US Pat. No. 10,114,341

INERTIA SETTING OR POISING OF A TIMEPIECE SPRUNG BALANCE ASSEMBLY

Nivarox-FAR S.A., Le Loc...

1. A method for producing and for setting inertia of and/or for poising a sprung balance assembly mounted in a timepiece oscillator mechanism which includes, mounted on a plate carrying a balance spring stud via a balance cock, the sprung balance assembly including a balance pivoting about a pivot axis and a balance spring whose inner coil is fixed to the balance or to a collet mounted integrally with the balance and whose outer coil is fixed to the stud to be held in the plate or in the balance cock, the method comprising:selecting a re-machining technology for setting the inertia of and/or for poising the balance by removal of material, from among tool or abrasive machining or laser beam or plasma projection or liquid jet projection, the re-machining technology being implemented by a re-machining means including a means of ablation and/or of charging and/or of deformation and/or of heat treatment;
defining, according to the selection of the re-machining technology, a value of a first distance, forming a minimum distance between any point of the balance spring and a re-machining area for setting the inertia of and/or for poising the balance;
determining a peripheral surface for setting the inertia of and/or for poising the balance, at a periphery of the balance, as a re-machining area, any point of the surface being separated from the balance spring by at least the value of the first predefined distance, to prevent any modification of features of the balance spring during irreversible re-machining of the balance on the peripheral area for setting the inertia of and/or for poising the balance on the assembled sprung-balance assembly;
making the balance spring, prior to attachment to the balance, with the outer coil thereof bent and/or twisted on the attachment thereof to the balance spring stud to move an active end part of the outer coil away from the peripheral surface;
manufacturing the balance and the balance spring, and irreversibly assembling to each other by fixing the inner coil to the balance or to the collet mounted integrally with the balance;
fixing the outer coil in position to the balance spring stud which is immobilized by irreversible attachment with respect to the balance cock;
defining, according to the selected re-machining technology, a value of a second distance, greater than or equal to the first distance and forming the minimum distance between the balance spring stud and the peripheral surface separated from the balance spring stud by a value greater than a second predefined distance, to prevent any modification of features of the attachment of the balance spring to the balance spring stud during re-machining of the balance on the peripheral area for setting the inertia of and/or for poising the balance on the assembled sprung-balance assembly;
determining a value and location of any necessary re-machining operations for setting the inertia and/or for poising;
determining a limit of a trajectory of the re-machining means, the limit being a volume external to a first surface of revolution about the pivot axis and resting on a minimum radius of the peripheral surface and at a third distance from any active point of the balance spring, the determining including comparing the third distance to the first distance to ensure that the third distance is equal to or greater than the first distance, and the first surface is a cone with a first apex centered on the pivot axis and whose first apex angle is lower than a first predetermined value; and
performing the inertia setting and/or poising re-machining operations only on the peripheral surface according to the limit of the trajectory of the re-machining means.

US Pat. No. 10,114,319

FIXING APPARATUS WITH COIL AND MOVABLE MAGNETIC BODY AND IMAGE FORMING APPARATUS WITH COIL AND MOVABLE MAGNETIC BODY

KABUSHIKI KAISHA TOSHIBA,...

1. A fixing apparatus, comprising:a fixing belt including a conductive layer; and
an induced current generation section facing the fixing belt, comprising
a coil configured to generate a magnetic flux, and
a magnetic body facing the fixing belt across the coil,
wherein a part of the magnetic body facing an end in a width direction of the fixing belt is set as a movable magnetic body capable of moving in a width direction; and
wherein the movable magnetic body includes a plurality of movable magnetic bodies provided at ends in the width direction of the magnetic body, and
wherein pressing members configured to press the movable magnetic bodies positioned at the ends in the width direction of the magnetic body to move the movable magnetic bodies inward in the width direction are provided at an outside portion in the width direction of the magnetic body.

US Pat. No. 10,114,276

PHOSPHOR WHEEL, LIGHT SOURCE APPARATUS, AND PROJECTION-TYPE DISPLAY APPARATUS

SONY CORPORATION, Tokyo ...

1. A phosphor wheel, comprising:a disc-like substrate;
a phosphor layer on the substrate; and
a plurality of heat dissipation fins, wherein a first fin of the plurality of heat dissipation fins overlaps with a second fin of the plurality of heat dissipation fins when viewed in a direction orthogonal to a surface of the substrate,
wherein at least one of the plurality of heat dissipation fins has a rising section extending in a direction crossing the surface of the substrate.

US Pat. No. 10,114,262

METHOD FOR MANUFACTURING COA ARRAY SUBSTRATE AND COA ARRAY SUBSTRATE

SHENZHEN CHINA STAR OPTOE...

1. A method for manufacturing a COA array substrate, comprising following steps:step 1, providing a TFT substrate, the TFT substrate comprising a base substrate, a TFT layer disposed on the base substrate, and a pixel electrode layer disposed on the TFT layer, wherein the pixel electrode layer comprises a plurality of red sub-pixel electrodes, green sub-pixel electrodes and blue sub-pixel electrodes disposed alternately;
black matrixes formed in interval regions of the plurality of red, green, blue sub-pixel electrodes on the TFT layer;
step 2, providing a counter electrode, a first electrolyte, a second electrolyte, and a third electrolyte; the counter electrode comprising an insulating substrate, and a plurality of counter electrode units disposed on the insulating substrate, the plurality of counter electrode units disposed correspondingly to the plurality of red, green, blue sub-pixel electrodes on the TFT substrate; the first electrolyte being a weak acidic solution containing a mixture of red quantum dots and chitosan, the second electrolyte being a weak acidic solution containing a mixture of green quantum dots and chitosan, the third electrolyte being a weak acidic solution containing a mixture of scattering particles and chitosan;
step 3, immersing the counter electrode and the TFT substrate into the first electrolyte altogether, forming a connecting circuit by linking the red sub-pixel electrodes on the TFT substrate and counter electrode units corresponding to the red sub-pixel electrodes on the counter electrode with a first wire and a first power source, the TFT substrate being an anode, the counter electrode being a cathode; after being electrified, a pH value of the first electrolyte close to the red sub-pixel electrodes on the TFT substrate increasing, making chitosan in the first electrolyte deposit on the red sub-pixel electrodes, the red quantum dots accompanied the chitosan depositing on the red sub-pixel electrodes, forming a plurality of red filter layers on the plurality of red sub-pixel electrodes respectively; controlling time of electrochemical deposition, disconnecting from the first power source when thickness of the red filter layers accumulated to be a certain value, taking out and cleaning the TFT substrate and the counter electrode;
step 4, immersing the TFT substrate and the counter electrode into the second electrolyte altogether, forming a connecting circuit by linking the green sub-pixel electrodes on the TFT substrate and counter electrode units corresponding to the green sub-pixel electrodes on the counter electrode with a second wire and a second power source, the TFT substrate being an anode, the counter electrode being a cathode; after being electrified, a pH value of the second electrolyte close to the green sub-pixel electrodes on the TFT substrate increasing, making chitosan in the second electrolyte deposit on the green sub-pixel electrodes, the green quantum dots accompanied the chitosan depositing on the green sub-pixel electrodes, forming a plurality of green filter layers on the plurality of green sub-pixel electrodes respectively; controlling time of electrochemical deposition, disconnecting from the second power source when thickness of the green filter layers accumulated to be a certain value, taking out and cleaning the TFT substrate and the counter electrode;
step 5, immersing the TFT substrate and the counter electrode into the third electrolyte altogether, forming a connecting circuit by linking the blue sub-pixel electrodes on the TFT substrate and counter electrode units corresponding to the blue sub-pixel electrodes on the counter electrode with a third wire and a third power source, the TFT substrate being an anode, the counter electrode being a cathode; after being electrified, a pH value of the third electrolyte close to the blue sub-pixel electrodes on the TFT substrate increasing, making chitosan in the third electrolyte deposit on the blue sub-pixel electrodes, the blue quantum dots accompanied the chitosan depositing on the blue sub-pixel electrodes, forming a plurality of blue filter layers on the plurality of blue sub-pixel electrodes respectively; controlling time of electrochemical deposition, disconnecting from the third power source when thickness of the blue filter layers accumulated to be a certain value, taking out and cleaning the TFT substrate and the counter electrode;
the step 3, the step 4, and the step 5 processed randomly; after the steps 3-5, a quantum dot color filter film comprising a plurality of red filter layers, green filter layers, and blue filter layers formed on the pixel electrode layer to manufacture a COA array substrate.

US Pat. No. 10,114,238

ACTIVELY CONTROLLABLE COLOR USING HIGH CONTRAST METASTRUCTURES

THE REGENTS OF THE UNIVER...

1. A photonic apparatus, comprising:a high contrast metastructure (HCM) having a plurality of high index grating structures; and
a transparent flexible film coupled to said high contrast metastructure (HCM);
wherein said high index grating structures of said high contrast metastructure (HCM) are disposed on, or within, said transparent flexible film in a combination forming a photonic device; and
wherein said combination of high contrast metastructure (HCM) and said transparent flexible film are configured so that the size of low index gaps between adjacent high index grating structures changes in response to compressive strain or tensile strain which results in change of reflectance and transmission angles causing a color change in said photonic device.

US Pat. No. 10,114,236

DISPLAY DEVICE AND DRIVING METHOD THEREOF

Samsung Display Co., Ltd....

1. A display device comprising:a display unit including:
scan lines,
data lines,
unit areas corresponding to intersections of the scan lines and the data lines, the unit areas including first unit areas in an effective display area, second unit areas in a dummy area around the effective display area, some of the second unit areas being smaller than the first unit areas, and
pixels in the first unit areas;
a timing controller configured to receive first data including image data corresponding to the first and second unit areas, the timing controller further configured to convert the first data into second data corresponding to the effective display area, and to output the second data; and
a data driver configured to generate a data signal that corresponds to the second data, and to supply the data signal to the data lines,
wherein the display unit includes a first horizontal line having fewer pixels than the number of the data lines, and
wherein, during a first horizontal period corresponding to the first horizontal line, the data signal that corresponds to the second data is applied to data lines connected to the pixels of the first horizontal line, and a predetermined first voltage is applied to the other data lines.

US Pat. No. 10,114,211

ENHANCED RESOLUTION DLP PROJECTOR APPARATUS AND METHOD OF USING SAME

STRATASYS LTD., Rehovot ...

1. A system for building three dimensional (3D) objects comprising:a system control unit;
a production table; and
a DLP projector having a first resolution configured to selectively irradiate a layer of radiation-curable material positioned at a defocused image plane with respect to the DLP projector at the production table so as to provide an image of a second resolution, which is higher than the first resolution of the DPL projector, the DLP projector comprising:
at least three light sources to radiate monochromatic light beams capable of curing the radiation curable material, the light beams having a variance that does not exceed 50 nm wavelength;
at least one light sink for capturing at least some of said monochromatic light beams;
at least one projection lens for refracting and projecting at least some of said monochromatic light beams;
at least one DMD chip for selectively reflecting at least some of said radiated monochromatic light beams from said at least three light sources towards said defocused plane; and
a synchronization control unit to control the activation of each of said at least three light sources in synchronization with said DMD chip.

US Pat. No. 10,114,190

SYSTEM AND METHOD FOR MARKING OPTICAL COMPONENT AT HIGH SPEED

Corning Optical Communica...

1. A system for marking a moving surface of a fiber optic cable, comprising:a supply of the fiber optic cable;
a laser generating device configured to generate a laser beam that forms markings by interacting with the material of the moving surface of the fiber optic cable, wherein the markings comprise indentations formed in the moving surface;
a movement device moving the fiber optic cable through the system at a speed of at least 50 m per minute;
a laser directing device located in the path of the laser beam and configured to change the path of the laser beam to direct the laser beam to a plurality of discrete locations on the moving surface to form a series of marks on the moving surface; and
a printing system configured to deposit ink indicia into the indentations.

US Pat. No. 10,114,178

CONNECTOR FOR AN OPTICAL FIBER AND COMBINATIONS, KITS, AND METHODS OF USING THE SAME

CommScope Connectivity Be...

1. An optical fiber connector for mechanical connection to another optical fiber connector, the optical fiber connector comprising:an optical fiber having a bare end, the bare end including an end face and further including a core and a cladding surrounding the core;
wherein the optical fiber connector is ferrule-less; the radius of curvature of the core is smaller than the radius of curvature of the cladding; the core has a radius of curvature at the end face in a range from 0.14 millimeter to 4 millimeters; and the cladding has a radius of curvature at the end face in a range from 0.4 millimeter to 4 millimeters.

US Pat. No. 10,114,033

METHODS, DEVICES, AND SYSTEMS FOR MIXING FLUIDS

Theranos IP Company, LLC,...

7. A system for mixing small volumes of fluid comprising:i) a fluid handling apparatus comprising a controller, a base in communication with the controller; at least one head operably connected with said base; at least one nozzle operably connected with said at least one head and having a pathway for fluid flow between said nozzle and said head; wherein said at least one head comprises mechanical and structural components operable with each nozzle, and wherein said at least one nozzle is configured to engage a pipette tip, effective that a pipette tip may be held by a nozzle; a pipette tip having an interior passage therethrough and comprising a proximal end configured to engage with a nozzle effective that said pipette tip may be held by the nozzle, and a distal end having a lip defining an orifice, wherein said orifice is continuous with and connected to said interior passage, wherein when a pipette tip is held by a nozzle, i) a continuous pathway for fluid flow is provided between the orifice of said pipette tip, the pipette tip interior passage, the nozzle holding the pipette tip, and the head associated with the nozzle; and ii) the pipette tip may be sealed to the nozzle effective that positive-pressure or suction within the pipette tip is effective to cause fluid flow into or out of the orifice of the pipette tip without dislodging the pipette tip from the nozzle; and a source of positive-pressure or suction in fluid contact with one or more of the pipette tip, the nozzle, the head, and the base, effective that said source may apply positive-pressure or suction within the pipette tip effective to cause fluid flow into or out of the orifice of the pipette tip, and
ii) a mixing vessel comprising an interior portion defined by an interior surface having an interior wall and a bottom, said interior portion having an engagement region, wherein said engagement region comprises a concave or convex feature configured to engage said lip of the pipette tip, effective that when the lip of the pipette tip is pressed against said concave or convex feature, the orifice is occluded effective to prevent fluid flow through the orifice;
wherein the controller is configured to mix fluid within the mixing vessel following occlusion of the orifice of the pipette tip against the inner surface of the mixing vessel, by instructing the head to apply pressure to fluid in the pipette tip during said occlusion, and then removing said pipette tip from contact with said inner surface of the mixing vessel, effective to remove said occlusion of said orifice effective that fluid flows through said orifice, whereby fluid is mixed within the mixing vessel.

US Pat. No. 10,114,001

QUANTITATION OF AMINES IN HYDROCARBONS

Phillips 66 Company, Hou...

1. A process for quantitation of amines in a petroleum oil, comprising:(a) warming a petroleum oil sample to a temperature of 20° C. to 150° C.;
(b) adding water and a solvent to the petroleum oil sample to create an extraction mixture;
(c) heating the extraction mixture to a temperature ranging from 50° C. to 160° C., and maintaining at a constant the temperature for a period of time ranging from 5 minutes to 5 hours to produce an extracted amine mixture comprising an oil phase and an aqueous phase;
(d) analyzing at least a portion of the aqueous phase by ion chromatography for quantitation of amines.

US Pat. No. 10,113,968

SPECIFIC DETECTION AND QUANTIFICATION OF CARDIOLIPIN AND ISOLATED MITOCHONDRIA BY POSITIVELY CHARGED AIE FLUOROGENS AND METHOD OF MANUFACTURING THEREOF

THE HONG KONG UNIVERSITY ...

1. A one-step method of detecting and quantifying cardiolipin in a sample using a positively charged aggregation induced emission (AIE) luminogen comprising:introducing the AIE luminogen to a solution containing the sample; and
measuring fluorescence intensity of the solution, wherein
the AIE luminogen binds to cardiolipin in vesicles and comprises a structure having a formula of

US Pat. No. 10,113,967

ABSORBANCE SPRECTRUM SCANNING FLOW CYTOMETRY

BECTON, DICKINSON AND COM...

1. A method of analyzing a fluorescently labeled particle in a flow channel, the method comprising:exciting the fluorescently labeled particle in the flow channel with a continuously varying excitation wavelength of light as the fluorescently labeled particle passes through a detection region of the flow channel; and
detecting emissions from the fluorescently labeled particle as the fluorescently labeled particle passes through the detection region of the flow channel to analyze the fluorescently labeled particle.

US Pat. No. 10,113,962

AUTOMATIC ANALYZER

HITACHI HIGH-TECHNOLOGIES...

1. An automatic analyzer comprising:a cell disc that holds at least a first cell and a second cell each containing a reaction mixture in which a sample and reagent are mixed with each other on a circumference thereof and the cell disc repeats rotation and termination;
a light source;
a plurality of optical systems, each optical system of the plurality of optical systems configured to receive scattered light at a different angle during rotation of the cell disc relative to each other optical system of the plurality of optical systems, the scattered light being generated upon irradiation of the reaction mixture in the cell with irradiation light from the light source; and
a scattered light receiver configured to receive light guided by the plurality of optical systems, wherein
a processor programmed to run a measurement time for measuring scattered light from a single cell is 2 msec or more, and
the processor programmed to run a measurement and sequential accumulation of the scattered light received from each cell during rotation of the cell disc.

US Pat. No. 10,113,949

DEVICE AND METHOD FOR DETECTING AND ANALYZING DEPOSITS

SOLENIS TECHNOLOGIES, L.P...

1. A device for detecting deposits in a reflection area inside a liquid-bearing system comprising an ultrasonic transducer for emitting an ultrasonic emission signal towards the reflection area and a first detection means for detecting an ultrasonic reflection signal obtained by reflection of the ultrasonic emission signal in the reflection area, wherein a second detection means is disposed in the reflection area, the second detection means being configured to detect a specific kind of deposit, wherein the second detection means is selected from the group consisting of an electrochemical biosensor, optical biosensor, electronic biosensor, piezoelectric biosensor or gravimetric biosensor, and light-addressable potentiometric sensor (LAPS), and wherein the second detection means is configured to generate a liveness detection signal comprising liveness-information about the deposits, extracellular acidification information of the deposits, information on a position dependent distribution of the deposits along a plane of main extension of a sensing surface of the second detection means, or a combination of information thereof.

US Pat. No. 10,113,906

DEVICES AND METHODS FOR MEASURING LIGHT

BlueLight Analytics, Inc....

1. A device comprising:a) a light diffusing element comprising:
an element comprising a top portion, a bottom portion, and a side portion, wherein said top portion comprises a screen, said bottom portion comprises an inner surface that is substantially hemispherical, and said side portion comprises an inner surface that is substantially cylindrical, and wherein said side portion is connected to said top portion and said bottom portion; and
an outlet port in said side portion, wherein said outlet port is substantially parallel to said top portion and is adjacent to said bottom portion, and wherein said outlet port is configured to receive a light conducting conduit,
wherein said light diffusing element prevents light from penetrating through said side portion or said bottom portion.

US Pat. No. 10,113,858

DISTRIBUTED DELAY-LINE FOR LOW-COHERENCE INTERFEROMETRY

Medlumics S.L., Madrid (...

1. An optical coherence tomography system comprising:an optical source configured to provide a beam of radiation;
an optical element configured to direct a first portion of the beam of radiation toward a sample arm and a second portion of the beam of radiation toward a reference arm; and
a detector configured to receive the first and second portions of the beam of radiation from the sample arm and reference arm,
wherein the reference arm includes a plurality of stages, each stage having a fixed group delay element and a group delay modulator, wherein the fixed group delay element and group delay modulator are configured to introduce a group delay such that the first portion of the beam of radiation corresponding to a distinct axial scanning depth range interferes with the second portion of the beam of radiation, wherein frequencies of phase modulation signals applied to each group delay modulator are the same and equal to a phase modulation frequency applied to a delay line in the sample arm.

US Pat. No. 10,113,850

TOOL FOR DISCLOSING AND CORRECTING DIMENSIONAL NON-COMPLIANCE OF AN EDGE PRIOR TO MOUNTING AN EDGE GUARD

1. A tool comprising:a body having a length ending at a first lengthwise end and at a second lengthwise end opposite the first lengthwise end;
a first portion of the body at the first lengthwise end comprising a first slot for gauging clearance depth of an edge of an object by insertion of the edge into the first slot, the first slot comprising an open entrance and mutually confronting side surfaces lying in respective parallel planes and extending depthwise of the first slot from the open entrance of the first slot to a bottom surface of the first slot;
a second portion of the body at the second lengthwise end comprising a second slot into which an edge of an object can be inserted to correct clearance depth of the edge alter the first slot has disclosed insufficient clearance depth of the edge for mounting an edge guard on the edge because of interfering material on the edge, the second slot comprising an open entrance and mutually confronting side surfaces lying in respective parallel planes and extending depthwise of the second slot from the open entrance of the second slot to a bottom surface of the second slot;
one side surface of the second slot having a depth, extending from the open entrance of the second slot to the bottom surface of the second slot, which is greater than depth of each side surface of the first slot, the one side surface of the second slot comprising an edge at the open entrance of the second slot; and
a surface extending from the edge of the one side surface of the second slot at an acute angle to the one side surface of the second slot and cooperating with the one side surface of the second slot to form a wedge for correcting insufficient clearance depth by displacing interfering material on the edge of the object when the edge of the object is inserted into the second slot so that sufficient clearance depth is achieved.

US Pat. No. 10,113,812

HEAT EXCHANGER AND MANUFACTURING METHOD THEREOF

DENSO CORPORATION, Kariy...

4. The heat exchanger according to claim 1, wherein the louvers are identical with one another in regard to a louver side-end angle between the side end and the planar portion regardless of the louver height.

US Pat. No. 10,113,807

INDIRECT-TYPE AIR COOLER

Modine Manufacturing Comp...

1. An indirect-type air cooler comprising:a brazed stack of plates arranged in plate pairs with air fins disposed between the plate pairs, the plate pairs enclosing a liquid space for a liquid coolant;
a housing into which the brazed stack of plates is disposed, having an air inlet and an air outlet, wherein air passing through the housing from the air inlet to the air outlet passes over the air fins to exchange heat with the liquid coolant flowing through the liquid space;
a venting element extending through an opening of the housing such that a first end of the venting element is disposed exterior to the housing, a second end opposite the first end being fluidly connected to the liquid space;
an inlet space portion of the liquid space, formed by a first plurality of openings in the plate pairs;
an outlet space portion of the liquid space, formed by a second plurality of openings in the plate pairs;
a plurality of liquid flow passages extending between and fluidly connecting the inlet space portion and the outlet space portion of the liquid space, each one of said liquid flow passages being arranged within one of the plate pairs, the plurality of liquid flow passages and the inlet and outlet space portions together defining the liquid space;
a first connector piece extending through the housing and fluidly coupled to the inlet space portion;
a second connector piece extending through the housing and fluidly coupled to the outlet space portion; and
a third connector piece extending through the housing, wherein the third connector piece is part of the venting element and is arranged at the first end of the venting element.

US Pat. No. 10,113,798

SLIDE-TYPE EXTRACTOR

VICAT, Paris la Defense ...

1. A slide-type extractor for extraction and transfer of granular mineral materials at high temperature contained in a first enclosure including:a fixed upper part and a mobile lower part delimiting a duct, this duct being provided with an inlet mouth suitable for being connected to the first enclosure and with an outlet mouth, the inlet and outlet mouths being horizontally and vertically offset;
the mobile lower part being movable in a determined movement direction reciprocally between a advanced position and a retracted position to allow a flow of the granular mineral materials in the duct; and
means for moving and guiding the mobile lower part relative to the fixed upper part;
wherein the fixed upper part and the mobile lower part each comprise a metal outer shell, and an inner shell made by stacking at least:
a first coating of thermally insulating material mounted on the metal outer shell; and
a second coating of refractory material mounted on the first coating,
wherein the slide-type extractor further comprises sealing means arranged between and/or around the fixed upper part and the mobile lower part, such that the duct is hermetically sealed.

US Pat. No. 10,113,794

METHOD FOR DRYING A MATERIAL

Mars, Incorporated, McLe...

1. A method of drying a food, comprising the steps of:transporting an extruded food comprising a flavor into a housing having a heated gaseous atmosphere therein,
wherein the gaseous atmosphere comprises a superheated steam having a varied density in a vertical direction and a varied temperature in the vertical direction,
drying the extruded food in the heated gaseous atmosphere to form a dried food and a flavor containing steam,
transporting the dried food out of the housing,
condensing a portion of the flavor containing steam to form a flavor containing liquid,
extracting the flavor from the flavor containing liquid; and
introducing the flavor into a packing container during a packing process.

US Pat. No. 10,113,751

METHOD FOR DETERMINING WHETHER HOT WATER IS USED DURING HEATING OF AN AIR HANDLER SYSTEM

KYUNGDONG NAVIEN CO., LTD...

1. A method for determining whether hot water is used during a heating operation performed by an air handler system,wherein the air handler system comprises:
a water heater including a burner configured to heat tap water, a temperature sensor configured to measure the temperature of water flowing inside a channel through which the tap water flows into the burner, and a flow sensor configured to measure the flow rate of the water flowing inside the channel through which the tap water flows into the burner; and
an air handler including a heat exchanger to which water heated by the burner is supplied, a blower configured to supply air to the heat exchanger, and a duct configured to supply warm air generated through heat exchange between the hot water and the air supplied to the heat exchanger, and
wherein the method comprises:
a) by a controller, inducing heat exchange between the hot water supplied from the burner and the air supplied from the blower in the heat exchanger of the air handler, and causing circulating water whose temperature has been decreased due to the heat exchange to be circulated in the water heater, thereby performing a heating operation;
b) by the controller, determining whether the temperature of the circulating water is decreased due to the circulating water's being mixed with supply tap water supplied from a water pipe after hot water is used, by measuring the temperature of the water flowing inside a channel through which the tap water flows into the burner using the temperature sensor;
c) by the controller, determining whether the flow rate of the circulating water is increased due to the circulating water's being mixed with the supply tap water supplied from the water pipe after hot water is used, by measuring the flow rate of the water flowing inside the channel through which the tap water flows into the burner using the flow sensor; and
d) by the controller, determining that the hot water is used during the heating operation if it is determined in operation (b) that the temperature of the water is decreased and it is determined in operation (c) that the flow rate of the water is increased, and then stopping the heating operation by stopping the operation of the air handler, while causing the water heated at a set temperature by the burner to be supplied through a hot water pipe.

US Pat. No. 10,113,747

SYSTEMS AND METHODS FOR CONTROL OF COMBUSTION DYNAMICS IN COMBUSTION SYSTEM

General Electric Company,...

1. A system, comprising:a gas turbine engine, comprising;
a first combustor comprising a first liner circumscribing a first primary combustion zone and a first secondary combustion zone downstream of the first primary combustion zone and a first fuel injector disposed along the first liner and configured to inject a fuel, via a first fuel outlet, through the first liner into the first secondary combustion zone of the first combustor, the first fuel injector being located at a first distance from a first outlet of the first combustor;
a second combustor comprising a second liner circumscribing a second primary combustion zone and a second secondary combustion zone downstream of the second primary combustion zone and a second fuel injector disposed along the second liner and configured to inject the fuel, via a second fuel outlet, through the second liner into the second secondary combustion zone of the second combustor, the second fuel injector being located at a second distance from a second outlet of the second combustor;
a first fuel conduit extending axially along a first outer surface of the first liner and supplying the fuel to the first fuel injector;
a first pre-orifice installed inside the first fuel conduit, such that a first volume of the first fuel conduit is defined between the first pre-orifice and the first fuel outlet;
a second fuel conduit extending axially along a second outer surface of the second liner and supplying the fuel to the second fuel injector; and
a second pre-orifice installed inside the second fuel conduit, such that to a second volume of the second fuel conduit is defined between the second pre-orifice and the second fuel outlet, wherein the first volume and the second volume are different from one another; and
wherein the first distance is equal to the second distance;
wherein the first pre-orifice comprises a first geometry, and the second pre-orifice comprises a second geometry, wherein one or more first geometric differences between the first geometry of the first pre-orifice and the second geometry of the second pre-orifice reduce coherence between the first combustor and the second combustor or alter a phase between the first combustor and the second combustor; and
wherein the one or more first geometric differences between the first geometry of the first pre-orifice and the second geometry of the second pre-orifice comprises one or more of a number of orifices and an arrangement of a plurality of orifices.

US Pat. No. 10,113,728

JUNCTION BOX FOR MULTIPLE LED DRIVERS

Elemental LED, Inc., Ren...

1. A junction box, comprising:a horizontal base having
an open central portion open at two opposed sides, and
two opposite end portions, each end portion having a four-walled compartment arising from the horizontal base, the four-walled compartments being at least substantially identical and spaced from one another by the open central portion, each of the four-walled compartments including
three vertical outer sidewalls, each of the three vertical outer sidewalls being aligned with an edge of the horizontal base and defining a portion of a sidewall of the junction box, and each of the three vertical outer sidewalls having at least one frangible portion that is adapted to be broken away to form an opening, and
a vertical inner sidewall separating the four-walled compartment from the open central portion of the base;
at least two mounting positions, each of the at least two mounting positions including or being associated with mounting structure secured, or adapted to be secured, to the open central portion of the base to secure a driver;
at least two cut-outs in each of the vertical inner sidewalls, the at least two cut-outs corresponding in number and position to the at least two mounting positions, and the at least two cut-outs in the respective vertical inner sidewalls being aligned with one another across a length of the open central portion of the base, each of the at least two cut-outs beginning at a top edge of one of the vertical inner sidewalls and extending downwardly; and
a U-shaped cover having
an upper face with a size and shape matching a size and shape of a lower face of the horizontal base, and
two depending side portions, the two depending side portions being sized and adapted to create a contiguous sidewall between the two four-walled compartments, such that when installed, the cover forms a closed enclosure with the base.

US Pat. No. 10,113,702

VEHICLE LIGHTING APPARATUS

KOITO MANUFACTURING CO., ...

1. A lighting apparatus configured to be mounted on a vehicle, comprising:a housing formed of resin that defines and forms at least a part of a lamp chamber; and
a lamp unit disposed in the lamp chamber,
wherein the lamp unit comprises:
a light source,
a reflector comprising:
a right bearing portion, and
a left bearing portion,
a heat sink, which is a single rigid piece formed of metal, to which the light source is fixed,
a projection lens through which at least a part of light emitted from the light source passes,
a first moveable frame comprising:
an upper right bearing portion,
a lower right bearing portion,
an upper left bearing portion,
a lower left bearing portion,
a right rotary shaft that is inserted in the right bearing portion of the reflector,
a left rotary shaft that is inserted in the left bearing portion of the reflector, and
a frame joint member,
a second moveable frame comprising:
an upper right shaft that is inserted in the upper right bearing portion,
an upper left shaft that is inserted in the upper left bearing portion,
a lower right shaft that is inserted in the lower right bearing portion,
a lower left shaft that is inserted in the lower left bearing portion,
a lens holder portion connected to the projection lens, and
a joint protrusion,
a link member comprising a joint portion connected to the joint protrusion of the second moveable frame,
an actuator connected to the frame joint member of the first moveable frame,
a joint member connected to the actuator,
a first screw that extends through the heat sink, that is connected to the joint member, and that has a first manipulation portion, and
a second screw that extends through the heat sink, that is connected to the link member, and that has a second manipulation portion,
wherein a reference position of an optical axis of the projection lens is adjusted in a first direction by manipulating the first manipulation portion,
wherein the reference position of the optical axis of the projection lens is adjusted in a second direction intersecting the first direction by manipulating the second manipulation portion,
wherein at least a portion of the heat sink, in which the first manipulation portion and the second manipulation portion are disposed, is disposed outside the housing, and
wherein the heat sink comprises heat radiating plates that extend vertically, with vertical grooves formed between the heat radiating plates.

US Pat. No. 10,113,701

WORKING LIGHT

Xiamen PVTECH Co., Ltd., ...

1. A working light, comprising: a frame and a plurality of LED modules located in the frame, wherein two supporting plates at two ends of the frame are respectively combined with two ratchets, two ends of the LED modules are combined with ratchet plates, the ratchets are respectively assembled to the ratchet plates to control a rotation angle of the LED modules, wherein each of the ratchets is combined with a spring and a pinball, and the pinball is elastically abutted in the corresponding ratchet plate.

US Pat. No. 10,113,697

BULB FOR A MOTOR VEHICLE LAMP

GRUPO ANTOLIN BESANCON, ...

1. A bulb for an automobile vehicle lamp, comprising:a body having a housing making at least one compartment, and an electronic card housed in said at least one compartment, said electronic card having at least one light-emitting diode mounted on said electronic card, and an end-piece, connected to said housing, said end-piece defining a cap cooperative with a socket for a bulb, said bulb being comprised of an electric connection means of said light-emitting diode with an electric circuit,
wherein said body and said electric connection means are defined by independent coupled parts and additional fitting means.

US Pat. No. 10,113,684

BRACKET FOR NOTEBOOK COMPUTER OR TABLET COMPUTER

SHENZHEN XGEAR TECHNOLOGY...

1. A bracket for a notebook computer or a tablet computer, comprising:a first support rod comprising a guide rail;
a second support rod comprising another guide rail;
a third support rod defining a first groove; and
a fourth support rod defining a second groove;
wherein a front end of the first support rod is rotatably connected to the third support rod;
wherein a front end of the second support rod is rotatably connected to the fourth support rod;
wherein the third support rod is rotatably connected to a fifth support rod, one end of the fifth support rod is rotatably connected to the first groove of the third support rod, and the other end of the fifth support rod is rotatably connected to the guide rail of the first support rod;
wherein the fourth support rod is rotatably connected to a sixth support rod, one end of the sixth support rod is rotatably connected to the second groove of the fourth support rod, and the other end of the sixth support rod is rotatably connected to the guide rail of the second support rod;
wherein a first stopper clip is defined on the first support rod, or on the third support rod, or on a connecting shaft between the first support rod and the third support rod;
wherein a second stopper clip is defined on the second support rod, or on the fourth support rod, or on a connecting shaft between the second support rod and the fourth support rod;
wherein a first synchronization rod is connected between the first support rod and the second support rod, a second synchronization rod is connected between the first support rod and the second support rod;
wherein two ends of the first synchronization rod are rotatably connected to the first support rod and the second support rod, respectively;
wherein two ends of the second synchronization rod are rotatably connected to the first support rod and the second support rod, respectively; and
wherein the first synchronization rod and the second synchronization rod are rotatably coupled to each other, the intersection between the first synchronization rod and the second synchronization rod is in the middle of the first synchronization rod and is also in the middle of the second synchronization rod.

US Pat. No. 10,113,683

TRANSFER LINE FOR CRYOGENIC LIQUID

KOREA ADVANCED INSTITUTE ...

1. A transfer line for cryogenic liquid comprising:a first conduit through which cryogenic liquid flows;
a first insulation part surrounding the first conduit and having a multi-layered film structure in which film layers are spaced apart from each other;
a first protective shield formed with a predetermined thickness and a predetermined diameter to surround an exterior of the first insulation part;
a second conduit through which a coolant for cooling the first protective shield flows, the second conduit being in contact with the first protective shield;
a second insulation part surrounding the first protective shield and the second conduit and having a multi-layered film structure in which film layers are spaced apart from each other; and
a second protective shield formed with a predetermined thickness and a predetermined diameter to surround the exterior of the second insulation part,
wherein each of the first insulation part and the second insulation part comprises an insulation member including the multi-layered film structure, and
wherein the film layers are spirally wound and lengths of the film layers in a longitudinal direction of the first conduit are different from each other.

US Pat. No. 10,113,678

QUICK-COUPLING SLIDING JOINTS

Roberto Messana, Porcia,...

1. A sliding quick-coupling joint, comprising:a tubular coupling element having an elongated shape, in which an inner duct extends longitudinally, the inner duct forming:
a cylindrical chamber having a first diameter (D1), with one end open outwardly at one end of the coupling element;
an intermediate cylindrical section having a second diameter (D2) narrower than the first diameter (D1);
a central duct section;
an inner transverse shoulder surface which connects the intermediate cylindrical section to the central duct section; and
a transverse surface which connects the cylindrical chamber to the intermediate cylindrical section;
an annular movable shoulder slidingly received in the cylindrical chamber;
an annular locking element slidingly received in the cylindrical chamber and having radially protruding inner engagement portions defining together a diameter smaller than the second diameter (D2), the annular locking element being axially interposed between the transverse surface and the movable shoulder;
a closing element stably connectable to the end of the coupling tubular element, so as to occlude at least partly the end of the cylindrical chamber; and
a fluid sealing device received in the cylindrical chamber.

US Pat. No. 10,113,665

LOW HYSTERESIS DIAPHRAGM FOR A VALVE

VistadelTek, LLC, Yorba ...

1. A valve housing for use with a valve seat, the valve housing comprising:a valve housing body;
a valve diaphragm integral with the valve housing body, the valve diaphragm having a first surface and a second surface opposing the first surface, one of the first surface and the second surface having a plastically deformed concentric strain hardened region having a concave shape; and
a control element attached to the valve diaphragm, the control element having a control surface offset from the first surface of the valve diaphragm, the control surface being configured to selectively engage the valve seat;
wherein the plastically deformed concentric strain hardened region biases the control surface one of towards and away from the valve seat.

US Pat. No. 10,113,657

MULTIPLE VALVE REFRIGERANT LEAK PROTECTION DEVICE

PRESCOTT, INC., Twin Fal...

1. A multiple valve refrigerant leakage protection device comprising:(a) a ball valve section having an interior portion and exterior portion, including a ball valve housing and a rotatable handle located on said ball valve exterior portion, and a ball valve and a refrigerant flow-through channel located within said ball valve interior portion; and
(b) a Schrader valve section having an interior portion and an exterior portion, including a Schrader valve fitting and a spring-loaded pin located on said Schrader valve exterior portion, and an air chuck and a refrigerant flow-through channel located within said Schrader valve interior portion;
wherein said Schrader valve section further includes a threaded male pipe connection, and further wherein said ball valve section further includes a female threaded connection coupler, an adapter, a gasket having a pin depression section and flow through orifices, whereby said Schrader valve section threaded male pipe connection mates with said ball valve section female threaded connection coupler, and thereby integrating said ball valve section and said Schrader valve section into a single unit;
wherein said ball valve section and said Schrader valve section are integrated into a single combined unit, and when in use as a single combined unit prevent leakage of refrigerant during refrigerant drainage and fill operations.

US Pat. No. 10,113,643

COMPRESSION PISTON RING FOR AN INTERNAL COMBUSTION ENGINE

Ford Global Technologies,...

1. A compression ring for an engine piston comprising:an upper face and a lower face;
an inner face positioned between the upper and lower faces along an inner diameter of the ring, wherein the upper face, the lower face, and the inner face cooperate with an annular groove in the piston; and
an outer face positioned between the upper and lower faces along an outer diameter of the ring for cooperation with a bore in a cylinder, the outer face formed by a smooth continuous curve along an axial direction of the ring, the curve having first and second convex surfaces connected by a concave surface;
wherein a first radius of the first convex surface is equal to a second radius of the second convex surface; and
wherein the concave surface has a third radius, the third radius being less than half of the first radius.

US Pat. No. 10,113,461

DELIVERY MODULE FOR USE IN A SYSTEM FOR PURIFYING THE EXHAUST GASES OF A COMBUSTION ENGINE

PLASTIC OMNIUM ADVANCED I...

1. A liquid delivery module comprising:a base plate positioned through an opening made in a wall of a liquid tank;
a pump assembly configured to pump liquid from the base plate and to deliver the liquid to a supply line, via a hydraulic connector; and
a cover adapted to be fixed to the base plate;
wherein the pump assembly is mounted outside the tank and at least a part of the hydraulic connector is attached to or mounted inside the cover,
wherein the hydraulic connector is molded from one piece with the cover, by injection-molding of a plastic, and
wherein the pump assembly is mounted within a dry area defined between the cover and the base plate.

US Pat. No. 10,113,360

ROLL-UP WALL TENSIONING

Hall Labs LLC, Provo, UT...

1. A flexible, roll-up wall, comprising:a roller drum having a selectively engageable one-way bearing;
one or more power supplies;
a motor coupled to the drum by a transmission and electrically coupled to at least one of the one or more power supplies;
a flexible, sound-attenuating sheet having a base fabric and a polymer coating surrounding the base fabric, the sheet coupled to the roller drum at a first end of the sheet;
an electromagnet and at least one of a corresponding permanent magnet or ferromagnet;
one or more conductive threads woven into the base fabric extending from the first end of the flexible sheet to a second end of the flexible sheet, at least one of the one or more conductive threads electrically coupled to the electromagnet and at least one of the one or more power supplies;
a force meter; and
a potentiometer electrically coupled between the at least one power source coupled to the electromagnet and the electromagnet, wherein the potentiometer varies the current delivered to the electromagnet based on a force measured by the force meter.

US Pat. No. 10,113,326

MODULAR HEAT EXCHANGE TOWER AND METHOD OF ASSEMBLING SAME

SPX Cooling Technologies,...

1. A modular heat exchange tower that extends vertically along a longitudinal axis, comprising:a first module comprising a first basin disposed therein;
a second module comprising a second basin disposed therein;
a plenum;
a first heat exchange section;
an air current generator having at least one blade;
a second heat exchange section;
a third module; and
a fourth module,
wherein the first heat exchange section is disposed in the first module and the third module,
wherein the second heat exchange section is disposed in the second module and the fourth module,
wherein the third module is positioned vertically adjacent to the first module along the longitudinal axis,
wherein the fourth module is positioned vertically adjacent to the second module along the longitudinal axis,
wherein the first heat exchange section disposed in the first module and the third module is further disposed vertically adjacent to the first basin along the longitudinal axis,
wherein the second heat exchange section disposed in the second module and the fourth module is further disposed vertically adjacent to the second basin along the longitudinal axis; and
a fifth module, wherein the fifth module comprises at least a portion of the air current generator and wherein said at least one blade extends from said fifth module into said first module.

US Pat. No. 10,113,321

DECKING SUPPORT SYSTEM

1. A decking support system including:a plurality of decking support elements, each decking support element including a first decking support engagement feature and a second decking support engagement feature,
a plurality of connection elements, wherein at least one of the plurality of connection elements includes a first side including a first connection element engagement structure and a second side including a second connection element engagement structure, wherein the first connection element engagement structure includes a first connection feature adapted to co-operate with said first decking support engagement feature of a decking support element, and a second connection feature adapted to co-operate with said second decking support engagement feature of a decking support element, wherein the first connection feature includes at least one wall extending outwardly and away from said first side, and a groove positioned in said at least one wall; and
wherein a first of said plurality of decking support elements is adapted to be engaged with a second of said plurality of decking support elements by the at least one of said plurality of connection elements.

US Pat. No. 10,113,282

CUTTING EDGE ATTACHMENT FOR SNOW PLOW

Nordic Auto Plow LLC, We...

1. A snow plow blade attachment and mounting for use with an existing plow blade mold board with a set of holes, comprising:a traditional cutting blade with a hole pattern and with a bottom part having a lower edge for engaging a ground;
a reinforcing plate with the hole pattern;
and a rounded cutting edge snow blade attachment having a first upper vertical flat thin section of a thickness with pre-drilled holes that match the hole pattern to receive the reinforcing plate on one side and the traditional cutting blade on the other side to secure the blade attachment to the traditional cutting blade, further including integral and adjacent to the first upper vertical flat thin section a second lower thin section of the first thickness separated from the first upper vertical flat thin section by a horizontal bend of approximately 30 to 45 degrees from the vertical and wherein the second lower thin section includes a primary curved section forming a rounded portion that protrudes forward of the first upper vertical flat thin section and bends downward to pass below the lower edge of the bottom part of the traditional cutting blade in a secondary flat and horizontal section.

US Pat. No. 10,113,275

SELF-PROPELLED GROUND MILLING MACHINE AND METHOD FOR WORKING ON A TRAFFIC SURFACE

Wirtgen GmbH, (DE)

1. A method for working a traffic surface using a self-propelled ground milling machine, wherein the machine comprises a working roller arranged in a roller housing, a hold-down device which is height-adjustable with respect to the traffic surface being arranged upstream of the working roller in a working direction, and one or more sensors, the method comprising:detecting, via the one or more sensors, a physical variable characteristic of disruption to an operating process, wherein a compressive force is applied counter to a force exerted by a weight of the hold-down device by fragments broken off from the traffic surface; and
upon detecting the disruption to the operating process, automatically applying a contact pressure to the hold-down device, said contact pressure directed counter to the compressive force applied by the fragments.

US Pat. No. 10,113,153

P450-BM3 VARIANTS WITH IMPROVED ACTIVITY

Codexis, Inc., Redwood C...

1. A recombinant polynucleotide sequence encoding a recombinant cytochrome P450-BM3 variant, wherein said sequence comprises SEQ ID NO: 3, and further wherein said recombinant cytochromie P450-BM3 variant oxidizes at least three organic substrates.

US Pat. No. 10,113,110

BORON-LOADED LIQUID SCINTILLATOR COMPOSITIONS AND METHODS OF PREPARATION THEREOF

ATOMIC ENERGY OF CANADA L...

1. A boron-loaded liquid scintillator composition comprising: linear alkylbenzene (LAB), a carborane, 2,5-diphenyloxazole (PPO) and 1,4-bis[2-methylstyryl]benzene (bis-MSB) as a wavelength shifter, the LAB, carborane, PPO and bis-MSB being at concentrations at which the boron-loaded liquid scintillator composition enables detection of neutron signals while discriminating the neutron signals from gamma and beta radiation, the PPO at a concentration of 2-6 g/L and the bis-MSB at a concentration of 20-40 mg/L.

US Pat. No. 10,113,013

CATALYST COMPONENTS FOR THE POLYMERIZATION OF OLEFINS

Basell Poliolefine Italia...

1. A solid catalyst component for the polymerization of olefins comprising Mg, Ti and an electron donor of the formula (I):
where each Q is a group —COOR1 in which R1 is selected from C1-C15 hydrocarbon groups, optionally containing a heteroatom selected from the group consisting of a halogen, P, S, N, and O; or a group —CON(R2)2 in which R2 groups, equal to or different from each other, are selected from hydrogen or R1 groups which are optionally fused together to form one or more cycles; and A is a bivalent bridging group with the proviso that the Q groups cannot be simultaneously a group —COOR1 or —CON(R2)2.

US Pat. No. 10,112,838

METHOD AND DEVICE FOR TREATING THE FREE SURFACE OF A MATERIAL

1. A method for treating a free surface of a silicon material, comprising:emitting at least one first gas flow from a first opening,
sweeping the free surface of the silicon material by the first flow, followed by
discharging the first flow through at least one discharge opening,
concomitantly with the emitting of the first flow, emitting at least one second gas flow from at least one second opening, the second gas flow forming a protective cover over the free surface of the material, at a distance from said free surface, and discharging the second gas flow through an upper part of the discharge opening, the first flow being discharged through a lower part of the discharge opening,
wherein the upper part of the discharge opening occupies up to 80% of the overall height of the discharge opening.

US Pat. No. 10,112,836

CONTINUOUS NANOSYNTHESIS APPARATUS AND PROCESS

The Regents of The Univer...

11. A nanosynthesis apparatus, comprising:an outer tube having an internal surface and a longitudinal axis;
a substrate support surface at least partially disposed within the outer tube and opposing the internal surface of the outer tube across a gap having opposite ends and circumscribing the substrate support surface;
a deposition fluid source in fluid communication with the gap and operable to provide a deposition fluid to the gap such that the deposition fluid flows along the gap in a direction from one of the opposite ends toward the other of the opposite ends, wherein the deposition fluid comprises a constituent to be deposited on a growth substrate in the gap;
a heater arranged to heat at least a portion of the gap;
a feed system arranged to provide the growth substrate in the gap and onto the substrate support surface at an angle with respect to the longitudinal axis of the outer tube such that a length of the growth substrate wraps around and is in physical contact with the substrate support surface and extends between the ends of the gap, whereby the growth substrate is exposed to the deposition fluid flowing along the gap;
an inner tube that includes the substrate support surface, the deposition fluid source being in fluid communication with the inside of the inner tube; and
an aperture extending through the inner tube at a location between the ends of the gap, wherein the deposition fluid source is in fluid communication with the gap via the inner tube and the aperture such that the deposition fluid flows along only a portion of the gap.

US Pat. No. 10,112,806

PORTABLE HOIST ARM ASSEMBLY

1. A portable hoist arm assembly comprising:a pair of bars, each said bar having a first terminus, said bars being pivotally coupled proximate to said first termini;
a pair of first couplers configured for coupling to a vertical support;
a pair of contractors, each said contractor being coupled to and extending between a respective said first coupler and an associated said bar proximate to said first terminus;
a connector coupled to a respective said bar proximate to said first terminus, said connector being configured for coupling to a hoist line, wherein said connector is positioned on said respective said bar such that said connector is configured for coupling to the hoist line; and
wherein said bars are configured for positioning such that second termini of said bars are positioned for abutting the vertical support with a first said bar extending substantially perpendicularly from the vertical support and a second said bar extending angularly and downwardly from said first said bar to the vertical support, wherein said contractors are positioned on said bars such that said contractors are positioned for contracting for coupling said bars to the vertical support positioning said connector for coupling to the hoist line.

US Pat. No. 10,112,770

METHOD AND APPARATUS FOR SUPPORTING A FLOATING ROOF DISPOSED IN A STORAGE TANK

Delta P Technology Intern...

1. A cribbing system, comprising:a first vertical riser;
a second vertical riser;
a first horizontal base span;
a first horizontal cap span;
a first base member having a first vertical base receptacle and a first horizontal base receptacle, wherein the first vertical base receptacle is configured to selectively receive the first vertical riser and the first horizontal base receptacle is configured to selectively receive the first horizontal base span;
a second base member having a second vertical base receptacle and a second horizontal base receptacle, wherein the second vertical base receptacle is configured to selectively receive the second vertical riser and the second horizontal base receptacle is configured to selectively receive the first horizontal base span;
a first cap member having a first vertical cap receptacle and a first horizontal cap receptacle, wherein the first vertical cap receptacle is configured to selectively receive the first vertical riser and the first horizontal cap receptacle is configured to selectively receive the first horizontal cap span;
a second cap member having a second vertical cap receptacle and a second horizontal cap receptacle, wherein the second vertical cap receptacle is configured to selectively receive the second vertical riser and the second horizontal cap receptacle is configured to selectively receive the first horizontal cap span; and
a grounding strap having a first end and a second end, wherein the first end of the grounding strap is coupled to one or more of the first vertical riser, second vertical riser, first horizontal base span, first horizontal cap span, first base member, second base member, first cap member, and second cap member, and wherein the first vertical riser, second vertical riser, first horizontal base span, first horizontal cap span, first base member, second base member, first cap member, and second cap member are electrically conductive.

US Pat. No. 10,112,761

PACKAGE HAVING INTEGRAL TAB WITH FINGER HOLE OPENING FEATURE

Hollister Incorporated, ...

1. A package, comprising a sheet material having first and second side panels and upper and lower panels, the sheet material being wrapped into a three-dimensional configuration wherein the first and second side panels are placed in confronting relation to define a fin having a longitudinal free edge and opposed end free edges, at least a portion of the side panels parallel to the longitudinal free edge of the fin being adhered to one another to define a fin seal extending between the longitudinal free edge and a terminal line parallel to the longitudinal free edge, portions of the upper and lower panels being placed in confronting relation and said portions of the upper and lower panels being adhered to one another to define first and second end seals, and a starter line formed in the fin at a location intermediate the end free edges extending from the longitudinal free edge of the fin toward the upper panels wherein the starter line directs tearing of the package parallel to the longitudinal free edge.

US Pat. No. 10,112,759

SINGLE DOSE MATERIAL AND APPLICATOR PACKAGE

Centrix, Inc., Shelton, ...

3. A single dose material and applicator package for dispensing a dental material comprising:a plastic tray;
an applicator well having a longitudinal length with a first end and a second end and a bottom formed in said plastic tray, said applicator well having a first lateral dimension over a majority of the longitudinal length;
a material well formed in said plastic tray adjacent the first end;
a ramp formed in said material well;
a finger depression formed in the bottom of said applicator well adjacent said material well and extending into said applicator well;
a front applicator channel formed in said finger depression;
an applicator support depression formed in the bottom of said applicator well adjacent the second end of said applicator well and extending into said applicator well;
a rear applicator channel formed in said applicator support depression;
a wider portion of said applicator well formed adjacent an end of said applicator well, said wider portion having a second lateral dimension greater than the first lateral dimension of the majority of the longitudinal length of said applicator well, whereby a finger of a user is capable of passing through said wider portion;
an applicator having an applicator handle and an applicator brush placed within the applicator well and positioned on top of said finger depression and said applicator support depression and held in a central position by said front applicator channel and said rear applicator channel;
a dental material placed within said material well;
a flange formed in a top surface of said tray forming a plane; and
a cover removably affixed to said flange,
whereby said cover seals the applicator and the material within the tray and upon removing said cover said applicator is capable of being pivoted on said applicator support depression upward by a user by placing a finger through said wider portion of said applicator well and pushing downward on a distal end of the applicator handle forcing the applicator brush away from said applicator well.

US Pat. No. 10,112,757

INSULATION PACKAGING SYSTEM

Johns Manville, Denver, ...

1. An insulation packaging system, comprising:a plurality of insulation packages comprising first ends and second ends, wherein the plurality of packages define an axis;
a first film configured to wrap around the axis to compress and couple the plurality of insulation packages together; and
a second film configured to wrap around the first and second ends of the plurality of insulation packages, wherein the second film comprises a stretch film, the stretch film including a longitudinal length and a lateral width that is perpendicular to the longitudinal length, wherein the second film is configured to wrap around the first and second ends of the plurality of insulation packages along the longitudinal length, and wherein the lateral width is sufficient such that wrapping the second film around the first and second ends of the plurality of insulation packages a single time entirely covers the first and second ends of the plurality of insulation packages;
wherein the first and second films are different films.

US Pat. No. 10,112,740

TAMPER-EVIDENT MESH MATERIAL AND METHODS OF MANUFACTURE THEREFOR

JX NIPPON ANCI, INC., Ke...

1. A tamper-evident mesh material comprising:a nonwoven mesh fabric, said mesh fabric comprising a plurality of strands, said plurality of strands comprising overlying strands and underlying strands, wherein said overlying strands and said underlying strands comprise a pigmentation, and wherein said overlying strands are bonded to said underlying strands at a plurality of crossover points; and,
a contrast layer, wherein said contrast layer is visually distinct from said pigmentation of said overlying strands and said underlying strands, and wherein said contrast layer is disposed over at least a portion of each said overlying strand and each said underlying strand, and over said plurality of crossover points,
wherein breakage of a bond between at least one of said overlying strands and at least one of said underlying strands at a crossover point of said plurality of crossover points exposes at least one pigmented section of said at least one underlying strand at said crossover point to indicate breakage of said bond.

US Pat. No. 10,112,721

PARACHUTE DEPLOYMENT SYSTEM FOR AN UNMANNED AERIAL VEHICLE

Flirtey Holdings, Inc., ...

1. A drone comprising:a lift mechanism configured to lift and propel the drone;
an error detection circuit configured to:
detect an error in operation of the drone, the error indicating a failure of the drone, the failure including a failure in all or a subset of motors of the lift mechanism, and
upon detecting the error, send a trigger event;
a parachute securely attached to the drone and configured to slow a decent of the drone when deployed;
a parachute deployment mechanism configured to release the parachute in response to the trigger event, or in response to another trigger event generated in response to a command from a base unit operated by a remote user; and
a cut-off circuit configured to control the lift mechanism in response to the trigger event, wherein the cut-off circuit is configured to control the lift mechanism by disabling the lift mechanism.

US Pat. No. 10,112,717

PIVOT BIN ASSEMBLY WITH TWO PART PIVOT AXLE

1. An aircraft storage bin comprising:an upper housing that includes first and second side panels,
a bucket that includes a bottom and first and second sides, wherein the bucket cooperates with the upper housing to define a bin interior,
a first clevis assembly that includes a first inner plate and a first outer plate, wherein the first inner plate and first outer plate extend between the first side panel and the first side wall, wherein the first inner plate includes a first outer protrusion and the first outer plate includes first inner protrusion, wherein the first inner protrusion and first outer protrusion cooperate to form a first pivot axle, and
a second clevis assembly that includes a second inner plate and a second outer plate, wherein the second inner plate and second outer plate extend between the second side panel and the second side wall, wherein the second inner plate includes a second outer protrusion and the second outer plate includes second inner protrusion, wherein the second inner protrusion and second outer protrusion cooperate to form a second pivot axle,
wherein the first and second pivot axles are axially aligned along a pivot axis, and wherein the bucket pivots about the pivot axis with respect to the upper housing between an open position and a closed position.

US Pat. No. 10,112,695

RECEPTACLE, PAYLOAD ASSEMBLY AND RELATED METHODS FOR AN AIRCRAFT

Georgian Aerospace LLC, ...

1. An aircraft comprising:a support structure;
an outer skin coupled to the support structure;
a port that defines a break in the support structure and extends through the outer skin;
a receptacle attached to portions of the support structure proximate the port, such that the receptacle routes at least a portion of the load borne by the support structure around the break defined by the port, the receptacle comprising an opening defined therein;
a removable payload assembly mounted within the receptacle opening;
a pressure ring forming a seal between an inner surface of the receptacle and an outer surface of the payload assembly;
at least one interior member coupled to the receptacle, the at least one interior member aligned with, and fastened to, a corresponding at least one rail mounted exteriorly to the aircraft outer skin; and
a door coupled to the at least one rail proximate the port for movement between a first position and a second position.

US Pat. No. 10,112,691

RELEASABLE FORWARD SECTION OF AN UNDERWATER VEHICLE

The Boeing Company, Chic...

1. An underwater vehicle comprising:a first section detachably coupled to a second section, wherein the second section is positioned forward of the first section;
a hinge detachably coupling the first section to the second section, wherein the hinge creates a pivot between the first section and the second section:
a lock having a locked position and an unlocked position, wherein, in the locked position, the lock couples the first section and the second section together, and wherein, in the unlocked position, the second section is capable of decoupling from the first section; and
a drag fin associated with the second section, wherein the drag fin is movable to an extended position away from the second section to create a drag force which causes the second section to pivot about the hinge away from the first section when the underwater vehicle is traveling through a fluid medium.

US Pat. No. 10,112,666

PART HOLDING ASSEMBLY, AN ASSEMBLY SYSTEM AND A METHOD OF LOCATING AND SECURING A PART

GM Global Technology Oper...

1. A part holding assembly configured to locate and secure a part defining a plurality of holes, the assembly comprising:a frame including a first track and a second track disposed transverse to the first track;
a first clamping device movable along the first track in a first direction and a second direction opposite the first direction for positioning the first clamping device relative to the part, and the first clamping device configured to engage the part to secure the part to the first clamping device;
a first pin device movable along the second track in a third direction and a fourth direction opposite the third direction for positioning the first pin device relative to the location of one of the holes of the part, with the first and second directions being different from the third and fourth directions;
wherein the first pin device includes a first pin movable between a closed position and an open position, with the first pin configured to be disposed through the one of the holes of the part when in the closed position for locating the part, and the first pin is configured to expand in the one of the holes when in the open position for securing the part to the first pin device; and
wherein the first pin includes a plurality of first fingers movable toward each other to insert the first fingers into one of the holes and movable away from each other to engage the part within the one of the holes.

US Pat. No. 10,112,647

GESTURE CONTROL FROM A REMOTE POSITION FOR REVERSING A VEHICLE AND A VEHICLE-TRAILER SYSTEM

Continental Automotive Sy...

1. A backing system for a vehicle, the backing system comprising:a camera for recording a video image of a user performing a gesture, the camera mounted to the vehicle or to a trailer in communication with the vehicle;
a microphone mounted to the vehicle or to the trailer in a position to capture a rear, or side rear position of the user, the microphone for capturing a voice command; and
an electronic control unit for the backing system, the electronic control unit in communication with the camera and the microphone, the electronic control unit includes instructions for:
determining that the vehicle is backing up;
interpreting the gesture with the electronic control unit to determine a meaning of the gesture;
calculating a first steering angle based upon the meaning of the gesture;
sending a first request to a steering system to provide the first steering angle;
calculating a second steering angle directly based upon the voice command; and
sending a second request to the steering system to provide the second steering angle.

US Pat. No. 10,112,635

FREIGHT CART

1. A freight cart comprising a carriage (1) as well as a bucket (2) and a handle (3) which are respectively located on front and rear sides of the carriage (1), characterized in that the bucket (2) is pivotally connected to the carriage (1), a double connecting rod assembly (5) for driving the bucket (2) to rotate relative to the carriage (1) is also provided on the carriage (1), the double connecting rod assembly (5) is pivotally connected to the bucket (2) and the carriage (1) respectively and forms a linkage mechanism together with the bucket (2) and the carriage (1), the handle (3) is transmissively connected to the double connecting rod assembly (5), and the handle (3) is operated to make the linkage mechanism drivable to rotate the bucket (2) relative to the carriage (1) and switch the bucket (2) between a storage position and a discharge position,wherein the freight cart further comprises a locking mechanism, the locking mechanism includes a first locking member (61) and a second locking member (62), and
wherein the first locking member (61) is pivotally connected to the carriage (1), and the second locking member (62) is fixed relative to the handle (3).

US Pat. No. 10,112,632

METHOD AND SYSTEM FOR RAIL VEHICLE COUPLING DETERMINATION

Trapeze Software ULC, Mi...

1. A system for identifying transport units in coupled relationship comprisinga plurality of transport units in a predefined area;
a first transport unit among said plurality of transport units having one end of a coupling unit at a front end thereof; said one end of said coupling unit including a first mechanical coupling portion and a first electrical coupling portion;
a second transport unit among said plurality of transport units have a second end of said coupling unit at a rear end thereof; said second end of said coupling unit including a second mechanical coupling portion and a second electrical coupling portion;
at least one additional transport unit among said plurality of transport units being closest in physical proximity to said first transport unit;
said first electrical coupling portion including a first dry contact having a closed state when said first mechanical coupling portion and said second mechanical coupling portion are coupled together and an open state when said first mechanical coupling portion and said second mechanical coupling portion are uncoupled from each other;
said second electrical coupling portion including a second dry contact having a closed state when said second mechanical coupling portion and said first mechanical coupling portion are coupled together and an open state when said first mechanical coupling portion and said second mechanical coupling portion are uncoupled from each other;
a communications device on said first transport unit in signal communication with said dry contact; said communications device configured to communicate a data packet identifying said first transport and a state of said dry contact to a communications receiving device;
a communications device on said second transport unit in signal communication with said second dry contact; said communications device configured to communicate a data packet identifying said second transport and a state of said second dry contact to a communications receiving device;
a communications device on said at least one additional transport unit configured to communicate a data packet identifying said additional transport unit to a communications receiver;
said communications receiving device including a computer processor and computer executable instructions for determining a transport unit amongst said plurality of transport units in closest coupled proximity to said first transport unit and for providing an indication that said first transport unit is coupled to said second transport unit upon a condition in which said first dry contact is in said closed state and upon a condition in which said transport unit amongst said plurality of transport units in closest coupled proximity to said first transport unit is determined to be said second transport unit;
said communications receiving device further including computer executable instructions for confirming the identity of said first transport unit and said second transport unit indicated to be coupled by determining a transport unit amongst said plurality of transport units in closest coupled proximity to said second transport unit and for providing an indication that said second transport unit is coupled to said first transport unit upon a condition in which said second dry contact is in said closed state and upon a condition in which said transport unit amongst said plurality of transport units in closest coupled proximity to said second transport unit is determined to be said first transport unit, whereby confirmation is provided that said first transport unit is coupled to said second transport unit and avoiding an indication where said transport unit amongst said plurality of transport units in closest physical proximity is said at least one additional transport unit incorrectly indicated to be coupled to said first or said second transport units.

US Pat. No. 10,112,346

PRINTING METHOD FOR LOW MELTING-POINT MATERIAL OF 3D PRINTER

XYZPRINTING, INC., New T...

1. A printing method for low melting-point material, used by a 3D printer having a nozzle and a printing platform, the printing method comprising:a) controlling the nozzle to move to a first printing position upon the printing platform corresponding to an internal-contour of a printing-layer;
b) after the step a, controlling the nozzle to start printing the internal-contour;
c) controlling the nozzle to stop printing after the internal-contour is printed completely, and controlling the stopped nozzle to move to a second printing position upon the printing platform corresponding to an exterior-contour of the printing-layer; and
d) controlling the stopped nozzle to start printing the exterior-contour after the step c;
e) controlling the nozzle to stop printing after the exterior-contour is printed completely;
f) controlling the stopped nozzle to move inwardly from the exterior-contour toward a space not upon the printing-layer and away from the exterior-contour by a threshold range after the step e; and
g) changing a related position between the nozzle and the printing platform upon a Z-axis.

US Pat. No. 10,112,330

MOULD, PARTICULARLY INJECTION MOULD, AND INJECTION MOULDING METHOD USING SUCH A MOULD

Safran Aircraft Engines, ...

1. A mold optionally an injection mold, comprising a plurality of blocks that, in an assembled position, define a mold cavity, wherein the mold includes at least one pusher, said pusher being configured to be housed in a first block of said plurality of blocks, in a side facing the mold cavity, and to present a first surface flush with the mold cavity when the pusher is housed in said first block, wherein the mold also includes an actuator enabling the pusher to be moved relative to the first block, and a seal configured to isolate the actuator from the mold cavity, wherein, when the blocks are in the assembled position, a second surface of said pusher is in contact with a second block other than the first block, and in that the actuator is accessible via said second surface of the pusher.

US Pat. No. 10,112,247

WIRE ELECTRIC DISCHARGE MACHINE HAVING MOVABLE AXIS ABNORMAL LOAD WARNING FUNCTION

FANUC CORPORATION, Yaman...

1. A wire electric discharge machine that moves an axis in accordance with an axis feed command by a program or an operation of an operator, comprising:a machine learning device that performs machine learning of an adjustment target parameter of the axis feed command in the movement of the axis and an adjustment amount of the adjustment target parameter, wherein
the machine learning device includes:
a state observation section that acquires state data as information indicative of a movement state of the axis in the movement of the axis;
a reward condition setting section that sets a reward condition;
a reward calculation section that calculates a reward based on the state data and the reward condition;
an axis feed command adjustment learning section that performs the machine learning of an axis feed command adjustment; and
an axis feed command output section that determines the adjustment target parameter of the axis feed command and the adjustment amount of the adjustment target parameter as an adjustment action based on a result of the machine learning of the axis feed command adjustment by the axis feed command adjustment learning section and the state data, adjusts the axis feed command based on the determined adjustment action, and outputs the adjusted axis feed command, wherein
the axis feed command adjustment learning section performs the machine learning of the axis feed command adjustment based on the adjustment action, the state data acquired by the state observation section after the movement of the axis based on the outputted adjusted axis feed command, and the reward calculated by the reward calculation section,
the wire electric discharge machine is configured to move the axis in accordance with the outputted adjusted axis feed command,
the reward condition provides a positive reward in a case where a load of the axis does not exceed an abnormal load level of the axis during the movement of the axis, or in a case where damage to a mechanical section of a movable axis does not occur at a time of a collision of the movable axis, and
the reward condition provides a negative reward in a case where the load of the axis exceeds the abnormal load level of the axis during the movement of the axis, or in a case where damage to the mechanical section of the movable axis occurs at the time of the collision of the movable axis.

US Pat. No. 10,112,116

METHOD AND SYSTEM FOR DATA COLLECTION USING LARGE-SCALE INTERACTIVE USER RESPONSE

DISNEY ENTERPRISES, INC.,...

1. A method, comprising:receiving, by a processor, a software application for sports player data collection,
receiving, by the processor, user input from a user, wherein the user input relates to a characteristic of a player depicted in a sports broadcast, and
sending, by the processor, the user input to an analysis apparatus,
wherein the analysis apparatus analyzes the user input in combination with a plurality of other user inputs to determine a best guess of the characteristic of the player in a frame, and
wherein the analyzing comprises determining a weighted average of the plurality of inputs.

US Pat. No. 10,112,104

SNOWSHOE WITH MULTI-DENSITY FOAM DECK

Cresent Moon Snowshoes, I...

1. A snowshoe comprising:a deck for providing floatation in snow, said deck having a front portion adjacent a front end of said deck, a back portion adjacent a back end of said deck, and a middle portion between said front portion and said back portion; and
a binding for attaching the deck to a user's footwear;
wherein said deck has a multi-density foam construction including a first layer having a first density and a second layer having a second density different than said first density, and said deck has thickness that is greater in said middle portion than in said front and back portions, said deck having a bottom surface that is continuously curved from said front end to said back end, said bottom surface having a first nonzero curvature at said front portion, a second nonzero curvature at said back portion, and a third nonzero curvature at said middle portion, wherein the third curvature is less than the first and second curvatures.

US Pat. No. 10,112,099

PUTTING TRAINING APPARATUS

1. A putting training apparatus comprising:an elongated planar member including:
a bottom surface;
an top surface; and
an aperture;
wherein said aperture extends from and through said top surface to and through said bottom surface;
wherein said elongated planar member planar member is adapted to lie over a ground surface with said bottom surface in contact with said ground surface;
a putting cup;
wherein said putting cup is installed within said aperture and is adapted to receive a golf ball;
a golf ball;
a golf ball positioning mark;
wherein said golf ball positioning mark is imprinted upon said top surface of the planar member;
a first line;
wherein said first line extends linearly from said golf ball positioning mark to said putting cup forming a putting line; and
wherein said first line includes at least one ball positioning mark imprinted along said putting line;
at least one elongated guiding line;
wherein said at least one elongated guiding line is imprinted linearly upon said top surface of said planar member parallel to said putting line and adjacent to said golf ball positioning mark;
a dome member;
wherein said dome member is adapted to be installed upon said putting cup and adapted to make a sound when said golf ball is received within said putting cup;
a putter member including:
a crown portion;
wherein said crown portion includes a line drawn thereon adapted to be visible by a golfer when in use, such that said line is adapted to be placed substantially parallel to said guiding line when said putter member is properly aligned with said putter line; and
an elongated and thin guiding member including:
a head portion; and
a body portion;
wherein said guiding member is removably coupled to said crown portion of said putter member via said body portion, and said head portion is adapted to point towards said at least one elongated guiding line;
wherein said guiding member is adapted to serve as a visual aid to orient said putter member along said putting line and stroking said golf ball along said guiding line.

US Pat. No. 10,112,084

GOLF CLUB HEAD HAVING A SUPPORT TO LIMIT FACEPLATE DEFORMATION

Karsten Manufacturing Cor...

1. A golf club head comprising:a body including:
a face plate having a strike surface and an opposing interior surface,
wherein a distance between the strike surface and the opposing interior surface of the face plate defines a thickness of the face plate,
and the thickness of the face plate is uniform;
a rear end; and
a sole connecting the face plate with the rear end, wherein the opposing interior surface of the face plate, an interior surface of the rear end, and an interior surface of the sole partially define a cavity; and
an insert positioned within the cavity, the insert comprising:
a first end configured to contact the entire interior surface of the sole;
a second end opposite the first end; and
a front portion configured to face the opposing interior surface of the face plate, the
front portion having:
a first insert surface in contact with the opposing interior surface of the face plate and positioned between the first end and the second end; and
a second insert surface positioned adjacent and offset from the first insert surface;
wherein the second insert surface is spaced apart from the opposing interior surface of the face plate defining a distance between the second insert surface and the opposing interior surface of the face plate; and
wherein the distance between the second insert surface and the opposing interior surface of the face plate ranges from 0.005-0.060 inch.

US Pat. No. 10,112,047

COCHLEAR IMPLANT

The Regents of the Univer...

1. A device for implantation into a scalia tympani of a cochlea that is connected to an auditory nerve with the cochlea having a plane of curvature and including cochlear fluid, said device comprising:a plurality of blocks;
a plurality of compliant elements interconnecting said plurality of blocks with one of said plurality of compliant elements disposed between each pair of adjacent blocks, said plurality of compliant elements for imparting flexibility to said device in the plane of curvature of the cochlea and for imparting stiffness to said device out of the plane of curvature of the cochlea;
a processing unit for processing sound into an electrical signal;
a plurality of electrodes with at least one of said electrodes disposed on each of said blocks, said plurality of electrodes for transmitting the electrical signal to the auditory nerve; and
a plurality of communication lines for transmitting the electrical signal through said device with one of said plurality of communication lines disposed between each of said pair of adjacent blocks and adjacent said compliant element.

US Pat. No. 10,112,035

CATHETER WITH VESSEL LINING AND METHODS FOR USING SAME

Cruzar Medsystems, Inc., ...

1. A method of providing access across a site of obstruction, the method comprising:positioning an inverted, distal portion of a sleeve adjacent to a site of obstruction;
inflating a balloon from a position in which a length of the balloon is situated entirely within a length of a remaining portion of the sleeve such that the balloon moves the distal portion from an inverted position to an everted position so the distal portion extends across the site of obstruction; and
deflating the balloon after eversion so as to provide access across the site of obstruction via a pathway through the sleeve, the pathway extending alongside the deflated balloon, across a juncture between the distal portion and the remaining portion of the sleeve and through a distal end of the distal portion.

US Pat. No. 10,112,031

CATHETER PACKAGED INSIDE OF A HANDLE ATTACHED TO A CONTAINER

1. A catheter assembly comprising:a catheter packaged inside of a handle that is attached to a container;
wherein the catheter has a proximal end portion that is insertable into a urethra and a distal end portion that includes a valve, where the valve includes a valve seat formed inside of the distal end portion of the catheter and a protrusion is located inside the handle and movable relative to the valve;
wherein the handle has a cavity extending between a proximal end portion and a distal end portion of the handle, where the distal end portion of the handle is engaged with the valve seat of the catheter to close the valve of the catheter, and where the container is removable from the proximal end portion of the handle to disengage the distal end portion of the handle from the valve seat of the catheter and to expose the proximal end portion of the catheter; and
wherein a flange is formed on an interior surface of the cavity of the handle, and the flange is sized to engage with the protrusion coupled to the exterior of the distal end portion of the catheter;
wherein the valve of the catheter opens when the protrusion of the catheter contacts the flange.

US Pat. No. 10,111,991

NEGATIVE PRESSURE WOUND THERAPY DEVICE

1. A negative pressure wound therapy system, comprising:a non-woven material configured to be positioned on an appendage, the non-woven material configured to communicate negative pressure to a wound on an appendage;
a gas impermeable flexible housing material configured to be positioned over the non-woven material, the flexible housing material comprising a fold, the fold generally perpendicular to a longitudinal axis of the appendage, and
wherein the flexible housing material comprises a gasket comprising a first portion and a second portion, the gasket configured such that when the flexible housing material is folded back upon itself to surround the wound on the appendage, the first portion of the gasket is adhered to the second portion of the gasket.

US Pat. No. 10,111,910

METHODS FOR TREATING CARDIAC CONDITIONS

MiMedx Group, Inc., Mari...

1. A method for treating injured or diseased cardiac tissue, which method comprises placing an effective amount of a composition comprising dehydrated modified placental tissue proximate to the injured or diseased cardiac tissue without obstructing the function thereof, wherein the dehydrated modified placental tissue is placed to promote treatment of the disease or healing of the injured or diseased cardiac tissue;wherein the modified placental tissue comprises a dehydrated chorion and a dehydrated amnion, said dehydrated amnion having an epithelial cell layer and/or a fibroblast layer, and said dehydrated chorion having a fibroblast layer.

US Pat. No. 10,111,825

OIL-IN-WATER EMULSIONS ENRICHED WITH SALT WHICH ARE HIGHLY VISCOUS AND STABLE OVER TIME

1. A composition (C1) presented in the form of an oil-in-water type emulsion, comprising:from 5 to 55% by weight of an oil phase (P1) comprising at least one oil and optionally at least one wax;
from 0.025% to 3.75% by weight of at least one cross-linked anionic polyelectrolyte (PA), the PA resulting from polymerisation of
partially or completely salified 2-methyl 2-[(1-oxo 2-propenyl) amino] 1-propane sulfonic acid with
at least one neutral monomer selected from the group consisting of: acrylamide, (2-hydroxy ethyl) acrylate, N,N-dialkyl acrylamide, wherein each of the alkyl groups comprises between one and four carbon atoms, and at least one monomer of formula (I):
wherein R represents a linear or branched alkyl radical comprising from eight to twenty carbon atoms and n represents a number greater than or equal to one and less than or equal to twenty,in the presence of at least one cross-linking agent;
from 0.025% to 3.75% by weight of at least one galactomannan (GM) having a degree of substitution (DS) of approximately 1/3; and
from 37.5% to 94.95% by weight of a cosmetically acceptable aqueous phase (P2), said aqueous phase (P2) comprising from 1% to 25% by weight of at least one salt (S) presented in a dissolved form,
wherein for said composition (C1), the weight ratio between the at least one galactomannan (GM) and the cross-linked anionic polyelectrolyte (PA) is greater than or equal to 1/3 and less than or equal to 3/1.

US Pat. No. 10,111,798

METHOD OF FORMING SHEET METAL CASKET SHELL

Batesville Services, Inc....

1. A casket shell precursor from which to fabricate a casket shell, said casket shell precursor comprising a rectangular tube having a pair of opposed side walls and a pair of opposed end walls, said casket shell precursor comprising:a single continuous length of sheet metal having a pair of opposite ends, a planar cross-sectional profile, and configured into said side walls and said end walls,
a rounded corner between adjacent ones of said side walls and said end walls, and
a single weld on one wall of either said side walls or said end walls joining said opposite ends of said single continuous length of sheet metal,
said casket shell precursor sized to contain the remains of a deceased.

US Pat. No. 10,111,766

INTEGRATED STENT REPOSITIONING AND RETRIEVAL LOOP

BOSTON SCIENTIFIC SCIMED,...

1. A stent comprising:a tubular body formed of a plurality of interwoven wires interwoven in a braided pattern, the tubular body having a lumen extending therethrough from a first open end of the tubular body end to a second open end of the tubular body, the tubular body having a length measured from the first open end to the second open end and a circumference;
wherein the plurality of interwoven wires defining the braided pattern of the tubular body includes a first wire interwoven with a second wire, each of the first and second wires extending the length of the tubular body;
wherein the first and second wires are formed into a repositioning and/or retrieval loop at the first open end of the tubular body;
wherein the repositioning and/or retrieval loop comprises a first section formed of the first wire and a second section formed of the second wire, wherein the first section extends circumferentially around a majority of the circumference of the tubular body at the first open end and the second section includes a loop portion extending longitudinally beyond the first open end of the tubular body.

US Pat. No. 10,111,756

MESH SPACER HYBRID

Spineology Inc., St. Pau...

1. An implant for performing an intervertebral fusion on adjacent vertebral bodies in a patient, and for being located entirely in a space between opposing end plates of the adjacent vertebral bodies, the implant comprising:a first intervertebral spacer body, defining a top side oriented to contact a first one of the opposing end plates when the implant is implanted in the space between opposing end plates and an opposing bottom side oriented to contact a second one of the opposing end plates when the implant is implanted in the space between opposing end plates;
a second intervertebral spacer body; and
a porous and expandable enclosed container, the container having a first end and a longitudinally opposing second end,
wherein the first end of the container is coupled to the first intervertebral spacer body and the second end of the container is coupled to the second intervertebral spacer body,
wherein the container is at least partially exposed between the first intervertebral spacer body and the second intervertebral spacer body to the opposing end plates when the implant is implanted in the space between opposing end plates, and
wherein the first intervertebral spacer body defines a non-circular outer perimeter in a cross-section taken perpendicular to its longitudinal axis.

US Pat. No. 10,111,753

ADDITIVE AND SUBTRACTIVE MANUFACTURING PROCESS FOR PRODUCING IMPLANTS WITH HOMOGENEOUS BODY SUBSTANTIALLY FREE OF PORES AND INCLUSIONS

Titan Spine, Inc., Mequo...

1. A method for producing an implant substantially free of pores and inclusions and having one or more bioactive surfaces, comprising:(a) melting a metal source material to form a molten metal;
(b) depositing the molten metal onto a substrate to form a layer of the implant;
(c) depositing the molten metal onto the previously formed layer of the implant to form the next layer of the implant, wherein depositing the molten metal according to this step partially melts the previously formed layer onto which the molten metal is deposited, thereby producing a substantially homogenous and substantially unitary crystal structure between the previously formed layer and the next layer;
(d) repeating step (c) until the implant is completed;
(e) optionally, partially remelting one or more surfaces of the implant to smooth the one or more surfaces;
(f) etching or partially melting one or more surfaces of the implant to form macro structures and micro structures in the one or more surfaces; and
(g) after step (f), etching the one or more surfaces of the implant to form nano structures in the one or more surfaces, thereby producing an implant substantially free of pores and inclusions and having one or more bioactive surfaces, with the proviso that the method does not include remelting or compression of the implant to homogenize the layers.

US Pat. No. 10,111,749

PROSTHETIC VALVE WITH FLOW DIRECTOR

Medtronic Vascular, Inc.,...

1. A prosthetic valve having an inflow end opposite an outflow end, the prosthetic valve comprising:a stent frame defining a lumen;
a valve structure disposed within the lumen and configured to define an inflow side and an outflow side opposite the inflow side;
wherein an outflow track is established within the lumen downstream of the outflow side and along which fluid flow from the valve structure progresses; and
a baffle structure connected to the stent frame downstream of the outflow side; wherein the baffle structure further includes a plurality of baffle members each projecting into the lumen.

US Pat. No. 10,111,738

POLYHYDROXYALKANOATE MEDICAL TEXTILES AND FIBERS

Tepha, Inc., Lexington, ...

1. A knitted mesh comprising oriented polymeric monofilament fibers, wherein the polymer consists of P4HB homopolymer and wherein the fibers are produced by a method comprising drying the polymer, extruding the polymer at a temperature between 100° C. and 220° C., allowing the polymer time to crystallize, and then drawing the polymer to stretch ratios from 6 to 11× at a temperature above the polymer's glass transition temperature.

US Pat. No. 10,111,729

NIGHT TIME ORTHODONTICS

OrthoAccel Technologies, ...

1. A method of orthodontic remodeling, said method comprising treating a patient with malocclusions with aligner trays that apply orthodontic forces to said patient to correct said malocclusions, wherein said patient wears said aligner trays only at night throughout the treatment plan and combines said wearing with 1-20? per night of micropulse vibration, said micropulse vibration shown to speed orthodontic remodeling by 50% as compared with a similar patient not using said micropulse vibration.

US Pat. No. 10,111,727

SURGICAL SPECIMEN MARKING MECHANISM

DB PATENT HOLDING COMPANY...

1. An apparatus comprising:an endoscopic clip placement tool;
a first marking clip adapted to be attached with the clip placement tool to a first area associated with a specimen mass, the specimen mass having an outer margin that defines the shape of the specimen mass;
a second marking clip adapted to be attached to a second area associated with tissue surrounding the specimen mass and outside the margin; and
wherein the first area and the second area are located on direct opposite sides of the margin, such that the first marking clip and the second marking clip identify the orientation of the specimen mass relative to the tissue surrounding the specimen mass.

US Pat. No. 10,111,708

SYSTEM AND METHOD FOR LOCATING AND IDENTIFYING THE FUNCTIONAL NERVES INNERVATING THE WALL OF ARTERIES AND CATHETERS FOR SAME

SYMAP MEDICAL (SUZHOU), L...

1. A method of mapping a parasympathetic renal nerve, comprising the steps of:a) introducing a catheter into the lumen of a renal artery such that a tip of said catheter contacts a site on an inner wall of said renal artery;
b) measuring one or more physiological parameters to obtain baseline measurements before introducing an electrical current to the site, said physiological parameters are selected from the group consisting of systolic blood pressure, diastolic blood pressure, mean arterial pressure, and heart rate;
c) applying electrical stimulation by introducing said electrical current to the site via the catheter, wherein said electrical current is controlled to be sufficient to elicit changes in said physiological parameters when there is an underlying parasympathetic nerve at the site; and
d) measuring said physiological parameters at a specific time interval after each electrical stimulation, wherein a decrease of said physiological parameters below the baseline measurements after said electrical stimulation would indicate that a parasympathetic renal nerve has been mapped at said site.

US Pat. No. 10,111,696

IMPLANT

DEPUY SYNTHES PRODUCTS, I...

1. An assembly for implantation in a patient comprising:an implant comprising:
a rear end for manipulating the implant;
a front end comprising an uncured layer of a polymerizable and/or cross-linkable material, the uncured layer being configured to contact a surface of a bone and adhere the implant to the surface of the bone, wherein the front end is substantially flat and does not include an opening;
a cylindrical core extending from the rear end of the implant to the front end of the implant;
a section of said cylindrical core made of a rigid transparent polymer adjacent to the front end configured to transmit visible and/or UV light from the rear end of the implant to the front end of the implant; and
a bone plate comprising a plurality of plate holes, each plate hole having an internal thread,
wherein said implant is a fixation element for attaching the bone plate to the bone without the implant penetrating further than a cortical layer of the bone, the fixation element including a rear side at said rear end, one or more lateral sides, a front side at said front end for insertion into one of said plate holes, and an external thread on the cylindrical core extending from said rear side to said front side for engaging with the internal thread of said one of said plate holes, said front side being provided with said uncured layer of the polymerizable and/or cross-linkable material,
wherein the assembly is configured to be attached to the bone without the bone being penetrated further than the cortical layer of the bone.

US Pat. No. 10,111,693

ORTHOPEDIC EXTERNAL COMPRESSION PLATE

1. An orthopedic locking plate unit for connecting and compressing fractured bone without direct contact and friction between the locking plate unit and the fractured bone, wherein the locking plating plate unit comprises:a locking plate, an external apparatus and a holder, the locking plate including a plurality of circular locking holes and at least one elongated hole, the at least one elongated hole provided on at least one side of the locking plate, and the holder being placed at the at least one elongated hole;
wherein said holder is configured to hold the locking plate above the fractured bone for enabling movement of the locking plate in a horizontal direction;
wherein said holder is in a dumbbell shape and comprises a hole throughout a length of the holder at a centre thereof for receiving a drill bit or tap and a longitudinal slit throughout a radius at an outer surface thereof for facilitating press fit and release; and
wherein the external apparatus includes a compression unit, a fixing unit and a box.

US Pat. No. 10,111,676

LOOPED CLOT RETRIEVER WIRE

COOK MEDICAL TECHNOLOGIES...

1. A clot retrieval system comprising:an elongated sheath having a lumen disposed therein, the lumen having an inner diameter;
a wire assembly disposed within the elongated sheath, the wire assembly comprising a straight section and a curved section, a distal end of the straight section connected to a proximal end of the curved section, the curved section being comprised of a first wire segment extending distally from the proximal end of the curved section and biased to curve in a first circumferential direction, a second wire segment extending distally from the proximal end of the curved section and biased to curve in a second circumferential direction opposite the first circumferential direction, the first wire segment and second wire segment forming a first loop having a first loop proximal end and a first loop distal end, the first wire segment being connected to the second wire segment at the first loop proximal end and the first loop distal end to prevent the first wire segment from moving relative to the second wire segment, a third wire segment extending distally from the first loop distal end and biased to curve in the first circumferential direction, a fourth wire segment extending distally from the first loop distal end and biased to curve in the second circumferential direction, the third wire segment and fourth wire segment forming a second loop having a second loop proximal end and a second loop distal end, the third wire segment being connected to the fourth wire segment at the second loop proximal end and the second loop distal end to prevent the third wire segment from moving relative to the fourth wire segment, wherein the second loop proximal end is connected to and extends from the first loop distal end, and a side view of the first loop and the second loop is arc-shaped;
an elastic membrane secured to the third wire segment and the fourth wire segment and not secured to the first wire segment or second wire segment, the membrane bridging the second loop and configured to collect clot material; and
a mesh comprised of a plurality of woven filaments secured to the first wire segment and the second wire segment and not secured to the third wire segment or the fourth wire segment, the mesh bridging the first loop and configured to break up a clot into smaller pieces;
wherein the curved section of the wire assembly is disposed on only one side of an axis defined by the straight section of the wire assembly.

US Pat. No. 10,111,664

CLOSURE SYSTEM AND METHODS OF USE

INTEGRATED VASCULAR SYSTE...

1. A closure component configured to cooperate with tissue and be delivered from an elongate member, the closure component comprising:at least two distally extending legs;
a narrow region proximal the at least two distally extending legs; and
a fastener disposed relative to the at least two distally extending legs with a portion of the fastener extending distally beyond the narrow region in a pre-deployed configuration, the fastener configured to direct opposing legs of the at least two distally extending legs inwardly towards one another;
wherein the closure component has a deployed configuration where the opposing legs of the at least two distally extending legs are directed inwardly towards one another to engage and cooperate with the tissue and a portion of the closure component at the narrow region has fractured under strain to separate the closure component from the elongate member.

US Pat. No. 10,111,650

PEDICLE MOUNTABLE RETRACTOR SYSTEM

Minimal Invasive Technolo...

1. A retractor system comprising:a first tower comprising
a first tube having a screw gripping formation in the form of elastic spring biased parts, for removably mounting the first tower on a first surgical screw;
a centre shaft comprising a transverse formation at a distal end thereof; and
an inner tube having an external thread towards a distal end thereof, and having an external diameter which is less than an inner diameter of the first tube, the inner tube being coaxially receivable in the first tube,
wherein the centre shaft is coaxially receivable in a bore of the first tube with the transverse formation locating in diametrically opposed notches of a head of the screw and wherein the inner tube is coaxially receivable between the centre shaft and the first tube and the external thread cooperates with a complementary internal thread in the first tube to bear onto and lock the transverse formation of the centre shaft in the diametrically opposed notches,
a second tower which is mountable on a second surgical screw;
a link extending between the first and second towers; and
at least a first elongate retractor element for at least one of muscle, tissue and nerve structures and which at least first elongate retractor element is movably mountable on the link.

US Pat. No. 10,111,560

VERTICAL BATHTUB CLOSURE SYSTEMS AND METHODS

Safeway Safety Step, LLC,...

1. A bathtub closure system comprising:(a) a step, the step comprising;
(i) a first side panel,
(ii) a second side panel, and
(iii) an elongated platform defining a cavity, wherein the cavity is configured to facilitate ingress and egress into a bathtub;
(b) a closure, wherein the closure is coupled with the step and cooperates with the step to form a substantially watertight seal when the closure is in a closed position, the closure further comprising a lateral projection dimensioned to engage a cavity defined by the second side panel of the step;
(c) a hinge, the hinge coupling the closure with the first side panel of the step such that the closure is rotatable in a substantially vertical direction about the hinge from the closed positon to an open position; and
(d) a fastener to engage the lateral projection of the closure and the second side panel of the step such that the closure is retained in the closed position further comprising, wherein the fastener is a threaded fastener that is inserted through an aperture defined by the lateral projection.

US Pat. No. 10,111,525

SEAT, IN PARTICULAR AN OFFICE CHAIR

Haworth, Inc., Holland, ...

1. A seat, in particular an office chair, comprising:a seat support for a seating surface;
a backrest support coupled with the seat support, the backrest support comprising two support arms having upper ends connected by a connecting element, the support arms and connecting element defining a central opening;
a backrest cover; and
a flexible shell extending outwardly from the support arms and the connecting element, the flexible shell defining at least a right peripheral side, a left peripheral side, and a top peripheral side, which collectively define a peripheral edge, the flexible shell extending from the support arms and the connecting element in the direction of the seat support, such that the peripheral edge is spaced forwardly from the backrest support in a direction adapted to engage or at least partially surround a user sitting in the seat;
wherein the backrest cover is supported on the peripheral edge of the shell, the backrest cover extending in the manner of a secant relative to the shell, wherein when the cover is loaded in a direction toward the flexible shell, a bending of at least a portion of the flexible shell is altered and at least one of the lateral sides of the shell bends toward the seating surface.

US Pat. No. 10,111,482

COOLING ASSEMBLY

NIKE, Inc., Beaverton, O...

1. A cooling assembly, comprising:one or more panels affixed together to form the cooling assembly, at least a portion of the one or more panels comprising an exterior material layer, an interior material layer, and an absorbent material layer maintained between the exterior material layer and the interior material layer, wherein:
the cooling assembly is configured to at least partially cover a head area of a user when the cooling assembly is worn, and
the one or more panels circumscribe a right ear opening and a left ear opening, wherein each of the right ear opening and the left ear opening extend through the exterior material layer, the interior material layer, and the absorbent material layer.

US Pat. No. 10,111,474

SPORTMAN'S GARMENT WITH VOLUME REDUCTION ARRANGEMENT

Under Armour, Inc., Balt...

1. A garment configured to be worn by a human, the garment comprising:a torso portion including an inner side and an outer side; and
a volume reduction arrangement provided on the torso portion, the volume reduction arrangement including a first strap, a second strap, a first strap adjustment member, and a second strap adjustment member, wherein the first strap is a first elastic cord, the first strap adjustment member is a first cord lock, the second strap is a second elastic cord, and the second strap adjustment member is a second cord lock, and wherein:
a first portion of the first strap is connected to a left side of the torso portion,
the first strap adjustment member is connected to a right side of the torso portion, and a second portion of the first strap engages the first strap adjustment member on the right side of the torso portion,
a first portion of the second strap is connected to the right side of the torso portion,
the second strap adjustment member is connected to the left side of the torso portion, and a second portion of the second strap engages the second strap adjustment member on the left side of the torso portion, and
the first strap crisscrosses the second strap on a lower portion of the torso portion adjacent a waist region of a wearer when worn.

US Pat. No. 10,111,405

VIDEOS FOR PETS AND METHODS FOR THE CREATION THEREOF

1. A method for creating a video for pets, comprising:creating visual content for the video; and
creating auditory content for the video, wherein the auditory content comprises:
a musical arrangement that has a relaxing effect on dogs, the musical arrangement characterized by a tempo in the range of 50 to 70 beats per minute (BPM), and
one or more sounds that have a stimulating effect on dogs.

US Pat. No. 10,111,378

ELECTRIC LAWN MOWER CONTROL APPARATUS

HONDA MOTOR CO., LTD., T...

1. An apparatus for controlling operation of a walk-behind electric lawn mower equipped with,a frame configured to be movable over a lawn growth area by a user by hand from behind;
an electric motor mounted on the frame;
a blade cutter provided at an underneath surface of the frame to be connected to the electric motor and configured to cut grass on the lawn growth area when driven by the electric motor;
a rechargeable battery mounted on the frame to be connected to the electric motor and configured to discharge electric power so as to apply to the electric motor as operating electric power and to be charged by a regenerative electric current that is generated by the electric motor during regenerative braking of rotation of the blade cutter;
a motor driver circuit configured to adjust supply of the operating electric power to the electric motor, and
a control unit configured to control operation of the motor driver circuit;
the improvement comprises
a first switching element disposed in a current path connecting the rechargeable battery and the electric motor to allow passage of charge current from the electric motor to the rechargeable battery when turned ON and block the passage of the charging current when turned OFF;
a resistor interposed in the current path;
a second switching element interposed in the current path in series with the resistor to allow the passage of the charge current from the electric motor to the resistor when turned ON and block the passage of the charge current when turned OFF;
a rechargeable battery temperature detector configured to produce an output indicating a temperature of the rechargeable battery; and
an internal circuit voltage detector configured to produce an output indicating an internal voltage of the motor driver circuit;
wherein the control unit configured to control ON/OFF of the first and second switching elements based on the outputs of the rechargeable battery temperature detector and the internal circuit voltage detector.

US Pat. No. 10,111,376

SEED DEPTH AUTO-LEARN SYSTEM ASSOCIATED WITH A SEED DEPTH DEVICE FOR AN AGRICULTURAL PLANTER

STEERING SOLUTIONS IP HOL...

1. A seed depth device for an agricultural planter comprising:an electric motor;
an actuator driven by the electric motor and constructed and arranged to move between a home position and a full extension position;
a first stop proximate to the actuator when in the home position;
at least one controller including a computing processor and a computer readable storage medium configured to control the electric motor; and
a seed depth auto-learn system at least in-part stored and executed by the at least one controller, the seed depth auto-learn system configured to learn the home position based at least in-part on the actuator stalling upon the first stop, wherein the seed depth auto-learn system includes a positive direction stall module configured to;
initiate a first positive motion of the seed depth device in a positive direction for a predetermined first distance,
determine if the seed depth device is stalled,
initiate a second positive motion in the positive direction for a predetermined second distance if not stalled,
determine if the seed depth device is stalled, and
record an unverified home position after the seed depth device has stalled.
US Pat. No. 10,112,879

PROCESS TO MANUFACTURE 2-CHLORO-1,1,1,2-TETRAFLUOROPROPANE (HCFC-244BB)

HONEYWELL INTERNATIONAL I...

1. A process for the production of 2-chloro-1,1,1,2-tetrafluoropropane which comprises reacting 2-chloro-3,3,3,-trifluoropropene with hydrogen fluoride, in a liquid phase reaction in the presence of hydrogen chloride and a liquid phase fluorination catalyst, wherein the hydrogen chloride is added into the reaction from an external source at a pressure of about 100 psig or more.
US Pat. No. 10,111,870

METHOD FOR INDUCING A SUSTAINED IMMUNE RESPONSE

1. A method for treating or preventing viral infections chosen from the group consisting of molluscum contagiosum infection, HTLV infection, HTLV-1 infection, hepatitis-A, HCV, HBV, HIV/AIDS infection, human papilloma virus infection, viral dysentery, flu, measles, rubella, chickenpox, mumps, polio, rabies, mononucleosis, ebola, respiratory syncytial virus, dengue fever, yellow fever, lassa fever, arena virus, bunyavirus, filovirus, flavivirus, hantavirus, rotavirus, viral meningitis, west Nile fever, arbovirus, parainfluenza, smallpox, Epstein-Barr virus, dengue hemorrhagic fever, cytomegalovirus, infant cytomegalic virus, progressive multifocal leukoencephalopathy, viral gastroenteritis, a hepatitis, meningitis, encephalitis, shingles, encephalitis, california serogroup viral, St. Louis encephalitis, rift valley fever, hand, foot, and mouth disease, hendra virus, enteroviruses, astrovirus, adenoviruses, Japanese encephalitis, lymphocytic choriomeningitis, roseola infantum, sandfly fever, SARS, warts, cat scratch disease, slap-cheek syndrome, orf, pityriasis rosea and lyssavirus in a mammal comprising administering to a patient in need thereof an immediate release pharmaceutical composition comprising between about 0.01 mg and about 10.0 mg of naltrexone or a pharmaceutically acceptable salt thereof wherein said immediate release pharmaceutical composition is to be administered alone or in combination with one or more antiviral agents.
US Pat. No. 10,113,166

TREATMENT OF FILAGGRIN (FLG) RELATED DISEASES BY MODULATION OF FLG EXPRESSION AND ACTIVITY

CuRNA, Inc., Miami, FL (...

1. A method of upregulating a function of and/or the expression of a Filaggrin (FLG) polynucleotide in patient cells or tissues in vivo or in vitro comprising:contacting said cells or tissues with at least one single-stranded antisense oligonucleotide of 15 to 25 nucleotides in length or a siRNA oligonucleotide of 19 to 25 nucleotides in length wherein said at least one is 100% complementary with and specifically hybridizes to a 15 to 25 nucleotide region or, in the case of siRNA, to a 19 to 25 nucleotide non-overlapping sequence of SEQ ID NO: 2; thereby upregulating a function of and/or the expression of the Filaggrin (FLG) polynucleotide in patient cells or tissues in vivo or in vitro.
US Pat. No. 10,113,168

RIBOZYME WITH TRNA SYNTHETASE ACTIVITY AND METHODS OF MANUFACTURING AND USING THE SAME

Purdue Reasearch Foundati...

1. An artificial ribozyme comprising:a T-box element comprising a 3?-terminus and a riboswitch element having a specifier loop for binding a cognate tRNA substrate with specificity; and
a flexizyme comprising SEQ ID NO: 2, which defines at least an active site for binding an unnatural amino acid, an acceptor end for base pairing to a terminus of a tRNA substrate, a nucleotide linker, and a P1 stem linked to the 3?-terminus of the T-box element,
wherein when the T-box element recognizes and preferentially binds the cognate tRNA substrate, the flexizyme can bind and aminoacylate the cognate tRNA substrate bound by the T-box element, and the active site of the flexizyme is not specific to a targeted unnatural amino acid.
US Pat. No. 10,111,900

?-GLUCAN METHODS AND COMPOSITIONS THAT AFFECT THE TUMOR MICROENVIRONMENT

BIOTHERA, INC., Eagan, M...

1. A method of treating a subject having cancer, the method comprising administering soluble ?(1,6)-[poly-(1,3)-D-glucopyranosyl]-poly-?(1,3)-D-glucopyranose and an anti-PD-1 antibody.
US Pat. No. 10,111,907

METHODS OF TREATING ISCHEMIA

Fate Therapeutics, Inc., ...

1. A method of increasing stem or progenitor cell homing to an ischemic tissue or a tissue damaged by ischemia, comprising:(a) treating stem or progenitor cells ex vivo with a prostaglandin pathway agonist and a glucocorticoid; and
(b) administering a composition comprising the treated stem or progenitor cells to a subject having an ischemic tissue or a tissue damaged by ischemia.
US Pat. No. 10,111,915

METHOD TO TREAT FATTY LIVER DISEASE USING PARABACTEROIDES GOLDSTEINII

CHANG GUNG BIOTECHNOLOGY ...

1. A method for treating fatty liver disease in a subject on a high fat diet, comprising administering a composition comprising an effective amount of Parabacteroides goldsteinii bacterium, wherein the composition is orally administered to the subject for at least eight weeks.
US Pat. No. 10,111,937

METHOD OF REDUCING ACCUMULATION OF INTRACELLULAR TINGIBLE BODY MACROPHAGES

THE REGENTS OF THE UNIVER...

1. A method of reducing accumulation of intracellular tingible body macrophages comprising:contacting a macrophage having an accumulation of tingible bodies with a human lysosomal phospholipase A2 (LPLA2) derivative having LPLA2 enzymatic activity in an amount effective to reduce the accumulation of tingible body macrophages, wherein the derivative is selected from the group consisting of a LPLA2 of SEQ ID NO:1 comprising one or more mannose residues, a LPLA2 of SEQ ID NO:1 comprising one or more mannose 6-phosphate residues, a fragment of a LPLA2 of SEQ ID NO:1 comprising a length of 50-275 residues with the catalytic active site corresponding to amino acids 196-200 of SEQ ID NO:1, a fragment of a LPLA2 of SEQ ID NO:1 comprising a length of 50-275 residues with amino acid residues Cys65 and Cys89 of SEQ ID NO:1, a LPLA2 of SEQ ID NO:1 with polyethylene glycol, a LPLA2 of SEQ ID NO:1 with polylysine, a LPLA2 of SEQ ID NO:1 with a lipid, a LPLA2 of SEQ ID NO:1 with a steroid, a LPLA2 of SEQ ID NO:1 with a carbohydrate, a LPLA2 of SEQ ID NO:1 with an oligonucleotide and a LPLA2 of SEQ ID NO:1 with an antibody Fc domain.
US Pat. No. 10,111,441

SYNTHESIS OF SILVER-PMMA NANOCOMPOSITE FILM USING HERBAL EXTRACT

KING SAUD UNIVERSITY, Ri...

1. A method for synthesis of a silver-PMMA nanocomposite film, comprising the steps of:dissolving silver nitrate in water to obtain an aqueous solution of silver ions;
extracting buds of Aristolochia bracteolate in water to obtain an aqueous Aristolochia extract;
mixing the aqueous solution of silver ions with the aqueous Aristolochia extract to obtain silver nanoparticles in water;
mixing the silver nanoparticles in water with poly (methyl methacrylate) [PMMA] in an organic solvent at 80° C. to obtain a colloidal solution of a nanocomposite of silver nanoparticles and PMMA;
casting the colloidal solution on a support; and
evaporating the organic solvent at room temperature to obtain a silver-PMMA nanocomposite film;
wherein the step of dissolving silver nitrate in water comprises the step of dissolving silver nitrate in distilled water at 60° C. under continuous stirring.
US Pat. No. 10,112,985

TOLL-LIKE RECEPTORS

Intervet Inc., Madison, ...

1. An immunostimulatory non-methylated phosphorothioate (PTO) oligodeoxynucleotide consisting of the general formula selected from the group consisting of:(i) [tcgN1]n, wherein N1=c or g and n?6 and ?100;
(ii) [N1cgt]n, wherein N1=g or c or a or t and n?6 and ?100;
(iii) [gacgtt]n, wherein n?4 and ?100;
(iv) [gacgatcgtc]n, [SEQ ID NO: 214] wherein n?3 and ?100;
(v) [tcgtcgttttcg]n, [SEQ ID NO: 215] wherein n?3 and ?100,
(vi) [tcgtcgttgtcgttttgtcgtt]n, [SEQ ID NO: 216] wherein n?2 and ?100;
(vii) (tx[ttcgtt]ty)n, wherein n?5 and ?100, x=0-5 and y=0-5;
(viii) [ttcgtN1]n, wherein N1=t or c and wherein n?5 and ?100;
(ix) [N1tcgtc]n, wherein N1=t or c and wherein n?5 and ?100;
(x) [gN1cgtt]n, wherein n?4 and ?100 and N1=a or t; and
(xi) [acga]n, and wherein n?6 and ?100.
US Pat. No. 10,114,290

METHOD FOR ACQUIRING PARAMETER FOR DOSE CORRECTION OF CHARGED PARTICLE BEAM, CHARGED PARTICLE BEAM WRITING METHOD, AND CHARGED PARTICLE BEAM WRITING APPARATUS

NuFlare Technology, Inc.,...

1. A method for acquiring a parameter for correcting a dose of a charged particle beam comprising:writing, using a charged particle beam, a plurality of evaluation patterns on a substrate coated with resist;
writing, under each writing condition while varying writing condition for each of the plurality of evaluation patterns, a peripheral pattern according to a corresponding writing condition on a periphery of any different one of the plurality of evaluation patterns by using a plurality of shots of the charged particle beam, after time that can be disregarded with respect to influence of temperature increase of the resist due to writing of an evaluation pattern concerned of the plurality of evaluation patterns has passed;
measuring, under the each writing condition, a width dimension of the evaluation pattern concerned, on whose periphery the peripheral pattern has been written;
calculating, under the each writing condition, a backscatter dose reaching the evaluation pattern concerned from each shot of the plurality of shots;
calculating, under the each writing condition, a temperature increase amount of the evaluation pattern concerned, which is increased due to heat transferred from at least one shot previous to a shot concerned in the plurality of shots, at each shot time of the plurality of shots; and
calculating a correlation parameter for defining a correlation among a width dimension change amount of the evaluation pattern concerned, the temperature increase amount of the evaluation pattern concerned, and the backscatter dose reaching to the evaluation pattern concerned, by using a width dimension of the evaluation pattern concerned under the each writing condition, the temperature increase amount of the evaluation pattern concerned at the each shot time under the each writing condition, and the backscatter dose reaching the evaluation pattern concerned from the each shot under the each writing condition, and outputting the correlation parameter.
US Pat. No. 10,113,010

METHOD FOR ISOLATING CARBOHYDRATE ALKYLCARBAMATES

CREASEARCH BVBA, Tienen ...

1. A method for isolating a carbohydrate alkylcarbamate from a composition containing a solution of said alkylcarbamate dissolved in a first solvent which does not contain groups that are reactive with a carbohydrate, isocyanate or carbohydrate alkylcarbamate or for preparing a product comprising the carbohydrate alkylcarbamate, the method comprising the following steps:a) adding a second solvent to the composition containing the solution of the carbohydrate alkylcarbamate, the second solvent having the following properties:
the second solvent forms a solution with a mixture of the first solvent and carbohydrate alkylcarbamate, the second solvent forms a solution with the carbohydrate alkylcarbamate, and the second solvent has a boiling point that is at least 5° C. higher than the boiling point of the first solvent, wherein the first solvent is a polar solvent, and
b) removing the first solvent in a removing step, the removing step consisting of removing the first solvent from the composition obtained in step a) by applying a reduced pressure, the resulting composition containing less than 5% (v/v) of the first solvent.
US Pat. No. 10,113,266

TREATMENT OF FILAMENTS OR YARN

E I DU PONT DE NEMOURS AN...

1. A method for treating a filament or yarn comprising:(a) forming a first mixture of reagents comprising first multi-functional isocyanate oligomers and first multi-functional epoxy oligomers, wherein the ratio of total isocyanate groups to total epoxy groups in the first mixture is in the range of from 0.8 to 1.2,
(b) dipping a filament or yarn into the first mixture of reagents,
(c) removing solvent from the dipped filament or yarn,
(d) dipping the filament or yarn from step (c) into a catalyst whereby the first isocyanate oligomers and the first epoxy oligomers form a network on the surface of the filament or yarn,
(e) forming a second mixture of reagents comprising second multi-functional isocyanate oligomers and second multi-functional epoxy oligomers, wherein the ratio of total isocyanate groups to total epoxy groups in the second mixture is in the range of from 0.8 to 1.2,
(f) dipping the filament or yarn of step (d) into the second mixture of reagents, and
(g) dipping the filament or yarn from step (f) into a catalyst whereby the second isocyanate oligomers and the second epoxy oligomers react to crosslink and form a network on the outer surface of the network formed by the first epoxy and first isocyanate oligomers of step (d), with the proviso that the double bonds present in the second epoxy and second isocyanate oligomers do not participate in the crosslinking reaction.
US Pat. No. 10,113,035

CURABLE POLYSILSESQUIOXANE COMPOUND, PRODUCTION METHOD THEREFOR, CURABLE COMPOSITION, CURED PRODUCT AND USE METHOD OF CURABLE COMPOSITION

LINTEC CORPORATION, Toky...

1. A method for producing a curable polysilsesquioxane compound comprising one structural unit or two or more structural units represented by R1SiO3/2,the curable polysilsesquioxane compound having a 29Si nuclear magnetic resonance spectrum that
has a first peak top within a range of ?60 ppm or more and less than ?54 ppm, and
has a second peak top within a range of ?70 ppm or more and less than ?61 ppm, and
a peak is not observed within the range of ?53 ppm or more and less than ?45 ppm, or, the ratio of the integral value of the peak within the range of ?53 ppm or more and less than ?45 ppm to the integral value of the peak within the range of ?60 ppm or more and less than ?54 ppm is less than 0.5% in the 29Si nuclear magnetic resonance spectrum,
the method comprising a step (I) that subjects one compound or two or more compounds represented by a formula (1) to polycondensation in the presence of an acid catalyst, and
R1Si(OR2)3  (1)
a step (II) that adds an organic solvent to a reaction mixture obtained by the step (I) to dissolve a polycondensate of the compound represented by the formula (1) to obtain a solution, adds a base to the solution in a molar equivalent equal to or larger than that of the acid catalyst, and then effects polycondensation,
wherein R1 is an alkyl group having 1 to 10 carbon atoms, and R2 is a hydrogen atom or an alkyl group having 1 to 10 carbon atoms, provided that a plurality of R2 are either identical to or different from each other.
US Pat. No. 10,113,060

BIOBASED RUBBER MODIFIED BIODEGRADABLE POLYMER BLENDS

CJ Cheiljedang Corporatio...

1. A composition, comprising a biodegradable branched polymer blend formed by reactive blending of:a. polylactic acid (PLA); and
b. a biodegradable polyhydroxyalkanoate (PHA) polymer having a glass transition temperature (Tg) of between ?5° C. and ?50° C. and a weight average molecular weight from 500,000 Daltons to 2,000,000 Daltons, wherein the PHA polymer is a copolymer of:
3-hydroxybutyrate and 4-hydroxybutyrate, wherein the content of 4-hydroxybutyrate in the PHA polymer is from about 25% to about 85% by weight of the PHA polymer;
wherein the copolymer of 3-hydroxybutyrate and 4-hydroxybutyrate is the sole PHA polymer in the polymer blend,
wherein the content of the PHA polymer in the biodegradable branched polymer blend is between about 3% and about 40% by weight of the blend, and
wherein the renewable carbon content of the biodegradable branched polymer blend is at least 95% by weight of the blend,
wherein the biodegradable branched polymer blend was formed by reactive blending of the PLA and the PHA polymer with a branching agent.
US Pat. No. 10,113,111

TREATED FILLERS AND USES THEREOF

Dow Silicones Corporation...

1. A condensation curable silicone composition comprising:a condensation curable polyorganosiloxane; and
treated particles comprising a particulate solid having an effective amount of nitrogen-containing superbase disposed thereon;
wherein the effective amount of nitrogen-containing superbase disposed on the particulate solid is sufficient to neutralize a substantial number of a plurality of acidic sites on the particulate solid and a substantial number of the acidic sites on the particulate solid are neutralized with the disposed nitrogen-containing superbase.

US Pat. No. 10,117,196

DYNAMICALLY CONFIGURABLE APPARATUS FOR OPERATING WITHIN THE CURRENT CAPABILITIES OF THE POWER SOURCE

QUALCOMM Incorporated, S...

1. An apparatus, comprising:a load including a processor having a plurality of cores;
a power management circuit configured to manage power supplied by a power source to the load and provide to the load one or more parameters relating to the power source, the one or more parameters comprising instantaneous peak current drawn from the power source and a voltage indicator responsive to voltage supplied by the power source to the load; and
a power monitor circuit including:
a current detector coupled to the power source;
a voltage detector coupled to the power source; and
a memory coupled to the current detector and the voltage detector, wherein the power monitor circuit generates the instantaneous peak current value and stores the instantaneous peak current value in the memory and wherein the power monitor circuit generates the voltage indicator, the voltage indicator comprising an interrupt, and
wherein the load is dynamically configurable to operate within a current capability of the power source based on the one or more parameters and to apply one or more current limiting schemes to operate within the current capability of the power source, based on a type of the power source coupled to the power management circuit.

US Pat. No. 10,117,185

CONTENT-AWARE ENERGY SAVINGS FOR VIDEO STREAMING AND PLAYBACK ON MOBILE DEVICES

FutureWei Technologies, I...

1. A computer-implemented method for reducing power consumption of a mobile device, comprising:detecting video content to be viewed in an application executed by the mobile device;
detecting unwanted content associated with the video content; and
operating the mobile device in a low-power mode during playback of the video content in the application in response to detecting the unwanted content, wherein operating the mobile device in the low-power mode comprises at least one of using Dynamic Voltage and Frequency Scaling (DVFS) to adjust power consumption of a processor included in the mobile device, reducing the resolution of a display device included in the mobile device, or reducing a brightness level of the display device.

US Pat. No. 10,117,122

TELECOMMUNICATIONS APPARATUS AND METHODS

SONY CORPORATION, Tokyo ...

1. A terminal device configured to operate in a wireless network configured to support communications with terminal devices using a primary component carrier operating on radio resources within a first frequency band and a secondary component carrier operating on radio resources within a second frequency band, wherein the wireless network supports a connected mode of operation in which terminal devices receive user-plane data from the wireless network using the primary and/or secondary component carrier and an idle mode of operation in which terminal devices do not receive user-plane data from the wireless network, the terminal device comprising:circuitry configured to
receive first Radio Resource Control (RRC) signaling transmitted from the wireless network to the terminal device over the radio resources within the first frequency band, the first RRC signaling indicating a measurement configuration for making measurements of radio channel conditions for radio resources within the second frequency band, wherein the first frequency band is a licensed frequency band in the wireless network and the second frequency band is an unlicensed frequency band in the wireless network;
identify the measurement configuration for making the measurements of radio channel conditions for radio resources within the second frequency band based on the first RRC signaling received from the wireless network, wherein the measurement configuration relates to at least measuring a signal strength received by the terminal device on the radio resources within the second frequency band;
measure radio channel conditions for radio resources within the second frequency band in accordance with the measurement configuration;
determine if the measurement of the signal strength comprising measurement of radio channel conditions meets a trigger criterion, and each time the trigger criterion is met, transmitting a measurement report to the network infrastructure equipment indicating that the trigger criterion has been met.

US Pat. No. 10,117,118

SIGNAL AMPLIFIERS THAT SWITCH TO AN ATTENUATED OR ALTERNATE COMMUNICATIONS PATH IN RESPONSE TO A POWER INTERRUPTION

CommScope, Inc. of North ...

1. A bi-directional RF signal amplifier, comprising:an RF input port;
a power divider network having a plurality of active RF output ports;
an active communications path connecting said RF input port to said power divider network, said active communications path including a power amplifier to amplify a downstream signal passing along said active communications path;
a passive RF output port, separate from said power divider network;
a passive communications path connecting said RF input port to said passive RF output port, wherein said passive communications path has no power amplifier and does not pass through said power divider network;
a switching device having an input that is coupled to said RF input port, a first output and a second output, wherein said first output of said switching device is directly coupled to an input of said power amplifier; and
an attenuator, wherein said second output of said switching device is connected to said attenuator.

US Pat. No. 10,117,113

BEAMFORMING APPARATUSES, METHODS AND COMPUTER PROGRAMS FOR A BASE STATION TRANSCEIVER AND A MOBILE TRANSCEIVER

Alcatel Lucent, Boulogne...

1. An apparatus operable in a base station transceiver of a mobile communication system, the apparatus comprising:a transceiver module comprising interfaces to a plurality of antennas and operable to:
subdivide the plurality of antennas in a plurality of subgroups using the interfaces, and
form a first beam pattern using one or more antennas of a subgroup,
wherein the transceiver module is operable to use analog beamforming to form the first beam pattern; and
a control module operable to:
transmit a synchronization signal using the transceiver module and the first beam pattern,
receive a random access preamble signal from a mobile transceiver using the first beam pattern,
transmit a random access response to the mobile transceiver using the first beam pattern,
receive a pilot signal as a response signal after transmission of the synchronization signal from the mobile transceiver using the transceiver module,
determine a second beam pattern based on the response signal from the mobile transceiver, the second beam pattern having a higher antenna gain than the first beam pattern, and
transmit a subsequent signal to the mobile transceiver using the second beam pattern and the transceiver module;
wherein the base station transceiver scans for the random access preamble in parallel in each subsector, and if the random access preamble is detected on one or more of the multiple subsectors, then the base station transceiver selects the subsector with the strongest random access preamble-signal and transmits the random access response in this subsector.

US Pat. No. 10,117,097

SHORT-RANGE CROSS-DEVICE AUTHORIZATION

United Services Automobil...

1. A computer-implemented method performed by a first computing device, the method comprising:receiving, by the first computing device, one or more identification (ID) signals transmitted from one or more second computing devices over a wireless network, each of the one or more ID signals identifying a respective second computing device that is authorized to access a remote service;
presenting, by the first computing device, a user interface (UI) that identifies the one or more second computing devices transmitting the one or more ID signals;
receiving, by the first computing device, a selection of a second computing device through the UI and, in response to the selection, transmitting a request for an authorization token, the request transmitted from the first computing device to the second computing device over the wireless network;
receiving, by the first computing device, the authorization token that is sent to the first computing device in response to a confirmation, provided through a second UI executing on the second computing device, that the first computing device is to be granted authorization to access the remote service; and
transmitting, by the first computing device, the authorization token to the remote service to indicate that the first computing device is authorized to access the remote service.

US Pat. No. 10,117,093

CONTROL OF USER EQUIPMENT IDENTITY DEPENDENT SERVICE

Telefonaktiebolaget LM Er...

1. A method, performed in an identity mediator node, of controlling a user equipment (UE) identity (ID) dependent service for a UE in a radio base station (RBS) of a wireless network, the method comprising:receiving, from a Mobility Management Entity (MME), a UE ID report comprising a permanent UE ID for a particular UE, a serving RBS identity for an RBS serving the particular UE, and a temporary UE ID for the particular UE in relation only to the serving RBS and the MME;
storing, for the particular UE, a record associating the temporary UE ID, the serving RBS identity, and the permanent UE ID; and,
upon receiving an order to activate the UE ID dependent service for the permanent UE ID, retrieving the temporary UE ID and the serving RBS identity from the stored record and sending a request to the serving RBS to activate the UE ID dependent service for the particular UE, wherein the request includes the temporary UE ID for the particular UE.

US Pat. No. 10,117,089

QUALITY OF EXPERIENCE AWARE MULTIMEDIA ADAPTIVE STREAMING

Intel IP Corporation, Sa...

1. A server operable to provide hyper-text transfer protocol (HTTP) adaptive streaming, the server comprising:memory; and a processor coupled to the memory, configured to:
determine a bandwidth available to the server for transmitting HTTP adaptive streaming content to a plurality of clients;
receive HTTP requests from the plurality of clients for representations offered by the server in a manifest file for the HTTP adaptive streaming stored in the memory;
calculate an availability of each representation that is offered in the manifest file for the server, wherein the availability is calculated, at least in part, based on the determined bandwidth; and
communicate the availability of each representation from the server to the plurality of clients as a maximum download rate to each of the plurality of clients, to configure each client to request the representations from the server having a bitrate less than the maximum download rate.

US Pat. No. 10,117,086

SHARING OF PROXIMATE DISCOVERY ANNOUNCEMENTS IN A WIRELESS COMMUNICATIONS NETWORK

QUALCOMM Incorporated, S...

1. A method for a mobile device to share a discovery, comprising:receiving a first announcement from an announcement device, wherein the first announcement is a public announcement associated with at least one of an identity, location, event or service, the identity, location, event or service being associated with the announcement device;
notifying a user of the mobile device of the first announcement;
after the notifying of the user, receiving a share instruction;
generating discovery sharing data based on the received first announcement in response to the share instruction;
transmitting the discovery sharing data to an external server;
receiving an update indicator from the external server indicating that metadata associated with the mobile device has been updated; and
generating a second announcement based on the update indicator.

US Pat. No. 10,117,082

WIRELESS TECHNOLOGY BRIDGING SYSTEM

PAYPAL, INC., San Jose, ...

1. A wireless communication system, comprising:a first wireless subsystem that is configured to receive wireless communications of a first wireless technology type;
a second wireless subsystem that is configured to send wireless communications of a second wireless technology type that are different than the wireless communications of the first wireless technology type; and
a bridging engine that is coupled to each of the first wireless subsystem and the second wireless subsystem, wherein the bridging engine is configured to:
convert a first wireless communication of the first wireless technology type, which was received through the first wireless subsystem, to a first wireless communication of the second wireless technology type; and
provide the first wireless communication of the second wireless technology type to the second wireless subsystem such that the second wireless subsystem sends the first wireless communication of the second wireless technology type to at least a first device.

US Pat. No. 10,117,081

SHORT-RANGE COMMUNICATION DEVICE

Orange, Paris (FR)

1. A communication device configured to communicate with a terminal through a short-range wireless connection, the terminal comprising several functions, each ongoing function of the several functions being able to be executed using a function identifier specific to the ongoing function,wherein the communication device comprises a plurality of interaction devices,
wherein the communication device is configured for:
/a/ detecting an event related to an interaction device of the plurality of interaction devices, the event being associated to a function identifier;
/b/ transmitting a message comprising the function identifier and intended to execute a corresponding function of the terminal;
/c/ receiving, from the terminal, and via local network, an access request linked to the detected event.

US Pat. No. 10,117,063

REAL-TIME LOCATING SYSTEM WITH LIMITED OR NO INFRASTRUCTURE AND METHOD OF USE

1. A locating system, comprising:a central server configured to receive and process data;
a device with a unique first identifier configured to be secured or assigned to a person or asset, the device having one or more sensors configured to immediately and continuously detect a first distance from a plurality of physical structures within a campus, the first distance being wirelessly transmitted as raw data to the central server; wherein the plurality of physical structures and subsequent plurality of structures are selectively recognized between static and moving objects based on intelligent object recognition;
a software installed on the central server and providing a computer implemented drawing of the campus, the computer implemented drawing having a database of floorplans and site plans associated with the campus; and
a unique second identifier incorporated into one of the plurality of physical structures, the unique second identifier configured to be wirelessly sensed by the device and provide the device with a campus information;
wherein the raw data is correlated to the database of floorplans, site plans, first identifier, and campus information, to determine a first location of the device within the campus;
wherein the central server is further configured to i) receive additional raw data from the device, the additional raw data related to subsequent plurality of distances from the subsequent plurality of structures in relation to the first distance within the campus; and ii) correlate the additional raw data to the first location to determine subsequent locations of the device.

US Pat. No. 10,117,053

VEHICLE, SERVER, AND SYSTEM INCLUDING THE SAME

Hyundai Motor Company, S...

1. A server comprising:a receiver configured to receive information, from a first vehicle, indicating that a third vehicle is unable to communicate with the server; and
a transmitter configured to transmit a message, to a second vehicle that is able to sense the third vehicle, indicating that it is unnecessary to transmit information about the third vehicle, in response to the receiver receiving the information indicating that the third vehicle is unable to communicate with the server,
wherein the transmission of the message to the second vehicle prevents information about the third vehicle from being redundantly collected.

US Pat. No. 10,117,033

HEARING PROSTHESIS HAVING AN IMPLANTABLE ACTUATOR SYSTEM

Cochlear Limited, Macqua...

1. An implantable device implantable in a recipient, comprising:a sealed housing;
an actuator assembly positioned in the housing and having at least one element displaceable relative to the housing; and
a displaceable material that is located between an interior wall of the device and a component of the actuator assembly, wherein the component of the actuator assembly is displaceable relative to the interior wall of the device, and wherein the displaceable material is displaced upon movement of at least a portion of the actuator assembly relative to the interior wall of the device, wherein
the device is configured to transfer vibrational energy from inside the housing to outside the housing via a solid transduction medium.

US Pat. No. 10,116,987

FINGERPRINTING MEDIA CONTENT USING HASHING

Sorenson Media, Inc., Dr...

1. A system comprising:non-transitory memory storing instructions; and
data processing hardware in communication with the non-transitory memory and configured to execute the instructions, the executed instructions causing the data processing hardware to perform operations comprising:
receiving an input set of hashed frame fingerprints of an unidentified media item from a media device, the hashed frame fingerprints ordered chronologically by frame number in the input set, and the input set of hashed frame fingerprints comprising a most recent hashed frame fingerprint;
identifying an index number from a hash table that matches the most recent hashed fingerprint and a target frame fingerprint corresponding to the identified index number;
identifying a target block of frame fingerprints corresponding to the target frame fingerprint, the target block of frame fingerprints ordered chronologically sequentially backwards by frame number from the target frame fingerprint;
determining a rank distance corresponding to a distance between the input set of hashed frame fingerprints and the target block of frame fingerprints;
identifying a media item identifier corresponding to the target block of frame fingerprints associated with a shortest rank distance from the input set of hashed frame fingerprints, the identified media item identifier identifying the media item associated with the input set of hashed frame fingerprints; and
sending the identified media item identifier to the media device.

US Pat. No. 10,116,983

SYSTEM AND METHOD FOR MANAGING ADVERTISING IN PROGRAM STREAMS

PRIME RESEARCH ALLIANCE E...

1. A method for managing advertisement opportunities in a network environment, the method comprising:retrieving advertisement parameters for a plurality of advertisements, the advertisement parameters provided by an advertiser;
creating a plurality of substreams by dividing a program stream;
identifying avails that are positioned within each of the plurality of substreams and dividing the avails into one or more subavails, each subavail having viewer characteristics related to a group of viewers of the subavail;
selecting a first subavail from a first substream of the plurality of substreams and a second subavail from a second substream of the plurality of substreams, the viewer characteristics of the first subavail being substantially similar to the viewer characteristics of the second subavail;
grouping the selected subavails, the grouped subavails having viewer characteristics based on the common viewer characteristics of the selected subavails;
correlating the viewer characteristics of the grouped subavails with the advertisement parameters of each of the plurality of advertisements; and
ranking the correlation of each of the plurality of advertisements to select one or more advertisements that are suitable to display in each of the grouped subavails.

US Pat. No. 10,116,897

PHOTOMETRIC STABILIZATION FOR TIME-COMPRESSED VIDEO

Adobe Systems Incorporate...

1. In a digital medium environment to reduce at least some photometric characteristic changes of time-compressed video, a method implemented by a computing device, the method comprising:determining, by the computing device, correspondences of pixels in adjacent frames of a time-compressed video;
determining, by the computing device, photometric transformations between the adjacent frames of the time-compressed video, the photometric transformations describing how photometric characteristics of the correspondences change between the adjacent frames;
computing, by the computing device, a measure of photometric similarity between the adjacent frames based on the photometric characteristics of the correspondences;
computing, by the computing device, filters for smoothing photometric characteristic changes across the time-compressed video as combinations of the determined photometric transformations by combining the determined photometric transformations according to weights indicating that photometric transformations between similar frames of the time-compressed video, as indicated by the measure of photometric similarity, influence the filters more than the photometric transformations between less similar frames; and
generating, by the computing device, digital content comprising photometrically stabilized time-compressed video, in part, by using the computed filters to smooth the photometric characteristic changes.

US Pat. No. 10,116,846

GAZE BASED DIRECTIONAL MICROPHONE

Tobii AB, Danderyd (SE)

1. A system for converting sounds to electrical signals, the system comprising:a gaze tracking device, wherein the gaze tracking device determines a gaze direction of a user;
a microphone; and
a processor configured to:
select a first sound reproduction unit to reproduce sound received by the microphone when the first sound reproduction unit is within the gaze direction of the user and to not select a second sound reproduction unit to reproduce the sound received by the microphone when the second sound reproduction unit is outside the gaze direction of the user; and
select the second sound reproduction unit to reproduce the sound received by the microphone when the second sound reproduction unit is within the gaze direction of the user and to not select the first sound reproduction unit to reproduce the sound received by the microphone when the first sound reproduction unit is outside the gaze direction of the user.

US Pat. No. 10,116,839

METHODS FOR CAMERA MOVEMENT COMPENSATION FOR GESTURE DETECTION AND OBJECT RECOGNITION

Atheer Labs, Inc., Mount...

1. A method, comprising:receiving a video stream comprised of a sequential series of frames from a camera, wherein the video stream is captured at a frame rate;
receiving motion data from a motion sensor that is physically associated with the camera to detect motion of the camera, wherein the motion data is captured at a sampling rate;
associating a first frame of the sequential series of frames with a portion of the motion data that is captured approximately contemporaneously with the first frame, the portion of the motion data indicative of an amount of movement of the camera when the camera captured the first frame;
when the sampling rate is greater than the frame rate, aggregating a first frame sample of the motion data and a second sample of the motion data captured between the first frame of the sequential series of frames and a second frame of the sequential series of frames to obtain an aggregated movement value representative of the motion of the camera when the camera captured the first frame;
comparing the aggregated movement value with a first threshold for the amount of movement of the camera;
when the aggregated movement value does not exceed the first threshold, accepting the first frame from the video stream; and
when the aggregated movement value exceeds the first threshold, rejecting the first frame from the video stream.

US Pat. No. 10,116,790

METHOD, SYSTEM AND APPARATUS FOR COMMUNICATING DATA ASSOCIATED WITH A USER OF A VOICE COMMUNICATION DEVICE

BCE INC., Verdun (CA)

1. A method executable by a server within a communication system, the method comprising:receiving a first identifier associated with a first communication device further to a connection request by the first communication device;
determining a second identifier of a second communication device based on the first identifier;
establishing a connection with the second communication device using the second identifier;
receiving data from the second communication device over the established connection;
identifying a profile for a user of the first communication device based on the received data; and
authenticating the user of the first communication device based on comparison of additional information obtained from the first communication device provided from the user to information contained in the identified profile,
wherein the connection request is for an outbound call, wherein the method further comprises authorizing the outbound call based on at least one of the received data associated and destination information,
wherein the received data comprises a user identifier and the destination information comprises a destination telephone number associated with a destination device; and wherein authorizing the outbound call comprises accessing a database comprising a list of user identifiers with one or more allowed destination telephone numbers corresponding to each user identifier; and confirming that the user of the first device is authorized to place the outbound call to the destination device.

US Pat. No. 10,116,787

ELECTRONIC DEVICE, CONTROL METHOD, AND NON-TRANSITORY STORAGE MEDIUM

Kyocera Corporation, Kyo...

1. An electronic device comprising:a display;
a user interface;
a motion sensor; and
at least one controller that is configured to,
display a lock screen on the display;
detect a user touch operation on the user interface to cancel limitation of operations of the electronic device;
when the detected user touch is a registered finger touch, then display a first screen on the display in place of the lock screen; and
when the detected user touch is a registered thumb touch, then
determine a state of the electronic device based on an output of the motion sensor; and
when the determined state is a state of being held, then display a second screen, which is different from the first screen, in place of the lock screen.

US Pat. No. 10,116,733

SYSTEM AND METHOD FOR COLLECTING FEEDBACK IN A MULTI-TENANT COMMUNICATION PLATFORM

Twilio, Inc., San Franci...

1. A method comprising:a first external application server system receiving first user-provided communication quality feedback from a first telephony communication endpoint system and providing the first user-provided communication quality feedback to a multi-tenant telephony communication platform system;
at the multi-tenant telephony communication platform system:
receiving the first user-provided communication quality feedback from the first external application server system, wherein the first user-provided communication quality feedback relates to a first communication route of a first telephony communication initiated on behalf of a first platform account that is associated with the first external application server system;
storing the first user-provided communication quality feedback in association with information that indicates the first communication route and an account identifier of the first platform account;
receiving second user-provided communication quality feedback from the first external application server system, wherein the second user-provided communication quality feedback relates to a second communication route of a second telephony communication initiated on behalf of the first platform account;
storing the second user-provided communication quality feedback in association with information that indicates the second communication route and the account identifier of the first platform account;
receiving from the first external application server system a RESTful first feedback application programming interface (API) call;
responsive to the RESTful first feedback API call, the platform system providing the first external application server system with feedback information that includes the first user-provided communication quality feedback and the second user-provided communication quality feedback,
wherein the first platform account is one of a plurality of platform accounts of the platform system.

US Pat. No. 10,116,662

ON-DEMAND SECURITY POLICY ACTIVATION

AirWatch LLC, Atlanta, G...

1. A method comprising:receiving, using a first application at a mobile computing device, a user selection of a resource locator, wherein the resource locator comprises a reference to a resource;
determining, using the mobile computing device, whether the selected resource locator is associated with a security policy; and
in response to determining that the resource locator is associated with the security policy:
activating, in the mobile computing device, a profile identified by the security policy, wherein the profile allows access to the resource, referred to by the resource locator and selected using the first application, if the mobile computing device is connected to a Virtual Private Network (VPN) connection;
launching, at the mobile computing device, the VPN connection; and
accessing the resource referred to by the resource locator using the VPN connection.

US Pat. No. 10,116,644

NETWORK ACCESS SESSION DETECTION TO PROVIDE SINGLE-SIGN ON (SSO) FUNCTIONALITY FOR A NETWORK ACCESS CONTROL DEVICE

Pulse Secure, LLC, San J...

1. A method comprising:establishing, with a network access control (NAC) client executing on a client device, a network access session between a user of a network associated with the NAC client and the NAC device;
configuring, with the NAC client, the client device to resolve a hostname to an internet protocol (IP) address in response to establishing the network access session;
listening, with the NAC client, to the IP address;
receiving, with the NAC device, a security assertion request from a user agent executing on the client device, the security assertion request including a request for a security assertion to be made by the NAC device, the security assertion indicating that a user of the user agent has been authenticated by the NAC device;
sending, with the NAC device, a redirect to the user agent in response to receiving the security assertion request, the redirect including a session verification request that includes information indicative of the security assertion request, the redirect message specifying that the redirect message is to be redirected to the hostname;
resolving, with the client device, the hostname to the IP address;
forwarding, with the user agent executing on the client device, the session verification request included in the redirect to the IP address;
sending, with the NAC client, a session verification message to the NAC device in response to receiving the session verification request at the IP address, the session verification message including the information indicative of the security assertion request and session verification information that is indicative of a session that has been established between the user and the NAC device;
sending, with the NAC device, a security assertion responsive to the security assertion request to the NAC client in response to receiving the session verification information from the NAC client; and
forwarding, with the NAC client, the security assertion to the user agent executing on the client device.

US Pat. No. 10,116,631

SYSTEMS AND METHODS FOR MANAGED DATA TRANSFER

Open Text SA ULC, Halifa...

1. A system for managed file transfer, comprising:a server machine operating a managed file transfer server connected, over a network, to a plurality of location servers, the server machine operating the managed file transfer server to:
receive a request to send data to a recipient;
determine a location of the recipient;
determine a location server of the plurality of location servers that is closest to the location of the recipient; and
automatically initiate a server-to-server transfer to move the data to the location server that is closest to the location of the recipient;
wherein the request is received from a first location server operating at a first location, the location server that is closest to the location of the recipient is a second location server operating at a second location, and the server-to-server transfer is automatically initiated by the managed file transfer server to move the data from the first location server to the second location server, each of the first location server and the second location server being a subset of the managed file transfer server, the subset comprising a transfer server and a file server.

US Pat. No. 10,116,619

SYSTEMS AND METHODS FOR PROVISIONING, CONFIGURING, DIAGNOSING, AND MAINTAINING OUT-OF BAND MANAGEMENT OF COMPUTING DEVICES

Connectwise, Inc., Tampa...

1. A method of provisioning an out-of-band system comprising:establishing, by a management engine of a server of a first domain, a network tunnel with a device on a second domain different from the first domain, the network tunnel comprising at least one of a virtual private network (“VPN”) or a secure socket shell (“SSH”) configured to route one or more communication ports of the device for provisioning;
modifying, by the management engine subsequent to establishing the network tunnel, via a dynamic host configuration protocol (“DHCP”) server on the second domain, the second domain to a modified domain including a fixed subdomain of the first domain, the fixed subdomain corresponding to a provisioning engine of the first domain;
receiving, by the provisioning engine from the device via the network tunnel established by the server of the first domain, responsive to the device obtaining the fixed subdomain of the first domain from the DHCP server, a provisioning request to initiate a provisioning cycle comprising at least one of configuring the device, diagnosing the device, or maintaining the device;
transmitting, by the provisioning engine to the device via the network tunnel established by the server of the first domain, a certificate configured with the first domain, the device configured to validate the certificate based on the certificate matching the modified domain obtained from the DHCP server;
reverting, by the management engine, responsive to completion of the provisioning cycle by the device, the modified domain to the second domain; and
terminating, by the management engine, responsive to reverting the modified domain to the second domain and the completion of the provisioning cycle, the network tunnel comprising the at least one of the VPN or the SSH established by the server of the first domain and used to provision the device.

US Pat. No. 10,116,617

SYSTEM ARCHITECTURE FOR DMZ EXTERNAL IP ADDRESSES

CardinalCommerce Corporat...

1. A method for enhancing data security, comprising:with a first demilitarized zone (DMZ) comprising a web server:
receive, via a first firewall, a request for an e-commerce service from a host of an external network;
with a data environment comprising a server:
receive, via a second firewall, a request to offload processing from the first DMZ, wherein the request to offload processing is associated with offloading processing of the request for the e-commerce service from the host of an external network; and
communicate, via the second firewall, a domain name system (DNS) request for a hostname corresponding to the host of the external network to a host of the data environment based on receiving the request to offload processing from the first DMZ;
with a second DMZ comprising a dynamic name service virtual IP gateway (DVG):
receive, via the second firewall, the DNS request for the hostname corresponding to the host of the external network from a host of the data environment;
allocate an internet protocol (IP) address of the second DMZ in response to receiving the DNS request;
determine an IP address of the host of the external network from the hostname by performing a DNS lookup of the hostname corresponding to the host of the external network, wherein determining the IP address of the host of the external network comprises performing the DNS lookup of the hostname corresponding to the host of the external network with a DNS server of the external network;
map the allocated IP address of the second DMZ to the determined IP address of the host of the external network; and
return, via the second firewall, the allocated IP address of the second DMZ to the host of the data environment in response to the DNS request;
with the data environment:
receive, via the second firewall, the allocated IP address of the second DMZ to the host of the data environment in response to the DNS request; and
communicate, via the second firewall, data associated with the request for the e-commerce service to the second DMZ; and
with the second DMZ:
communicate, via a third firewall, data associated with the request for the e-commerce service to the host of the external network after receiving the data associated with the request for the e-commerce service from the host of the data environment.

US Pat. No. 10,116,600

EXPRESSING STATEMENTS IN MESSAGES WITH PERSONALIZED EXPRESSION STYLE

EXCALIBUR IP, LLC, Sunny...

1. A method of expressing a statement to a recipient on behalf of a user on a device having a processor, the method comprising:executing on the processor instructions that cause the device to:
examine an expression set comprising at least one expression authored by the user to identify a phrase that appears in at least one prior expression previously authored by the user and that is relevant to the statement;
compose a message expressing the statement in an expression style of the user by:
selecting a message template associated with the expression style of the user, wherein the message template comprises at least one slot for insertion of content to adapt the message template to the statement; and
inserting the phrase previously authored by the user into the at least one message slot of the message template;
present the message to the user for confirmation; and
responsive to receiving a confirmation of the message from the user, transmit the message to the recipient, transmit the message to the recipient.

US Pat. No. 10,116,599

TOPIC CATEGORIZED INSTANT MESSAGE COMMUNICATION

Cisco Technology, Inc., ...

1. A computer-implemented method comprising:defining, for an online conference session, a plurality of pages based on information received from a moderating participant having administrative privileges for the conference session, each page corresponding to a discussion topic of a text-based communication;
selecting, by a request received from the moderating participant, one of the plurality of pages;
synchronizing the selected page, such that the selected page is displayed to the moderating participant and each of one or more other participants in the online conference session;
after selecting one of the plurality of pages, chronologically displaying, in the display of the selected page, an entirety of the text-based communication that is generated while the selected page remains selected until another page of the plurality of pages is selected; and
receiving, from the moderating participant, commands to manage the online conference session, the commands including a command to add a new page corresponding to a new discussion topic, a command to delete at least one page of the plurality of pages, a command to modify the selected page, a command to search for a specific page of the plurality of pages, and a command to close the selected page.

US Pat. No. 10,116,577

DETECTING PATH MTU MISMATCH AT FIRST-HOP ROUTER

DELL PRODUCTS LP, Round ...

1. A method for correcting path maximum transmission unit (PMTU) size mismatch comprising:receiving, at a routing system of a network, a packet for a new flow from a source host system to a destination host system, the packet comprising an initial packet transmission unit size, a source host system routing identifier, and a destination host system routing identifier;
responsive to the routing system not having a forwarding routing match for the new flow in its routing table, forwarding at least some of the routing information of the packet including the initial packet transmission unit size to a central controller system of the network, the central controller system knowing the network's topology formed by network nodes in the network and maximum transmission unit size information of routing interfaces of the network nodes in the network;
receiving a notification from the central controller system of the network that the initial packet transmission unit size for the new flow is a mismatch with a path maximum transmission unit size of a route in the network, the route determined by the central controller system of the network from among a plurality of potential routes in the network using the information representing the network's topology and the route comprising a plurality of network nodes in the network but does not include the central controller and wherein the path maximum transmission unit size of the route in the network is determined by the central controller of the network using maximum transmission unit size information of routing interfaces of network nodes that form the route in the network; and
notifying the source host system of the mismatch between the initial packet transmission unit size and the path maximum transmission unit of the route in the network determined by the central controller system.

US Pat. No. 10,116,561

PROTOCOL CIRCUIT LAYER

CoCo Communications Corp....

1. A system that enables network communications over circuits defined by a plurality of nodes, wherein adjacent ones of the plurality of nodes are communicatively coupled together via at least one leg, and wherein each of the circuits are defined by a source node and a destination node that are interconnected via a series of the nodes, and wherein each circuit is uniquely identified by a circuit identifier (ID), wherein each node of a circuit is configured to:add to a circuit table at least one circuit that the node is a member of,
wherein the circuit table identifies the at least one circuit by its circuit ID, and
wherein the circuit table includes a tuple that has an identifier of the source node, an identifier of the destination node, an identifier of a source service from the source node, and an identifier of a destination service to the destination node; and
scan a leg table to return an incoming leg and an outgoing leg that are associated with the at least one circuit,
wherein the incoming leg communicatively couples the node with a first adjacent node that is used when the node receives packets from the first adjacent node,
wherein the outgoing leg communicatively couples the node to a second adjacent node that is used when the node communicates packets to the second adjacent node,
wherein the leg table identifies the incoming leg using a first triple that has at least a link ID, a first local leg ID, and a direction that defines an incoming travel direction of packets from the first adjacent node to the node,
wherein the first triple of the leg table is associated with the circuit ID in the circuit table,
wherein the leg table further identifies the outgoing leg using a second triple that has at least the link ID, a second local leg ID, and a direction that defines an outgoing travel direction of packets from the node to the second adjacent node, and
wherein the second triple of the leg table is associated with the circuit ID in the circuit table,
wherein the first adjacent node and the second adjacent node are members of the at least one circuit identified in the circuit table.

US Pat. No. 10,116,526

SYSTEMS AND METHODS FOR PROVIDING A SELF-ELECTING SERVICE

Ivanti, Inc., South Jord...

11. An apparatus, comprising:a processor of a first managed device configured to be included in a plurality of managed devices in a network segment, the processor configured to:
determine an election score for the first managed device using a set of election rules based on a type of a service, the election score for the first managed device indicating a capability of the first managed device to provide the type of the service relative to remaining managed devices from the plurality of managed devices;
send a first multicast message including the election score for the first managed device to a set of managed devices from the plurality of managed devices, such that each managed device from the set of managed devices, in response to receiving the first multicast message, (1) determines an election score for that managed device using the set of election rules, (2) compares the election score for the first managed device with the election score for that managed device, and (3) determines, based on the comparing of the election score for the first managed device and the election score for that managed device, to not provide the service on the network segment;
receiving, at the first managed device, a second multicast message from a second managed device from the plurality of network devices and including an election score for the second managed device;
in response to the receiving, compare the election score for the first managed device with the election score for the second managed device;
elect, based on the comparing of the election score for the first managed device with the election score for the second managed device, to provide the service on the network segment; and
provision the first managed device with the service; and
memory (1) in electronic communication with the processor and (2) storing the set of election rules.

US Pat. No. 10,116,477

PADDING FOR ORTHOGONAL FREQUENCY DIVISION MULTIPLEXING (OFDM) SYMBOLS IN A WIRELESS COMMUNICATION SYSTEM

Marvell World Trade Ltd.,...

1. A method for generating a physical layer (PHY) data unit for transmission via a communication channel, the method comprising:receiving, at a communication device, a set of information bits to be included in a data portion of the PHY data unit;
determining, at the communication device, a boundary within a last orthogonal frequency division multiplexing (OFDM) symbol, the last OFDM symbol among one or more OFDM symbols of the data portion of the PHY data unit;
adding, at the communication device, a number of pre-encoder padding bits to the set of information bits to generate a set of padded information bits, wherein the number of pre-encoder padding bits is determined such that the set of padded information bits, after being encoded, fill the one or more OFDM symbols up to the boundary within the last OFDM symbol;
encoding, at the communication device, the set of padded information bits to generate a set of coded bits;
generating, at the communication device, a PHY preamble to include a subfield that indicates the boundary;
generating, at the communication device, the one or more OFDM symbols to include (i) the set of coded information bits in the one or more OFDM symbols up to the boundary within the last OFDM symbol to allow a receiving device to stop decoding the one or more OFDM symbols at the boundary, and (ii) post-encoder padding bits in the last OFDM symbol following the boundary; and
generating, at the communication device, the PHY data unit to include the PHY preamble and the one or more OFDM symbols of the data portion.

US Pat. No. 10,116,461

CONTROL INFRASTRUCTURE

SYSTECH CORPORATION, San...

1. A system comprising:a script execution module comprising
a compiler that compiles scripts, represented in a base scripting language, into virtual-machine programs, wherein the scripts comprise instructions that reference device properties,
a virtual machine that executes virtual-machine programs, and
a script manager that stores scripts in a script registry, retrieves scripts from the script registry, and loads scripts into the compiler; and
one or more gateways, wherein each of the one or more gateways is communicatively connected to one or more physical devices, and wherein each of the one or more gateways comprises
at least one hardware processor,
one or more drivers, wherein each of the one or more drivers communicates with at least one of the one or more physical devices using a communication protocol to read, write, or read and write device properties of the physical device, and
a device manager that, when executed by the at least one hardware processor, maps device properties referenced in the virtual-machine programs to device properties used by the one or more drivers, according to a mapping.

US Pat. No. 10,116,448

TRANSACTION AUTHORIZATION METHOD AND SYSTEM

Meontrust Inc, (FI)

1. A method for authorizing a transaction, the method comprising the following acts performed by a telecommunications server configured to act as an authentication provider:at least one preparatory phase; and
at least one authorization phase;
wherein the at least one preparatory phase comprises for each of several user accounts:
registering a user account via a user terminal;
registering a plurality of personal devices with the registered user account, wherein registering of a personal device comprises registering an authentication application installed in that personal device;
wherein the authentication application in the registered personal device is configured to:
indicate at least a subset of received transaction-specific details via a user interface;
receive transaction-specific instructions via the user interface; and
digitally sign the transaction-specific instructions by using a cryptographic private key assigned to the user account;
wherein the at least one authorization phase performed by the telecommunications server comprises for each of several transactions related to one of the several user accounts:
receiving knowledge of a transaction relating to a user of a user terminal;
determining, in response to receiving the knowledge, a user account related to the transaction;
receiving a request for details specific to the transaction from at least one personal device;
checking, whether the at least one personal device wherefrom the request is received belongs to the plurality of personal devices registered with the user account determined to relate to the transaction;
providing, in response to the at least one personal device wherefrom the request is received belonging to the plurality of personal devices registered with the user account determined to relate to the transaction, the requested details specific to the transaction to the authentication application in the at least one personal device wherefrom the request for details specific to the transaction were received;
receiving, after the providing, from the authentication application in the at least one personal device a digitally signed transmission which indicates transaction-specific instructions received via the user interface by the authentication application in the at least one personal device; and
authorizing or denying the transaction based on the received transaction-specific instructions.

US Pat. No. 10,116,444

METHOD FOR USING DYNAMIC PUBLIC KEY INFRASTRUCTURE TO SEND AND RECEIVE ENCRYPTED MESSAGES BETWEEN SOFTWARE APPLICATIONS

Synergex Group (corp.), ...

1. A method for using dynamic Public Key Infrastructure to send and receive encrypted messages between software applications comprising:(a) generating a sender's PKI public and private key pair for a sender application and a receiver's PKI public and private key pair for a receiver application, wherein the sender's PKI public and private key pair comprises a sender's public key and a sender's private key and wherein the receiver's PKI public and private key pair comprises a receiver's public key and a receiver's private key, and sharing the sender's public key with the receiver application and the receiver's public key with the sender application;
(b) building a first message with a format of
[IP Address]:[Command]:[Message];
(c) encrypting the first message with the recipient's PKI receiver's public key to produce an encrypted first message;
(d) generating a new sender's PKI public and private key pair, wherein the new sender's PKI public and private key pair comprises a new sender's public key and a new sender's private key;
(e) sending the encrypted first message and the new sender's public key to the receiver application;
(f) decrypting the encrypted first message using the receiver's private key to produce a decrypted first message having a [Command];
(g) validating the [Command] of the decrypted first message to determine if the [Command] of the decrypted first message is a valid [Command] that is known in advance;
(h) if the [Command] of the decrypted first message is determined to not be a valid [Command], black listing an IP address of the sender application, sending a first fraud alert message to a first mobile phone, and sending a first fraud alert email to a first email address;
(i) if the [Command] of the decrypted first message is determined to be a valid [Command], building an acknowledgement message with a format of
[IP Address]:[Command]:[Message];
(j) encrypting the acknowledgement message with the new sender's public key to produce an encrypted acknowledgment message;
(k) generating a new receiver's PKI public and private key pair, wherein the new receiver's PKI public and private key pair comprises a new receiver's public key and a new receiver's private key;
(l) sending the encrypted acknowledgment message and the new receiver's public key to the sender application;
(m) decrypting the encrypted acknowledgment message using the new sender's private key to produce a decrypted acknowledgment message having a [Command];
(n) validating the [Command] of the decrypted acknowledgment message to determine if it is a valid [Command] that is known in advance; and
(o) if the [Command] of the decrypted acknowledgment message is determined to not be a valid [Command], black listing an IP address of the receiver application, sending a second fraud alert message to a second mobile phone, and sending a second fraud alert email to a second email address.

US Pat. No. 10,116,443

PAIRING VERIFICATION IN SUPERSINGULAR ISOGENY-BASED CRYPTOGRAPHIC PROTOCOLS

ISARA Corporation, Water...

1. A supersingular isogeny-based cryptography method, comprising:obtaining a secret integer of a first entity;
obtaining a public key of a second entity, the public key comprising a first image curve and a first pair of elliptic curve points;
obtaining a first pairing value based on a second pair of elliptic curve points defined by a supersingular isogeny-based cryptosystem;
computing, by operation of one or more processors, a second pairing value based on the first pair of elliptic curve points;
validating the public key, wherein validating the public key comprises verifying whether the first pairing value matches the second pairing value;
computing, by operation of one or more processors, a second image curve based on the secret integer and the first pair of elliptic curve points;
computing, by operation of one or more processors, a shared secret value based on the second image curve, wherein the shared secret value is shared by the first entity and the second entity; and
executing a cryptographic correspondence in a communication network between the first entity and the second entity.

US Pat. No. 10,116,440

CRYPTOGRAPHIC KEY MANAGEMENT FOR IMPORTED CRYPTOGRAPHIC KEYS

Amazon Technologies, Inc....

1. A computer-implemented method, comprising:under the control of one or more computer systems of a cryptographic key management service provided by a computing resource service provider, the one or more computer systems configured with executable instructions:
receiving, from a client device, a request to import a customer cryptographic key from the client device;
generating a cryptographic key pair, the cryptographic key pair comprising a public cryptographic key and a private cryptographic key;
utilizing a domain cryptographic key to encrypt the private cryptographic key, resulting in an import key token;
providing the import key token and the public cryptographic key to the client device;
receiving, from the client device, the import key token and an encrypted customer cryptographic key, the encrypted customer cryptographic key being the customer cryptographic key encrypted using the public cryptographic key;
using the domain cryptographic key to decrypt the import key token to obtain the private cryptographic key;
decrypting, using the private cryptographic key, the encrypted customer cryptographic key to obtain the customer cryptographic key;
encrypting, using the domain cryptographic key, the customer cryptographic key to generate an encrypted key token; and
causing one or more cryptographic operations to be performed using the encrypted key token.

US Pat. No. 10,116,405

APPARATUS AND METHOD FOR INTERFERENCE CANCELLATION IN COMMUNICATION SYSTEMS

1. A method, comprising:determining, by a processing system comprising a processor, an interference based on a group of interference signals received at a receiver from a group of transmitters, wherein the determining the interference is based on channel gains that are estimated for the group of transmitters, and wherein a portion of the interference is self-interference generated from transmitting and receiving at a same time; and
determining, by the processing system, whether or not the interference satisfies a threshold range of an analog-to-digital converter of the receiver for each of the group of transmitters,
wherein an analog time domain cancellation is performed responsive to a determination that the interference does not satisfy the threshold range, and
wherein a digital time domain cancellation is performed responsive to a determination that the interference satisfies the threshold range.

US Pat. No. 10,116,397

TEST SEQUENCES USING UNIVERSAL TESTING SYSTEM

Contec, LLC, Schenectady...

1. A testing system for testing a plurality of devices, the testing system comprising:a plurality of test station slots, wherein:
each test station slot of the plurality of test station slots is configured to receive and connect to a corresponding wireless device of a plurality of wireless devices to be tested; and
each test station slot of the plurality of test station slots is configured to use a shared wireless frequency channel for performing one or more wireless tests on each test station slot's corresponding installed wireless device to be tested; and
at least one resource control server, wherein:
the at least one resource control server is configured to lock the shared wireless frequency channel;
a respective test station slot of the plurality of test station slots sends a request to the at least one resource control server for a lock on the respective test station slot's shared wireless frequency channel when the respective test station slot needs to perform a wireless test on the respective test station slot's corresponding installed wireless device to be tested; and
the at least one resource control server is configured to grant the request for the lock on the respective test station slot's shared wireless frequency channel based on a predetermined set of criteria.

US Pat. No. 10,116,374

RECEIVER WITH NON-COHERENT MATCHED FILTER

Aieron LLC, McLean, VA (...

1. A receiver for receiving 1090 MHz Mode S Extended Squitter (“ES”) ADS-B messages comprising:an analog-to-digital converter configured to convert a received analog signal into a digital representation of the received signal;
a carrier detection module configured to determine if a spectral component within a range of 1090 MHz is present within a portion of the digital representation of the received signal;
a cross-correlation module configured to:
calculate, responsive to a determination by the carrier detection module that a spectral component within the range of 1090 MHz is present within the portion of the digital representation of the received signal, a measure of the cross-correlation between the portion of the digital representation of the received signal and a reference signal representing an expected pulse pattern for a specific portion of a 1090 MHz Mode S ES ADS-B message, the calculated measure of the cross-correlation representing a first measure of the likelihood that the digital representation of the received signal includes a 1090 MHz Mode S ES ADS-B message, and
determine if the first measure of the likelihood that the digital representation of the received signal includes a 1090 MHz Mode S ES ADS-B message satisfies a first condition;
a signal estimator module configured to generate, responsive to a determination that the first measure satisfies the first condition, an estimate of a portion of a 1090 MHz Mode S ES ADS-B message potentially included in the digital representation of the received signal corresponding to the portion of the digital representation of the received signal;
a screening module configured to:
generate a feature vector representing n?2 features of the estimate of the portion of the 1090 MHz Mode S ES ADS-B potentially included in the digital representation of the received signal,
project the feature vector into a corresponding n-dimensional feature space,
determine, based on the projection of the feature vector into the feature space, a second measure of the likelihood that the digital representation of the received signal includes a 1090 MHz Mode S ES ADS-B message, and
determine if the second measure of the likelihood that the digital representation of the received signal includes a 1090 MHz Mode S ES ADS-B message satisfies a second condition; and
a non-coherent matched filter configured to recover, responsive to a determination that the second measure satisfies the second condition, a 1090 MHz Mode S ES ADS-B message from the digital representation of the received signal.

US Pat. No. 10,116,368

COMMUNICATION UNIT, INTEGRATED CIRCUIT AND METHOD FOR GENERATING A PLURALITY OF SECTORED BEAMS

Analog Devices Global, H...

1. A communication unit for generating a plurality of sectored beams, the communication unit comprising:a plurality of antenna element feeds arranged to couple to a plurality of antenna elements of an antenna array, wherein an individual antenna element feed of the plurality of antenna element feeds is configured to provide a transmit signal associated with two sectors;
a plurality of transmitters operably coupled to the plurality of antenna element feeds; wherein a transmitter of the plurality of transmitters is configured to receive a first signal associated with a first sector and a second signal associated with a second sector, the two sectors comprising the first sector and the second sector, and the transmitter comprises:
beamformer logic arranged to apply independent beamform weights on the first signal and the second signal of the transmitter to generate a weighted first signal and a weighted second signal, respectively, wherein each of the independent beamform weights is allocated on a per sector basis; and
a signal combiner arranged to combine the weighted first signal and the weighted second signal to produce a combined signal such that the combined signal supports sectored beams for the two sectors, wherein an output of the signal combiner is operably coupled to the individual antenna element feed, and
wherein the beamformer logic is configured to apply a calibration correction coefficient so as to calibrate an amplitude and a phase of the combined signal.

US Pat. No. 10,116,364

METHOD FOR DETERMINING RANK INDICATION RI BIT NUMBER, BASE STATION, AND TERMINAL

Huawei Technologies Co., ...

1. A method, comprising:obtaining, by an apparatus, configuration information from a base station; and
selecting, by the apparatus, a current maximum number of multi-input multi-output (MIMO) layers according to band combination and the obtained configuration information, wherein the current maximum number of the MIMO layers is a maximum value of the supported MIMO layers for one frequency band that appears at least two times in the band combination;
wherein the band combination is a combination of frequency bands which indicates MIMO capabilities of the apparatus, and each of the MIMO capabilities represents a maximum number of supported MIMO layers of the apparatus in each of the frequency bands of the band combination.

US Pat. No. 10,116,357

SYSTEM AND METHOD FOR MULTIPLE POINT TRANSMISSION IN A COMMUNICATIONS SYSTEM

FUTUREWEI TECHNOLOGIES, I...

1. A method for multiple point transmission operation for a user equipment (UE), the method comprising:informing, by a first transmission point to a second transmission point, to modify a bearer configuration associated with a bearer, the bearer split by a first packet data convergence protocol (PDCP) entity of the first transmission point and transferred by the first PDCP entity to a radio link control (RLC) entity of the second transmission point without going through any PDCP entity of the second transmission point, with the first PDCP entity operating at a PDCP layer and the RLC entity operating at an RLC layer; and
receiving, by the first transmission point from the second transmission point, a response indicating a modified configuration associated with the bearer.

US Pat. No. 10,116,355

POWER SUPPLY APPARATUS, POWER RECEIVING APPARATUS, AND CONTROL METHOD THEREOF

Canon Kabushiki Kaisha, ...

1. A power supply apparatus which can supply power to a power receiving apparatus in a non-contact manner, the power supply apparatus comprising:a power supply unit configured to output power to the power receiving apparatus in a non-contact manner;
a first communication unit configured to communicate with the power receiving apparatus through a first communication scheme;
a second communication unit configured to communicate with the power receiving apparatus through a second communication scheme, wherein a range in which the second communication unit can communicate is broader than a range in which the first communication unit can communicate; and
a control unit configured to transmit a request signal requesting first device information to the power receiving apparatus using the first communication unit, and output first power from the power supply unit after a response signal responding to the request signal is received from the power receiving apparatus;
wherein the control unit receives second device information from the, power receiving apparatus using the second communication unit and compares the second device information and the first device information,
wherein, in a case where both of the second device information and the first device information indicate the same power receiving apparatus, the control unit controls the power supply unit to output second power and continue communication with the power receiving apparatus via the second communication unit,
wherein, in a case where both of the second device information and the first device information do not indicate the same power receiving apparatus, the control unit controls the power supply unit to stop communication with the power receiving apparatus via the second communication unit.

US Pat. No. 10,116,351

POLLUTION DETECTION CIRCUIT FOR DATA LINES AND METHOD THEREOF

SEMICONDUCTOR COMPONENTS ...

1. A pollution detection circuit for data lines, comprising: an impedance detector configured for coupling to at least one data terminal and detecting an impedance of said data terminal for detecting the pollution at said data terminal or said data lines; a sample and hold circuit, of the impedance detector, to store a value of a signal on the at east one data terminal as a stored signal; the impedance detector configured to apply a detection current to the at least one data terminal to form a detection signal wherein the pollution is confirmed in response to a difference less than a threshold value between the stored signal and the detection signal.

US Pat. No. 10,116,349

SYSTEM AND METHOD FOR TIME DIVISION DUPLEXED MULTIPLEXING IN TRANSMISSION-RECEPTION POINT TO TRANSMISSION-RECEPTION POINT CONNECTIVITY

Futurewei Technologies, I...

1. A method for operating a transmission-reception point (TRP), the method comprising:transmitting, by a first TRP, a first backhaul signal to a plurality of TRPs in accordance with a first backhaul frame configuration using a plurality of beams in a first backhaul communication mode of a plurality of backhaul communication modes, the plurality of beams comprising a full set of communication beams of the first TRP, the first backhaul frame configuration indicating an arrangement of subframes in a frame used in the first backhaul signal;
receiving, by the first TRP, a second backhaul signal from a first subset of the plurality of TRPs in accordance with a second backhaul frame configuration using a first subset of the plurality of beams in a second backhaul communication mode of the plurality of backhaul communication modes, the first subset of the plurality of beams being less than the full set of communication beams of the first TRP, the second backhaul frame configuration indicating an arrangement of subframes in a frame used in the second backhaul signal; and
receiving, by the first TRP, a third backhaul signal from a second subset of the plurality of TRPs in accordance with a third backhaul frame configuration using a second subset of the plurality of beams in a third backhaul communication mode of the plurality of backhaul communication modes, the second subset of the plurality of beams being mutually exclusive from the first subset of the plurality of beams, the second subset of the plurality of TRPs being mutually exclusive from the first subset of the plurality of TRPs, the third backhaul frame configuration indicating an arrangement of subframes in a frame used in the third backhaul signal.

US Pat. No. 10,116,348

HIGH-FREQUENCY POWER AMPLIFYING MODULE AND COMMUNICATION APPARATUS

MURATA MANUFACTURING CO.,...

1. A high-frequency power amplifying module for a communication device that simultaneously transmits and receives radio frequency signals in a first communication band and a second communication band, the high-frequency power amplifying module comprising:a first high-frequency power amplifier that amplifies radio frequency signals in the first communication band, the first high-frequency power amplifier comprising a second transmission filter configured to attenuate a transmission frequency of the second communication band; and
a second high-frequency power amplifier that amplifies radio frequency signals in the second communication band, the second high-frequency power amplifier comprising a first transmission filter, a second upstream amplifier, and a second downstream amplifier,
wherein the first communication band and the second communication band produce intermodulation distortion due to the transmission frequency of the first communication band and a transmission frequency of the second communication band, the intermodulation distortion having a frequency within a reception frequency band of the second communication band,
wherein the first transmission filter is configured to attenuate the transmission frequency of the first communication band,
wherein the second upstream amplifier amplifies a transmission signal in the second communication band,
wherein the first transmission filter is disposed between the second upstream amplifier and the second downstream amplifier,
wherein the second downstream amplifier amplifies a signal having passed through the first transmission filter,
wherein the first transmission filter, the second upstream amplifier, and the second downstream amplifier are mounted on a single board, and
wherein the first transmission filter and the second transmission filter are formed as a single high-frequency power amplifying module that is different from a high-frequency circuit that is coupled to the high-frequency power amplifying module.

US Pat. No. 10,116,343

MULTI-MIXER SYSTEM AND METHOD FOR REDUCING INTERFERENCE WITHIN MULTI-MIXER SYSTEM

MEDIATEK INC., Hsin-Chu ...

1. A multi-mixer system, comprising:an amplifier module, for receiving signals from at least an antenna to generate at least a first radio frequency (RF) input signal and a second RF input signal; and
a first channel coupled to the amplifier module, wherein the first channel comprises a first mixer and a first interference reduction circuit configured between the amplifier module and the first mixer, and the first channel is used to receive the first RF input signal to generate a first mixed signal; and
a second channel coupled to the amplifier module, wherein the second channel is used to receive the second RF input signal to generate a second mixed signal, the second channel comprises a first sub-channel and a second sub-channel, the first sub-channel comprises a second mixer and a second interference reduction circuit configured between the amplifier module and the second mixer, and the second sub-channel comprises a third mixer;
wherein only one of the first sub-channel and the second sub-channel is enabled to generate the second mixed signal, and when an oscillating signal used by the second mixer or the third mixer satisfies a specific condition, the first sub-channel is enabled to generate the second mixed signal, and the second sub-channel is disabled; and when the oscillating signal used by the second mixer or the third mixer does not satisfy the specific condition, the first sub-channel is disabled, and the second sub-channel is enabled to generate the second mixed signal.

US Pat. No. 10,116,341

POLAR TRANSMITTER WITH JOINED MODULATOR

Intel IP Corporation, Sa...

1. An apparatus including a polar transmitter joined with a modulator, and operable to transmit a signal over a wireless channel, the apparatus comprising:a circuit configured to, based on a type of modulator, a type of combiner and a channel frequency:
generate first and second streams of data from received data, each stream having at least some portion of the received data that is distinct from data included in the other stream, the type of combiner comprising a multiplicative or an additive combiner, and
generate a first analog signal based on the first stream and a supply voltage based on the second stream; and
an amplifier, coupled to the circuit, and configured to generate a Radio Frequency (RF) signal based on the supply voltage and the type of combiner.

US Pat. No. 10,116,338

MEASURING TRANSDUCER SUPPLY UNIT, SYSTEM FOR USE IN AUTOMATION TECHNOLOGY, AND METHOD FOR OPERATING SUCH A SYSTEM

4. A system for use in automation technology, that comprises at least the following:a superordinate unit;
at least one field unit;
a measuring transducer supply unit for use in automation technology;
a first two-wire line, which connects said measuring transducer supply unit with said at least one filed unit;
a second two-wire line, which connects said measuring transducer supply unit with said superordinate unit;
a superordinate unit that is connected through said measuring transducer supply unit to a field unit via a two-wire line; and
a mobile terminal having a unit that corresponds to said radio module for said wireless communications connection, wherein:
said measuring transducer supply unit comprises at least: one switch; one radio module; and one circuit;
said radio module can be activated and de-activated by said switch; said circuit realizes the conversion of signals between signals of two-wire lines and signals of said radio unit, so that the minimum of one field unit that is connected to the measuring transducer supply unit via said first two-wire line can be operated by means of said radio module using a wireless communications connection; and
so that said at least one field unit can be operated via said mobile terminal by means of said wireless communications connection between said measuring transducer supply unit and said mobile terminal by means of the connection between said measuring transducer supply unit and said at least one field unit via said first two-wire line.

US Pat. No. 10,116,284

BRANCHING DEVICE

MURATA MANUFACTURING CO.,...

1. A branching device comprising:a switch including a common terminal, a first individual terminal, and a second individual terminal;
a fixed filter circuit connected to the first individual terminal and having a fixed pass band; and
a tunable filter circuit connected to the second individual terminal and having a tunable pass band, wherein
the fixed filter circuit includes a plurality of filters having different pass bands,
the pass bands of the plurality of filters correspond to frequency bands used in carrier aggregation,
if carrier aggregation is carried out, the common terminal is connected to the fixed filter circuit through the first individual terminal, and
if carrier aggregation is not carried out, the common terminal is connected to the tunable filter circuit through the second individual terminal.

US Pat. No. 10,116,260

VCO SELECTION AND AMPLITUDE MANAGEMENT USING CENTER TAP INDUCTOR

International Business Ma...

1. An apparatus comprising:a first voltage controlled oscillator (VCO) that includes a first inductor, a first varactor, a first transistor, and a second transistor, wherein the first inductor is coupled to the first varactor, the first transistor and the second transistor; wherein the first inductor includes a first center tap connection; and wherein a center tap voltage at the first center tap connection affects an oscillation of the first VCO;
a second VCO that includes a second inductor having a second center tap connection, a pair of transistors coupled to the second inductor, and a second varactor;
an operational amplifier, wherein an output of the operational amplifier is coupled to the first center tap connection of the first inductor;
a first multiplexer receiving an output from the operational amplifier, the first multiplexer coupled to the first and second center tap connections; and
a second multiplexer providing an input to the operational amplifier, the second multiplexer coupled to the first and second center tap connections,
wherein a selection signal is used to select between the second VCO and the first VCO.

US Pat. No. 10,116,255

CLEANING SYSTEM FOR SOLAR PANELS

SOLAR MAID OF NORTHERN AR...

1. An apparatus for cleaning a solar panel, the apparatus comprising:a brush body having a width approximately equal to the solar panel;
a plurality of brush heads each attached to the brush body and having bristles extending away from the brush body, the bristles of each of the plurality of brush heads cooperating to form a contact plane where the bristles contact the solar panel;
a fluid manifold attached to the brush body, the fluid manifold comprising one or more pipes interconnecting a plurality of bulkheads, the plurality of bulkheads comprising:
a hose bulkhead that connects to a hose to establish fluid communication between the fluid manifold and a fluid supply; and
a plurality of nozzle bulkheads in fluid communication with the hose bulkhead; and
a plurality of nozzles each connected to one of the plurality of nozzle bulkheads such that each nozzle bulkhead has attached thereto:
a corresponding forward-facing nozzle of the plurality of nozzles, the corresponding forward-facing nozzle extending beyond a front edge of the brush body and emitting pressurized fluid onto the solar panel; and
a corresponding rear-facing nozzle of the plurality of nozzles, the corresponding rear-facing nozzle extending beyond a rear edge of the brush body and emitting pressurized fluid onto the solar panel.

US Pat. No. 10,116,229

MULTILEVEL CASCADE HEXAGONAL VOLTAGE SOURCE CONVERTER WITH ISOLATED DC SOURCES

KING SAUD UNIVERSITY, Ri...

1. A multilevel cascade hexagonal voltage source converter (VSC) comprising a plurality of polyphase stages, each of the polyphase stages having:a plurality of n AC inputs corresponding to a number of phases, and a numerically identical plurality of n outputs, the outputs of one of the polyphase stages being connected to the inputs of a next polyphase stage in order to connect the polyphase stages in cascade;
a plurality of n DC-to-AC converters corresponding to the number of phases, each of the n DC-to-AC converters being connected to one of the n AC inputs corresponding to a respective phase so that the n DC-to-AC converters provide n DC-to-AC electrical conversions at the corresponding respective phase of their respective n AC inputs and cascades AC current received at the inputs connected to then DC-to-AC converters, each of the n DC-to-AC converters providing two AC outputs;
a connection for receiving DC power and amplifying its AC outputs with the received DC power;
the multilevel cascade hexagonal voltage source converter (VSC) further having a plurality of n split inductors, each n split inductor having two end terminals and a center tap terminal, the n split inductor on respective sides of the center tap terminal forming inductor half-segments, the AC outputs of the n DC-to-AC converters being connected to adjacent ones of the n split inductors at respective ones of the two end terminals, whereby the n split inductors and the n DC-to-AC converters establish a polyphase ring connection, the plurality of n split inductors having inductive cross-coupling links, the inductive cross-coupling links being inductively connected to the inductor half-segments at opposite sides of the polyphase ring connection, the center tap terminals of the n split inductors providing n AC outputs for its respective polyphase stage.

US Pat. No. 10,116,228

CONVERTER AND POWER CONVERSION DEVICE MANUFACTURED USING THE SAME

TOSHIBA MITSUBISHI-ELECTR...

1. A converter configured to convert an AC voltage applied to an input terminal into a first DC voltage, a second DC voltage and a third DC voltage, and output the first DC voltage, the second DC voltage and the third DC voltage through a first output terminal, a second output terminal and a third output terminal, respectively, the converter comprising:a first transistor having a first electrode and a second electrode that are connected to the first output terminal and the input terminal, respectively;
a second transistor having a first electrode and a second electrode that are connected to the input terminal and the second output terminal, respectively;
a first diode and a second diode connected in anti-parallel to the first transistor and the second transistor, respectively; and
a first bidirectional switch connected between the input terminal and the third output terminal,
the first DC voltage being higher than the second DC voltage, and the third DC voltage being an intermediate voltage between the first DC voltage and the second DC voltage,
the first bidirectional switch including a third transistor, a fourth transistor, a third diode, and a fourth diode,
each of the first diode, the second diode, the third transistor, and the fourth transistor being formed of a wide band gap semiconductor,
each of the third diode, the fourth diode, the first transistor, and the second transistor being formed of a semiconductor other than the wide band gap semiconductor, and
each of the first diode and the second diode being greater in rated current than each of the third diode, the fourth diode, the first transistor, the second transistor, the third transistor, and the fourth transistor.

US Pat. No. 10,116,224

SWITCHING POWER CONVERTER CIRCUIT

Northrop Grumman Systems ...

1. A switching power converter circuit comprising:a gate driver configured to generate at least one switching signal in response to a feedback signal;
a feedback stage configured to generate the feedback signal based on an amplitude of an output voltage at an output; and
a power stage comprising at least one switch and a transformer, the at least one switch being controlled via the respective at least one switching signal to provide a primary current through a primary winding of the transformer to induce a secondary current through a secondary winding of the transformer to generate the output voltage, the power stage further comprising a self-driven synchronous rectifier stage coupled to the secondary winding to conduct the secondary current from a low voltage rail through the secondary winding, the self-driven synchronous rectifier stage comprises:
a first transistor interconnecting a first end of the secondary winding and the low voltage rail and being configured to conduct the secondary current from the low voltage rail through a first portion of the secondary winding when activated during a first switching phase; and
a second transistor interconnecting a second end of the secondary winding and the low voltage rail and being configured to conduct the secondary current from the low voltage rail through a second portion of the secondary winding when activated during a second switching phase.

US Pat. No. 10,116,221

SERIES COMPENSATING ELECTRIC POWER TRANSMISSION SYSTEM

TDK Corporation, (JP)

1. A series compensating electric power transmission system, comprising:a first direct current voltage source that has a first voltage source positive terminal and a first voltage source negative terminal;
a second direct current voltage source that has a second voltage source positive terminal and a second voltage source negative terminal; and
a bidirectional DC-DC converter, the bidirectional DC-DC converter includes:
a pair of first direct current input and output terminals configured with a first I/O positive terminal and a first I/O negative terminal, the first I/O positive terminal being connected to the first voltage source positive terminal, the first I/O negative terminal being connected to the first voltage source negative terminal;
a pair of second direct current input and output terminals configured with a second I/O positive terminal and a second I/O negative terminal, the second I/O negative terminal being connected to the first voltage source positive terminal, the second I/O positive terminal being connected to the second voltage source positive terminal;
a first power converter having the pair of first direct current input and output terminals and a pair of first alternating current input and output terminals, the first power converter configured to bidirectionally perform power conversion between a first direct current voltage generated between the pair of first direct current input and output terminals and a first alternating current voltage generated between the pair of first alternating current input and output terminals;
a second power converter having the pair of second direct current input and output terminals and a pair of second alternating current input and output terminals, the second power converter configured to bidirectionally perform power conversion between a second direct current voltage generated between the pair of second direct current input and output terminals and a second alternating current voltage generated between the pair of second alternating current input and output terminals; and
an isolation transformer having a primary winding and a secondary winding, the primary winding being connected to the pair of first alternating current input and output terminals, the secondary winding being connected to the pair of second alternating current input and output terminals,
wherein the first power converter has a plurality of first switches, and the plurality of first switches are connected to each other in one of push-pull, half bridge and full bridge configurations,
the second power converter has a plurality of second switches, and the plurality of second switches are connected to each other in one of push-pull and full bridge configurations,
the plurality of first switches and the plurality of second switches perform ON and OFF operations based on the first and second direct current voltages,
wherein the plurality of second switches of the second power converter are a plurality of bidirectional switches, and the plurality of bidirectional switches are connected to each other in one of a push-pull configuration or a full bridge configuration, and
each of the plurality of first switches of the first power converter has a single unidirectional switching element, and each of the plurality of bidirectional switches of the second power converter has two unidirectional switching elements so that a configuration of each of the plurality of first switches of the first power converter is different from a configuration of each of the plurality of bidirectional switches of the second power converter.

US Pat. No. 10,116,216

ULTRASONIC CONTROL SYSTEM AND METHOD FOR A BUCK-BOOST POWER CONVERTER

SEMICONDUCTOR COMPONENTS ...

1. A circuit for a buck-boost power converter comprising:an inductor driver comprising a first switch to selectively couple an input to a first node of an inductor, a second switch to selectively couple the first node of the inductor to a ground node, a third switch to selectively couple a second node of the inductor to the ground node, and a fourth switch to selectively couple the second node of the inductor to an output;
a pulse width modulator (PWM) to generate a PWM control signal responsive to an output level of the output;
a switch control in communication with the second switch and the third switch;
the circuit configured to operate in a buck mode with the fourth switch enabled for the buck mode and to begin to transition to a boost mode wherein the switch control is configured to, during the transition to the boost mode, detect an on time of the third switch less than a specified entry value and force the second switch to generate first boot refreshing pulses so that the second switch is enabled, during an on-time of the third switch, with an on time of a specified duration value at a rate more than a specified frequency, the circuit configured to subsequently operate in the boost mode after generation of the first boot refreshing pulses;
the circuit configured to operate in the boost mode with the first switch enabled for the boost mode and to begin to transition to the buck mode wherein the switch control is configured to, during the transition to the buck mode, detect on time of the second switch less than the specified entry value and force the third switch to generate second boot refreshing pulses so that the third switch is enabled, during an on time of the second switch, with an on time of the specified duration value at a rate more than the specified frequency, the circuit configured to subsequently operate in the buck mode after generation of the second boot refreshing pulses.

US Pat. No. 10,116,212

VOLTAGE REGULATION BASED ON CURRENT SENSING IN MOSFET DRAIN-TO-SOURCE RESISTANCE IN ON-STATE RDS(ON)

Dell Products, L.P., Rou...

1. An Information Handling System (IHS) comprising:an information handling resource;
a synchronous buck voltage regulator (VR) coupled to the information handling resource to deliver electrical energy to the information handling resource by switching between a high side (HS) control switch and a low side (LS) synchronous switch to regulate a direct current (DC) output voltage (VOUT) generated from a DC input voltage (VIN); and
a VR controller coupled to the voltage regulator, and which:
measures at least one inductor current (IMON) value of the voltage regulator during LS synchronous switch ON state;
synthesizes one or more IMON values of the voltage regulator during HS power switch ON state based on the calibrated inductance value, a period of time of Pulse Width Modulation (PWM) ON state, at least one measured VIN value, and at least one measured VOUT value; and
generates a complete IMON signal that combines the measured and synthesized IMON values.

US Pat. No. 10,116,211

POWER CONVERTER WITH ADAPTIVE ZERO-CROSSING CURRENT DETECTION

MEDIATEK INC., Hsin-Chu ...

1. A power converter, comprising:a first transistor, coupled between a VDD supply voltage and a common node;
a second transistor, coupled between the common node and a ground voltage, wherein the common node has a reactive voltage, and a reactive current flows through the common node;
a PWM (Pulse Width Modulation) controller, selectively enabling and disabling the first transistor and the second transistor according to a second control signal and a first transistor control signal;
a low-pass filter, coupled between the common node and an output node; and
a delay controller, generating the second control signal according to a first control signal, wherein the delay controller comprises:
a first comparator, comparing the reactive voltage with a reference voltage so as to generate the first control signal; and
a delay unit directly connected to an output of the first compactor, directly delaying the first control signal for a first delay time so as to generate the second control signal.

US Pat. No. 10,116,209

SYSTEM AND METHOD FOR STARTING A SWITCHED-MODE POWER SUPPLY

INFINEON TECHNOLOGIES AG,...

1. A method of operating a switched-mode power supply (SMPS), the method comprising:starting up the SMPS in an open loop mode of operation comprising
determining a rate of increase of a duty cycle of a pulse width modulated (PWM) signal over a plurality of cycles based on an input voltage and a switching frequency of the SMPS,
generating the PWM signal having the duty cycle in accordance with the determined rate of increase until an exit condition is reached, and
generating an initial closed loop duty cycle value when the exit condition is reached; and
transitioning operation of the SMPS from the starting up to a closed loop mode of operation, transitioning comprising initializing a dynamic controller with the initial closed loop duty cycle value.

US Pat. No. 10,116,201

HIGH POWER DENSITY INVERTER (I)

1. A single phase, non-insulated, miniaturized DC/AC power inverter (1) having an output power density higher than 3000 W/dm3, comprising:a DC input having a positive terminal (L+) and a negative terminal (L?);
an AC output having a line terminal (L) and a neutral terminal (N);
at least a H full bridge switch topology made of a first half-bridge (201) having a first switch (S1_H) in series with a second switch (S1_L), and of a second half-bridge (202) having a third switch (S2_H) in series with a fourth switch (S2_L), said first switch (S1_H) being connected at one end to the positive terminal (L+) of the DC input, said second switch (S1_L) being connected at one end to the negative terminal (L?) of the DC input, the other end of the first switch (S1_H) being connected to the other end of the second switch (S1_L), defining a first common end, said first common end being connected to the line terminal (L) of the AC output, said third switch (S2_H) being connected at one end to the positive terminal (L+) of the DC input, said fourth switch (S2_L) being connected at one end to the negative terminal (L?) of the DC input, the other end of the third switch (S2_H) being connected to the other end of the fourth switch (S2_L), defining a second common end, said second common end being connected to the neutral terminal (N) of the AC output,
at least one common mode noise EMI filter (100) connected between the first and the second common ends of the half-bridges and the terminals of the AC output,
at least one differential mode noise EMI filter (101) connected between the first and the second common ends of the half-bridges and the terminals of the AC output;
said common mode noise filter (100) having at least two “Y”-capacitors and two coupled inductors and said differential mode noise filter (101) having at least one “X”-capacitor;
wherein said first (S1_H), second (S1_L), third (S2_H) and fourth (S2_L) switches are made of wide-band semiconductors;
wherein said DC/AC power inverter (1) further comprises:
a ripple-compensating active filter comprising a third half-bridge (203) having a fifth switch (S3_H) in series with a sixth switch (S3_L), said fifth switch (S3_H) being connected at one end to the positive terminal (L+) of the DC input, said sixth switch (S3_L) being connected at one end to the negative terminal (L?) of the DC input, the other end of the fifth switch (S3_H) being connected to the other end of the sixth switch (S3_L), defining a third common end, said third common end being connected to a first end of a LC filter, made of at least one inductor (L6) and one storage capacitor (C5), a second end of the LC filter being connected to the negative terminal (L?);
modulation control means of said first (S1_H), second (S1_L), third (S2_H), fourth (S2_L), fifth (S3_H) and sixth (S3_L) switches for providing a switch frequency comprised between 20 and 500 kHz and allowing variable phase shifts between any two of said first (201), second (202) and third (203) half-bridges and allowing dead time modulation of the switches of said half-bridges (201, 202, 203),
so that to obtain a switching approaching ZVS switching, in particular to obtain switching when current crosses through zero and further to cancel switching losses and so that to allow high peak-to-peak voltage variations in the active filter, while storing corresponding energy in the storage capacitors (C5),
wherein the Y-capacitors of said common mode noise filter (100) are referenced to a shielding being at a reference potential, said shielding being insulated from earth, said Y-capacitors having a value comprised between 100 nF and several ?F.

US Pat. No. 10,116,198

SWITCHING SYSTEM

RENESAS ELECTRONICS CORPO...

1. A switching system comprising:a first PWM timing generation circuit generating an edge timing of a first PWM (Pulse Width Modulation) signal by using a first count value and a first comparison value supplied;
a second PWM timing generation circuit generating an edge timing of a second PWM signal by using a second count value and a second comparison value supplied, the second count value being a count value which is the same as the first count value or having a relation of the same frequency or integral multiple of frequencies of the first count value and whose timing at which the count value becomes the maximum value or minimum value is synchronized with that of the first count value;
a first switching circuit including a switching transistor driven by the first PWM signal and a shunt resistor detecting current flowing in the switching transistor;
a second switching circuit including a switching transistor driven by the second PWM signal and a shunt resistor detecting current flowing in the switching transistor in the second switching circuit;
a first AD conversion circuit converting an analog value detected by the shunt resistor in the first switching circuit to a digital value at a first AD conversion timing as a sampling timing;
a first AD conversion timing generation circuit generating the first AD conversion timing on the basis of an edge timing of the first PWM signal;
a second AD conversion circuit converting an analog value detected by the shunt resistor in the second switching circuit to a digital value at a second AD conversion timing as a sampling timing; and
a second AD conversion timing generation circuit generating the second AD conversion timing on the basis of an edge timing of the second PWM signal,
wherein one of the first and second switching circuits is an inverter circuit of a common shunt type in which the shunt resistor is provided commonly for a plurality of phases, and
wherein the first PWM timing generation circuit verifies an interval between an edge timing of the first PWM signal and the second AD conversion timing or an interval between the first AD conversion timing and an edge timing of the second PWM signal and, when the interval is less than a first reference value, shifts the edge timing of the first PWM signal so that the interval becomes equal to or larger than the first reference value.

US Pat. No. 10,116,196

PARALLEL ELASTIC MECHANISM FOR ROBOT-ENVIRONMENT FORCE INTERACTION

DISNEY ENTERPRISES, INC.,...

1. An apparatus for producing relative motion between a supported load and its environment, comprising:a direct drive motor directly coupled to the supported load and the environment operable to provide translational motion between the support load and the environment;
an elastic element directly coupled to the supported load and the environment; and
a prismatic guide assembly first supporting the direct drive motor to constrain the translational motion and second supporting the elastic element to constrain compression and expansion of the elastic element to be parallel to the translational motion,
wherein the direct drive motor comprises a translational voice coil motor,
wherein the prismatic guide assembly comprises:
a coil support supporting a coil element of the voice coil motor;
a body support spaced apart from the coil support and supporting a body of the voice coil motor; and
a translational bearing assembly constraining relative movement between the coil and body supports to be parallel to the drive axis,
wherein the translational bearing assembly comprises first and second guide shafts extending between the coil support and the body support and positioned on opposite sides of the voice coil motor,
wherein the elastic element comprises a compression spring coiled about exterior surfaces of one of the first and second guide shafts, and
wherein the elastic element further comprises an additional compression spring coiled about exterior surfaces of another one of the first and second guide shafts.

US Pat. No. 10,116,195

DISPLACEMENT DEVICES AND METHODS FOR FABRICATION, USE AND CONTROL OF SAME

The University of British...

1. A displacement device comprising:a stator comprising a plurality of electrically conductive coils, the plurality of electrically conductive coils shaped to provide:
a first plurality of coil traces generally elongated in a stator-x direction and distributed over at least a first portion of a first layer;
a second plurality of coil traces generally elongated in a stator-y direction and distributed over at least a second portion of a second layer, the stator-y direction non-parallel to the stator-x direction;
the first and second portions of the first and second layers overlapping one another in a stator-z direction, the stator-z direction generally orthogonal to both the stator-x direction and the stator-y direction;
a moveable stage comprising one or more magnet arrays, the moveable stage moveable relative to the stator within a two-dimensional working region, the one or more magnet arrays comprising a first magnet array, the first magnet array comprising a plurality of first magnetization segments, each first magnetization segment having a corresponding first magnetization direction;
one or more amplifiers connected to drive a plurality of currents in the plurality of electrically conductive coils;
a controller connected to deliver signals to the one or more amplifiers and configured, by using such signals, to control the currents driven by the one or more amplifiers and to thereby cause the moveable stage to track a desired position, (xr,yr), within the working region, where xr is a desired position of the moveable stage in the stator-x direction in the working region and yr is a desired position of the moveable stage in the stator-y direction in the working region;wherein:the controller is configured to control the currents driven by the one or more amplifiers to drive first currents, ix, in at least some of the first plurality of coil traces and to drive second currents, iy, in at least some of the second plurality of coil traces;
the first currents, ix, comprise a plurality of first current phases, ikx, each first current phase, ikx, driven into a corresponding one of the at least some of the first plurality of coil traces and phase-adjacent first current phases driven into spatially adjacent ones of the at least some of the first plurality of coil traces, where:
k is an integer from 0 to np?1 representing a first phase index; and
np is a number greater than or equal to two of different effective phases in the first currents, ix;
each first current phase, ikx, is determined based on a function F(yr), where F(yr) is a spatially periodic function of yr in the stator-y direction over the working region, with a first spatial period, ?1;
each first current phase, ikx, in a particular one of the at least some of the first plurality of coil traces is out of phase, as a function of yr, with one or more phase-adjacent first current phases in one or more spatially adjacent ones of the at least some of the first plurality of coil traces by a first spatial phase difference

the second currents, iy, comprise a plurality of second current phases, ijy, each second current phase, ijy, driven into a corresponding one of the at least some of the second plurality of coil traces and phase-adjacent second current phases driven into spatially adjacent ones of the at least some of the second plurality of coil traces, where:
j is an integer from 0 to mp?1 representing a second phase index; and
mp is a number greater than or equal to two of different effective phases in the second currents, iy;
each second current phase, ijy, is determined based on a function G(xr), where G(xr) is a spatially periodic function of xr in the stator-x direction over the working region, with a second spatial period, ?2; and
each second current phase, ijy, in a particular one of the at least some of the second plurality of coil traces is out of phase, as a function of xr, with one or more phase-adjacent second current phases in one or more spatially adjacent ones of the at least some of the second plurality of coil traces by a second spatial phase difference