACID/TRIMETHYLGLYCINE HALIDE

Colgate-Palmolive Company...

1. A personal cleansing composition comprisinga) a skin cleansing effective amount of a surfactant, and
b) a zinc X halide complex present in an amount to provide at least 0.36 weight % of the composition of zinc,
wherein X is an amino acid or trimethylglycine;
wherein upon rinsing the skin, the composition deposits a zinc precipitate which provides an SPF factor of at least 2 to skin after washing skin with the personal cleansing composition.
US Pat. No. 10,189,907

POLYNUCLEOTIDES ENCODING ANTI-KIT ANTIBODIES

Celldex Therapeutics, Inc...

1. An polynucleotide comprising nucleotide sequences encoding a VH chain region, a VL chain region, or both a VL chain region and a VH chain region, of an antibody or an antigen-binding fragment thereof, which immunospecifically binds to human KIT (SEQ ID NO: 15) and comprises:(i) a variable light (“VL”) chain region comprising a VL CDR1, VL CDR2, and VL CDR3 comprising the amino acid sequences of SEQ ID NO: 20, SEQ ID NO: 21, and SEQ ID NO: 22, respectively; and
(ii) a variable heavy (“VH”) chain region comprising a VH CDR1, VH CDR2, and VH CDR3 comprising the amino acid sequences of SEQ ID NO: 23, SEQ ID NO: 24, and SEQ ID NO: 25, respectively.
US Pat. No. 10,190,163

SINGLE CELL NUCLEIC ACIDS FOR HIGH-THROUGHPUT STUDIES

FLUIDIGM CORPORATION, So...

1. A method of exposing cells from a population to at least two different reagents, wherein each cell is exposed to the reagents individually, or in groups of two of more, the method comprising:(a) distributing cells from the population to a plurality of capture sites in a microfluidic device so that a plurality of capture sites each comprises one or more cells;
(b) providing one or more first reagent(s) to each capture site;
(c) providing one or more second reagent(s) to each capture site, wherein the second reagent(s) is/are different from the first reagent(s) and is/are provided separately from the first reagent(s), and the one or more first reagent(s) and the one or more second reagent(s) are separately provided to each capture site after distributing the cells to the capture sites;
(d) conducting a reaction, whereby the reaction products encode an item of capture site information;
(e) recovering the reaction products; and
(f) analyzing the reaction products, wherein such analysis permits the identification of particular reaction products as having been derived from a single cell or group of cells at a particular capture site.
US Pat. No. 10,188,113

ANTAGONISTIC PROPERTIES OF REEF FISH MICROFLORA

AEQUOR, INC., San Diego,...

1. A method of inhibiting growth or killing one or more target organisms comprising bacteria, photosynthetic eukaryotic organisms, and non-photosynthetic eukaryotic organisms, wherein the one or more target organisms are growing in or on a biofilm, the method comprising contacting the target organisms with a composition comprising an extract from one or more bacterial isolates identified by PTA-6763, PTA-6682, PTA-6764, PTA-6681, PTA-6765, and PTA-6766, wherein the extract is obtained using diethyl-ether, wherein the target organism is one or more of an organism selected from the group consisting of Micrococcus spp., Enterobacter cloacae, Serratia marcescens, Shigella sonnei, Klebsiella pneumoniae, Proteus vulgaris, and Salmonella typhimurium.
US Pat. No. 10,189,908

CHIMERIC ANTIGEN RECEPTORS RECOGNIZING CANCER-SPECIFIC TN GLYCOPEPTIDE VARIANTS

THE UNIVERSITY OF CHICAGO...

1. A cancer-specific Tn glycopeptide binding partner that binds a cancer-specific Tn glycopeptide, wherein the binding partner comprises the antibody heavy chain variable fragment (VH) of SEQ ID NO:19 or a humanized derivative thereof, and the antibody light chain variable fragment (VL) of SEQ ID NO:20 or a humanized derivative thereof.
US Pat. No. 10,190,164

METHOD OF MAKING A PAIRED TAG LIBRARY FOR NUCLEIC ACID SEQUENCING

APPLIED BIOSYSTEMS, LLC, ...

1. A plurality of circular nucleic acid molecules, the individual circular molecules in the plurality comprising:(a) an adapter sequence common to the plurality of circular nucleic acid molecules, wherein the adapter sequence is 100 bases or less in length, and wherein the adapter sequence comprises a double-stranded nucleic acid; and
(b) a target sequence region that differs between different molecules of the plurality of circular molecules, wherein each target sequence region comprises a fragment of genomic DNA comprising between 200 bp and 15 kb, wherein each of the circular nucleic molecules comprise a first and second nick in the target sequence, one on each strand of the circular nucleic acid molecule, wherein the first and second nick are each located at different positions within the target sequence region.
US Pat. No. 10,188,114

CONTROLLED GROWTH OF MICROORGANISMS

SYNGULON SA, Seraing (BE...

1. A method of controlling the growth of a second microbial cell, the method comprising:allowing a recombinantly engineered first microbial cell to proliferate in a culture medium being fermented by said first microbial cell and further comprising said second microbial cell, wherein said second microbial cell interferes with the fermenting of said culture medium,
said first microbial cell comprising a first nucleic acid encoding a bacteriocin operably linked to a promoter, the method further comprising expressing and secreting the bacteriocin into the culture medium, wherein the bacteriocin is selected to inhibit or prevent the reproduction of the second microbial cell,
wherein the first microbial cell has been genetically engineered to conditionally decrease or eliminate at least one of transcription, post-transcriptional expression, or post-transcriptional activity of a cell immunity modulator that confers resistance to the secreted bacteriocin in the first microbial cell, said decrease or elimination concurrent with expression of said secreted bacteriocin, thereby decreasing immunity modulator activity of said cell immunity modulator,
said second microbial cell being susceptible to the secreted bacteriocin due to an inactivity or absence of the cell immunity modulator in the second microbial cell, whereby the secreted bacteriocin inhibits or prevents the reproduction of the second microbial cell, and whereby the culture medium is fermented by the first microbial cell.
US Pat. No. 10,189,909

ANTIBODIES TO MASP-2

Helion Biotech ApS, Cope...

1. A monoclonal antibody or antigen-binding fragment thereof specifically recognising and binding a polypeptide fragment of human MASP-2 consisting of the CCP1, CCP2 and serine protease domains (aa 293 to 686 of SEQ ID NO:1), wherein said monoclonal antibody or antigen-binding fragment thereof is selected from the group consisting of:(i) the monoclonal antibody produced by the hybridoma cell line deposited under the deposition number 03050904;
(ii) the monoclonal antibody produced by the hybridoma cell line deposited under the deposition number DSM ACC2657
(iii) the monoclonal antibody produced by the hybridoma cell line deposited under the deposition number DSM ACC2660;
(iv) the monoclonal antibody produced by the hybridoma cell line deposited under the deposition number DSM ACC2658; and
(v) the monoclonal antibody produced by the hybridoma cell line deposited under the deposition number DSM ACC2659,
wherein the monoclonal antibody, or antigen-binding fragment thereof, is capable of inhibiting MASP-2 catalyzed C4 deposition.
US Pat. No. 10,188,115

PROTEINS TOXIC TO HEMIPTERAN INSECT SPECIES

Monsanto Technology LLC, ...

1. An insect inhibitory recombinant polypeptide comprising the amino acid sequence as set forth in SEQ ID NO: 36.
US Pat. No. 10,189,911

INNOVATIVE DISCOVERY OF THERAPEUTIC, DIAGNOSTIC, AND ANTIBODY COMPOSITIONS RELATED TO PROTEIN FRAGMENTS OF VALYL-TRNA SYNTHETASES

aTyr Pharma, Inc., San D...

1. A therapeutic composition for detecting or modulating a biological activity of a splice variant polypeptide, comprising a pharmaceutically-acceptable carrier and an antibody or antigen-binding fragment thereof that exhibits binding specificity for an isolated aminoacyl-tRNA synthetase (AARS) splice variant polypeptide that consists of SEQ ID NO: 14, 74, 76, or 78 or an epitope comprising at least 5 amino acids selected from SEQ ID NOs: 55, 57, 69, 182, 194, and 196, wherein the composition has a purity of at least about 90% on a protein basis and less than about 10 EU endotoxin/mg protein.
US Pat. No. 10,190,167

METHODS AND SYSTEMS FOR INFERRING BOVINE TRAITS

Branhaven LLC, Canton, O...

1. A method of matching a bovine trait-associated genotype with a bovine subject, comprising identifying in a nucleic acid sample from the bovine subject a nucleotide occurrence of at least one test single nucleotide polymorphism (SNP), wherein the at least one test SNP is in linkage disequilibrium with at least one trait-associated SNP listed in Table 1A or Table 1B.
US Pat. No. 10,193,756

RESOURCE ALLOCATION BASED ON CONNECTED DEVICES

The Toronoto-Dominion Ban...

1. A device hub, the device hub managing a plurality of connected devices, wherein the device hub communicates with and manages operations of the connected devices via a network connection, the device hub comprising:a memory;
at least one hardware processor interoperably coupled with the memory and configured to:
identify a master resource allocation associated with a plurality of connected devices, the master resource allocation associated with resource usage associated with the plurality of connected devices;
monitor resource usage information associated with each of the connected devices from the plurality of connected devices, wherein each of the plurality of connected devices are assigned a portion of the master resource allocation;
compare the monitored resource usage information associated with the plurality of connected devices to the master resource allocation for the plurality of connected devices to determine if at least one of the connected devices exceeds its corresponding portion of the master resource allocation;
in response to determining that at least one of the connected devices exceeds its corresponding portion of the master resource allocation:
identify at least one device management rule associated with the determination that the at least one of the connected device exceeds its corresponding portion of the master resource allocation, wherein the at least one device management rule defines a priority of different device types included in the plurality of connected devices;
determine, based on the defined priority of the different device types included in the plurality of connected devices, at least one connected device of a device type at a relatively lower priority level in than the at least one device management rules than the at least one of the connected device exceeding its corresponding portion of the master resource allocation;
identify at least one operational modification to the at least one connected device of a device type at the relatively lower priority level based on the at least one device management rule; and
transmit an instruction to perform the at least one operational modification to the at least one connected device of the device type at the relatively lower priority level, wherein the at least one connected device of the device type at the relatively lower priority level performs the at least one operational modification in response to receiving the transmitted instruction.
US Pat. No. 10,188,630

METHODS FOR IDENTIFYING AND USING INHIBITORS OF CASEIN KINASE 1 EPSILON ISOFORM FOR INHIBITING THE GROWTH AND/OR PROLIFERATION OF MYC-DRIVEN TUMOR CELLS

Fred Hutchinson Cancer Re...

1. A method of treating a subject having a tumor comprising tumor cells of neural origin that overexpress Myc, comprising:determining that the tumor comprises tumor cells that overexpress Myc; and
then administering to the subject an amount of a composition comprising a CSNK1? inhibitor effective to inhibit the growth and/or proliferation of the tumor cells.
US Pat. No. 10,190,168

METHOD FOR PREDICTING A TREATMENT RESPONSE TO A CRHR1 ANTAGONIST AND/OR A V1B ANTAGONIST IN A PATIENT WITH DEPRESSIVE AND/OR ANXIETY SYMPTOMS

1. A method of treating a human patient with unipolar or bipolar depression comprisingadministering an effective amount of a V1B receptor antagonist and/or CRHR1 antagonist to the patient in need thereof,
wherein the patient's genome has a polymorphic variant in the AVPR1B gene, the polymorphic variant is SNP rs28373064 which is represented by a single polymorphic change at position 27 of SEQ ID NO: 1, wherein in one or two alleles of the wild-type nucleotide A is replaced by indicator nucleotide G, and
wherein the patient's genome excluding the AVPR1B gene has at least one polymorphic variant selected from the group of biomarkers consisting of:
SNP rs9880583 which is represented by a single polymorphic change at position 27 of SEQ ID NO: 2, wherein in one or two alleles the wild-type nucleotide C is replaced by indicator nucleotide G,
SNP rs13099050 which is represented by a single polymorphic change at position 27 of SEQ ID NO: 3, wherein in one or two alleles the wild-type nucleotide A is replaced by indicator nucleotide C,
SNP rs7441352 which is represented by a single polymorphic change at position 27 of SEQ ID NO: 4, wherein in one or two alleles the wild-type nucleotide A is replaced by indicator nucleotide G,
SNP rs730258 which is represented by a single polymorphic change at position 27 of SEQ ID NO: 5, wherein in one or two alleles the wild-type nucleotide C is replaced by indicator nucleotide T,
SNP rs12654236 which is represented by a single polymorphic change at position 27 of SEQ ID NO: 6, wherein in one or two alleles the wild-type nucleotide A is replaced by indicator nucleotide G,
SNP rs17091872 which is represented by a single polymorphic change at position 27 of SEQ ID NO: 7, wherein in one or two alleles the wild-type nucleotide A is replaced by indicator nucleotide G,
SNP rs12254219 which is represented by a single polymorphic change at position 27 of SEQ ID NO: 8, wherein in one or two alleles the wild-type nucleotide C is replaced by indicator nucleotide T,
SNP rs11575663 which is represented by a single polymorphic change at position 27 of SEQ ID NO: 9, wherein in one or two alleles the wild-type nucleotide A is replaced by indicator nucleotide G,
SNP rs7080276 which is represented by a single polymorphic change at position 27 of SEQ ID NO: 10, wherein in one or two alleles the wild-type nucleotide A is replaced by indicator nucleotide G,
SNP rs7416 which is represented by a single polymorphic change at position 27 of SEQ ID NO: 11, wherein in one or two alleles the wild-type nucleotide A is replaced by indicator nucleotide G,
SNP rs12424513 which is represented by a single polymorphic change at position 27 of SEQ ID NO: 12, wherein in one or two alleles the wild-type nucleotide C is replaced by indicator nucleotide T,
SNP rs1035050 which is represented by a single polymorphic change at position 27 of SEQ ID NO: 13, wherein in one or two alleles the wild-type nucleotide C is replaced by indicator nucleotide T,
SNP rs9959162 which is represented by a single polymorphic change at position 27 of SEQ ID NO: 14, wherein in one or two alleles the wild-type nucleotide A is replaced by indicator nucleotide C, and
SNP rs8088242 which is represented by a single polymorphic change at position 27 of SEQ ID NO: 15, wherein in one or two alleles the wild-type nucleotide A is replaced by indicator nucleotide G.
US Pat. No. 10,194,528

COMPOSITE MATERIAL, HIGH-FREQUENCY CIRCUIT BASEBOARD MADE THEREFROM AND PRODUCTION METHOD THEREOF

GUANGDONG SHENGYI SCI. TE...

1. A prepreg produced by a method, the method comprising the steps of:Step 1) preparing a liquid cement consisting of a mixture of:
a) an emulsion of polytetrafluoroethylene in water,
b) a powdery filler, and
c) an auxiliary agent;
Step 2) forming a composite consisting of the liquid cement and a porous, expanded polytetrafluoroethylene (ePTFE film);
wherein the liquid cement is coated onto a surface of and infused into the pores of the porous, ePTFE film; and
wherein the liquid cement coated onto the surface of the porous ePTFE film has a thickness that is controlled below 20 microns; and
Step 3) baking the composite at 80-300° C. to remove water and the auxiliary agent from the composite to form the prepreg.
US Pat. No. 10,189,914

COUPLED DIENE ELASTOMER HAVING A SILANOL FUNCTION IN THE MIDDLE OF THE CHAIN AND HAVING AN AMINE FUNCTION AT THE CHAIN END, AND RUBBER COMPOSITION COMPRISING SAME

COMPAGNIE GENERALE DES ET...

1. A modified diene elastomer comprising: from 80% to 100% by weight, with respect to the modified diene elastomer, of an entity functionalized in the middle of the chain by a silanol group, the silicon atom of which bonds the two pieces of the chain, the chain ends of the modified diene elastomer being functionalized to at least 70 mol %, with respect to the number of moles of chain end, by an amine functional group, and an overall content of Si functional group T, which is the ratio Ns/Np, in which Ns represents the number of moles of silicon bonded to the coupled polymer, determined by 1H nuclear magnetic resonance NMR and expressed in mmol/kg, and Np represents the number of mmoles of polymer before coupling per kilogram of polymer, ranging from 0.36 to 0.60, a content of silanol (SiOH) functional group in the middle of the chain T1 which is the ratio corresponding to the number of moles of SiOH functional groups to the number of moles of silicon (Si), determined by 1H-29Si 2D nuclear magnetic resonance NMR, ranging from 80 to 100% and a monomodal distribution of the number-average molecular weights of the coupled polymer chains.
US Pat. No. 10,190,170

MAKER FOR DIAGNOSING HER2 INHIBITOR RESISTANT CANCER, DIAGNOSTIC KIT COMPRISING SAME, AND METHOD FOR DIAGNOSING HER2 INHIBITOR RESISTANT CANCER

NATIONAL CANCER CENTER, ...

1. A method for providing information about prognosis of an HER2-positive breast cancer patient about administration of trastuzumab and treating the HER2-positive breast cancer patient, the method comprising:(a) obtaining a sample from the HER2-positive breast cancer patient who are taking the trastuzumab:
(b) treating the sample with the trastuzumab for 24 to 48 hours;
(c) measuring an expression level of mRNA of ENAH gene and an expression level of HER2 protein from the sample of (b);
(d) diagnosing the HER2-positive breast cancer patient having trastuzumab resistance when the measured expression level of mRNA of ENAH gene is higher than an expression level of mRNA of the corresponding gene in the sample before treating with the trastuzumab, and the measured expression level of HER2 protein is lower than an expression level of the corresponding protein in the sample before treating with the trastuzumab; and
(e) administering a second-line drug to the patient diagnosed as having trastuzumab resistance.
US Pat. No. 10,188,633

IDENTIFICATION OF SMALL MOLECULES THAT FACILITATE THERAPEUTIC EXON SKIPPING

THE REGENTS OF THE UNIVER...

1. A method for enhancing exon skipping in an mRNA of interest, comprising contacting the mRNA with an antisense oligonucleotide that is specific for a splicing sequence in the mRNA and an effective amount of dantrolene, Ryanodine, or RyCal S107, or a pharmaceutically acceptable salt, hydrate, solvate, or isomer thereof.
US Pat. No. 10,190,171

POLYNUCLEOTIDE PRIMERS FOR DETECTING PIK3CA MUTATIONS

QIAGEN MANCHESTER LIMITED...

1. A method of detecting a mutation in a nucleic acid sample containing at least a fragment of the phosphatidylinositol 3-kinase catalytic subunit A (PIK3CA) gene comprising:a) mixing the nucleic acid sample with
a polynucleotide comprising a sequence corresponding to SEQ ID NO:21 to produce a mixture;
b) amplifying copies of a fragment of a PIK3CA gene in the mixture using thermal cycling nucleic acid amplification to produce amplicons; and
c) detecting hybridization of the polynucleotide to the nucleic acid sample wherein hybridization indicates the presence of the mutation in the PIK3CA gene.
US Pat. No. 10,188,123

METHODS OF MAKING REDUCED SODIUM FOOD PRODUCTS FORMED OF POTASSIUM-CONTAINING EMULSIFYING SALT MIXTURES

1. A method of preparing a dairy product comprising:combining a dairy ingredient with an emulsifying salt mixture of one or more of liquid sodium potassium hydrogen phosphate or liquid sodium dipotassium phosphate to form the dairy product,
wherein the liquid sodium potassium hydrogen phosphate, the liquid sodium dipotassium phosphate or a combination thereof accounts for at least 50 percent of the emulsifying salt mixture, and
wherein any sodium hydroxide in the emulsifying salt mixture is less than 0.05 percent by weight of the emulsifying salt mixture.
US Pat. No. 10,189,918

CURABLE FLUOROCOPOLYMER FORMED FROM TETRAFLUOROPROPENE

HONEYWELL INTERNATIONAL I...

1. A copolymer composition comprising:(a) from 45 mol % to 55 mol % of a polymerized monomers of 1,3,3,3-tetrafluoropropene;
(b) from 25 mol % to 45 mol % of polymerized monomers of vinyl esters and vinyl ethers; and
(c) from 5 mol % to 20 mol % of polymerized monomers of hydroxyl group-containing vinyl ether(s).
US Pat. No. 10,190,174

ULCERATIVE COLITIS (UC)-ASSOCIATED COLORECTAL NEOPLASIA MARKERS

Baylor Research Institute...

1. A method for determining increased methylation levels in genes from a sample from a patient with ulcerative colitis comprising measuring in the sample increased methylation levels for genes encoding miR-1 and miR-9 compared to a control or reference methylation level for the genes.
US Pat. No. 10,188,637

GRANULATE FORMULATION OF 5-METHYL-1-PHENYL-2-(1H)-PYRIDONE AND METHOD OF MAKING THE SAME

HOFFMANN-LA ROCHE INC., ...

1. A granulate formulation of 5-methyl-1-phenyl-2-(1H)-pyridone, comprising:granules comprising 5-methyl-1-phenyl-2-(1H)-pyridone and a glidant; and
one or more extragranular excipients comprising an extragranular glidant.
US Pat. No. 10,189,919

ACETALIZED POLYVINYL ALCOHOL BARRIER COATINGS

SUN CHEMICAL CORPORATION,...

1. An in situ method for preparing a resin solution comprising:(a) providing a solution comprising polyvinyl alcohol homopolymer or copolymer with ethylene groups, alcohol, and a C1-C3 aldehyde in order to achieve an acetalization of under 25 mol %; and
(b) adjusting solids content of the solution to about 20 to about 35 wt %;
wherein, said method does not comprise any step selected from the group consisting of: an isolation step, a washing step and a precipitation step, and the alcohol is adjusted to be at least 40 wt % and up to 60 wt %.
US Pat. No. 10,188,125

COFFEE CONCENTRATE COMPOSITION

KAO CORPORATION, Tokyo (...

1. A concentrated coffee composition, comprising:components (A), (B) and (C);
(A) at least one chlorogenic acid,
(B) total sugar, and
(C) caffeine,
wherein a mass ratio of the component (A) and the component (B), [(B)/(A)], is from 2.9 to 5,
wherein a mass ratio of the component (A) and the component (C), [(C)/(A)], is 0.17 or less, and
wherein a (F) Brix value of the concentrated coffee composition is 5% or more.
US Pat. No. 10,188,640

PHOSPHODIESESTERASE 4 INHIBITORS FOR THE TREATMENT OF A COGNITIVE DEFICIT

Cold Spring Harbor Labora...

1. A method comprising: (a) providing cognitive training to an animal in need of treatment of a cognitive deficit associated with Parkinson's Disease under conditions sufficient to produce an improvement in performance by said animal of a cognitive function whose deficit is associated with the Parkinson's Disease; (b) administering to the animal in conjunction with the cognitive training an inhibitor of phosphodiesterase 1; and (c) repeating steps (a) and (b) one or more times, wherein administration of the inhibitor of phosphodiesterase 1 to the animal in conjunction with the cognitive training results in increased improvement in performance relative to the improvement in performance produced by cognitive training alone.
US Pat. No. 10,189,922

VERY LOW DENSITY POLYETHYLENE PRODUCED WITH SINGLE SITE CATALYST

NOVA Chemicals (Internati...

1. An ethylene copolymer havinga) a density from about 0.890 to about 0.915 g/cm3,
b) a molecular weight distribution Mw/Mn from about 2.2 to about 4.5,
c) a molecular weight distribution Mz/Mw of greater than 2, provided that when the Mz/Mw is greater than 3, the copolymer further has a normal to flat comonomer distribution,
d) a CDBI50 from about 55 to about 98, and
e) a single peak in a DSC measurement.
US Pat. No. 10,190,178

COMPOSITIONS AND METHODS FOR DETECTING MECC-CONTAINING METHICILLIN-RESISTANT STAPHYLOCOCCUS AUREUS

Roche Molecular Systems, ...

1. A kit for detecting a nucleic acid of mecC-containing methicillin-resistant Staphylococcus aureus (mecC-MRSA) comprising:a first oligonucleotide consisting of a sequence selected from the group consisting of SEQ ID NOs: 1, 2, 6, and 8;
a second oligonucleotide configured to hybridize to a portion of an orfX gene, consisting of SEQ ID NO: 9; and
a detectably labeled third oligonucleotide configured to hybridize to an amplicon generated by the first oligonucleotide and the second oligonucleotide, consisting of SEQ ID NO: 10, or a complement thereof.

US Pat. No. 10,194,401

METHOD OF TERMINAL TRANSMITTING SOUNDING REFERENCE SIGNAL ON THE BASIS OF APERIODIC SOUNDING REFERENCE SIGNAL TRIGGERING AND METHOD FOR CONTROLLING UPLINK TRANSMISSION POWER TO TRANSMIT APERIODIC SOUNDING REFERENCE SIGNAL

LG ELECTRONICS INC., Seo...

1. A method for transmitting an aperiodic sounding reference signal (SRS) by a user equipment (UE) in a wireless communication system, the method comprising:receiving, by the UE, uplink power control information, the uplink power control information including a power offset value related to aperiodic SRS transmission;
receiving, by the UE, information regarding plural SRS parameter sets for the aperiodic SRS transmission;
receiving, by the UE, a downlink control information (DCI) format, the DCI format indicating a first triggering of an aperiodic SRS transmission; and
transmitting the aperiodic SRS based on the power offset value related to the aperiodic SRS transmission and a first SRS parameter set of the plural SRS parameter sets,
wherein the first SRS parameter set according to the first triggering is different from a second SRS parameter set of the plural SRS parameter sets, the second SRS parameter set having been configured for a previous aperiodic SRS transmission according to a second triggering before the first triggering.

US Pat. No. 10,194,368

TELECOMMUNICATIONS ROUTING SYSTEM

VODAFONE IP LICENSING LIM...

1. A method of routing network traffic between a first telecommunications network and a second telecommunications network, each telecommunications network providing Internet Protocol “IP” communications based on a mobile station number “MSISDN”, the method comprising the steps of:at the first telecommunications network, analyzing incoming telecommunications traffic to identify a capabilities request or response message or presence information update message that was transmitted from the second telecommunications network, which capabilities request or response message or presence information update message includes a mobile station number;
when such capabilities request or response message or presence information update message is identified:
extracting the mobile station number from the identified capabilities request or response message or presence information update message;
obtaining routing data for the second telecommunications network;
storing the extracted mobile station number in association with the obtained routing data; and
determining an assigned priority for the second telecommunications network;
if the extracted mobile station number has already been stored in association with routing data:
comparing the already stored routing data associated with the mobile number to the obtained routing data; and
comparing a predetermined priority of a particular telecommunications network identified by the already stored routing data to a predetermined priority of the second telecommunications network from which the message was received; and
if the already stored routing data is different from the obtained routing data, performing either:
if the predetermined priority of the particular telecommunications network identified by the already stored routing data is lower than the predetermined priority of the second telecommunications network from which the message was received, replacing the stored routing data with the obtained routing data, or
if the predetermined priority of the particular telecommunications network identified by the already stored routing data is higher than the predetermined priority of the second telecommunications network from which the message was received, not replacing the stored routing data with the obtained routing data.

US Pat. No. 10,194,319

MOBILE DEVICE AND CONTROL METHOD THEREOF

LG ELECTRONICS INC., Seo...

1. A mobile terminal configured to operate during a locked state and during an unlocked state, the mobile terminal comprising:a touchscreen; and
a controller configured to:
execute a navigation application at the mobile terminal during the unlocked state;
transition the mobile terminal from the unlocked state to the locked state;
cause the touchscreen to display a map during the locked state, wherein the map is associated with the navigation application and depicts a geographical area that includes a current location of the mobile terminal;
cause the touchscreen to display a location indicator on the map during the locked state, wherein the location indicator represents on the map the current location of the mobile terminal;
cause the touchscreen to change a displayed location of the location indicator on the map to reflect changes in the current location of the mobile terminal;
receive, via the touchscreen, a touch input applied to the touchscreen during the displaying of the map during the locked state; and
execute one of different operations based on the touch input and a touch direction of the touch input,
wherein:
the controller transitions the mobile terminal from the locked state to the unlocked state when the touch input is applied in a first direction during the displaying of the map during the locked state, wherein displaying the map is maintained though the mobile terminal is transitioned from the locked state to the unlocked state,
wherein:
the controller controls the touchscreen to switch the map of the navigation application into another execution screen of another application different from the navigation application when the touch input is applied in a second direction different from the first direction during the locked state,
wherein the touch input applied in the second direction does not release the locked state.

US Pat. No. 10,194,314

METHOD AND SYSTEM FOR IDENTIFYING AN ENTITY IN A MOBILE DEVICE ECOSYSTEM

BlackBerry Limited, Wate...

1. A method of assigning an identifier to a first entity operating within a mobile device ecosystem the method comprising:obtaining an identifier of a first entity which uniquely identifies the first entity within a first domain in a plurality of domains in the mobile device ecosystem, each domain including a plurality of entities, each entity having an identifier that is unique within its respective domain but which may not be unique across the plurality of domains, wherein the identifier of the first entity comprises a number of octets and represents a personal identification number (PIN) that uniquely identifies a device within a domain that consists of all devices of a particular make or a universally unique identifier (UUID);
determining a length of the identifier of the first entity, wherein the length of the identifier of the first entity is represented by a single octet;
determining an identifier of the first domain which uniquely identifies the first domain within the mobile device ecosystem based on a combination of an entity type of the first entity and a protocol used to identify the first entity within the first domain, wherein the protocol is one of a PIN protocol, UUID protocol or Internet Protocol version 6 (IPv6) protocol, wherein the identifier of the first domain comprises a variable length integer, wherein the variable length integer includes one or more octets which encode an unsigned integer of a variable length, wherein a most significant bit of each octet indicates whether that octet is the last octet in the variable length integer;
concatenating the identifier of the first entity with the length of the identifier of the first entity and the identifier of the first domain to create a globally unique identifier of the first entity which is globally unique in the mobile device ecosystem, wherein the globally unique identifier is represented as an array of octets;
storing the globally unique identifier in a memory associated with an identity management system module; and
exchanging communications between the first entity and a second entity, wherein the communications specify the first entity using the globally unique identifier of the first entity stored in the identity management system module and specify the second entity using a globally unique identifier of the second entity stored in the identity management system module.

US Pat. No. 10,194,311

METHOD FOR SETTING AND UPDATING TRACKING AREA IN C-RAN AND APPARATUS THEREFOR

LG ELECTRONICS INC., Seo...

1. A method for performing a tracking area (TA) update by a user equipment (UE) in a cloud radio access network (C-RAN), the method comprising:receiving a list of neighbor radio remote units (RRUs) from a serving eNodeB (eNB);
setting a TA based on the list and characteristics of the UE; and
transmitting information on the set TA to the serving eNB through a radio resource control (RRC) connection release request message or a TA configuration message.