US Pat. No. 10,113,634

DEVICE INCLUDING ONE FIRST AND AT LEAST ONE SECOND BEARING

AKTIEBOLAGET SKF, Gothen...

1. A device comprising:a first bearing,
a second bearing,
a first bearing-attachment element holding a first bearing and configured to exert a first force on an outer ring of first bearing,
a second bearing-attachment element holding the second bearing and configured to exert a second force on an outer ring of the second bearing,
a convex annular surface region on a circumferential portion of the outer ring of the second bearing,
and
a formation in the first bearing attachment element, the formation including a stepped cross-section having a convex annular underside surface that contacts and extends above the convex annular surface region of the outer ring of the second bearing and abuts the second bearing-attachment element at a first surface region and a second surface region, and
the formation is configured to exert a third force on the outer ring of the second bearing.

US Pat. No. 10,113,618

COMPOUND PLANETARY FRICTION DRIVE

Technische Universiteit D...

1. A compound planetary friction drive comprising a first sun wheel, wherein said first sun wheel engages planetary wheels, which planetary wheels are arranged with a first part having a first radius and a second part having a second radius, wherein the second radius differs from the first radius and a transition region is provided between the first part and the second part, and wherein at least one ring annulus is provided that is driven by the planetary wheels, wherein the first sun wheel is in frictional engagement with the first part of the planetary wheels, said first part of the planetary wheels is in frictional engagement with a first ring annulus and a second ring annulus is in frictional engagement with the second part of the planetary wheels, and wherein the planetary wheels are both hollow and compressible uninterruptedly along their entire length spanning the first part, the transition region and the second part.

US Pat. No. 10,113,607

ACTIVE VIBRATION DAMPING DEVICE AND ACTIVE VIBRATION DAMPING METHOD

HONDA MOTOR CO., LTD., T...

1. An active vibration damping device, comprising:an actuator disposed between a drive source and a vehicle body; and
a computer configured to suppress transmission of vibrations from the drive source to the vehicle body by causing the actuator to actively generate vibrations;
wherein the computer comprises:
an internal temperature estimating unit configured to calculate an internal temperature of the actuator;
a command value calculating unit configured to calculate an operation command value for the actuator from rotation information of the drive source;
a command value correction unit configured to correct the operation command value in accordance with the internal temperature;
a drive control unit configured to apply a drive voltage to the actuator using a voltage duty ratio based on the corrected operation command value; and
a point number calculating unit configured to obtain an integer value point number which is set so as to become larger as a period of rotation of the drive source becomes longer; and
wherein the internal temperature estimating unit comprises:
an output average duty ratio calculating unit configured to calculate an output average duty ratio, which is an average of target values or actually measured values of the voltage duty ratios that are used for realizing the operation command value, when the period of rotation of the drive source is a predetermined period;
a reference average duty ratio calculating unit configured to calculate, on basis of the operation command value and the point number, a reference average duty ratio, which is an average of the voltage duty ratios that realize the operation command value when the internal temperature is a reference temperature and the period of rotation of the drive source is the predetermined period;
an average duty ratio rate-of-change calculating unit configured to calculate, from the operation command value and the point number, an average duty ratio rate of change, which indicates a relationship between an amount of change of the internal temperature and an amount of change of an average duty ratio which is an average of the voltage duty ratios, when the period of rotation of the drive source is the predetermined period; and
an internal temperature calculating unit configured to calculate as the internal temperature a value obtained by adding the reference temperature to a product of the average duty ratio rate of change and a deviation between the output average duty ratio and the reference average duty ratio.

US Pat. No. 10,113,589

AXIALLY SELF-POSITIONING RADIAL SUPPORT BEARING

KOYO BEARINGS NORTH AMERI...

1. A radial support bearing assembly for use with a shaft defining an annular groove in its outer surface, comprising:a substantially cylindrical cage including a central portion extending between a first end portion and a second end portion, the central portion defining a plurality of roller pockets, a first projection and a second projection extending radially outwardly from the outer surface of the cage, and at least one projection extending radially inwardly from an inner surface of the cage;
a plurality of rollers, each roller being disposed in a respective roller pocket; and
a substantially cylindrical outer sleeve having an inner surface and an outer surface, the outer sleeve being disposed about an outer surface of the cage so that the inner surface of the outer sleeve is adjacent the plurality of rollers, and the outer sleeve being axially retained between the first projection and the second projection,
wherein the at least one projection is operatively engaged with the annular groove in the shaft so that the cage is axially fixed with respect to the shaft.

US Pat. No. 10,113,569

SENSOR MOUNTING DEVICE FOR HYDRAULIC CYLINDER

SMC CORPORATION, Chiyoda...

1. A sensor mounting device for mounting, on an outer periphery of a cylindrical cylinder tube, a position sensor that detects a position of a piston of a hydraulic cylinder, the sensor mounting device comprising:a fitting band; and
a fastening screw that fastens the fitting band and that fixes the position sensor onto the cylinder tube,
wherein the fitting band includes an annular portion wound and attached around the outer periphery of the cylinder tube, and first and second sensor holding portions formed on a first end and a second end of the annular portion so as to oppose each other, the first and second sensor holding portions pinching the position sensor from both sides,
wherein the annular portion is formed of a metal belt-shaped band main body, the first and second sensor holding portions are formed by being provided with metal reinforcing plates in a superposed manner on an outer surface of first and second reinforcing plate attaching portions formed at a first end and a second end of the band main body so as to oppose each other, screw insertion holes for inserting the fastening screw are formed in the first and second reinforcing plate attaching portions and a first reinforcing plate provided on the first reinforcing plate attaching portion in a superposed manner, and a screw hole for screwing the fastening screw thereto is formed in a second reinforcing plate provided on the second reinforcing plate attaching portion in a superposed manner,
wherein tip edges of the first and second reinforcing plate attaching portions of the band main body are formed in straight lines parallel to an axis of the annular portion, and
wherein shapes of the first and second reinforcing plates in front view are rectangular, an inclined portion is at least formed at a distal end portion of the second reinforcing plate among the first and second reinforcing plates by inwardly bending the distal end portion along a folding line parallel to the axis of the annular portion, the tip edge of the reinforcing plate attaching portion among the first and second reinforcing plate attaching portions of the band main body including the reinforcing plate having the inclined portion provided in a superposed manner extends along the folding line of the inclined portion.

US Pat. No. 10,113,565

ENGINE NOZZLE SYNCHRONIZATION SYSTEM

Moog Inc., East Aurora, ...

1. An actuator synchronization system comprising:a control valve in fluid communication with a plurality of actuators, each of said actuators comprising:
an input stage element in fluid communication with said control valve and having an input member movably mounted along an input axis, and configured to be moved from a first input position to a second input position along said input axis by said control valve;
a main valve having a valve member movably mounted in a valve chamber along a main valve axis, and configured to be moved from a null position to an off-null position along said main valve axis to selectively meter fluid flow from at least one port defined between said valve member and said valve chamber;
an output stage element in fluid communication with said port of said main valve and having an output member moveably mounted along an output axis, and configured to be moved from a first output position to a second output position along said output axis by a pressure differential applied on said output member by said main valve;
said main valve and said output member configured such that said output member is at a pressure equilibrium and does not move when said valve member is in said null position;
a feedback linkage acting between said valve member and said output member;
an eccentric drive link acting between said input member and said feedback linkage and configured to rotate about a fixed drive axis;
said drive link rotationally connected to said feedback linkage at a first pivot that is off-set a distance from said fixed drive axis and configured such that selective motion of said input member between said first input position and said second input position along said input axis causes said pivot of said feedback linkage to rotate about said drive axis;
said feedback linkage and said drive link configured such that selective movement of said input member from said first position to said second position causes said drive link and said feedback linkage to move said valve member from said null position to said off-null position;
said movement of said valve member from said null position to said off-null position causes said pressure differential on said output member and said output member to thereby move from said first output position to said second output position; and
said movement of said output member to said second output position causes said feedback linkage to move said valve member from said off-null position back to said null position; and
a mechanical connector between each of said input stage elements and/or said drive links configured such that rotational motion of each of said respective drive links about said respective fixed drive axis is substantially the same and thereby synchronized.

US Pat. No. 10,113,517

AIR CLEANER FOR STRATIFIED SCAVENGING TWO-STROKE INTERNAL COMBUSTION ENGINE

Yamabiko Corporation, To...

1. An air cleaner for a stratified scavenging two-stroke internal combustion engine, wherein the air cleaner is connected to a carburetor with an air passage and an air-fuel mixture passage to supply clean air filtered by the air cleaner to the air passage and the air-fuel mixture passage of the carburetor, the air cleaner comprising:an element member provided with a cleaner element for filtering air, an outer circumferential surface of the cleaner element forming an outer circumferential surface of the air cleaner;
an air cleaner base having a first inlet and a second inlet;
a ceiling plate member opposed to the air cleaner base to define a ceiling wall of the air cleaner and;
an air cleaner clean space formed by the air cleaner base, the ceiling plate member and the cleaner element;
a passage forming member forming an extended passage leading to the second inlet,
wherein the passage forming member is shaped to surround a periphery of the first inlet, and
wherein the passage forming member forms a blown-back fuel diffusion preventing region leading to the first inlet,
wherein the blown-back fuel diffusion preventing region is closed by the air cleaner base and the ceiling plate member, and defined by the air cleaner base, the ceiling plate member and a peripheral wall surface of the passage forming member,
wherein the passage forming member has an entrance opening at one end in a longitudinal direction of the passage forming member and an exit opening at another end of the passage forming member,
wherein the entrance opening is opened to the air cleaner clean space, and the exit opening is connected to the second inlet,
wherein the blown-back fuel diffusion preventing region is opened to an air cleaner clean space that is defined by the cleaner element and outside of the passage forming member, and the blown-back fuel diffusion preventing region is opened to the air cleaner clean space through a clearance gap between the entrance opening and the exit opening,
wherein the first inlet is connected to one of the air passage and the air-fuel mixture passage, the second inlet is connected to the other of the air passage and the air-fuel mixture passage.

US Pat. No. 10,113,509

CARBURETOR FOR INTERNAL COMBUSTION ENGINE

HONDA MOTOR CO., LTD., T...

1. A carburetor for an internal combustion engine, comprising,a throttle body internally defining an intake passage;
a throttle valve provided in the intake passage for controlling a flow rate of air conducted by the intake passage, the throttle valve including a throttle shaft rotatably supported by the throttle body;
a fuel passage including a fuel nozzle for supplying fuel to the intake passage;
a first air passage communicating with the fuel passage to supply air to the fuel passage;
a variable communication unit provided in a part of the first air passage and moveable between an open position for communicating the first air passage and a closed position for shutting off the first air passage, the variable communication unit including an air passage shaft received in a retaining hole provided in an intermediate part of the first air passage in a rotatable manner around an axial line extending in parallel with the throttle shaft, the air passage shaft having a communication passage defined therein and being rotatable between the open position where the communication passage forms a part of the first air passage and the closed position where the communication passage forms no part of the first air passage; and
a switch mechanism for rotating the air passage shaft between the open position and the closed position in dependence on a load of the engine,
wherein the switch mechanism comprises a link mechanism coupled between the throttle shaft and the air passage shaft to rotate the air passage shaft such that the first air passage is communicated when an opening angle of the throttle valve is a first angle, and is shut off when the opening angle of the throttle valve is a second angle greater than the first angle,
wherein the first air passage includes an upstream portion extending in parallel with the intake passage to the retaining hole of the air passage shaft, and a downstream portion extending from a bottom end of the retaining hole along an axis of the retaining hole and then is bent to extend to the fuel passage, and
wherein the communication passage is bent in the air passage shaft and has an upstream end opening out in an outer circumference of the air passage shaft and a downstream end opening out in an inner end face of the air passage shaft.

US Pat. No. 10,113,498

METHOD TO CONTROL A FUEL PUMP FOR A DIRECT INJECTION SYSTEM

MAGNETI MARELLI S.p.A., ...

1. A method to control a high pressure pump (4) for a direct injection system provided with a common rail (3) comprising the steps of:calculating an objective fuel flow rate (Mref) to be fed by the high pressure pump (4) to the common rail (3) instant by instant to have the desired pressure value inside the common rail (3);
comparing the objective fuel flow rate (Mref) with the maximum flow rate (Mmax) that can be delivered by the high pressure pump (4); and
based on the comparison between the objective fuel flow rate (Mref) and the maximum flow rate (Mmax) that can be delivered by the high pressure pump (4), controlling the high pressure pump (4) so as to alternate exclusively operating cycles of the high pressure pump (4) with the maximum flow rate (Mmax) that can be delivered and idle operating cycles of the high pressure pump (4).

US Pat. No. 10,113,306

DECK BOARD FASTENERS

SIMPSON STRONG-TIE COMPAN...

1. A decking clip comprising:a body having a transverse upper member with an upper surface and a lower surface, a perpendicular member extending from the lower surface of the upper member, a central aperture through the transverse upper member, two or more clip anchor apertures positioned about the central aperture, and a planar surface section on the upper surface of the transverse upper member between the central aperture and the two or more clip anchor apertures; and
a clip having an upper surface and a lower surface, a central clip aperture therethrough, and two or more clip anchors positioned along at least one edge of the clip and extending downward away from the lower surface of the clip, wherein the clip anchor apertures receive the clip anchors when the central aperture of the transverse upper member corresponds at least partially with the central clip aperture and the lower surface of the clip engages the planar surface section of the upper surface of the transverse upper member.

US Pat. No. 10,113,274

ROAD FINISHER WITH HEATED TAMPER BAR

BOMAG GMBH, Boppard (DE)...

1. A road finisher, comprising:a screed plate extending at right angles to the working direction of the road finisher; and
a tamper bar disposed rearwardly and/or forwardly of the screed plate in the working direction, wherein at least one electrically operated heating element is present, which is configured to heat up a heating surface facing a road subsurface, and wherein the heating element comprises a heating layer at least partially comprising a thermal spray coating obtained through thermal spraying onto a substrate surface, wherein the tamper bar is made from two parts with an upper tamper bar member and a lower tamper bar member assembled together;
wherein the upper tamper bar member has a lower surface which, in the assembled state, contacts an upper surface of the lower tamper bar member, wherein a groove is provided in the lower surface of the upper tamper bar member; and
wherein the heating layer, which is multilayered comprising at least an insulating layer, a strip conductor, and a sealing layer, is accommodated in the groove.

US Pat. No. 10,113,232

AZIMUTHAL MIXER

Lam Research Corporation,...

1. An apparatus for supplying process gases to a semiconductor processing gas distribution system, the apparatus comprising:a main passage;
a first plenum that substantially encircles the main passage;
a first inlet, the first inlet fluidically connected to the first plenum;
a manifold block including a first block and a second block; and
a plurality of first radial passages, each first radial passage spanning between, and fluidically connecting, the main passage with the first plenum, wherein:
the first block and the second block are adjacent to one another,
the first radial passages are defined by opposing surfaces of the first block and the second block,
the first plenum is defined by opposing surfaces of the first block and the second block, and
a first feed-through fluidically connects the first inlet with the first plenum.

US Pat. No. 10,113,212

SENSORS

THE UNIVERSITY OF MANCHES...

1. A system for monitoring a microstructure of a metal target, comprising:a plurality of electromagnetic sensors for outputting a magnetic field, wherein an excitation signal output by each of the electromagnetic sensors is a multi-frequency waveform, detecting a resultant magnetic field and outputting a detection signal in response thereto; and
a control unit arranged to receive the detection signals from the plurality of electromagnetic sensors, to determine a phase change between the output magnetic field and the resultant magnetic field at each of a plurality of frequencies forming the multi-frequency waveform for each of the plurality of electromagnetic sensors, to determine a microstructure development rate of a metal target at the plurality of electromagnetic sensors based on the phase changes, and to determine a deviation of the microstructure development rate from a predetermined microstructure development rate.

US Pat. No. 10,113,112

PREPARATION OF NANORODS

Massachusetts Institute o...

1. A method of preparing a core-shell nanorod comprising growing a shell of a core-shell nanorod (M1X1)M2X2 in a solution through a slow-injection of M2 precursor solution and X2 precursor solution to a suspension of M1X1 nanocrystals to form the shell in a first shell growth step, and, after stopping the first shell growth step, further growing the shell of the core-shell nanorod (M1X1)M2X2 in the solution through a slow-injection of M2 precursor solution and X2 precursor solution to a suspension of M1X1 nanocrystals to form a thicker shell in a second shell growth step and, wherein the core-shell nanorod includes a M1X1 core.

US Pat. No. 10,113,018

SHAPE CONTROLLED PRO-CATALYST AND A PROCESS FOR PREPARING THE SAME

Reliance Industries Limit...

1. A single-pot process for the preparation of a shape controlled pro-catalyst; said process comprising the following steps:a. reacting at least one alkanol with magnesium metal using at least one modifier and at least one solvent resulting in evolution of hydrogen gas; increasing the evolution of hydrogen gas in a controlled manner by increasing the temperature in a graded manner to 100° C. to obtain a mass, and
b. subjecting the mass to drying to obtain a free flowing pro-catalyst.

US Pat. No. 10,112,942

SUBSTITUTED PYRAZOLO[1,5-A]PYRIDINE COMPOUNDS AS RET KINASE INHIBITORS

Array BioPharma Inc., Bo...

1. A compound of the Formula I:and pharmaceutically acceptable salts and solvates thereof, wherein:X1, X2, X3 and X4 are independently CH or N, wherein zero, one or two of X1, X2, X3 and X4 is N;
A is CN;
B is
(b) C1-C6 alkyl optionally substituted with 1-3 fluoros,
(c) hydroxyC2-C6 alkyl-, wherein the alkyl portion is optionally substituted with 1-3 fluoros or a C3-C6 cycloalkylidene ring,
(e) (C1-C6 alkoxy)C1-C6 alkyl- optionally substituted with 1-3 fluoros,
(f) (R1R2N)C1-C6 alkyl-, wherein said alkyl portion is optionally substituted with OH and wherein R1 and R2 are independently H or C1-C6 alkyl (optionally substituted with 1-3 fluoros);
(g) hetAr1C1-C3 alkyl-, wherein hetAr1 is a 5-6 membered heteroaryl ring having 1-3 ring heteroatoms independently selected from N, O and S and is optionally substituted with one or more independently selected C1-C6 alkyl substituents; or
(i) (hetCyca)C1-C3 alkyl-,
hetCyca- is a 4-6 membered heterocyclic ring having 1-2 ring heteroatoms independently selected from N and O and optionally substituted with one or more substituents independently selected from OH, C1-C6 alkyl (optionally substituted with 1-3 fluoros), hydroxyC1-C6 alkyl-, C1-C6 alkoxy, (C1-C6 alkyl)C(?O)—, (C1-C6 alkoxy)C1-C6 alkyl- and fluoro, or wherein hetCyca is substituted with oxo;
Ring D is (i) a saturated 4-7 membered heterocyclic ring having two ring nitrogen atoms, or (ii) a saturated 7-9 membered bridged heterocyclic ring having two ring nitrogen atoms and optionally having a third ring heteroatom which is oxygen, wherein each of said rings is optionally substituted with (a) one to four groups independently selected from halogen, OH, C1-C3 alkyl which is optionally substituted with 1-3 fluoros, or C1-C3 alkoxy which is optionally substituted with 1-3 fluoros, (b) a C3-C6 cycloalkylidene ring, or (c) an oxo group;
E is
(h) Ar1C1-C6 alkyl-,
(j) hetAr2C1-C6 alkyl-, wherein the alkyl portion is optionally substituted with 1-3 fluoros, or
(l) hetAr2C(?O)—,
Ar1 is phenyl optionally substituted with one or more substituents independently selected from the group consisting of halogen, CN, C1-C6 alkyl (optionally substituted with 1-3 fluoros), C1-C6 alkoxy (optionally substituted with 1-3 fluoros), ReRfN— wherein Re and Rf are independently H or C1-C6 alkyl, (RpRqN)C1-C6 alkoxy- wherein RP and Rq are independently H or C1-C6 alkyl, and (hetAra)C1-C6 alkyl- wherein hetAra is a 5-6 membered heteroaryl ring having 1-2 ring nitrogen atoms, or Ar1 is a phenyl ring fused to a 5-6 membered heterocyclic ring having 1-2 ring heteroatoms independently selected from N and 0; and
hetAr2 is a 5-6 membered heteroaryl ring having 1-3 ring heteroatoms independently selected from N, O and S or a 9-10 membered bicyclic heteroaryl ring having 1-3 ring nitrogen atoms, wherein hetAr2 is optionally substituted with one or more substituents independently selected from the group consisting of halogen, CN, C1-C6 alkyl (optionally substituted with 1-3 fluoros), C1-C6 alkoxy (optionally substituted with 1-3 fluoros), (C1-C6 alkoxy)C1-C6 alkyl-(optionally substituted with 1-3 fluoros), ReRfN— wherein Re and Rf are independently H or C1-C6 alkyl, OH, (C1-C6 alkoxy)C1-C6 alkoxy- and C3-C6 cycloalkyl.

US Pat. No. 10,112,906

1-ARYL-3-ALKYLPYRAZOLE INSECTICIDES

FMC Corporation, Philade...

1. A compound selected from Formula 1, an N-oxide or salt thereof,whereinQ is

R1 is C3-C6 cycloalkyl or a 3- to 6-membered saturated ring containing one oxygen atom as a ring member and carbon atoms as the remaining ring members;
Z is phenyl or a 6-membered heteroaromatic ring, each substituted with 1 to 3 R4;
R2a, R2b, R2c and R2d are H;
J1 is CH2;
J2 is a direct bond or CH2;
M is —CH(A)-;
A is cyano, C1-C4 haloalkyl, NHC(O)R5a or 1,3,4-oxadiazol-2-yl;
each R4 is independently halogen, C1-C4 alkyl or C1-C4 haloalkyl; and
R5a is C1-C4 alkyl or C1-C4 haloalkyl.

US Pat. No. 10,112,889

CONTINUOUS PROCESS FOR PRODUCING A SURFACTANT IN A TUBE REACTOR

CLARIANT INTERNATIONAL LT...

1. A continuous process for preparing a surfactant, wherein the surfactant comprises a compound of the formula (1), in which R2 is a fatty acid alkyl radical and R1 is a straight-chain or branched C1 to C12 hydrocarbyl radical and x is in the range from 1 to 15
wherein the continuous process comprises at least the step of reacting at least one fatty acid alkyl ester or fatty acid triglyceride with at least one N-n-alkylated polyhydroxyamine in the presence of an alkali metal catalyst or of a catalyst selected from the group consisting of hydroxides or alkoxides of transition groups 2 and 4 of the Periodic Table, at a temperature in the range from 40 to 300° C., wherein the continuous process comprises the following steps:
1. mixing an aqueous raw material solution comprising at least one N-n-alkylated polyhydroxyamine with the catalyst to form an aqueous solution;
2. drying the aqueous solution, wherein the water content after drying being in the range of 0-5 wt % to form a dried mixture;
3. heating the dried mixture to a temperature in the range from 60 to 180° C. to form a melt, and mixing the melt with fatty acid alkyl esters or triglycerides to form a reaction mixture;
4. optionally, intermediately storing and mixing the reaction mixture in a continuously operated stirred tank;
5. carrying out reaction in a tube reactor; and optionally
6. removing any coproducts.

US Pat. No. 10,112,824

SEMICONDUCTOR DEVICE

ROHM CO., LTD., Kyoto (J...

1. A semiconductor device comprising:a substrate made of a semiconductor material and having an obverse surface formed with a recess;
a wiring layer formed on the substrate;
at least one functional element disposed in the recess and electrically connected to the wiring layer; and
an additional element controlling an orientation detection process that involves the at least one functional element, the additional element overlapping with at least a part of the at least one functional element as viewed in a direction normal to the obverse surface of the substrate,
wherein the recess comprises a first hollow that houses the at least one functional element, the first hollow having a first bottom surface and at least one first inclined side surface, and the first inclined side surface being connected to the first bottom surface,
the wiring layer including a portion on the first inclined side surface, the portion of the wiring layer extending from an upper edge of the first inclined side surface on the first inclined side surface, the upper edge of the first inclined side surface extending in a first direction perpendicular to the direction normal to the obverse surface of the substrate,
as viewed in the direction normal to the obverse surface of the substrate, the portion of the wiring layer comprises a first extension extending in the first direction and a second extension extending in a second direction that is perpendicular to the first direction and the direction normal to the obverse surface of the substrate,
the recess comprises a second hollow that has a second bottom surface and at least one second inclined side surface, the second bottom surface being connected to the first inclined side surface, the second inclined side surface being connected to the second bottom surface and the obverse surface, and
an angle of the first inclined side surface relative to the first bottom surface is less than 90 degrees.

US Pat. No. 10,112,820

BEVERAGE DISPENSING SYSTEM WITH DISPOSABLE LINER AND FAUCET

DSS Rapak, Inc., Romeovi...

1. A faucet assembly for a beverage dispensing container and container liner assembly with a tube, the container having a fitting assembly, the faucet assembly comprising:a main body having a first surface and connection means for connecting said main body to the fitting assembly;
a lid having a second surface and closed and open positions, the closed position including the first surface being held against the second surface so that said lid and said main body define a distal passageway for holding the tube and having a centerline, the centerline defining three points not on a straight line, and the open position including the first surface being in a position not held against the second surface; and
a valve assembly connected with and extending upwardly from said main body, and positioned between the fitting assembly and the lid, for selectively pinching closed a tube extending through the distal passageway, wherein said lid is hingedly connected to said valve assembly to pivot between the closed and open positions.

US Pat. No. 10,112,784

APPARATUS FOR VARYING THE PITCH BETWEEN MOVING ARTICLES

FAMECCANICA.DATA S.P.A., ...

1. An apparatus for varying the pitch between moving articles, comprising:a stationary structure having a suction volume;
a plurality of rotors rotatable independently from each other about a common axis, each rotor having at least one transport element and each transport element having respective gripping surfaces provided with suction holes;
a rotary distributor rotatable about said axis independently of said rotors, and having a plurality of intake ducts comprising first openings selectively connected to said suction volume and second openings located on an interface surface of said rotary distributor; and
a plurality of rigid connection elements that establish a pneumatic connection between respective transport elements and said rotary distributor, wherein said rigid connection elements are fixed with respect to respective transport elements and have respective sliding surfaces in sliding contact with said interface surface, wherein said rigid connection elements have respective suction chambers elongated in the circumferential direction and open on said sliding surfaces, wherein said suction chambers are pneumatically connected to said suction holes of the respective transport elements and are connected pneumatically to said respective second openings of said rotary distributor.

US Pat. No. 10,112,762

FLAT SEAL CONTAINER

Philip Morris Products S....

1. A container of smoking articles comprising:a bundle of smoking articles having a plurality of faces wrapped in a wrapper of flexible sheet material, free edge margins of the generally inside surface of the wrapper being adhered together over a first face of the bundle to form a fin seal that is joined to the rest of the wrapper along a fold line; and
an outer housing around the wrapped bundle,
in which the fin seal is folded around an edge of the bundle that is parallel to the fold line, and the fin seal is adhered to the wrapper over a second face of the bundle.

US Pat. No. 10,112,748

ONE-HANDED OPERATION BOTTLE DEVICE

1. A bottle device, comprising:a housing to contain a liquid therein;
an opening in the housing;
a cover rotating between an open position and a closed position over the opening to selectively release the liquid from the housing;
a switch connected to the cover via a switch arm, a connecting arm, and a primary link arm to move the switch arm between a first position and a second position corresponding to the open position and the closed position of the cover; and
a lock mechanism to secure the switch with the cover in the closed position, wherein the lock mechanism further comprises a lock block to apply pressure against the switch;
wherein the connecting arm is pivotally connected on one end to the switch arm, and the connecting arm is pivotally connected on a second end to the primary link arm.

US Pat. No. 10,112,747

FOAM GENERATOR FOR COMPRESSION RECEPTACLES

APOLLO INDUSTRIAL CO., LT...

1. A foam generator for a compression receptacle, mounted to a neck of the compression receptacle having liquid contents stored therein for mixing the liquid contents, discharged out of the compression receptacle when the compression receptacle is compressed, with air and discharging the mixed liquid contents in a form of foam, wherein the foam generator comprises:a cap main body comprising a large cap part fastened to the neck of the compression receptacle in a screw coupling manner, an upward and downward movement guide wall disposed at an outside of the large cap part, the upward and downward movement guide wall being formed in a shape of a cylinder, and a foam discharge part protruding from an upper part of the large cap part in a shape of a pipe having a diameter while a step is formed at a lower end thereof, an upper part of the foam discharge part being open, an air hole for allowing external air to be introduced therethrough being formed in the step;
a content discharge guide configured such that an edge thereof is fitted, received, and disposed in an upper end of the large cap part of the cap main body so as to be spaced apart from a lower part of the step of the cap main body, the content discharge guide comprising a discharge guide part having a liquid discharge port formed in a central region thereof so as to be recessed concavely and a tube coupling port provided at a center of a bottom surface of the discharge guide part, a discharge tube for discharging the liquid contents stored in the compression receptacle being coupled to the tube coupling port, the discharge guide part being provided at an edge thereof with an air discharge port, through which air in the compression receptacle can move to an upper side of the discharge guide part when the compression receptacle is compressed, and with an air introduction port, through which external air is introduced into the compression receptacle when the compression receptacle is restored to an original state thereof;
a check valve unit made of an elastic material, the check valve unit comprising a ring-shaped partition wall, having a lower end disposed in tight contact with an upper surface of the content discharge guide and an upper end disposed in tight contact with the lower part of the step of the cap main body, for defining an air and liquid mixing chamber in the foam discharge part, a first check valve part disposed inside the partition wall so as to extend downward toward a central part thereof, an end of the first check valve part being disposed in elastically tight contact with the discharge guide part of the content discharge guide, the first check valve part being configured to selectively allow the air in the compression receptacle to move to the air and liquid mixing chamber through the air discharge port when the compression receptacle is compressed, and a second check valve part disposed outside the partition wall so as to extend upward toward an outside, an end of the second check valve part being disposed in elastically tight contact with an outside of the step of the cap main body, the second check valve part being configured to close the air hole when the compression receptacle is compressed and to open the air hole when the compression receptacle is restored to the original state thereof such that external air can be introduced;
a filtration member fitted, received, and disposed in the foam discharge part of the cap main body, the filtration member being formed in a shape of a cylinder having open upper and lower parts, the filtration member being provided at upper and lower surfaces thereof with filtration nets, the filtration member being configured to guide a discharge of foam formed as a result of the liquid contents being mixed with air in the air and liquid mixing chamber while homogenizing the foam; and
an upward and downward movement cap comprising a cylindrical wall surface having a lower end received in and coupled to the upward and downward movement guide wall of the cap main body so as to be movable upward and downward and an upper surface configured to cover an upper part of the cap main body, the upper surface being provided with a plurality of foam distribution holes, through which the foam that has passed through the filtration member is discharged to the outside in a distributed manner, the upward and downward movement cap being provided at a center of the upper surface thereof with a cylindrical blocking wall for selectively opening and closing the foam discharge part according to an upward and downward manipulation thereof.

US Pat. No. 10,112,742

BOTTLE CAP

1. A container cap comprising an outer skin assembled and retained on an inner core, wherein:a. the inner core comprises an inner core bottom edge, a first inner core portion proximate the inner core bottom edge and a second inner core portion proximate the first inner core portion such that the first inner core portion is interposed between the second inner core portion and the inner core bottom edge, the inner core comprising a first exterior diameter T4 at the first inner core portion and a second exterior diameter T3 at the second inner core portion;
b. the outer skin comprises a skirt comprising a rolled bottom edge folded inwardly toward an inner surface of the skirt to form an upwardly extending arm directly adjacent the inner surface of the skirt, wherein the upwardly extending arm comprises a distal edge;
c. the skirt comprises a first interior diameter T2 at the rolled bottom edge and a second interior diameter T1 above the rolled bottom edge;
d. T4 e. when the outer skin is assembled on the inner core, the skirt extends at least partially around and in contact with the inner core and the rolled bottom edge of the skirt is proximate the first inner core portion such that the upwardly extending arm of the rolled bottom edge is interposed between the skirt and the inner core and the distal edge of the upwardly extending arm is not exposed on the container cap.

US Pat. No. 10,112,737

METHOD FOR THE MANUFACTURE OF AN ALUMINUM SHEET PRODUCT FROM USED BEVERAGE CONTAINERS

Golden Aluminum, Inc., F...

1. A method, comprising:forming a molten aluminum feedstock comprising at least about 65 wt. % used beverage containers, the used beverage containers having a body and an end, the end comprising a connector to a tab for opening the container, wherein the aluminum alloy of the body and the aluminum alloy of the end each comprise from about 0.55 to about 0.90 wt. % manganese, and wherein the aluminum alloy of the end has a higher magnesium concentration than the aluminum alloy of the body;
casting the molten aluminum feedstock to form a cast sheet; and
forming the cast sheet into an aluminum alloy sheet product.

US Pat. No. 10,112,715

SIGNALING PRINT SUBSTANCES

Hewlett-Packard Developme...

1. An unmanned aerial vehicle, comprising:an electromagnetic radiation (EMR) sensor to detect a signal indicative of a substance to be printed and corresponding to an image to be printed; and
a nozzle to eject the substance based on a location at which the signal is detected.

US Pat. No. 10,112,701

AIRCRAFT LANDING GEAR DOOR ACTUATION MECHANISM WITH INTEGRATED EMERGENCY ACTUATION ASSEMBLY

1. A retractable aircraft landing gear door actuation mechanism comprising:a landing gear door;
a door support bracket attached to the landing gear door, the support bracket being attached to aircraft structure for pivotal movement about a pivot axis between a closed condition whereby the landing gear door covers an aircraft landing gear when retracted relative to the aircraft structure, and an opened condition whereby the landing gear door is moved laterally and upwardly relative to the aircraft landing gear when extended relative to the aircraft structure; and
a gear door actuation assembly operatively connected to the door support bracket for moving the door support bracket and the gear door supported thereby between the closed and opened conditions thereof, wherein
the gear door actuation assembly includes an over-the-center spring assembly which assists in pivotal movement of the door support bracket and the gear door supported thereby from the closed condition into the opened condition thereof, wherein
the over-the center spring assembly comprises:
(i) first and second linkage arms, wherein the first linkage arm is pivotally connected at a proximal end thereof to the aircraft structure at a first pivot axis and being pivotally connected at a distal end thereof to a proximal end of the second linkage arm at a second pivot axis, and wherein the second linkage arm is pivotally connected at a distal end thereof to the gear door support structure at a third pivot axis;
(ii) an actuator assembly having a proximal end pivotally connected to the aircraft structure at a fourth pivot axis and having a distal end pivotally connected to the first linkage arm at a fifth pivot axis between the first and second pivot axes thereof; and
(iii) a tension spring assembly having a proximal end pivotally connected to the aircraft structure at a sixth pivot axis and a distal end pivotally connected to the first linkage arm at a seventh pivot axis positioned inboard of the fifth pivot axis, wherein
(iv) the tension spring assembly is loaded with a tension force when the gear door support bracket and the gear door supported thereby is in the closed condition thereof, and wherein
(v) actuation of the actuator assembly pivotally drives the first linkage arm about the first pivot axis to cause the second linkage arm to drive the door support bracket and the gear door supported thereby to pivot laterally and outwardly relative to the relative to the aircraft landing gear and into the opened condition thereof; and wherein
(vi) movement of the door support bracket and the gear door supported thereby responsively moves the seventh pivot axis over center of the fifth pivot axis to thereby cause the force of the tension spring assembly to unload and assist in movement of the door support bracket and the gear door supported thereby into the opened condition thereof.

US Pat. No. 10,112,691

RELEASABLE FORWARD SECTION OF AN UNDERWATER VEHICLE

The Boeing Company, Chic...

1. An underwater vehicle comprising:a first section detachably coupled to a second section, wherein the second section is positioned forward of the first section;
a hinge detachably coupling the first section to the second section, wherein the hinge creates a pivot between the first section and the second section:
a lock having a locked position and an unlocked position, wherein, in the locked position, the lock couples the first section and the second section together, and wherein, in the unlocked position, the second section is capable of decoupling from the first section; and
a drag fin associated with the second section, wherein the drag fin is movable to an extended position away from the second section to create a drag force which causes the second section to pivot about the hinge away from the first section when the underwater vehicle is traveling through a fluid medium.

US Pat. No. 10,112,688

SURF WAKE FORMING SYSTEM WITH DUAL ACTUATED TRIM TAB

1. A system for forming asymmetric surf wakes behind a wakeboat, comprising:a hull having a port side, a starboard side, a bow, a stern, a length from the bow to the stern, and a width from the port side to the starboard side, the hull being configured to float in water with a waterline on the outside of the hull;
the hull having a yaw axis, the yaw axis running substantially vertically through the hull;
the hull having a pitch axis, the pitch axis being orthogonal to the yaw axis and running substantially laterally across the width of the hull;
the hull having a roll axis, the roll axis being orthogonal to the yaw axis and the pitch axis and running substantially along the length of the hull;
a primary left trim tab pivotally supported by the hull proximate the port side of the stern for rotation about a first tab axis that is substantially parallel with the waterline when the hull is at rest in the water;
a primary left actuator mounted between the hull and the primary left trim tab, and configured to rotate the primary left trim tab around the first tab axis of the primary left trim tab from a position having decreased interaction with the water passing beneath the hull to a position having increased interaction with the water passing beneath the hull;
a secondary left trim tab pivotally mounted to the primary left trim tab for rotation about a second tab axis that is non-parallel to the first tab axis;
a secondary left actuator mounted between the primary left trim tab and the secondary left trim tab, and configured to rotate the secondary left trim tab around the second tab axis from a position having decreased interaction with the water passing beneath the hull to a position having increased interaction with the water passing beneath the hull;
a primary right trim tab pivotally supported by the hull proximate the starboard side of the stern for rotation about a third tab axis that is substantially parallel with the waterline when the hull is at rest in the water;
a primary right actuator mounted between the hull and the primary right trim tab, and configured to rotate the primary right trim tab around the third tab axis from a position having decreased interaction with the water passing beneath the hull to a position having increased interaction with the water passing beneath the hull;
a secondary right trim tab pivotally mounted to the primary right trim tab for rotation about a fourth tab axis that is non-parallel to the third tab axis;
a secondary right actuator mounted between the primary right trim tab and the secondary right trim tab, and configured to rotate the secondary right trim tab around the fourth tab axis from a position having decreased interaction with the water passing beneath the hull to a position having increased interaction with the water passing beneath the hull; and
a controller with at least one actuator interface, the controller in selective communication with at least one of the primary left actuator, the secondary left actuator, the primary right actuator, and the secondary right actuator.

US Pat. No. 10,112,679

BICYCLE WITH SUPPORT DEVICE

1. A support pad device comprising of a pad with a top surface and a bottom surface, a post of a tubular shape having a first end attached to the pad wherein a second end fits directly inside and on a same axis of a fork steerer tube of a two wheeled cycle, the cycle further comprising:a handlebar including a left and a right crank oriented at 0 degrees relative to one another and securely attached to one another,
a sprocket securely attached to the handlebar,
a single chain or belt that engages with the sprocket and transfers propulsion to a front wheel from the handlebar capable of completing a full circular motion,
a stem comprising of a first end having a horizontal tubular bearing surface rotatably connected to the handlebar and a second end securely attached to the fork steerer tube.

US Pat. No. 10,112,671

SADDLEBAG SPEAKER ASSEMBLY AND METHOD OF FORMING A SADDLEBAG SPEAKER ASSEMBLY

1. A saddlebag speaker assembly for housing a speaker within a saddlebag, the assembly comprising:a saddlebag lid configured to cooperate with a saddlebag base to form a saddlebag interior space, the saddlebag lid including a saddlebag lid upper portion and a saddlebag lid opening through the saddlebag lid upper portion;
a saddlebag lid opening cover covering the saddlebag lid opening;
a speaker adapter including a speaker adapter first end aligned with a first plane, the speaker adapter first end configured to be coupled to the saddlebag lid at the saddlebag lid opening and having a first opening area, the speaker adapter further including a speaker adapter second end aligned with a second plane and having a second opening area, wherein the second opening area is greater than the first opening area and the second plane forms a speaker angle with the first plane; and
a speaker coupled to the speaker adapter second end and having a speaker face comprising a speaker face area greater than the saddlebag lid opening.

US Pat. No. 10,112,660

VEHICLE SPARE TIRE LIFT ASSEMBLY

Ford Global Technologies,...

1. A tire lift assembly comprising:an upper plate;
an intermediate plate;
a bottom plate;
a rod extending through the plates and being removably attached to the bottom plate; and
a pair of handles each including a tab disposed at a lower handle portion and each mounted to the upper plate and intermediate plate for rotation between first and second positions,
wherein the upper plate and bottom plate are spaced from one another to receive a spare tire therebetween and each of the tabs extends from the respective handle to engage the spare tire when the handles are in the second position.

US Pat. No. 10,112,647

GESTURE CONTROL FROM A REMOTE POSITION FOR REVERSING A VEHICLE AND A VEHICLE-TRAILER SYSTEM

Continental Automotive Sy...

1. A backing system for a vehicle, the backing system comprising:a camera for recording a video image of a user performing a gesture, the camera mounted to the vehicle or to a trailer in communication with the vehicle;
a microphone mounted to the vehicle or to the trailer in a position to capture a rear, or side rear position of the user, the microphone for capturing a voice command; and
an electronic control unit for the backing system, the electronic control unit in communication with the camera and the microphone, the electronic control unit includes instructions for:
determining that the vehicle is backing up;
interpreting the gesture with the electronic control unit to determine a meaning of the gesture;
calculating a first steering angle based upon the meaning of the gesture;
sending a first request to a steering system to provide the first steering angle;
calculating a second steering angle directly based upon the voice command; and
sending a second request to the steering system to provide the second steering angle.

US Pat. No. 10,112,632

METHOD AND SYSTEM FOR RAIL VEHICLE COUPLING DETERMINATION

Trapeze Software ULC, Mi...

1. A system for identifying transport units in coupled relationship comprisinga plurality of transport units in a predefined area;
a first transport unit among said plurality of transport units having one end of a coupling unit at a front end thereof; said one end of said coupling unit including a first mechanical coupling portion and a first electrical coupling portion;
a second transport unit among said plurality of transport units have a second end of said coupling unit at a rear end thereof; said second end of said coupling unit including a second mechanical coupling portion and a second electrical coupling portion;
at least one additional transport unit among said plurality of transport units being closest in physical proximity to said first transport unit;
said first electrical coupling portion including a first dry contact having a closed state when said first mechanical coupling portion and said second mechanical coupling portion are coupled together and an open state when said first mechanical coupling portion and said second mechanical coupling portion are uncoupled from each other;
said second electrical coupling portion including a second dry contact having a closed state when said second mechanical coupling portion and said first mechanical coupling portion are coupled together and an open state when said first mechanical coupling portion and said second mechanical coupling portion are uncoupled from each other;
a communications device on said first transport unit in signal communication with said dry contact; said communications device configured to communicate a data packet identifying said first transport and a state of said dry contact to a communications receiving device;
a communications device on said second transport unit in signal communication with said second dry contact; said communications device configured to communicate a data packet identifying said second transport and a state of said second dry contact to a communications receiving device;
a communications device on said at least one additional transport unit configured to communicate a data packet identifying said additional transport unit to a communications receiver;
said communications receiving device including a computer processor and computer executable instructions for determining a transport unit amongst said plurality of transport units in closest coupled proximity to said first transport unit and for providing an indication that said first transport unit is coupled to said second transport unit upon a condition in which said first dry contact is in said closed state and upon a condition in which said transport unit amongst said plurality of transport units in closest coupled proximity to said first transport unit is determined to be said second transport unit;
said communications receiving device further including computer executable instructions for confirming the identity of said first transport unit and said second transport unit indicated to be coupled by determining a transport unit amongst said plurality of transport units in closest coupled proximity to said second transport unit and for providing an indication that said second transport unit is coupled to said first transport unit upon a condition in which said second dry contact is in said closed state and upon a condition in which said transport unit amongst said plurality of transport units in closest coupled proximity to said second transport unit is determined to be said first transport unit, whereby confirmation is provided that said first transport unit is coupled to said second transport unit and avoiding an indication where said transport unit amongst said plurality of transport units in closest physical proximity is said at least one additional transport unit incorrectly indicated to be coupled to said first or said second transport units.

US Pat. No. 10,112,623

SENSORY STIMULATION SYSTEM FOR AN AUTONOMOUS VEHICLE

Uber Technologies, Inc., ...

1. A sensory stimulation system for an autonomous vehicle (AV), the sensory stimulation system comprising:at least one display unit within an interior of the AV;
one or more processors; and
one or more memory resources storing instructions that, when executed by the one or more processors, causes the sensory stimulation system to:
determine a set of maneuvers to be executed by the AV;
based on each respective maneuver of the set, determine a set of visual stimulation outputs to provide a passenger of the AV with visual indications of the respective maneuver; and
prior to the AV executing the respective maneuver, preemptively display the set of visual stimulation outputs on the at least one display unit.

US Pat. No. 10,112,607

DRIVING SUPPORT DEVICE THAT PERFORMS DRIVING SUPPORT IN ACCORDANCE WITH CHARACTERISTICS AND SKILLS OF DRIVER

HONDA MOTOR CO., LTD., T...

1. A driving support device comprising:a processing device that performs driving support by controlling in-vehicle equipment having an influence on running of a subject vehicle equipped with the driving support device,
the processing device being configured to
repeatedly obtain and store, at a predetermined time interval or a predetermined distance interval, a pair of a value of longitudinal acceleration and a value of lateral acceleration that are generated as a result of a driving operation performed by a driver, the longitudinal acceleration being an acceleration in a traveling direction of the subject vehicle, the lateral acceleration being an acceleration in a direction orthogonal to the traveling direction,
set at least one parameter of a support operation for performing the driving support, by using a plurality of pairs of the value of the longitudinal acceleration and the value of the lateral acceleration, repeatedly obtained and stored,
plot points, each representing the respective pairs, on a two-dimensional coordinate plane that includes two axes respectively representing the longitudinal acceleration and the lateral acceleration,
generate a first shape, which is a closed shape, by connecting the plotted points adjacent to one another by line segments,
generate a second shape, which is a closed shape, formed of a circumscribed curve of the first shape,
calculate an area difference by subtracting an area of the first shape from an area of the second shape, and
set the one parameter of the support operation for performing the driving support, by using the area difference.

US Pat. No. 10,112,516

DUAL FUNCTION STOWABLE ARMREST

Ford Global Technologies ...

1. An armrest assembly for a vehicle, comprising:a displaceable armrest element; and
a linkage assembly adapted to releasably retain the displaceable armrest element in a deployed configuration.

US Pat. No. 10,112,515

FLEX SHIELD FOR SEAT ASSEMBLY

Magna Seating Inc., Auro...

1. A flex shield adapted to be operatively coupled to a seat assembly of an automotive vehicle, wherein the seat assembly comprises a seat cushion, and front and rear legs extending and exposed above a floor of the automotive vehicle, and the flex shield is coupled to the seat assembly under the seat cushion to conceal open sides of the seat assembly below the seat cushion, said flex shield comprising:a flexible planar body portion extending laterally between a front edge and a rear edge and vertically between an upper edge and a lower edge;
a plurality of elastic straps fixedly secured to said body portion and adapted to be coupled to the seat assembly for maintaining tension on the flexible body portion; and
a plurality of pre-formed fold lines formed in said body portion and extending between at least one of said front edge and rear edge for consistently controlling folding motion of said body portion between an unfolded position defining a generally planar body portion and a folded position wherein the body portion is collapsed along said fold lines;
wherein said plurality of elastic straps includes an upper strap extending between a proximal end fixedly secured to said rear edge of said body portion and an opposite distal end spaced from said rear edge and adapted to be coupled to the seat assembly.

US Pat. No. 10,112,512

SUSPENSION DEVICE

GRAMMER AG, Amberg (DE)

1. A suspension device for a vehicle seat, comprising:an upper suspension portion and a lower suspension portion, said suspension portions being connected to one another by a first swivel connector and a second swivel connector, said first swivel connector being arranged on the lower suspension portion in such a way that said first swivel connector can swivel about a first swivel pin, and the second swivel connector being arranged on the lower suspension portion in such a way that said second swivel connector can swivel about a second swivel pin, a first tension spring and a second tension spring being respectively connected to the first swivel connector by a first end region and to the upper suspension portion or the lower suspension portion by a second end region,
wherein the first end region of the first tension spring is attached to the first swivel connector at a first distance, and the first end region of the second tension spring is attached to said first swivel connector at a second distance, the length of the first distance being variable,
wherein the first distance between the first end region of the first tension spring and the first swivel connector can be adjusted by an adjustment device, which is connected to the first swivel connector at one end and to the first end region at the other end.

US Pat. No. 10,112,486

APPARATUS FOR DETECTING GAS LEAKAGE OF A VEHICLE EQUIPPED WITH A FUEL CELL SYSTEM

Hyundai Motor Company, S...

1. A device for detecting leakage of gas of a fuel cell vehicle, the device comprising:a gas sensor configured to determine whether gas leaks based on a change in a temperature by a catalyst reaction; and
a vehicle control unit including a comparator configured to read a variation in temperature from the gas sensor, and configured to control a fuel cell vehicle,
wherein in a power off state of the fuel cell vehicle, a power application state is maintained in the comparator, power of the gas sensor is switched at regular periodic intervals, the comparator determines the variation in temperature measured by the gas sensor, and, when the variation in temperature exceeds a predetermined value, the power of the gas sensor is switched to normal power.

US Pat. No. 10,112,476

COOLING MODULE OF A VEHICLE AIR CONDITIONING SYSTEM, AND ASSEMBLY FOR COOLING A MOTOR VEHICLE ENGINE WITH A COOLING MODULE OF THIS TYPE

VALEO KLIMASYSTEME GMBH, ...

1. A cooling module of a vehicle air conditioning unit for trucks, comprising:a fan which has an air inlet and an air outlet and generates an air flow in an air flow direction from the air inlet to the air outlet; and
a condenser, through which the air flow can pass bi-directionally, for liquefying a refrigerant of the vehicle air conditioning unit, said condenser having an air flow cross section and being arranged adjacent to the air outlet of the fan,
wherein the air flow cross section has a first partial cross section and a second partial cross section which is different from the first partial cross section,
wherein the air outlet of the fan is exclusively assigned to the first partial cross section and loads the first partial cross section in the air flow direction with the entire air flow of the fan, and
wherein, during operation of the fan, the air flow can pass through the second partial cross section optionally in the air flow direction of the fan and counter to the air flow direction of the fan.

US Pat. No. 10,112,375

DRY FIBROUS MATERIAL FOR SUBSEQUENT RESIN INFUSION

Cytec Industries Inc., W...

1. A binder composition in the form of an aqueous dispersion consisting of:a. a polyhydroxyether -polyurethane copolymer, wherein the polyhydroxyether portion of the copolymer is derived from dihydric phenol and saturated epoxide, and the polyurethane portion of the copolymer is a reaction product of a polyisocyanate and a polyether or polyester polyol;
b. a methoxyalkyl melamine aminoplast cross-linker represented by Structures 1, 2, or 3 below:

where R is a methoxymethyl reactive group; and
c. a blocked sulfonic acid catalyst; and
d. water.

US Pat. No. 10,112,358

PRESS FOR SHAPING PELLETS IN A RESTRICTED AND HOSTILE ENVIRONMENT AND METHOD FOR ASSEMBLING THE PRESS

CHAMPALLE, Peronnas (FR)...

1. A press comprising:a die in which pellets are shaped by compression;
a first upper punch and a second lower punch, the upper punch and the lower punch being aligned with the die and penetrating the die by opposite ends of the die to compress the pellets and extract the pellets from the die;
a lower platen to which the lower punch is fastened;
parallel columns, also fastened to the lower platen;
a die platen and an upper punch platen to which the die and the upper punch are respectively fastened, and which are slidingly placed onto the columns;
an upper motor displacing the upper punch platen and a lower motor displacing the die platen by actuating parts;
wherein the actuating parts of the motors are joined to the die platen and to the upper punch platen by detachable connections comprising screws,
the upper punch is joined to the upper punch platen by detachable connections comprising screws,
the lower punch is joined to the lower platen by detachable connections comprising screws, and
the actuating part of the lower motor comprises a knuckle connector joined to the die platen and to an actuating rod of the lower motor, the actuating rod being at a non-zero angle with the columns.

US Pat. No. 10,112,288

METHOD OF CALIBRATING TORQUE USING PEAK HOLD MEASUREMENT ON AN ELECTRONIC TORQUE WRENCH

Snap-on Incorporated, Ke...

1. A calibration fixture having a torque sensor configured to measure an amount of torque being applied by a tool, comprising:a processor in communication with the torque sensor and configured to store a peak applied torque value after the amount of the torque applied by the tool is released;
a display in communication with the processor and configured to display the peak applied torque value; and
an input interface in communication with the processor and configured to receive a calibration torque value.

US Pat. No. 10,112,269

SCREEN PRINTER, COMPONENT MOUNTING LINE, AND SCREEN PRINTING METHOD

PANASONIC INTELLECTUAL PR...

1. A screen printing method comprising:holding a first substrate by a substrate holder placed on a base;
moving an imaging device in a horizontal direction of a mask and the first substrate, and imaging the first substrate held by the substrate holder by the imaging device;
contacting the first substrate held by the substrate holder with the mask before a printing by moving the substrate holder up at a below-mask-position below the mask before the printing based on a result of the imaging of the first substrate;
moving a printing head on the mask to print a paste on the first substrate; and
moving a mask cleaner under the mask after the printing within a moving range of the mask cleaner and cleaning a lower surface of the mask after the printing by the mask cleaner with the first substrate being separated from the mask after the printing,
wherein an imaging of a second substrate is performed when the substrate holder is positioned at an initial position between a feeding conveyor and a discharge conveyor and in line with the conveyors away from the below-mask-position outside the moving range of the mask cleaner in the horizontal direction, while simultaneously, the cleaning of the mask after the printing is performed when the substrate holder holding the second substrate is positioned at the initial position.

US Pat. No. 10,112,255

PLATE BONDING METHOD AND PLATE ASSEMBLY

Korea Institute of Energy...

1. A plate bonding method through lamination and bonding of two or more plates, comprising:a roughness increasing process of increasing a surface roughness of at least one surface of the two or more plates facing each other;
a coating process of uniformly coating microfine ceramic columns on the at least one surface of the two or more plates, wherein the microfine ceramic columns have a diameter of not more than 10 microns; and
a diffusion bonding process of laminating the two or more plates, then bonding the plates under heated and pressurized conditions.

US Pat. No. 10,112,249

BRAZE ALLOY LAYERED PRODUCT

ALFA LAVAL CORPORATE AB, ...

1. A method for providing a braze alloy layered product comprising the following steps:applying a mechanical blend on at least a part of a surface of a substrate, wherein the mechanical blend is a mechanical blend of at least one powder of particles of a silicon source, in which each particle is of a silicon source, and at least one powder of particles of a boron source, in which each particle is of a boron source, wherein the particles have an average particle size less than 250 ?m wherein the at least one boron source and the at least one silicon source are oxygen free except for inevitable amounts of contaminating oxygen, wherein the amount of inevitable amount of oxygen is less than 10 wt %, and wherein the weight ratio in the blend of boron and silicon is within a range from about 3:100 to about 100:3, and wherein silicon and boron are present together in the blend in at least 35 wt %, and wherein the substrate comprises a parent material having a solidus temperature above 1100° C.;
heating the substrate having the applied boron source and the applied silicon source to a temperature lower than the solidus temperature of the parent material of the substrate to form a braze alloy; and
cooling the substrate having the applied boron source and the applied silicon source, and obtaining a layer of braze alloy on the substrate, wherein the layer of braze alloy comprises the silicon source, the boron source and the elements of the parent material, wherein the braze alloy layer has a melting point lower than the parent material;
wherein the silicon source is one or more of elemental silicon, an alloy containing silicon, or a compound containing silicon; and
wherein the boron source is one or more of elemental boron, an alloy containing boron, or a compound containing boron.

US Pat. No. 10,112,247

WIRE ELECTRIC DISCHARGE MACHINE HAVING MOVABLE AXIS ABNORMAL LOAD WARNING FUNCTION

FANUC CORPORATION, Yaman...

1. A wire electric discharge machine that moves an axis in accordance with an axis feed command by a program or an operation of an operator, comprising:a machine learning device that performs machine learning of an adjustment target parameter of the axis feed command in the movement of the axis and an adjustment amount of the adjustment target parameter, wherein
the machine learning device includes:
a state observation section that acquires state data as information indicative of a movement state of the axis in the movement of the axis;
a reward condition setting section that sets a reward condition;
a reward calculation section that calculates a reward based on the state data and the reward condition;
an axis feed command adjustment learning section that performs the machine learning of an axis feed command adjustment; and
an axis feed command output section that determines the adjustment target parameter of the axis feed command and the adjustment amount of the adjustment target parameter as an adjustment action based on a result of the machine learning of the axis feed command adjustment by the axis feed command adjustment learning section and the state data, adjusts the axis feed command based on the determined adjustment action, and outputs the adjusted axis feed command, wherein
the axis feed command adjustment learning section performs the machine learning of the axis feed command adjustment based on the adjustment action, the state data acquired by the state observation section after the movement of the axis based on the outputted adjusted axis feed command, and the reward calculated by the reward calculation section,
the wire electric discharge machine is configured to move the axis in accordance with the outputted adjusted axis feed command,
the reward condition provides a positive reward in a case where a load of the axis does not exceed an abnormal load level of the axis during the movement of the axis, or in a case where damage to a mechanical section of a movable axis does not occur at a time of a collision of the movable axis, and
the reward condition provides a negative reward in a case where the load of the axis exceeds the abnormal load level of the axis during the movement of the axis, or in a case where damage to the mechanical section of the movable axis occurs at the time of the collision of the movable axis.

US Pat. No. 10,112,245

BAND SAW BLADE

Irwin Industrial Tool Com...

1. A band saw blade comprising a bi-metal blade body and a cutting edge defined by a plurality of cutting teeth with repeating pitch patterns and set patterns within pitch patterns, wherein:(i) at least one set pattern includes at least one unset or relatively light set tooth, and at least one relatively heavy set tooth;
(ii) a plurality of teeth within the pitch pattern define different pitches;
(iii) the at least one relatively heavy set tooth defines a heavy set tooth primary clearance angle, the at least one unset or relatively light set tooth defines an unset or relatively light set tooth primary clearance angle, each heavy set tooth primary clearance angle is less than or equal to 9°, each unset or relatively light set tooth primary clearance angle is less than or equal to 15°, and each heavy set tooth primary clearance angle is within the range of 4° to 6° less than each unset or relatively light set tooth primary clearance angle;
(iv) each unset or relatively light set tooth defines at least one of (a) a greater gullet area than the at least one relatively heavy set tooth, and (b) a finer pitch than the respective relatively heavy set tooth; and
(v) each tooth defines a positive rake angle within the range of 3° to 10°.

US Pat. No. 10,112,236

DEVICE AND METHOD FOR THE MANUFACTURE OR REPAIR OF A THREE-DIMENSIONAL OBJECT

MTU AERO ENGINES AG, Mun...

1. A device for the manufacture or repair of a three-dimensional object, comprising:at least one construction chamber for successive solidification of at least one solidifiable material layer by layer in predefined regions for the layer-by-layer buildup of the three-dimensional object or for layer-by-layer repair of individual regions of the three-dimensional object within the construction chamber, and
at least one inlet nozzle and at least one suction nozzle for a process gas, with the inlet nozzle and the suction nozzle being arranged where a gas flow that passes at least partially over a buildup and joining zone of a construction platform formed in the construction chamber is created,
wherein the ratio of the sums of the fluid-dynamically relevant cross-sectional areas of the at least one suction nozzle to the at least one inlet nozzle is 2.5:1 to 0.3:1, and
wherein the at least one suction nozzle comprises at least two suction orifices, wherein said at least two suction orifices are each connected to an associated suction channel in such a way as to carry the flow, and each suction channel has wall surfaces that have a contoured course that is curved at least in sections in the flow direction and the associated suction channels are separated from one another.

US Pat. No. 10,112,192

PIPETTE COMPRISING IMAGING DEVICE ELEMENT

Thermo Fisher Scientific ...

1. A hand-held pipette, comprising:an elongated hand-held body having a handle portion configured for gripping the pipette, a display portion located above the handle portion, and a tip portion located below the handle portion configured for supporting at least one detachable tip;
a cylinder disposed within the body and having a piston movable inside the cylinder for aspiring and dispensing liquid;
an imaging device element supported by the pipette and configured for obtaining at least one image, wherein the imaging device element comprises one of a camera unit or an optical imaging sensor including an optical lens that is focused at an area in front of the at least one tip of the pipette and/or at the at least one tip of the pipette; and
a display supported by the display portion and being configured to display at least one image from the imaging device element.

US Pat. No. 10,112,165

APPARATUS FOR GENERATING FORMALDEHYDE MONOMER VAPOR

Airgas, Inc., Radnor, PA...

1. An apparatus for generating a desired gas, comprising:an effusion tube comprising a first zone and a second zone,
wherein the first zone comprises walls of micro-porous metal tube, and a closed end,
wherein the second zone comprises non-porous metal tube, and an open end,
wherein the two-zone effusion tube is fixtured inside of a larger cylindrical metal jacket with gas entry and exit ports at opposite ends of the jacket, which allows gas to flow over the exterior of the effusion tube,
wherein the effusion tube is configured to contain a matrix comprising media containing a parent compound and an inert media, and
a heating means for heating the effusion tube, thereby producing a desired gas which exits the open end of the metal jacket.

US Pat. No. 10,112,090

HOCKEY BLADE WITH WRAPPED CORE

Bauer Hockey, LLC, Exete...

1. A method comprising:forming a foam core, the core comprising a first core face, a second core face, a top core edge and a bottom core edge;
wrapping the foam core with a first layer of fiber tape, the first layer of fiber tape extending continuously along the first core face, top core edge, second core face and bottom core edge of the foam core, wherein the wrapped core has a first wrapped face, a second wrapped face, a top wrapped edge and a bottom wrapped edge;
supplying the wrapped foam core with a thread, the thread extending along one of the first wrapped face and the second wrapped face;
wrapping a portion of the wrapped core with a second layer of fiber tape;
placing the preform in a mold;
heating the mold;
cooling the mold; and
removing the formed structure from the mold.

US Pat. No. 10,112,044

FEATURES FOR ROUTING CONDUCTORS IN MEDICAL ELECTRICAL LEAD ELECTRODE ASSEMBLIES

MEDTRONIC, INC., Minneap...

1. An implantable medical system, comprising:an electrical paddle lead that comprises:
an insulative carrier including a first side and a second side opposite the first side;
at least one conductive component, the at least one conductive component including at least one tab and an electrode portion having an inward facing surface and an outward facing contact surface, the electrode portion of the at least one conductive component being disposed on the first side of the carrier, each tab of the at least one conductive component extending away from the corresponding electrode portion through the carrier and bending to extend along the second side of the carrier and bending again toward the second side of the carrier to secure the conductive component to the carrier, the carrier extending beneath at least a portion of the electrode portion of the at least one conductive component;
at least one elongate insulative tubular body;
at least one conductor extending within the at least one elongate insulative tubular body, the at least one conductor being electrically coupled to the at least one conductive component, the at least one conductive component being powered by the at least one conductor when the at least one conductor is electrically coupled to a stimulation device; and
an insulative layer molded over the at least one tab and the second side of the carrier to form a first side of a paddle-shaped body of the implantable medical electrical paddle lead.

US Pat. No. 10,112,042

APPARATUS AND METHODS FOR TISSUE ANCHORING OF MEDICAL DEVICES

MEDTRONIC, INC., Minneap...

26. A kit comprising an apparatus for tissue anchoring of an elongate medical device body, and an associated tool configured to engage with the apparatus and thereby facilitate positioning of the apparatus along a length of the device body, and wherein the apparatus comprises:a retention member including a tubular sidewall that extends from a first end of the retention member to a second end of the retention member and defines a lumen of the retention member, the lumen extending along a longitudinal axis of the apparatus from a first opening thereof to a second opening thereof, and the retention member being transformable along the longitudinal axis from a first, gripping state to a second, open state, and vice versa, the first state being that at which the lumen has a first diameter and the first and second ends of the tubular sidewall are spaced apart by a first distance, and the second state being that at which the lumen has a second diameter and the first and second ends of the tubular sidewall are spaced apart by a second distance, the first diameter being smaller than the second diameter, and the first distance being greater than the second distance;
an elastic member secured between the first and second ends of the retention member, the elastic member being spring biased to push the first and second ends apart from one another, thereby holding the retention member in the first, gripping state;
a pair of force interface members, a first of the pair of interface members being coupled to the retention member in proximity to the first end thereof, a second of the pair of interface members being coupled to the retention member in proximity to the second end thereof, and the interface members being configured to receive opposing forces that compress the elastic member, against the spring bias thereof, and thereby transform the retention member to the second, open state; and
a tissue fixation member directed outward from the retention member, when the retention member is in the first, gripping state;
wherein, when the tool engages the apparatus force interface members, the apparatus, with the retention member thereof in the second, open state, is positionable along the length of the device body; andwhen the tool is released from engagement with the apparatus force interface members, the apparatus, with the retention member thereof in the first, gripping state, grips the medical device body;wherein the apparatus further comprises an outer sheath extending between the apparatus force interface members and around the apparatus elastic member;
the apparatus further comprises a deployment member extending alongside the outer sheath of the apparatus and being free to slide relative to the sheath;
the deployment member includes an end secured to the first force interface member of the apparatus and an outward protruding ramp member spaced apart, along the longitudinal axis of the apparatus, from the secured end;
the tissue fixation member of the apparatus comprises a deployable tine or barb element, the tine or barb element including a fixed end and a free end, the fixed end coupled to the second force interface member of the apparatus, and the free end configured to engage with the ramp member of the deployment member; and
when the opposing forces that compress the elastic member of the apparatus are released, the ramp member of the deployment member forces the free end of the tine or barb element outward from the longitudinal axis to engage tissue.

US Pat. No. 10,112,017

PEN TYPE DRUG INJECTION DEVICE WITH LOW FRICTION DOSE ENCODER MECHANISM ON THREAD

Sanofi-Aventis Deutschlan...

1. A drug delivery device comprising:a body component located concentrically within a sleeve, wherein the body component comprises body component thread features and the sleeve comprises sleeve thread features that engage with the body component thread features such that the body component is caused to rotate within the sleeve as the body component and the sleeve component move axially with respect to one another by force of an engaging face of the sleeve thread features against an engaging face of the body component thread features causing sliding of the engaging face of the sleeve thread features over the engaging face of the body component thread features,
wherein the body component is an inner housing,
wherein one of the body component and the sleeve constitutes a first part and the other of the body component and the sleeve constitutes a second part, and
wherein a conductive track pattern is formed on the thread features of the first part and plural electrical contacts are formed on the second part such as to contact the conductive track pattern as the body component rotates within the sleeve.

US Pat. No. 10,112,008

MEDICAL DEVICE FOR ADMINISTERING A SOLUTION

DEBIOTECH S.A., Lausanne...

1. A medical device for administering a solution, said device comprising:a pump that is not inside a patient,
a reservoir that is not inside the patient, and
a communication structure for connecting said reservoir and said pump, wherein said communication structure is not inside the patient, and
a line for connecting the medical device to the patient,
a sensor for measuring an exposure of the solution, which is contained in the reservoir, to temperature, to humidity, or to pressure of the solution, or ageing or permeability of the reservoir, over the course of time,
wherein the medical device uses a mathematical model in order to determine at any moment physical or chemical characteristics of the solution, which is contained in the reservoir, wherein the mathematical model takes account of a modification of the solution in the reservoir over the course of time as a function of an exposure to temperature, to humidity, or to pressure of the solution, or ageing or permeability of the reservoir; and
wherein the medical device informs the patient about refilling the solution or changing the reservoir depending on the modification of the characteristics of the solution.

US Pat. No. 10,112,001

METHOD AND COMPOSITION FOR REMOVING UREMIC TOXINS IN DIALYSIS PROCESSES

BAXTER INTERNATIONAL INC....

1. A method of performing dialysis comprising:passing a dialysis fluid in a first flow direction through a sorbent cartridge in fluid communication with at least one of a patient or a dialyzer, the sorbent cartridge including a housing having a zirconium phosphate layer followed by at least one of a urease layer, a zirconium oxide layer, or a carbon layer, wherein the zirconium phosphate layer is first contacted by the dialysis fluid in the first flow direction before the at least one of the urease layer, zirconium oxide layer or carbon layer;
storing the dialysis fluid in a storage container; and
passing the dialysis fluid from the storage container back through the sorbent cartridge in a reverse flow direction from the first flow direction to reach the patient or the dialyzer.

US Pat. No. 10,111,974

METHOD AND APPARATUS FOR ON-SITE MICROBIAL REMEDIATION AND SANITIZATION OF HOUSEHOLD ITEMS

Vacu Fog LLC, Atlanta, G...

1. A method for remediating a crushable, air permeable, household item that may have been exposed to mold, comprising the steps of:(a) preparing said item to prevent it from being crushed by bracing said item;
(b) sealing said item inside a sealable vacuum bag;
(c) evacuating air from the inside of said bag, said step of evacuating air from the inside of said bag causing the evacuation of air from within said air permeable item occurring after said step of preparing said item;
(d) introducing an antimocrobial remedial fog into said bag;
(e) infusing said antimicrobial remedial fog into said air permeable item; and
(f) removing said item from said bag.

US Pat. No. 10,111,892

ANTI-CANCER AGENT

Nippon Chemical Industria...

1. An anti-cancer agent comprising:at least one kind of phosphine transition metal complex selected from a group of compounds represented by Formulae (1a) to (1d),

at least one kind of phosphine transition metal complex selected from a group of compounds represented by Formulae (2a) to (2c),
anda phosphine transition metal complex represented by Formula (3),

wherein in the Formulae, R1 and R2 represent a linear or branched alkyl group, a cycloalkyl group, a cycloalkyl group having a substituent, an adamantyl group, a phenyl group, or a phenyl group having a substituent that has 1 to 10 carbon atoms; R1 and R2 are different from each other, and R1 has a higher priority than R2 as ranked according to RS notation; R3 and R4 represent a hydrogen atom or a linear or branched alkyl group having 1 to 6 carbon atoms, and may be groups that are the same as or different from each other; R3 and R4 may form a saturated or unsaturated ring by binding to each other, and the saturated or unsaturated ring may have a substituent; M represents an atom of a transition metal selected from a group consisting of gold, copper, and silver; and X? represents an anion; and
wherein the mixing ratio (molar ratio) among the total amount of the compounds represented by Formulae (1a) to (1d), the total amount of the compounds represented by Formulae (2a) to (2c), and the compound represented by Formula (3) is Formulae (1a) to (1d):Formulae (2a) to (2c):Formula (3)=20 to 80:10 to 30:10 to 80.

US Pat. No. 10,111,875

PYRROLOPYRIMIDINE COMPOUNDS AND USES THEREOF

HUTCHINSON MEDIPHARMA LIM...

1. A compound of formula (1):
wherein
R1 is chosen from hydrogen, alkyl, cycloalkyl and heterocycle, each of the said alkyl, cycloalkyl, and heterocycle, in R1 is optionally substituted with one or more groups chosen from optionally substituted lower alkyl, optionally substituted aryl, optionally substituted alkenyl, optionally substituted alkynyl, optionally substituted cycloalkyl, —C(O)Ra, —C(O)ORb, —CN, —C(O)NRcRd, halo, optionally substituted haloalkyl, optionally substituted heterocycle, optionally substituted heteroaryl, —NRcRd, —NReC(O)Ra, —NReC(O)ORb, —NReC(O)NRcRd, —NReS(O)nRf, —NReS(O)nNRcRd, —NO2, —ORb, —S(O)nRf, and —S(O)nNRcRd;
R2 is chosen from aryl, heterocycle, heteroaryl, —S(O)nRf, and —S(O)nNRcRd, wherein said aryl or heteroaryl is selected from the group consisting of
and each of the above said aryl, heterocycle, heteroaryl in R2 is optionally substituted with one or more groups chosen from optionally substituted alkyl, optionally substituted aryl, optionally substituted alkenyl, optionally substituted alkynyl, optionally substituted cycloalkyl, C(O)Ra, —C(O)ORb, —CN, —C(O)NRcRd, halo, optionally substituted haloalkyl, optionally substituted heterocycle, optionally substituted heteroaryl, —NRcRd, —NReC(O)Ra, —NReC(O)ORb, —NReC(O)NRcRd, —NReS(O)nRf, —NReS(O)nNRcRd, —NO2, —ORb, —S(O)nRf, and —S(O)nNRcRd;m is 1 and n is independently chosen from 0, 1, and 2;for each occurrence, Ra, Rb, Rc, Rd, Re and Rf are each independently chosen from hydrogen, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted alkynyl, optionally substituted cycloalkyl, optionally substituted aryl, optionally substituted haloalkyl, optionally substituted heteroaryl and optionally substituted heterocycle,or Re and Rd, with the nitrogen to which they are attached, combine to form a heterocycle ring, which is optionally substituted with one or more groups chosen from halo, lower alkyl, hydroxy, and lower alkoxy, wherein the heterocycle ring further optionally comprises one or two additional heteroatoms chosen from N, O and S,wherein each optionally substituted group above can be unsubstituted or independently substituted with at least one substituent independently chosen from C1-C4 alkyl, cycloalkyl, aryl, heterocycle, heteroaryl, aryl-C1-C4 alkyl, heteroaryl-C1-C4 alkyl-, C1-C4 haloalkyl-, —OC1-C4 alkyl, —OC1-C4 alkylphenyl, —C1-C4 alkylOH, —C1-C4 alkyl-O—C1-C4 alkyl, —OC1-C4 haloalkyl, halo, —OH, —NH2, —C1-C4 alkyl-NH2, —N(C1-C4 alkyl)(C1-C4 alkyl), —NH(C1-C4 alkyl), —N(C1-C4 alkyl)(C1-C4 alkylphenyl), —NH(C1-C4 alkylphenyl), cyano, nitro, oxo, —CO2H, —C(O)OC1-C4 alkyl, —CON(C1-C4 alkyl)(C1-C4 alkyl), —CONH(C1-C4 alkyl), —CONH2, —NHC(O)(C1-C4 alkyl), —NHC(O)(phenyl), —N(C1-C4 alkyl)C(O)(C1-C4 alkyl), —N(C1-C4 alkyl)C(O)(phenyl), —C(O)C1-C4 alkyl, —C(O)C1-C4 haloalkyl, —OC(O)(C1-C4 alkyl), —SO2(C1-C4 alkyl), —SO2(phenyl), —SO2(C1-C4 haloalkyl), —SO2NH2, —SO2NH(C1-C4 alkyl), —SO2NH(phenyl), —NHSO2(C1-C4 alkyl), —NHSO2(phenyl), and —NHSO2(C1-C4 haloalkyl), in which each of phenyl, aryl, heterocycle, and heteroaryl is optionally substituted by one or more groups chosen from halo, cycloalkyl, heterocycle, C1-C4 alkyl, C1-C4 haloalkyl-, —OC1-C4 alkyl, C1-C4 alkyl-OH, —C1-C4 alkyl-O—C1-C4 alkyl, —OC1-C4 haloalkyl, cyano, nitro, —NH2, —CO2H, —C(O)OC1-C4 alkyl, —CON(C1-C4 alkyl)(C1-C4 alkyl), —CONH(C1-C4 alkyl), —CONH2, —NHC(O)(C1-C4 alkyl), —N(C1-C4 alkyl)C(O)(C1-C4 alkyl), —SO2(C1-C4 alkyl), —SO2(phenyl), —SO2(C1-C4 haloalkyl), —SO2NH2, SO2NH(C1-C4 alkyl), —SO2NH(phenyl), —NHSO2(C1-C4 alkyl), —NHSO2(phenyl), and —NHSO2(C1-C4 haloalkyl);or at least one pharmaceutically acceptable salt thereof.

US Pat. No. 10,111,872

FUSED BICYCLIC 2,4-DIAMINOPYRIMIDINE DERIVATIVE AS A DUAL ALK AND FAK INHIBITOR

CEPHALON, INC., Frazer, ...

1. A method of inhibiting anaplastic lymphoma kinase (ALK) and focal adhesion kinase (FAK) in a subject, comprising administering to the subject a pharmaceutical composition comprising a therapeutically effective amount of a compound of Formula (I):
or a salt thereof, and at least one excipient.

US Pat. No. 10,111,864

PHOSPHOINOSITIDE 3-KINASE INHIBITOR WITH A ZINC BINDING MOIETY

Curis, Inc., Lexington, ...

1. A method of producing Compound 1,
comprising the step of reacting Compound 108,

wherein R is methyl or ethyl, with hydroxylamine, thereby producing Compound 1.

US Pat. No. 10,111,862

TRAPS IN THE TREATMENT OF MACULAR DEGENERATION

Aldeyra Therapeutics, Inc...

1. A compound of formula (I):
or a pharmaceutically acceptable salt thereof, wherein:
A and R are attached to adjacent carbon atoms on the phenyl ring, and together with the two carbon atoms to which they are attached, form a five-membered heteroaryl ring containing one nitrogen atom and one oxygen atom, wherein the heteroaryl ring is substituted with X;
X is C1-C10 alkyl, C1-C10 alkyl substituted with C3-C6 cycloalkyl, C3-C6 cycloalkyl, aryl, aryl substituted with C1-C6 alkyl, or C1-C6 alkoxy;
n1 is 1 or 2;
T1 is halogen; and
each D is independently C1-C6 alkyl or C3-C6 cycloalkyl, or two D, together with the carbon atom to which they are attached, form a C3-C6 carbocyclic ring or a saturated heterocycle selected from the group consisting of

wherein “*” denotes the position of the carbon atom to which the two D are attached.

US Pat. No. 10,111,859

METHODS AND COMPOSITIONS ASSOCIATED WITH THE GRANULOCYTE COLONY-STIMULATING FACTOR RECEPTOR

LIGAND PHARMACEUTICALS, I...

1. A method of treating a hematopoietic or neurological disorder selected from the group consisting of granulocytopenia, neutropenia, amyotrophic lateral sclerosis, multiple sclerosis, multiple dystrophy, and spinal cord injury, the method comprising administering an effective amount of a compound of Formula (II) wherein the compound of Formula (II) has the following structure:
a tautomer thereof, or a pharmaceutically acceptable salt thereof,
wherein:
R3 is selected from hydrogen, an optionally substituted C1-C6 alkyl, an optionally substituted C2-C6 alkenyl, an optionally substituted C2-C6 alkynyl, an optionally substituted C1-C6 heteroalkyl, an optionally substituted C3-C8 cycloalkyl, an optionally substituted C3-C8 cycloalkenyl, an optionally substituted C1-C6 heterocycle, an optionally substituted aryl, and an optionally substituted heteroaryl;
R4 is selected from hydrogen, an optionally substituted C1-C6 alkyl, an optionally substituted C2-C6 alkenyl, an optionally substituted C2-C6 alkynyl, an optionally substituted C1-C6 heteroalkyl, an optionally substituted C3-C8 cycloalkyl, an optionally substituted C3-C8 cycloalkenyl, an optionally substituted C1-C6 heterocycle, an optionally substituted heteroaryl, and an optionally substituted heteroarylalkyl;
R9 is selected from hydrogen, an optionally substituted C1-C6 alkyl, an optionally substituted C2-C6 alkenyl, an optionally substituted C2-C6 alkynyl, an optionally substituted C1-C6 heteroalkyl, an optionally substituted C3-C8 cycloalkyl, an optionally substituted C3-C8 cycloalkenyl, an optionally substituted C1-C6 heterocycle, an optionally substituted heteroaryl, an optionally substituted arylalkyl, an optionally substituted arylalkenyl, an optionally substituted arylalkynyl, an optionally substituted heteroarylalkyl, an optionally substituted heteroarylalkenyl, and an optionally substituted heteroarylalkynyl;
W is selected from O (oxygen) and NH;
X is N (nitrogen) or CR2; and
Y is selected from an optionally substituted C1-C6 alkyl, C2-C6 alkenyl, an optionally substituted C1-C6 heteroalkyl, an optionally substituted C1-C6 heteroalkenyl, an optionally substituted phenylalkenyl, and an optionally substituted heterocyclealkenyl.

US Pat. No. 10,111,858

PHARMACEUTICAL FOR PROPHYLAXIS OR TREATMENT OF HYPERTENSION

Daiichi Sankyo Company, L...

1. A method for the treatment of diabetic nephropathy, comprising administering to a subject in need thereof a therapeutically effective amount of a pharmaceutical comprising(i) a mineralocorticoid receptor antagonist represented by formula (I):

an atropisomer thereof, or a pharmacologically acceptable salt thereof, and
(ii) (5-methyl-2-oxo-1,3-dioxolan-4-yl) methyl-4-(1-hydroxy-1-methylethyl)-2-propyl-1-[2?-(1H-tetrazol-5-yl)biphenyl-4-ylmethyl]imidazole-5-carboxylate, or a pharmacologically acceptable salt thereof.

US Pat. No. 10,111,821

METHODS AND COMPOSITIONS FOR ADMINISTERING A SPECIFIC WAVELENGTH PHOTOTHERAPY

Applied Biology, Inc., I...

1. A method of treating a human patient suffering from psoriasis, vitiligo, atopic dermatitis, and/or pruritis, comprising:delivering, from ambient solar radiation, a dose of EMR to skin of a human subject by:
covering a region of the skin with a topical composition;
exposing the human subject to the ambient solar radiation for a predetermined period of time to generate an erythemally weighted irradiance therapeutic response; and
stopping the exposure of the human subject to the ambient solar radiation after the passage of the predetermined period of time;
wherein the topical composition comprises:
a cosmetic-grade carrier suitable for application to the human skin;
a first compound, suitable for application to human skin, which blocks more total radiation within wavelength range B (280 to 300 nm) than it blocks in wavelength range A (300 to 320 nm); and
a second compound, suitable for application to human skin, which blocks more total radiation within wavelength range C (320 to 340 nm) than it blocks in wavelength range A
wherein:
the topical composition blocks a percentage PFB of radiation in wavelength range B that is greater than a percentage PFA of radiation blocked in wavelength range A,
PFA is defined as:

PFB is defined as:

the topical composition blocks a percentage PFC of radiation in wavelength range C (320 to 340 nm) that is greater than PFA, wherein PFC is defined as:

PFC?PFA is at least about 5%; and
? is a wavelength of radiation, I(?) is an intensity of radiation according to solar irradiance standard ASTM G177-03 passing through the topical composition at a given wavelength in W/m2/nm, T(?) is the mean transmittance of a topical composition determined using the methodology outline in the US FDA Broad Spectrum Test (21 CFR 201.327(j), Jul. 5, 2011), and w(?) is a weighting function defined as:

PFB?PFA is at least about 10%; and
further wherein the first compound and the second compound are present in amounts and in a ratio such that the topical composition has an absorbance spectra forming a spectra valley defined by a wavelength range from 306 nm to 315 nm, the spectra valley allowing passage of light to generate the erythemally weighted irradiance therapeutic response,
wherein the topical composition comprises 4% hesperidin by weight percent and 1.125% or 2.5% diethylamino hydroxybenzoyl hexyl benzoate by weight percent.

US Pat. No. 10,111,818

USE OF CHARGED SURFACTANTS FOR REDUCING TEXTILE STAINING BY ANTIPERSPIRANTS

BEIERSDORF AG, Hamburg (...

1. A cosmetic or dermatological preparation, wherein the preparation comprises (i) one or more antiperspirant substances and (ii) one or more surfactants comprising one or more cationic surfactants of formula (I), a weight ratio (i):(ii) being from 1:1 to 30:1wherein:R1 represents a saturated or unsaturated linear alkyl group having from 8 to 24 carbon atoms,
R2 represents a saturated linear alkylene group having from 1 to 10 carbon atoms and being substituted with from 0 to 5 hydroxy groups,
R3, R4, R5 independently of one another represent hydrogen, a C1-C4 alkyl group, a C5 or C6 cycloalkyl group, or a C2-C4 hydroxyalkyl group, and
X represents a monovalent anion.

US Pat. No. 10,111,808

STERILE MEDICATION IDENTIFICATION AND LABELING SYSTEM

ORventions LLC, Westlake...

1. An apparatus for sterile labeling of medications and medical solutions comprising:a medication or medical solution in a first container having a sterile interior and a non-sterile exterior, the first container being received in a second container, the second container having at least a portion thereof being transparent,
at least one sterile printed label containing information specific to the medication or medical solution provided in a third container having a sterile interior and a non-sterile exterior, the third container having at least a portion thereof being transparent,
the third container being removably affixed to the exterior of the second container,
a masking element interposed between the second container and the third container for blocking at least a portion of the information contained on the at least one sterile printed label when the third container is affixed to the exterior of the second container but permitting viewing of the information on the label in the third container when the third container is not affixed to the second container,
whereby the medication or medical solution in the first container may be dispensed into a sterile container in the sterile field and one of the at least one sterile printed labels from the third container may be applied to the corresponding sterile container or medical accessory in the sterile field.

US Pat. No. 10,111,804

DYNAMIC RECOVERY AND THERAPY SYSTEM

Amchi Gendynamy Science C...

1. A massage system for a person's body, comprising:a first massaging unit coupled to an processing module and a power supply;
a first actuator housed in the first massaging unit and configured to apply a first moving pressure to the person's body in a first direction to create a first trace;
a second actuator housed in the first massaging unit and configured to apply a second moving pressure to the person's body in a second direction to create a second trace simultaneously with creation of the first trace by the first actuator;
wherein the first trace comprises a first segment of a perimeter of a rectangle from a first corner of the rectangle to a midpoint of a first edge that is adjacent to the first corner;
wherein the second trace comprises a second segment of the perimeter of the rectangle from a second corner of the rectangle to a midpoint of a second edge that is adjacent to the second corner; and
wherein the first and second edges are parallel.

US Pat. No. 10,111,801

APPARATUS FOR RELIEVING BACK PAIN

1. An apparatus for performing spinal decompression, comprising:a surface for receiving a user, the surface being inclined at an angle, obtuse to a vertical position, the surface having a pair of opposing, parallel sides, each of the pair of opposing, parallel sides having an aperture formed therein;
a support for each of the parallel sides, each support comprising:
a rod having a first end insertable into the aperture and a second end;
the second end inserted into a body; and
an armrest extending outwardly from the body.

US Pat. No. 10,111,799

TRIM-TO-FIT THERAPEUTIC COMPRESSION GARMENT SYSTEM AND METHOD

BSN Medical, Inc., Charl...

9. A method of treating a condition of a patient's limb, the method comprising:obtaining a compression garment wrappable about the limb, wherein the compression garment comprises:
an upper band;
lower bands; and
an attachment mechanism attaching the upper band to the lower bands;
obtaining a template comprising markings showing where to trim the compression garment to fit a smaller size limb, the markings indicating a compressed scale considering stretch at application of the compression garment;
taking a measurement of a circumference of the limb of the patient;
overlaying at least a portion of the compression garment with the template;
cutting the compression garment proximate a marking of the markings matching the measurement;
cutting away the upper band by trimming the attachment mechanism; and
donning the cut compression garment on the limb.

US Pat. No. 10,111,798

METHOD OF FORMING SHEET METAL CASKET SHELL

Batesville Services, Inc....

1. A casket shell precursor from which to fabricate a casket shell, said casket shell precursor comprising a rectangular tube having a pair of opposed side walls and a pair of opposed end walls, said casket shell precursor comprising:a single continuous length of sheet metal having a pair of opposite ends, a planar cross-sectional profile, and configured into said side walls and said end walls,
a rounded corner between adjacent ones of said side walls and said end walls, and
a single weld on one wall of either said side walls or said end walls joining said opposite ends of said single continuous length of sheet metal,
said casket shell precursor sized to contain the remains of a deceased.

US Pat. No. 10,111,793

IV POLE STAND STOP

1. A stop for an IV pole stand having a base mounted on a plurality of wheels and having a pole extending vertically from said base, said stop comprising an attachment member having a central opening adapted to receive said pole, and a stop pad supported on a spring arm cantilevered from said attachment member such that upon said stop pad being stepped on by a person, said spring arm can resiliently deflect downwardly such that said stop pad can be pressed against the floor to hold the pole stand in place on the floor and to resist tipping of the pole stand, wherein said attachment member is a collar comprised of a pair of collar members, a spring for holding said collar members in a closed position such that with said pole received within said central opening said collar members can substantially surround said pole, each of said collar members having a front end and a rear end, the front ends of said collar members being biased to a closed position by said spring, the front ends of said collar members each having a cam surface configured such that upon the front ends of said collar members being forcefully pressed against said pole said cam surfaces can force the front ends of said collar members apart so that said pole can pass therebetween to be received in said central opening and so that when said pole is received in said central opening said spring can resiliently close said collar members, and said stop pad supported on said spring arm cantilevered from one of said collar members such that upon said stop pad being stepped on by the person, said spring arm will resiliently deflect downwardly and said stop pad can be pressed against the floor to hold the pole stand in place on the floor and to resist tipping of the pole stand.

US Pat. No. 10,111,789

WHEELCHAIR WHEEL WINDER

1. A wheelchair hand pedal manual propulsion device that attaches to a wheelchair wheel comprising:a gearbox comprised of a gearbox housing and a plurality of gears configured for speed changing, said plurality of gears encased in said gearbox housing, said gearbox further comprising a drive member that is integrally formed with said housing,
a telescoping hand pedal arm with a first end and a second end, said second end opposite to said first end, wherein said gearbox housing is affixed to said first end,
a pawl and a pawl switch to shift from a forward to backward position with a locked position and a neutral position, said pawl switch located on an exterior surface of said gearbox housing,
a lever to change gears,
a detachable handle, said detachable handle positioned at said second end of said hand pedal arm,
a socket attachment, said socket attachment being attachable at an axis of the wheelchair wheel, said socket attachment configured to receive said drive member such that torque from said drive member is transmitted to said wheelchair wheel,
a first quick release mechanism to detach said drive member from said socket, wherein said gearbox and said drive member are detached from the wheel when said drive member is detached from said socket.

US Pat. No. 10,111,788

PACKAGE CONTAINING A PLURALITY OF WRAPPED ABSORBENT ARTICLES

UNICHARM CORPORATION, Eh...

1. A package comprising:wrapped absorbent articles comprising: an absorbent article having an absorber; and a wrapper for individually wrapping the absorbent article, the absorbent article being placed on the wrapper and folded together with the wrapper, and the absorbent article being wrapped individually by the wrapper; and
a bag containing the plurality of wrapped absorbent articles, wherein
the wrapped absorbent articles are provided with a perfume,
at least one surface of the bag comprises: aperture through which the perfume of the wrapped absorbent articles contained in the bag can pass; and a perfume indicator for indicating an existence of the perfume,
a compressibility of the package is 10% or more when a load of 1.35 kg in weight is applied in an area of 100 mm×200 mm of the package for ten seconds, and
a compression resilience of the package is 95% or more after ten seconds has passed after removal of the load.

US Pat. No. 10,111,784

DEVICE FOR PRODUCING DISPOSABLE WEARABLE ARTICLE AND METHOD FOR PRODUCING DISPOSABLE WEARABLE ARTICLE

Zuiko Corporation, Setts...

1. A device for producing a disposable wearable article, comprising:a doubling unit provided in a line for continuously conveying a sheet and configured to double the sheet together with an absorber such that opposite side edges of the sheet having the absorber arranged thereon are proximate to or overlapped with each other; and
a joining/cutting unit provided in the line and configured to join parts of the doubled sheet at opposite sides of a crotch part having the absorber arranged thereon and then cut the joined parts,
the joining/cutting unit including a drum having a peripheral surface and rotatable with the doubled sheet placed on the peripheral surface, at least one joining mechanism configured to join the parts of the doubled sheet at the opposite sides of the crotch part between the joining mechanism and the drum, a cutting mechanism arranged downstream of the joining mechanism in a rotating direction of the drum and configured to cut the parts of the sheet joined by the joining mechanism between the cutting mechanism and the drum, a claw member mounted on the drum to be vertically movable with respect to the peripheral surface of the drum, and a vertically moving cam mechanism configured to move the claw member downward to press a part of the sheet between the crotch parts against the peripheral surface of the drum on a side upstream of the at least one joining mechanism in the rotating direction of the drum and move the claw member upward to release the pressing on a side downstream of the cutting mechanism in the rotating direction of the drum,
the vertically moving cam mechanism including a cam disc having an eccentric cam groove, facing a side surface of the drum and coaxially arranged with the drum and a cam follower provided on the claw member and configured to be engaged with the eccentric cam groove so that the claw member vertically moves according to the rotation of the drum, and
the joining/cutting unit further including a phase adjusting mechanism capable of adjusting a phase of the eccentric cam groove with respect to the drum.

US Pat. No. 10,111,783

SILICA FIBER COMPOSITION AND METHOD OF USE

American Nano, LLC, Clem...

25. A method for making and using a silica fiber composition, the method comprising:preparing a sol that contains 70% to 90% tetraethyl orthosilicate (TEOS) by weight, 12% to 25% ethanol by weight, 1% to 10% water by weight, and an acid catalyst;
transitioning the sol to a sol-gel for 2 to 7 days under conditions where humidity is within the range of 40% to 80%, and the temperature is within the range of 50 to 90° F.;
electrospinning the sol-gel into a silica fiber mat; and
combining at least a portion of the silica fiber mat with a liquid or gelatinous composition.

US Pat. No. 10,111,780

GOGGLE LENS AND FACE GASKET ENGAGEMENT SYSTEM

Abominable Labs, LLC, La...

1. A goggle having a lens and interchangeable face gasket engagement system comprising:a. a lens member having a posterior inner surface and first and second ends;
b. latch members pivotably attached to said lens member, one latch member attached adjacent each end of said lens member, each latch member having at least one face gasket member engagement portion;
c. a flexible face gasket member further comprising a plurality of corresponding latch member engagement portions, each latch member engagement portion of said gasket member for engaging a corresponding one of the gasket member engagement portions of said latch members, at least one of said lens member and said flexible face gasket member further comprising a plurality of other alignment protrusions thereon, whereas the other of said lens member and said flexible face gasket member further comprises corresponding receptacles aligned with the other protrusions for aligning and helping to retain said face gasket member with said lens member when engaged thereon; and
d. A strap member having first and second ends, each end interconnected to one of said latch members for securing the goggle lens and face gasket engagement system to a user's head.

US Pat. No. 10,111,779

DEVICE AND METHOD FOR LASER ASSISTED DEEP SCLERECTOMY

I Optima Ltd., Ramat-Gan...

1. A method, comprising:providing a laser scanner, wherein the laser scanner is configured to allow to control a direction of at least two converging beams that are generated from at least two light sources;
identifying a target ablating area of an eye overlying at least one of a Schlemm canal and a trabecular meshwork;
utilizing the laser scanner to control the direction of the at least two converging beams to ablate at least a portion of a scleral tissue overlying a percolation layer above one or both of the Schlemm canal and the trabecular meshwork in the target ablating area of the eye so as to achieve, without a full thickness penetration of the Schlemm's canal or the trabecular meshwork, a percolation of an aqueous humor of the eye to reduce an elevated intra-ocular pressure while causing a minimal thermal damage to the percolation layer and surrounding tissue.

US Pat. No. 10,111,778

BSS-ONLY MULTI-SPORT LASER PROBE

Novartis AG, Basel (CH)

1. An optical surgical probe comprising:a cylindrical cannula;
a light guide partially within the cannula, configured
to receive a light beam from a light source through a proximal end,
to guide the light beam to a distal end of the light guide, and
to emit the light beam through the distal end of the light guide;
a multi-spot generator at a distal end of the cannula, the multi-spot generator including
an optical element with a proximal surface to receive the emitted light beam, the optical element having an index of refraction noe in the range of 1.45-1.70; and
a focusing lens comprising at least one of a ball lens, a plano-convex lens, a bi-convex lens, a concave-convex lens, and a meniscus lens, positioned inside the optical element to focus the received light beam into a focused beam, the focusing lens having an index of refraction nfl in the range of 1.65-1.85, wherein
the optical element has a faceted distal surface comprising at least one facet forming an acute facet-angle in the range of 20-60 degrees with respect to a portion of an optical axis centered in the cannula proximal to the faceted distal surface, the at least one facet configured
to split the focused beam into multiple distally emitted beam-components when the optical surgical probe is operated in a fluid with a fluid index of refraction in the range of 1.30-1.40, and
to confine the focused beam into the optical surgical probe when the optical surgical probe is operated in air.

US Pat. No. 10,111,777

TRACTION-LIMITING VITRECETOMY PROBE

Novartis AG, Basel (CH)

1. A vitrectomy probe comprising:a body;
a cutter extending from the body, the cutter comprising:
an outer cutter portion; and
an inner cutter portion slideable within the outer cutter portion between an extended position and a retracted position;
a diaphragm coupled to the inner cutter portion and disposed within a chamber formed in the body and dividing the chamber into a first chamber portion and a second chamber portion, the diaphragm moveable in a first direction to retract the inner cutter portion in response to a first pneumatic pressure introduced into the first chamber portion; and
a first valve coupled to the inner cutter portion, at least a portion of the valve disposed in the first chamber portion and adapted to close upon introduction of the first pneumatic pressure into the first chamber portion.

US Pat. No. 10,111,775

APPLICATOR FOR SUPERFICIAL CORNEAL MEDICAMENTS

1039578 B.C. Ltd, Vancou...

1. A corneal applicator for applying a fluid medicament onto a corneal surface comprising:an elongated, hollow shaft comprising a lumen for holding the fluid medicament, the shaft having a proximal end and a distal end with the lumen extending therebetween, wherein the shaft defines a shaft axis and has a decreasing taper in a distal direction;
a ring member connected with the shaft, wherein the ring member surrounds an aperture and defines a ring plane with a central axis centered in the aperture and perpendicular to the ring plane, and wherein the aperture of the ring member is in fluid communication with the lumen of the shaft; and
an injection portion connected with the proximal end of the shaft configured to inject the fluid medicament into the aperture of the ring member to create a bubble of the fluid medicament held therein by surface tension across the aperture for depositing the fluid medicament onto the corneal surface.

US Pat. No. 10,111,765

ALIGNMENT SYSTEM FOR MULTIPLE BRANCH ENDOGRAFTS

Red Vascular Technologies...

1. A system for treating disease involving branching vessels of a mammal, comprising:a main cover (412) having a main lumen permitting fluid flow therethrough, a first take-off opening (432) wherein the main cover is configured to expand in, and contact a wall of, a main vessel of a mammal; and
a first branch cover (422) attached to the first take-off opening (432) on one side of the main cover (412) and having a branch lumen in fluid communication with the main lumen, wherein the main cover is configured to expand in, and contact a wall of, a first branch vessel that branches from the main vessel;
wherein the branch cover (422) has a longitudinal length extending from the take-off (432) to a distal end of the branch cover and wherein the branch cover is tapered from a wide cross-section where connected to the take-off opening to a narrower cross-section along more distal portions (421) of the branch cover's axial length; and
wherein the branch cover is integrally formed with the main cover and is configured move relatively freely axially, radially, and rotationally along its long axis to accommodate placement in a branch artery whose ostium at a main vessel is axially and/or radially misaligned with the branch graft cover's take-off opening.

US Pat. No. 10,111,764

PROSTHESIS INCLUDING RETRACTABLE ANCHORING MEMBERS

COOK MEDICAL TECHNOLOGIES...

1. A prosthesis for engaging with a body vessel comprising:a tubular frame comprising rings which are concentric along an axis of the tubular frame, the rings have a serpentine shape with apexes in a longitudinal direction such that the rings are configured to move between a compressed configuration and an expanded configuration, a first ring of the rings comprises:
a first apex comprising:
a first anchoring member extending radially outward; and
a first crossbar extending radially inward; and
a second apex that neighbors the first apex,
wherein the first crossbar extends toward the second apex and extends radially inward further than the second apex, and when in the compressed configuration, the first crossbar engages the second apex such that the first apex and the second apex move radially away from each other and the first anchoring member is moved radially inward further than the second apex.

US Pat. No. 10,111,763

NON-CONTACT CAPACITIVE SENSING SYSTEM FOR ROBOTIC LOWER-LIMB PROSTHESIS

Peking University, Beiji...

1. A non-contact capacitive sensing system for a robotic prosthesis, comprising: a sensing front end configured to form coupling capacitors with a human body; a signal sampling unit configured to convert capacitance values of the coupling capacitors to digitalized capacitance signals; and a signal processing unit configured to regulate the digitalized capacitance signals sampled by the signal sampling unit and transmit the regulated digitalized capacitance signals to subsequent processors;wherein the sensing front end is composed of capacitance electrodes with multi channels, each of which is placed between a prosthetic socket and a stump sock and is configured to couple with the human body to form the coupling capacitors; the capacitance electrodes are adhered to an outer surface of the stump sock and insulated from an inner surface of the prosthetic socket with insulated tapes and all electrodes are connected to the signal sampling unit with shielding lines;
wherein the signal sampling unit comprises a capacitance-to-digital (CTD) module disposed over a reference capacitor and a control module; wherein the CTD module is configured to measure a charge-and-recharge cycle time of the reference capacitor and the coupling capacitors under test, and transmit a value to the control module; the control module is configured to calculate under-test capacitance values based on a ratio of charge-and-recharge cycle between the reference capacitor and the coupling capacitors under test, and transmit the capacitance value to the signal processing unit; and
wherein the signal processing unit comprises a digital filter module and a communication module; the digital filter module is configured to remove noises in the capacitance value to obtain filtered data; the communication module is configured to transmit the filtered data to the subsequent processors.

US Pat. No. 10,111,759

METHOD AND APPARATUS FOR MINIMALLY INVASIVE INSERTION OF INTERVERTEBRAL IMPLANTS

DePuy Synthes Products, I...

1. A method for accessing a patient's intervertebral disc to be treated in orthopedic surgery, comprising the steps of:passing a first dilator tube along a first longitudinal axis through Kambin's triangle until the first dilator tube reaches the intervertebral disc to be treated; and
passing a second dilator tube along a second longitudinal axis that is parallel to and laterally displaced from the first longitudinal axis, until a distal portion of the second dilator tube contacts an annulus, wherein the second dilator tube has cutting flutes oriented towards an inferior pedicle, and wherein the distal portion of the second dilator tube has a generally semi-annular cross-section, configured such that the second dilator tube does not contact an exiting nerve during insertion.

US Pat. No. 10,111,758

EXPANDABLE INTERVERTEBRAL CAGE ASSEMBLIES

SPECTRUM SPINE IP HOLDING...

1. An expandable cage for insertion into an intervertebral space, comprising:a cage body having an upper portion and a lower portion, the upper portion having an upper bone contact surface and an upper portion lower surface, the lower portion having a lower bone contact surface and a lower portion upper surface, wherein the upper portion and the lower portion each define a window configured to permit bone growth therethrough
an elongate expander positioned substantially therebetween the upper portion lower surface and the lower portion upper surface, the elongate expander comprising a feature for receipt of a means for actuating longitudinal translation of the elongate expander, wherein longitudinal translation of the elongate expander in a proximal direction causes the expander to act upon portions of the upper portion and the lower portion to expand the cage body by separating the upper portion from the lower portion; and
wherein the expandable cage comprises a tapered distal end tapering from a proximal portion to the distal end and extending at least partially beyond a distal end of the upper and lower portions when the expandable cage is in an unexpanded position.

US Pat. No. 10,111,753

ADDITIVE AND SUBTRACTIVE MANUFACTURING PROCESS FOR PRODUCING IMPLANTS WITH HOMOGENEOUS BODY SUBSTANTIALLY FREE OF PORES AND INCLUSIONS

Titan Spine, Inc., Mequo...

1. A method for producing an implant substantially free of pores and inclusions and having one or more bioactive surfaces, comprising:(a) melting a metal source material to form a molten metal;
(b) depositing the molten metal onto a substrate to form a layer of the implant;
(c) depositing the molten metal onto the previously formed layer of the implant to form the next layer of the implant, wherein depositing the molten metal according to this step partially melts the previously formed layer onto which the molten metal is deposited, thereby producing a substantially homogenous and substantially unitary crystal structure between the previously formed layer and the next layer;
(d) repeating step (c) until the implant is completed;
(e) optionally, partially remelting one or more surfaces of the implant to smooth the one or more surfaces;
(f) etching or partially melting one or more surfaces of the implant to form macro structures and micro structures in the one or more surfaces; and
(g) after step (f), etching the one or more surfaces of the implant to form nano structures in the one or more surfaces, thereby producing an implant substantially free of pores and inclusions and having one or more bioactive surfaces, with the proviso that the method does not include remelting or compression of the implant to homogenize the layers.

US Pat. No. 10,111,752

CRANIOPLASTY PLATE

UNIVERSITY OF IOWA RESEAR...

1. A cranioplasty plate, comprising: a body adapted to cover a skull opening exposing the brain and having opposite upper and lower surfaces and a perimeter edge; a gasket on the lower surface of the body adjacent the perimeter to space the body apart from the skull; the gasket being adapted to shrink over time so that the body settles onto the skull;elastic fasteners fixed to the body and extending radially outward; and
cranial screws adapted to fix the elastic fasteners to the skull;
whereby the elastic fasteners pull the body towards the skull as the gasket shrinks over time.

US Pat. No. 10,111,751

NATIVE VALVE REPAIR DEVICES AND PROCEDURES

Edwards Lifesciences Corp...

1. A valve repair device for repairing a native valve of a patient, the valve repair device comprising:a pair of paddles that are movable between an open position and a closed position;
a pair of gripping members that each have a barbed portion for securing the gripping member to the native valve of the patient;
wherein each gripping member of the pair of gripping members is slidably attached to a corresponding paddle of the pair of paddles;
wherein each gripping member is moved in a first direction along the paddle before the barbed portion of the gripping member pierces the native valve of the patient; and
wherein each gripping member is moved in a direction along the paddle substantially opposite the first direction after the barbed portion pierces the native valve of the patient such that the gripping members create a tensioning force on the native valve of the patient.

US Pat. No. 10,111,750

METHOD AND APPARATUS FOR THERAPY OF AORTIC VALVE

Jeko Metodiev Madjarov, ...

1. A device for supporting a valve annulus comprising:a plurality of spaced apart support members configured to be sutured to tissue surrounding a valve opening so as to support leaflets of the valve to promote sufficient closure of the leaflets;
a connecting member extending between and connecting the support members; and
at least one adjustor engaged with the connecting member and configured to modify a length of the connecting member between two adjacent support members,
wherein each support member comprises at least two channels extending through at least a portion of a length of the respective support member at different heights with respect to an overall thickness of the respective support member,
wherein each channel is configured to receive a portion of the connecting member therethrough, wherein each support member comprises a passageway between the at least two channels, and
wherein each passageway is configured to allow selection of one of the channels for receipt of the connecting member such that the device is configured to be adjusted in at least two dimensions to support the valve leaflets and promote sufficient closure of the leaflets.

US Pat. No. 10,111,749

PROSTHETIC VALVE WITH FLOW DIRECTOR

Medtronic Vascular, Inc.,...

1. A prosthetic valve having an inflow end opposite an outflow end, the prosthetic valve comprising:a stent frame defining a lumen;
a valve structure disposed within the lumen and configured to define an inflow side and an outflow side opposite the inflow side;
wherein an outflow track is established within the lumen downstream of the outflow side and along which fluid flow from the valve structure progresses; and
a baffle structure connected to the stent frame downstream of the outflow side; wherein the baffle structure further includes a plurality of baffle members each projecting into the lumen.

US Pat. No. 10,111,746

PROSTHETIC CAPSULAR DEVICES, SYSTEMS, AND METHODS

Omega Ophthalmics LLC, V...

1. A prosthetic capsular device configured to be inserted in a natural capsular bag of an eye after removal of a lens, the device comprising:a housing structure capable of containing an intraocular device, the housing structure comprising:
an anterior portion, wherein the anterior portion comprises an anterior opening, wherein the anterior opening is capable of allowing at least one of insertion, removal, or replacement of the intraocular device, and wherein the anterior opening is further configured to be coupled to a refractive surface to cover the anterior opening;
a posterior portion, wherein the posterior portion comprises a posterior opening wherein the posterior opening is capable of allowing at least one of insertion, removal, or replacement of the intraocular device, and wherein the posterior opening is further configured to be coupled to a refractive surface to cover the posterior opening; and
a continuous lateral portion interposed between the anterior portion and the posterior portion, wherein the continuous lateral portion protrudes radially beyond the anterior portion and the posterior portion, wherein the continuous lateral portion fully encloses a lateral side of the housing structure, wherein an internal cavity of the continuous lateral portion forms a groove for containing the intraocular device,
wherein the housing structure is symmetrical over a plane at a midpoint of the continuous lateral portion between the anterior portion and the posterior portion; and
a refractive surface configured to be attached to at least one of the anterior opening or the posterior opening;
wherein the refractive surface comprises a plurality of tabs for affixing the refractive surface to at least one of the anterior opening or the posterior opening, and wherein the plurality of tabs protrudes from the refractive surface in alternating posterior and anterior directions.

US Pat. No. 10,111,745

ACCOMMODATING INTRAOCULAR LENS

LensGen, Inc., Irvine, C...

1. An accommodating intraocular lens (IOL) comprising:an anterior lens;
a flexible posterior surface comprising a concave central portion surrounding an optical axis, wherein the concave central portion is coupled to an outer circumferential portion of the flexible posterior surface;
an articulating member joining the anterior lens and the posterior surface, the articulating member comprising anterior and posterior arms coupling the anterior lens and the posterior surface, respectively, and a peripheral portion coupled to the anterior and posterior arms, the peripheral portion having a length extending radially away from the anterior and posterior arms and having a thickness that is greater than each of a thickness of the anterior arm and a thickness of the posterior arm; and
a first posterior flex region disposed about the posterior arm and at a distance from the peripheral portion, the first posterior flex region permitting the flexible posterior surface to articulate relative to the posterior arm, to decrease the radius of curvature of the posterior surface as the peripheral portion on opposing sides of the IOL move toward one another in a first state and to increase the radius of curvature of the posterior surface as the peripheral portion on opposite sides of the IOL move away from one another in a second state, the first posterior flex region having a reduced thickness as compared to each of the posterior arm and the flexible posterior surface.

US Pat. No. 10,111,743

WRAPPING CLIP FOR SECURING A FLEXIBLE LINE TO ANOTHER OBJECT

SOUTHWEST RESEARCH INSTIT...

1. A securing device configured to facilitate the securing of a flexible line to another object, the device comprising:a single continuous length of wire, shaped to form the following elements:
a main shaft having a working end and a clip end;
a first loop extending from the main shaft in a first direction;
wherein the first loop is formed as a continuous loop having a first loop beginning at the clip end of the main shaft, curving away from the main shaft, and curving back toward the main shaft to a first loop end;
second loop extending from the main shaft in a second direction and in the same plane as the first loop;
wherein the second loop is formed as a continuation of the wire, beginning from where the first loop ends at the main shaft, extending past the main shaft, and curving back toward the beginning of the first loop, such that the second loop has a second loop end tightly adjacent to the first loop beginning, such that when the line is wrapped between the first loop and the second loop, there is a first point of contact between the line and the clip that contributes to frictional retention of the line in the clip
a locking clip formed as straight secondary shaft extending from the second loop end, parallel to and tightly adjacent to the main shaft such that when the line is wedged between the main shaft and the secondary shaft, there is a second point of contact between the line and the clip that contributes to frictional retention of the line in the clip;
wherein the working end of the main shaft ends at the lowermost extremity of the securing device and the first and second loop form the uppermost extremity of the securing device.

US Pat. No. 10,111,740

DECELLULARIZED BIOLOGICALLY-ENGINEERED TUBULAR GRAFTS

Regents of the University...

1. A decellularized, biologically-engineered, tubular extracellular matrix comprising circumferentially aligned fibers and exhibiting a burst pressure of at least 4000 mm Hg and greater tensile stiffness in the circumferential direction than in the longitudinal direction, wherein the decellularized, biologically-engineered, tubular extracellular matrix is made by a method comprising: preparing a hydrogel comprising matrix-producing cells, fibrinogen and thrombin, wherein the matrix-producing cells comprise fibroblasts and are grown for between three five and seven passages before being combined with the fibrinogen and thrombin; molding the hydrogel around a mandrel into a hollow tubular hydrogel; culturing the hollow tubular hydrogel under appropriate conditions that comprises circumferentially stretching or distending the hollow tube while providing or allowing for an axial length of the hollow tube to shorten, wherein, upon culturing the tubular hydrogel under appropriate conditions, the matrix-producing cells, the fibrinogen and the thrombin produce a cell-produced tubular extracellular matrix; removing the mandrel from the cell-produced tubular extracellular matrix; and decellularizing the cell-produced tubular extracellular matrix, thereby producing the decellularized, biologically-engineered, tubular extracellular matrix.

US Pat. No. 10,111,735

DOUBLE-CUSHIONED DENTAL IMPLANT

JTI BIOMED CORP., Tainan...

1. A dental implant comprising:a solid base member;
an abutment;
an implant-abutment junction (IAJ) portion at one end of said base member to retain said abutment to said base member, so that said abutment is able to move within a predetermined distance in an axial direction of said base member, wherein said one end of said base member is a flat closed end;
a first cushion adapted to be sandwiched between said abutment and said flat closed end of said base member only in said axial direction; and
a second cushion adapted to be sandwiched between said IAJ portion and said abutment,
wherein the first cushion and the second cushion are two separate members.

US Pat. No. 10,111,716

SYSTEM FOR AND METHOD OF PERFORMING SONASURGERY

SONACARE MEDICAL, LLC, , ...

1. A system for performing a surgical procedure, the system comprising:preoperative images of a region of a patient to be treated;
a room coordinate system established by a minimum of three reference markers placed or identified on the patient, the room coordinate system configured to create a uniform reference point in an operating room for the surgical procedure;
a sheath configured to be inserted at least partially into a single surgical port created in the patient proximate a target volume;
a series of interchangeable probes configured to be inserted in series at least partially into the sheath, each probe including a shaft and at least one tool at a distal end thereof, the at least one tool of one of the series of interchangeable probes including i) at least one sensor configured to provide at least one operative image of the target volume of the patient and ii) at least one of a laser, a haptic feedback sensor, a pressure sensor, and a transducer configured to provide at least one of ultrasound imaging and therapy, a proximal end of the shaft of each probe being operatively connected to at least one motor to permit manipulation of at least one of a position and an orientation of the at least one tool; and
at least one controller configured to i) fuse, prior to commencing the surgical procedure, the at least one operative image from the sensor with the preoperative images, ii) manipulate at least a portion of one of the series of interchangeable probes to treat the target volume, iii) track the at least one tool in real-time, and iv) display the position of the at least one tool on a screen,
wherein the at least one controller monitors a position and orientation of the sheath such that the probes are inserted and removed from the sheath while maintaining a desired orientation of all of the probes along a same or substantially same trajectory into and out of the sheath.

US Pat. No. 10,111,713

SURGERY ASSISTANCE APPARATUS, SURGERY ASSISTANCE METHOD AND NON-TRANSITORY COMPUTER-READABLE RECORDING MEDIUM HAVING STORED THEREIN SURGERY ASSISTANCE PROGRAM

FUJIFILM CORPORATION, To...

1. A surgery assistance apparatus that is connected to a display device, the apparatus comprising:a memory; and
a processor connected to the memory and configured to:
obtain a three-dimensional medical image of a subject to be examined;
extract a region of target tissue from the obtained three-dimensional medical image;
extract an abnormal region from the extracted region of target tissue;
obtain, based on each of at least two excision region determination conditions, at least two excision methods, each of which is classified by excision regions satisfying the each of at least two excision region determination conditions for the abnormal region; and
display images on the display device, of the at least two obtained excision methods,
wherein each of the images is generated according to each of the at least two excision methods, and is displayed on the display device so that an excision region which is determined by each of the at least two excision methods, is distinguishable from another region,
wherein the processor obtains evaluation values corresponding to the respective excision region determination conditions,
wherein the display device displays the obtained evaluation values, and
wherein the display device displays a list in which the excision methods corresponding to the respective excision region determination conditions and the evaluation values are correlated with each other.

US Pat. No. 10,111,711

ROBOTIC SURGICAL DEVICES, SYSTEMS, AND RELATED METHODS

Board of Regents of the U...

1. A robotic device sized to be positioned completely within a patient, the device comprising:a. a body component;
b. a first rotating shoulder component;
c. a second rotating shoulder component;
d. a first movable segmented robotic arm operationally connected to the body component by way of the first shoulder component, the first movable segmented robotic arm comprising:
i. an upper first arm link;
ii. a lower first arm link;
iii. a first operational component; and
iv. at least one first arm motor;
e. a second movable segmented robotic arm operationally connected to the body component by way of the second shoulder component, the second movable segmented robotic arm comprising:
i. an upper second arm link;
ii. a lower second arm link;
iii. a second operational component; and
iv. at least one second arm motor; and
f. an elongate support beam operably coupled to the body component at a distal end of the support beam, wherein the elongate support beam is configured to be positionable through a port into a body cavity of the patient such that a distal portion of the elongate support beam is positioned within the body cavity and a proximal portion of the elongate support beam is positioned outside the body cavity.

US Pat. No. 10,111,703

ELECTROSURGICAL GENERATOR

COSMAN INSTRUMENTS, LLC, ...

1. A system for tissue ablation that includes a radiofrequency generator, a radiofrequency ablation electrode, and a controller; wherein the radiofrequency generator is configured to deliver a radiofrequency signal via the radiofrequency ablation electrode; wherein the controller automatically produces a sequence of on periods and off periods; wherein during each on period, the controller configures the signal level to heat tissue in order to increase the volume ablated tissue and to produce boiling in the tissue; wherein during each off period, the controller configures the signal level to allow for cooling of heated tissue; wherein the controller terminates an on period based in part on a measured indication of boiling in the tissue; wherein after the signal is first configured to heat tissue in order to increase the volume ablated tissue, the controller configures both increases and decreases of the signal level delivered during on periods based in part on the duration of a present on period or of a previous on period.

US Pat. No. 10,111,701

MICRO-BIPOLAR ENDOSCOPIC ENDONASAL CAUTERY DEVICE

THE REGENTS OF THE UNIVER...

1. An endoscopic electrosurgical forceps apparatus, comprising:a proximal handle assembly comprising at least one actuating handle;
an outer tube having a longitudinal axis and a proximal end coupled to and extending from said proximal handle assembly;
an inner shaft slidably disposed in said outer tube, said inner shaft having a proximal end coupled to the proximal handle assembly;
wherein the inner shaft and outer tube are coupled to the proximal handle assembly such that actuation of the at least one actuating handle drives the inner shaft to translate axially within the outer tube along the longitudinal axis;
a pair of forceps tips each having a free distal end and a proximal end coupled to the inner shaft via an actuating member; and
a coupling member coupled to the actuating member and forceps tips;
said forceps tips being slidably coupled to said coupling member such that axial motion of the inner shaft within the outer tube as a result of operation of said proximal handle assembly drives the forceps tips to open and close with respect to each other;
wherein motion of the forceps tips from an open orientation to a closed orientation is substantially orthogonal to the longitudinal axis such that the distal ends of the forceps tips are constrained at the same axial location along the longitudinal axis;
wherein the forceps tips comprise bipolar electrosurgical electrodes configured to cauterize tissue in contact with the forceps tips;
wherein each of the forceps tips form a dovetail joint with respect to the coupling member;
wherein the dovetail joint constrains motion of the forceps tips orthogonally to the longitudinal axis;
wherein the actuating member is fixed to a distal end of the inner shaft;
wherein the coupling member is fixed to the outer tube; and
wherein the actuating member is configured to slideably reciprocate within an axial channel of the coupling member to drive actuation of the forceps tips.

US Pat. No. 10,111,699

RF TISSUE SEALER, SHEAR GRIP, TRIGGER LOCK MECHANISM AND ENERGY ACTIVATION

Ethicon LLC, Guaynabo, P...

1. An electrosurgical instrument for operating on tissue, comprising:a first arm comprising a first handle and a first jaw;
a second arm pivotally connected to the first arm, the second arm comprising:
a second handle;
a second jaw comprising an electrode operable to deliver radio frequency (RF) energy to tissue;
an energy button operable to activate the RF energy;
a knife configured to translate within slots defined in the first and second jaws; and
a push plate operably connected to the knife such that a proximal motion of the push plate extends the knife and a distal motion of the push plate retracts the knife; and
a knife lockout mechanism comprising a first end of a movement arm pivotally connected at a first end of the first arm, wherein the movement arm is operable to prevent operation of the knife.

US Pat. No. 10,111,691

EXPANDABLE INTRAMEDULLARY SYSTEMS AND METHODS OF USING THE SAME

Globus Medical, Inc., Au...

1. A system for stabilizing a long bone, the system comprising:an expandable intramedullary nail configured to extend through an intramedullary canal of a long bone, the intramedullary nail having a proximal portion and a distal portion, the proximal portion having an opening extending therethrough, and the distal portion having one or more expandable fixation members disposed in the intramedullary nail in a contracted position, wherein, upon mechanical actuation of the one or more fixation members, the one or more fixation members linearly extend from the intramedullary nail to an expanded position to securely anchor the distal portion of intramedullary nail in the intramedullary canal; and
a proximal anchor positioned through the opening and configured to secure the proximal portion of the intramedullary nail,
wherein the one or more expandable fixation members have an outer surface that is substantially planar with a curve that conforms to a cross-sectional shape of the intramedullary nail, and
wherein each outer surface of the one or more expandable fixation members is substantially parallel to the intramedullary nail when extended to the expanded position.

US Pat. No. 10,111,688

SYSTEM FOR TREATING BONE FRACTURES

McGinley Engineered Solut...

1. A method for restoring a subchondral bone fragment of a fractured bone, comprising:providing a beam proximate to the subchondral bone fragment; and
rotating the beam about an axis of rotation so as to reposition the subchondral bone fragment, wherein rotating the beam comprises inserting a positioning device through the bone to engage the beam such that the beam rotates about the axis of rotation and repositions the subchondral bone fragment.

US Pat. No. 10,111,685

METHOD AND STRUCTURE FOR SELECTIVELY LOCKING PORTIONS OF A SEAL ASSEMBLY

Covidien LP, Mansfield, ...

1. A seal assembly for a surgical access device, the seal assembly comprising:a lower housing configured to couple to a sleeve of the surgical access device;
an upper housing supported on the lower housing and movable relative to the lower housing between first and second rotational orientations to selectively secure the upper and lower housings together; and
a first lock component secured to the lower housing and a second lock component secured to the upper housing, the first lock component configured to move between a locked position to engage the second lock component and retain the upper and lower housings in the second rotational orientation to prevent removal of the upper housing from the lower housing, and an unlocked position to enable the upper housing to move to the first rotational orientation and enable the upper housing to be removed from the lower housing, the first lock component normally biased toward the locked position.

US Pat. No. 10,111,681

HAND HELD DERMAPLANING DEVICE AND DERMAPLANING PROCESS

DD Karma LLC, Highland P...

1. A blade assembly for use with a hand-held skin treatment device, the skin treatment device including first and second rails for detachably coupling the blade assembly thereto, the blade assembly comprising:an elongated blade holder configured to be slidably attached to the skin treatment device in a longitudinal direction, the blade holder including first and second ends and first and second sides extending in the longitudinal direction between the first and second ends;
first and second slots extending in the longitudinal direction between the first and second ends of the blade holder, the first slot extending along the first side and the second slot extending along the second side, the first and second slots configured to slidably receive the first and second rails of the skin treatment device;
an elongated blade supported by the blade holder, the blade extending in the longitudinal direction and including a cutting edge; and
at least one first notch located on the first side of the blade holder and at least one second notch located on the second side of the blade holder, the at least one first and second notches located between the first and second slots and the blade edge, each of the at least one first and second notches configured to cooperate with a blade retainer to hold the blade holder in position on the blade retainer for slidably attaching the blade assembly to the skin treatment device when the blade assembly is held by the blade retainer, wherein the at least one first notch extends directly from the first slot and the at least one second notch extends directly from the second slot, each notch extending in a lateral direction toward the cutting edge.

US Pat. No. 10,111,680

THERAPEUTIC ULTRASOUND SYSTEM

Flowcardia, Inc., Tempe,...

1. An ultrasound catheter comprising:an elongated catheter body having a proximal end, a distal end and at least one lumen extending longitudinally therethrough;
a proximal housing that is coupled to the proximal end of the elongated catheter body, the proximal housing having a distal bore;
an ultrasound transmission member extending longitudinally through the lumen of the catheter body;
a sonic connector positioned on the proximal end of the ultrasound transmission member for connecting the ultrasound transmission member to a separate ultrasound generating device at a connection location, the sonic connector comprising a proximal section for connection to the separate ultrasound generating device, and a front portion which connects to the proximal end of the ultrasound transmission member;
and
an absorber retained inside the distal bore of the proximal housing and which substantially surrounds the ultrasound transmission member.

US Pat. No. 10,111,676

LOOPED CLOT RETRIEVER WIRE

COOK MEDICAL TECHNOLOGIES...

1. A clot retrieval system comprising:an elongated sheath having a lumen disposed therein, the lumen having an inner diameter;
a wire assembly disposed within the elongated sheath, the wire assembly comprising a straight section and a curved section, a distal end of the straight section connected to a proximal end of the curved section, the curved section being comprised of a first wire segment extending distally from the proximal end of the curved section and biased to curve in a first circumferential direction, a second wire segment extending distally from the proximal end of the curved section and biased to curve in a second circumferential direction opposite the first circumferential direction, the first wire segment and second wire segment forming a first loop having a first loop proximal end and a first loop distal end, the first wire segment being connected to the second wire segment at the first loop proximal end and the first loop distal end to prevent the first wire segment from moving relative to the second wire segment, a third wire segment extending distally from the first loop distal end and biased to curve in the first circumferential direction, a fourth wire segment extending distally from the first loop distal end and biased to curve in the second circumferential direction, the third wire segment and fourth wire segment forming a second loop having a second loop proximal end and a second loop distal end, the third wire segment being connected to the fourth wire segment at the second loop proximal end and the second loop distal end to prevent the third wire segment from moving relative to the fourth wire segment, wherein the second loop proximal end is connected to and extends from the first loop distal end, and a side view of the first loop and the second loop is arc-shaped;
an elastic membrane secured to the third wire segment and the fourth wire segment and not secured to the first wire segment or second wire segment, the membrane bridging the second loop and configured to collect clot material; and
a mesh comprised of a plurality of woven filaments secured to the first wire segment and the second wire segment and not secured to the third wire segment or the fourth wire segment, the mesh bridging the first loop and configured to break up a clot into smaller pieces;
wherein the curved section of the wire assembly is disposed on only one side of an axis defined by the straight section of the wire assembly.

US Pat. No. 10,111,674

DEVICES AND METHODS FOR VERTEBROSTENTING

Globus Medical, Inc., Au...

1. A method for treating a vertebral body comprising:inserting a distal end of a flexible shaft assembly through a cannula and into the vertebral body; and
moving a lever and cam subassembly of the flexible shaft assembly from a first position to a second position, thereby applying a curving force to the distal end of the flexible shaft assembly,
wherein the flexible shaft assembly further comprises a handle and a compression spring within the handle,
wherein the lever rotates away from the handle in the first position causing the cam subassembly to compress the compression spring and straighten the distal end of the flexible shaft assembly, and
wherein the lever is positioned against the handle in the second position causing the compression spring to expand and curve the distal end of the flexible shaft assembly.

US Pat. No. 10,111,672

SURGICAL CLOSURE DEVICES INCLUDING A STAPLING MEMBER

BOSTON SCIENTIFIC SCIMED,...

1. A medical device for delivery of a surgical closure member, comprising:an elongate tubular member having a proximal end, a distal end and a lumen extending therein, wherein the elongate tubular member is adapted to be delivered through the working channel of an endoscope, and wherein the lumen is adapted to receive a surgical closure member;
a tissue support extending from the distal end of the elongate tubular member, wherein the tissue support includes a support surface, and wherein the support surface is adapted to support tissue as a surgical closure member engages the tissue thereon; and
an orienting member coupled to the distal end of the elongate tubular member, the orienting member being rotatable to rotate the surgical closure member to a desired direction.

US Pat. No. 10,111,670

EXPANDABLE VASCULAR OCCLUSION DEVICE WITH LEAD FRAMING COIL

DePuy Synthes Products, I...

1. An occlusion device comprising:an inner embolic element comprising a proximal section and a distal section, wherein the distal section has a first stiffness and the proximal section has a second stiffness that differs from the first stiffness; and
an expandable mesh capable of being transformed between a collapsed position and an expanded position,
wherein the expandable mesh is disposed over a portion of the proximal section of the inner embolic element, and
wherein the occlusion device is permanently deployed into an aneurysm.

US Pat. No. 10,111,667

SUTURELESS VASCULAR ANASTOMOSIS CONNECTION

ASFORA IP, LLC, Sioux Fa...

1. A sutureless vascular anastomosis system, comprising:a connector configured to couple with a first vessel and a second vessel when the connector is inserted into an incision of the second vessel and configured to be inserted into a lumen of a support tube, the connector having a deployable barb that is integrally formed in the connector, the deployable barb having a barb junction integrally formed in the connector, the deployable barb configured to bend away from the connector at the barb junction in a direction towards the second vessel when deployed, the support tube configured to secure the first vessel to the second vessel, the support tube having a body configured to partially house the first vessel and a ring disposed circumferentially about and raised over a surface of the body; and
an incision seal configured to couple with the connector, the incision seal comprising a groove disposed within a lumen formed by an interior surface of the incision seal, the groove configured to couple with the ring when the support tube is received into the lumen of the incision seal, the deployable barb being configured to puncture a wall of the second vessel and to engage with the incision seal, the incision seal having a base configured to support the wall and also having a lumen configured to receive the support tube.

US Pat. No. 10,111,663

IMPLANT RETRIEVAL DEVICE

Ancora Heart, Inc., Sant...

1. A retrievable implant assembly comprising:an anchor delivery catheter comprising a proximal end, a distal end, and a longitudinal lumen therebetween;
an implantable tissue anchor disposed within the longitudinal lumen of the anchor delivery catheter, wherein the implantable tissue anchor comprises an eyelet;
a tether coupled to the tissue anchor eyelet and extending through the longitudinal lumen of the anchor delivery catheter from the proximal end;
an implant retrieval device comprising:
an outer elongate body having a first longitudinal lumen extending therethrough;
an inner elongate body configured to be slidably disposed within the first longitudinal lumen, wherein the inner elongate body comprises a second longitudinal lumen and a stop located within the second longitudinal lumen at a distal portion thereof;
an actuator slidably coupled to the inner elongate body;
a retrieval cable slidably disposed within the second longitudinal lumen of the inner elongate body and connected to the actuator such that the retrieval cable at least partially surrounds the stop to define a loop configured to capture the tether therein; and
a retainer comprising a clamp disposed over the inner elongate body that locks the position of the actuator with respect to the inner elongate body such that the tether is restrained within the loop against the stop.

US Pat. No. 10,111,661

MATRIX METALLOPROTEINASE INHIBITING ADJUNCTS FOR SURGICAL DEVICES

Ethicon LLC, Guaynabo, P...

1. A staple cartridge assembly for use with a surgical stapler, comprising:a cartridge body having a plurality of staple cavities, each staple cavity having a surgical staple disposed therein;
a biocompatible adjunct material releasably retained on the cartridge body and configured to be delivered to tissue by deployment of the staples in the cartridge body to form a staple line; and
an effective amount of at least first and second medicants disposed within and releasable from the adjunct material along the staple line, the first medicant having a first absorbable coating configured to dissolve according to a first predetermined release profile, and the second medicant having a second absorbable coating configured to dissolve according to a second predetermined time release profile that is different than the first predetermined release profile such that the first and second medicants are configured to be released from the adjunct material at different times from one another, the first and second medicants including a tissue matrix degradation inhibitor and an agent configured to induce proliferation of fibroblasts.

US Pat. No. 10,111,654

APPARATUS AND METHOD FOR MINIMALLY INVASIVE SUTURING

EndoEvolution, LLC, Rayn...

1. A surgical suturing device having a proximal end and a distal end comprising:a) an arced suturing needle having a pointed leading end and a trailing end;
b) a suturing head disposed proximate the distal end of the device, the suturing head being configured to support the arced suturing needle therein, the arced suturing needle having a curved body, the curved body covering an arc greater than about 180°, wherein the arced suturing needle is disposed in and adapted and configured to be advanced along an arcuate path about an axis of rotation substantially perpendicular to a longitudinal axis defined by the suturing device;
c) a reciprocating needle drive configured to advance the arced suturing needle along a first direction led by the leading end of the needle, wherein the needle drive includes a reciprocating drive wheel pivotally coupled at an outer radial region of the drive wheel to a proximal end of a first elongate arm, the first elongate arm having a distal end with a drive pawl attached thereto for engaging the arced suturing needle, the drive wheel and first elongate arm cooperating to drive the arced suturing needle about the axis of rotation in response to actuation of the reciprocating needle drive, wherein the distal end of the first elongate arm is movable along a path that is transverse to the longitudinal axis to direct the arced suturing needle about the axis of rotation, the reciprocating needle drive also including a second elongate arm configured and arrange to limit the range of rotational motion of the reciprocating drive wheel.

US Pat. No. 10,111,649

SURGICAL INSTRUMENT

Arthrex, Inc., Naples, F...

1. A surgical instrument comprising:a handle;
a shaft attached to the handle, the shaft having a proximal end and a distal end;
at least one flexibly movable member positioned at the distal end of the shaft, the at least one flexibly movable member being movable between an operative position in which the at least one flexibly movable member extends radially in a direction substantially transverse to a longitudinal axis of the shaft and an inoperative position in which the at least one flexibly movable member extends substantially parallel to the longitudinal axis of the shaft; and
an actuating mechanism provided at the proximal end of the shaft, the actuating mechanism being configured to move the shaft in a first direction away from the handle and in a second direction toward the handle,
wherein moving the shaft in the first direction extends the at least one flexibly movable member to the operative position and moving the shaft in the second direction retracts the at least one flexibly movable member to the inoperative position.

US Pat. No. 10,111,581

THERMAL DEFOGGING SYSTEM AND METHOD

Align Technology, Inc., ...

1. An optical scanning device comprising:an optical element for transmission of optical signals;
a primary housing that houses the optical element, the primary housing comprising a head configured for insertion into a patient oral cavity, the head of the primary housing defining an aperture for transmission of the optical signals; and
a defogging element coupled to the primary housing, the defogging element comprising:
a transparent element positioned within the aperture, at least one side of the transparent element facing an external environment; and
a transparent conductive layer covering an area on a surface of the transparent element, the area of the transparent conductive layer having a size that at least partially covers an optical footprint of the transparent element for the optical signals to be transmitted through the transparent element; and
a disposable sleeve coupled to and covering the head of the primary housing, wherein the disposable sleeve protects the optical scanning device from contact with the patient oral cavity, the disposable sleeve comprising:
an additional aperture that aligns with the aperture; and
an additional transparent element in the additional aperture, the additional transparent element lacking a conductive layer;
wherein an air gap separates the additional transparent element from the transparent element, and wherein responsive to application of electrical power to the transparent conductive layer, the transparent conductive layer generates heat that is thermally communicated across the air gap to the additional transparent element to defog the additional transparent element of the disposable sleeve.

US Pat. No. 10,111,555

BEVERAGE COMPOSITION

Koninklijke Douwe Egberts...

1. A beverage dispensing container comprising:a chocolate beverage composition including a dry mix of a foaming creamer and discrete cocoa solids, wherein at least about 95% of the discrete cocoa solids are in a non-powdered form and wherein the discrete cocoa solids have less than 15 wt. % fat and a density in the range of from 1.5 g/cm3 to 3 g/cm3;
the container being in the form of a cartridge containing the chocolate beverage composition, the container having an inlet for introduction of an aqueous medium and an outlet downstream of the inlet for discharge of the beverage.

US Pat. No. 10,111,495

VENTILATED SHOE

GEOX S.p.A., Montebellun...

1. A ventilated shoe, comprising:a sole; and
an upper assembly associated therewith in an upper region, the upper assembly comprising:
an external upper, with which an inner lining is associated which is constituted at least partly by a first element that defines at least one interspace that separates a foot of a user from the external upper and including preferential passages for sweat that moves away from the foot of the user toward an upper external edge of the shoe,
a breathable insole, joined perimetrically at least to the inner lining,
wherein the preferential passages are defined by a series of channels that facilitate rise of sweat in a vapor phase upwardly from below, and
wherein each of the channels is open in a direction of the foot of the user.

US Pat. No. 10,111,474

SPORTMAN'S GARMENT WITH VOLUME REDUCTION ARRANGEMENT

Under Armour, Inc., Balt...

1. A garment configured to be worn by a human, the garment comprising:a torso portion including an inner side and an outer side; and
a volume reduction arrangement provided on the torso portion, the volume reduction arrangement including a first strap, a second strap, a first strap adjustment member, and a second strap adjustment member, wherein the first strap is a first elastic cord, the first strap adjustment member is a first cord lock, the second strap is a second elastic cord, and the second strap adjustment member is a second cord lock, and wherein:
a first portion of the first strap is connected to a left side of the torso portion,
the first strap adjustment member is connected to a right side of the torso portion, and a second portion of the first strap engages the first strap adjustment member on the right side of the torso portion,
a first portion of the second strap is connected to the right side of the torso portion,
the second strap adjustment member is connected to the left side of the torso portion, and a second portion of the second strap engages the second strap adjustment member on the left side of the torso portion, and
the first strap crisscrosses the second strap on a lower portion of the torso portion adjacent a waist region of a wearer when worn.

US Pat. No. 10,111,465

ELECTRONIC SMOKE APPARATUS

Altria Client Services LL...

1. A power management device for an electronic smoke apparatus, the electronic smoke apparatus including a heater to heat a liquid, and a reservoir to hold the liquid, the power management device comprising:a controller to adaptively supply operating power to the heater to operate the electronic smoke apparatus based on received signals indicative of characteristics of a puff event, the characteristics including airflow through the electronic smoke apparatus;
wherein the controller is configured to, during the puff event,
supply the operating power at a first power level in response to detecting airflow through the electronic smoke apparatus at or above a first threshold level,
reduce the operating power from the first power level to a second power level after expiration of a first time period following detection of the airflow at or above the first threshold level, the second power level less than the first power level, and
increase the operating power from the second power level to a third power level after expiration of a second time period and in response to detecting airflow through the electronic smoke apparatus at or above a second threshold level;
wherein the expiration of the second time period is after the expiration of the first time period; and,
wherein the third power level is less than or equal to the first power level.

US Pat. No. 10,111,459

ASSEMBLY MACHINE FOR PRODUCING CIGARETTES, AND RELATIVE ASSEMBLY METHOD

1. An assembly machine for producing multicomponent cigarettes, each comprising a number of portions, which have a central axis and comprise at least one portion defined by a filter element, and at least another portion defined by an aromatic, tobacco-based, element; the assembly machine comprising:a combining unit for forming groups of portions, each comprising at least two different first portions aligned axially and contacting end to end, and in which the groups of portions travel perpendicularly to their central axis; the combining unit comprises a number of structurally identical feed stations, each for supplying a respective first portion of single length to form the groups of portions; and each feed station comprises an insertion drum which receives the groups of portions from a preceding feed station or creates the groups of portions, receives respective first portions, and inserts the respective first portions into the groups of portions;
a first wrapping unit, which receives a succession of groups of portions, aligned axially and contacting end to end, from the combining unit, feeds the groups of portions perpendicularly to their central axis, and winds a single first sheet of wrapping material around the whole circumference of each group of portions; and
a second wrapping unit, which receives a succession of groups of portions from the first wrapping unit, feeds the groups of portions perpendicularly to their central axis, and winds a single second sheet of wrapping material around the whole circumference of each group of portions; wherein the second wrapping unit comprises a portion feed unit for inserting third portions into the groups of portions.

US Pat. No. 10,111,405

VIDEOS FOR PETS AND METHODS FOR THE CREATION THEREOF

1. A method for creating a video for pets, comprising:creating visual content for the video; and
creating auditory content for the video, wherein the auditory content comprises:
a musical arrangement that has a relaxing effect on dogs, the musical arrangement characterized by a tempo in the range of 50 to 70 beats per minute (BPM), and
one or more sounds that have a stimulating effect on dogs.

US Pat. No. 10,111,382

MID-MOUNT RIDING GRASS MOWER WITH A MOWER UNIT COVER

Kubota Corporation, Osak...

1. A mid-mount riding grass mower comprising:a traveling vehicle body;
a mower unit liftably suspension-supported at a front/rear intermediate lower portion of the traveling vehicle body;
a belt transmission device attached to an upper portion of the mower unit; and
a cover unit that covers the belt transmission device;
wherein the mower unit includes a blade rotatable with a driven pulley of the belt transmission device, and a mower deck that covers the blade from the above;
the cover unit includes a lower cover extending upward from the mower deck so as to surround three sides of the belt transmission device, and right and left side covers detachably attached to right and left end portions of the traveling vehicle body;
the lower cover has an upper end disposed higher than an upper end of the belt transmission device, the lower cover having a vertical length for forming a maintenance space relative to the front/rear intermediate lower portion of the traveling vehicle body when the mower unit is located at its lower limit position; and
each of the right and left side covers has a vertical wall that overlaps respective outermost sides of the lower cover as seen in a right/left direction in a lifting range of the mower unit.
US Pat. No. 10,113,134

CAPPED OIL SOLUBLE POLYALKYLENE GLYCOLS WITH LOW VISCOSITY AND HIGH VISCOSITY INDEX

Dow Global Technologies L...

1. A capped oil soluble polyalkylene glycol having the following structure:R1O-(AO)n—R2
where: R1 is a linear or branched alkyl or aryl with one to 18 carbon atoms; AO refers to residuals of monomers selected from 1,2-butylene oxide and 1,2-propylene oxide selected so that at least 50 weight-percent of the (AO)n, component is 1,2-butylene oxide residuals; n is a number from 3 to 7 and is selected to provide a kinematic viscosity at 100 degrees Celsius of less than 5 centiStokes for the non-capped polyalkylene glycol; and R2 is a linear or branched alkyl or aryl having from 1-8 carbon atoms and wherein the capped oil soluble polyalkylene glycol is characterized by having a kinematic viscosity of less than 4.5 centiStokes at 100 degrees Celsius and a viscosity index of greater than 150.
US Pat. No. 10,111,854

SYNTHESIS AND USE OF AMINE-CONTAINING FLAVONOIDS AS POTENT ANTI-LEISHMANIAL AGENTS

The Hong Kong Polytechnic...

1. An anti-leishmanial compound having the general formula of:Flavonoid-X—NR1R2 or Flavonoid-X—R1R2,
or a pharmaceutically acceptable salt thereof,wherein:the flavonoid is selected from the group consisting of flavone, flavonol, flavanone, and isoflavonoid;
X is a linker, wherein each linker independently comprises one or more groups selected from the group consisting of alkylene, ethyleneoxy, propyleneoxy, butyleneoxy, alkylC(O)—, ethylene amine, propylene amine, butylene amine, alkylcyclic amine, alkylcyclic diamine, or a combination thereof;
wherein:
(i) R1 is independently selected from the group consisting of H, —(CH2)n-aryl, and —(CH2)n-heteroaryl which may be optionally substituted; R2 is independently selected from the group consisting of H, —(CH2)n-aryl, and —(CH2)n-heteroaryl which may be optionally substituted; or
(ii) R1R2 forms a cyclic compound with a general structure of —(CH2)n—Y—(CH2)m— wherein Y is CH2, O, or NR1, any of which may be optionally substituted; and
wherein n and m are independently selected from an integer between 1 to 6.
US Pat. No. 10,111,857

MICROCAPSULES CONTAINING AN OXIDIZABLE ACTIVE, AND A PROCESS FOR PREPARING THE SAME

IDCAPS, La Rochelle (FR)...

1. A microcapsule consisting of:a single core consisting of an oxidizable active (OA), and at least one additional element selected from drying agents, antioxidant agents, filmogen agents and emulsifying agents, the outer part of said core being in a solid form; and
a water insoluble coating obtained from a water soluble encapsulating agent (EA) selected from alginates of monovalent cations, water insolubility being induced by a salt having a divalent metallic cation, said coating surrounding said core,
wherein said OA is selected from the group consisting of vitamin B5, vitamin B6, vitamin B8, vitamin B9, vitamin A, vitamin D3, vitamin K and vitamin E,
with the proviso that:
said core does not comprise a metal oxide, and
said coating does not comprise a disintegrant.
US Pat. No. 10,115,963

NEGATIVE ELECTRODE MATERIAL FOR SECONDARY BATTERY AND SECONDARY BATTERY USING THE SAME

LG Chem, Ltd., (KR)

1. A negative electrode material for a secondary battery capable of intercalating and de-intercalating lithium, wherein the negative electrode material consists of alloy particles including a silicon phase and a metal phase, and a carbonaceous material, whereinthe silicon phase has a crystallite size of 10 nm or less,
the metal phase comprises two or more kinds of metals alloying with silicon but not with lithium,
the carbonaceous material has a crystallite size of 30 nm or more, and
the carbonaceous material is present on a surface of, or within the alloy particles.
US Pat. No. 10,111,879

ADRENOCEPTORS ANTAGONISTS FOR THE PREVENTION AND TREATMENT OF NEURODEGENERATIVE CONDITIONS

Cedars-Sinai Medical Cent...

1. A method for determining whether or not a non-motor symptom phase of idiopathic Parkinson's disease (iPD) is progressing in a human subject who has not been diagnosed with iPD based on motor symptoms, and who does not exhibit a motor symptom of iPD, but is exhibiting a non-motor symptom of iPD, comprising:performing an initial assay to measure cardiac uptake of iodine-123-metaiodobenzylguanidine (123I-MIBG) in the subject;
administering a composition comprising one or more adrenoceptor antagonist selected from the group consisting of: acebutolol, betaxolol, bisopropolol, bopindolol, carvedilol, metoprolol, oxprenolol, propranolol, and timolol;
subsequently performing an additional assay to measure cardiac uptake of 123I-MIBG in the subject, wherein it is determined iPD is progressing in the subject if the cardiac uptake of 123I-MIBG has decreased in the additional assay, compared to the initial assay; and wherein it is determined iPD is not progressing in the subject if the cardiac uptake of 123I-MIBG has not decreased in the additional assay, compared to the initial assay; and
continuing to administering the adrenoceptor antagonist if iPD is not progressing or providing an additional or alterative iPD treatment if iPD is progressing.
US Pat. No. 10,113,167

METHODS AND COMPOSITIONS FOR RNA-DIRECTED TARGET DNA MODIFICATION AND FOR RNA-DIRECTED MODULATION OF TRANSCRIPTION

The Regents of the Univer...

1. A non-naturally occurring DNA-targeting RNA, or a nucleic acid encoding the non-naturally occurring DNA-targeting RNA, wherein the non-naturally occurring DNA-targeting RNA comprises:(a) a targeter-RNA comprising:
(i) a first nucleotide sequence that is complementary to a target sequence of a target DNA molecule, and
(ii) a second nucleotide sequence that hybridizes with an activator-RNA,
wherein the first and second nucleotide sequences are heterologous to one another; and
(b) the activator-RNA, which hybridizes with the second nucleotide sequence of the targeter-RNA to form a double-stranded RNA (dsRNA) duplex of a protein-binding segment, wherein the activator-RNA hybridizes with the targeter-RNA to form a total of 8 to 15 base pairs,
wherein the non-naturally occurring DNA-targeting RNA is capable of forming a complex with a Cas9 polypeptide and targeting the complex to the target sequence of the target DNA molecule.
US Pat. No. 10,113,171

METHODS FOR IMPROVING COGNITIVE FUNCTION VIA MODULATION OF QUINONE REDUCTASE 2

Carmel-Haifa University E...

1. A method for improving cortex or hippocampus dependent cognition in an Alzheimer disease patient or a patient with senility, comprising administering intracerebrally to said patient a nucleic acid molecule that reduces gene expression level of quinone reductase 2; a vector comprising said nucleic acid molecule; or a pharmaceutical composition comprising said nucleic acid molecule or said vector and a pharmaceutically acceptable carrier, wherein said quinone reductase 2 is a human quinone reductase 2 encoded by a nucleic acid sequence identified as SEQ ID NO:1.
US Pat. No. 10,113,172

NUCLEIC ACID APTAMERS

University of Iowa Resear...

1. A nucleic acid molecule not more than 90 nucleotides in length comprising an aptamer, wherein the aptamer is aptamer-1 (SEQ ID NO:2322), aptamer-35 (SEQ ID NO:2356), aptamer-41 (SEQ ID NO:2362) or aptamer-51 (SEQ ID NO:2372).
US Pat. No. 10,113,943

MULTIPLE AGGRESSOR HAIR ASSESSMENT METHOD

Conopco, Inc., Englewood...

1. A method of comparatively evaluating the efficacy of a series of hair products, the method comprising, in any order, the steps of;applying each individual product or product system to an individual test hair switch;
subjecting each hair switch to the same regime of two or more aggressors, once a day for 4 or more days; and
assessing and comparing a condition of the switches that have been treated with the product or product system and subjected to said regime,wherein the individual product or product system is selected from the group consisting of shampoos, conditioners, and styling products, and the condition is a measurable physical feature or characteristic of the hair switches.
US Pat. No. 10,111,915

METHOD TO TREAT FATTY LIVER DISEASE USING PARABACTEROIDES GOLDSTEINII

CHANG GUNG BIOTECHNOLOGY ...

1. A method for treating fatty liver disease in a subject on a high fat diet, comprising administering a composition comprising an effective amount of Parabacteroides goldsteinii bacterium, wherein the composition is orally administered to the subject for at least eight weeks.
US Pat. No. 10,112,181

CATALYST FOR PURIFICATION OF EXHAUST GAS, METHOD FOR PRODUCING THE SAME, AND METHOD FOR PURIFICATION OF EXHAUST GAS USING THE SAME

KABUSHIKI KAISHA TOYOTA C...

1. A catalyst for purification of exhaust gas, comprising:a substrate; and
a catalyst coat layer which is formed on a surface of the substrate and which comprises catalyst particles, wherein
the catalyst coat layer has an average thickness in a range of 25 to 160 ?m, and a void fraction in a range of 50 to 80% by volume as measured by a weight-in-water method,
0.5 to 50% by volume of all voids in the catalyst coat layer consist of high-aspect ratio pores which have equivalent circle diameters in a range of 2 to 50 ?m in a cross-sectional image of a cross-section of the catalyst coat layer which the cross-section is perpendicular to a flow direction of exhaust gas in the substrate, and which have aspect ratios of 5 or higher, and
the high-aspect ratio pores have an average aspect ratio in a range of 10 to 50.
US Pat. No. 10,112,985

TOLL-LIKE RECEPTORS

Intervet Inc., Madison, ...

1. An immunostimulatory non-methylated phosphorothioate (PTO) oligodeoxynucleotide consisting of the general formula selected from the group consisting of:(i) [tcgN1]n, wherein N1=c or g and n?6 and ?100;
(ii) [N1cgt]n, wherein N1=g or c or a or t and n?6 and ?100;
(iii) [gacgtt]n, wherein n?4 and ?100;
(iv) [gacgatcgtc]n, [SEQ ID NO: 214] wherein n?3 and ?100;
(v) [tcgtcgttttcg]n, [SEQ ID NO: 215] wherein n?3 and ?100,
(vi) [tcgtcgttgtcgttttgtcgtt]n, [SEQ ID NO: 216] wherein n?2 and ?100;
(vii) (tx[ttcgtt]ty)n, wherein n?5 and ?100, x=0-5 and y=0-5;
(viii) [ttcgtN1]n, wherein N1=t or c and wherein n?5 and ?100;
(ix) [N1tcgtc]n, wherein N1=t or c and wherein n?5 and ?100;
(x) [gN1cgtt]n, wherein n?4 and ?100 and N1=a or t; and
(xi) [acga]n, and wherein n?6 and ?100.
US Pat. No. 10,113,015

CATALYST FOR THE POLYMERIZATION OF OLEFINS

Basell Poliolefine Italia...

1. A catalyst system for the (co)polymerization of ethylene, comprising (A) a solid catalyst component comprising Ti, Mg, and a halogen, (B) an aluminum alkyl compound, and (C) a halogenated cyclic ether selected from the group consisting of 2-chloro-tetrahydrofuran, 3-chloro-tetrahydrofuran, 2,3-dichloro-tetrahydrofuran and 2,3-dichloro-tetrahydropyran,wherein the catalyst system has a molar ratio of component (C)/Ti ranging from 1 to 25, and wherein the molar amount of Ti is based on the amount of Ti present in component (A).
US Pat. No. 10,113,058

CLEAR AND IMPACT RESISTANT POLYMER COMPOSITION AND FABRICATED ARTICLE

Braskem America, Inc., P...

1. A polymer composition, comprising:from about 50 weight percent (wt. %) to about 95 wt. % of a matrix phase comprising a polypropylene polymer comprising from 0 to 7 mole percent (mol. %) of units derived from ethylene, a C4-C10 alpha olefin or combinations thereof;
from about 5 wt. % to about 50 wt. % of a dispersed phase being a propylene/alpha olefin copolymer having from 10 mol. % to 70 mol. % of units derived from ethylene or a C4-C10 alpha olefin or combinations thereof,
wherein the weight percentages of the matrix phase and the dispersed phase are based on the total weight of the matrix phase and the dispersed phase, and
the polymer composition satisfies the following inequality:
y?55x ?8, wherein x is a ratio of Mw solubles/Mw insolubles and is less than or equal to 0.85, Mw solubles is weight average molecular weight of a soluble fraction of the polymer composition in xylene at 25° C. following ASTM D5492, Mw insoluble is weight average molecular weight of an insoluble fraction of the polymer composition in xylene at 25° C. following ASTM D5492, and y is the haze value being measured on a 0.508 millimeter (20 mil) thick injection molded plaque according to ASTM D1003; and
wherein the matrix phase has a melt flow rate of from about 0.1 dg/min. to about 10 dg/min.; and the dispersed phase has a melt flow rate of from about 1 dg/min. to about 200 dg/min., being measured using a load of 2.16 kg at 230 ° C. following ASTM D 1238.
US Pat. No. 10,113,066

CURABLE COMPOSITION, CURED COATING FILM USING SAME, AND PRINTED WIRING BOARD

TAIYO INK MFG. CO., LTD.,...

1. A curable composition, comprising:a photobase generator;
an epoxy group-containing (meth)acrylate compound;
a photopolymerization initiator; and
a thermosetting component other than the epoxy group-containing (meth)acrylate compound,
wherein the epoxy group-containing (meth)acrylate compound is a low-molecular-weight material that is a monomer or an oligomer and having a molecular weight in a range of 100 to 1,000, the photobase generator is in an amount of from 0.1 to 40 parts by mass with respect to 100 parts by mass of the thermosetting component and generates a catalyst for addition reaction between the epoxy group-containing (meth)acrylate compound and the thermosetting component by photoirradiation, and the thermosetting component is in an amount of 1 to 30 parts by mass with respect to 100 parts by mass of the curable composition.
US Pat. No. 10,113,099

HIGH PRESSURE HIGH TEMPERATURE (HPHT) AQUEOUS DRILLING MUD COMPOSITION AND PROCESS FOR PREPARING THE SAME

ISP INVESTMENTS LLC, Wil...

1. An aqueous high-temperature high-pressure (HTHP) stable drilling mud composition comprising:i. about 20 wt. % to about 80 wt. % of 0-60% w/w brine solution;
ii. about 0.1 wt. % to about 3 wt. % of butylated reaction product of p-cresol and dicyclopentadiene;
iii. about 0.1 wt. % to about 10.0 wt. % of triethanol amine;
iv. (a) about 0.1 wt. % to about 10 wt. % of rheology modifier (RM); and (b) about 0.5 wt. % to about 30 wt. % of fluid loss additive (FLA), wherein said fluid loss additive (FLA) is a terpolymer of (a) about 30 to about 70 wt. % of acrylamide (AM), (b) about 30 to about 70 wt. % of 2-acrylamido-2-methyl propanesulfonic acid (AMPS), salts thereof, and (c) about 2.0 to about 50 wt. % of cationic monomer selected from the group consisting of quaternized (meth)acrylate monomers, quaternized (meth)acrylamide monomers, diallyldimethyl ammonium chloride (DADM AC), dimethylaminoethyl methacrylate (DMAEMA), 3-methacryloyloxy-2-hydroxypropyl-trimethylammonium chloride, 3-acrylamido-3-methylbutyl-trimethyl ammonium chloride, N-methyl-2-vinyl pyridinium methyl sulfate, N-propyl acrylamido trimethylammonium chloride, 2-methacryloyloxy-ethyl trimethyl ammonium methosulfate, acrylamidopropyltrimethylammonium chloride (APT AC), methacrylamidopropyltrimethylammonium chloride (MAPTAC), and combinations thereof;
v. about 20 wt. % to about 80 wt. % of weighting agent;
vi. about 0 wt. % to about 20 wt. % of drilling solid; and
vii. about 0 wtyryy. % to about 50 wt % of water.

US Pat. No. 10,117,184

POWER SUPPLYING APPARATUS CAPABLE OF EXECUTING WIRELESS POWER SUPPLY TO POWER RECEIVING APPARATUS AND WIRELESS COMMUNICATION WITH THE SAME

Canon Kabushiki Kaisha, ...

1. A power supplying apparatus comprising:a power supplying unit configured to contactlessly supply power to a power receiving apparatus;
a communication unit configured to wirelessly communicate with the power receiving apparatus; and
a control unit configured to control the supply of power by the power supplying unit and the communication by the communication unit such that the supply of power and the communication are exclusively executed,
wherein, in a case where the control unit performs control such that the communication is executed after the supply of power is executed, the control unit determines whether or not output power from the power supplying unit is less than or equal to a predetermined value;
wherein, in a case where it is determined by the control unit that the output power from the power supplying unit is not less than or equal to the predetermined value, the control unit disables the communication unit, and
wherein, in a case where it is determined by the control unit that the output power from the power supplying unit is less than or equal to the predetermined value, the control unit enables the communication unit.

US Pat. No. 10,117,182

COMMUNICATING CONTROL MESSAGES THAT INDICATE FREQUENCY RESOURCE INFORMATION TO RECEIVE DATA

InterDigital Technology C...

1. A method performed by a wireless device, the method comprising:receiving, by the wireless device, a wireless signal that includes a plurality of control messages, wherein each control message from the plurality of control messages points to a different message and indicates frequency resource information and coding information of data for each respective different message;
determining, by the wireless device, that a control message from the plurality of control messages corresponds to the wireless device; and
receiving, by the wireless device, the data pointed to by the control message that corresponds to the wireless device.

US Pat. No. 10,117,153

COMMUNICATION APPARATUS, COMMUNICATION METHOD, AND STORAGE MEDIUM

Canon Kabushiki Kaisha, ...

1. A communication apparatus comprising:one or more computers that cause the communication apparatus to:
perform scan for a Neighbor Awareness Networking (NAN) cluster, by receiving a discovery beacon, other than a first NAN cluster where the communication apparatus participates;
determine, in a case where a second NAN cluster, which has a cluster grade that is higher than a cluster grade of the first NAN cluster, is detected by the scan, whether the communication apparatus is performing wireless data communication, which is different from the scan, with a communication partner in the first NAN cluster;
continue participating in the first NAN cluster in a case where it is determined that the communication apparatus is performing the wireless data communication; and
stop participating in the first NAN cluster and join the second NAN cluster according to detection of the second NAN cluster in a case where it is determined that the communication apparatus is not performing the wireless data communication.

US Pat. No. 10,117,148

RADIO COMMUNICATION SYSTEM, BASE STATION, COMMUNICATION METHOD, MOBILE STATION, AND COMPUTER-READABLE MEDIUM

NEC CORPORATION, Minato-...

1. A radio communication system comprising:a base station connectable to a mobile station using a plurality of radio access technologies including first and second radio access technologies; and
an upstream network corresponding to the first radio access technology,
wherein the base station is configured to, when the mobile station communicate with the base station using the second radio access technology, use a communication path that passes through the upstream network without passing through another upstream network.

US Pat. No. 10,117,127

METHODS, SYSTEMS, AND COMPUTER READABLE MEDIA FOR COMMUNICATING RADIO ACCESS NETWORK CONGESTION STATUS INFORMATION FOR LARGE NUMBERS OF USERS

ORACLE INTERNATIONAL CORP...

1. A method for communicating radio access network (RAN) congestion status information for a large number of users, the method comprising:at a policy and charging rules function (PCRF) including one or more processors:
receiving a user-specific message from a radio access network (RAN) congestion awareness function (RCAF), wherein the user-specific message is user-specific by virtue of being formatted according to a protocol for specifying a specific user equipment identifier in a message field designated by the protocol for only one user equipment identifier, wherein receiving the user-specific message comprises receiving RAN user plane congestion information (RUCI) in a non-aggregated-RUCI-report-request (NRR) command on an Np interface;
determining, as a result of a predetermined value being in the message field designated by the protocol for only one user equipment identifier, that the user-specific message indicates that one or more evolved nodeBs (eNodeBs) monitored by the RCAF are congested for a plurality of users using the one or more eNodeBs for radio access to a telecommunications network, wherein determining that the user-specific message indicates that one or more eNodeBs monitored by the RCAF are congested for a plurality of users comprises determining that a Subscription-Id attribute value pair (AVP) of the NRR command contains the predetermined value; and
in response to determining that the user-specific message indicates that the one or more eNodeBs are congested, performing one or more actions to mitigate the congestion.

US Pat. No. 10,117,126

FEMTO CELL ACCESS POINT PASSTHROUGH MODEL

1. An access point device, comprising:a processor; and
a memory that stores executable instructions that, when executed by the processor, facilitate performance of operations, comprising:
facilitating provision of a first quality of service for a first packet flow associated with a first quality of service policy; and
facilitating provision of a second quality of service for a second packet flow associated with a second quality of service policy, wherein the first packet flow and the second packet flow are received as a packetized stream using a passthrough traffic configuration that enables discrimination of the packetized stream into the first packet flow and the second packet flow.

US Pat. No. 10,117,124

METHOD, APPARATUS AND COMPUTER PROGRAM FOR UPDATING A PRIORITIZATION LEVEL OF A SERVICE DATA FLOW BASED ON TRAFFIC SIZE PER TIME UNIT OF SAID DATA FLOW

Telefonaktiebolaget L M E...

1. A method for updating a prioritization level of a service data flow between a user node and a network node of a communication system, the network node further being connected to an application server participating in the service data flow, the method being performed in an apparatus of the communication system, the apparatus having access to the service data flow, the method comprising:obtaining a traffic size per time unit of detected data packets of the service data flow, the traffic size per time unit representing a data volume per time unit;
updating the prioritization level of the service data flow, based on the obtained traffic size per time unit; and,
adding virtual tokens to a virtual leaky bucket based on the obtained traffic size per time unit of the service data flow, and withdrawing virtual tokens from the virtual leaky bucket according to a leakage rate of the virtual leaky bucket;
wherein updating the prioritization level of the service data flow comprises:
downgrading the prioritization level if a fill level of virtual tokens in the virtual leaky bucket increases to a first downgrade threshold; and,
upgrading the prioritization level, if the fill level of virtual tokens in the virtual leaky bucket decreases to a pending threshold and no data packets have been detected during a pre-determined time interval, or if the fill level of virtual tokens in the virtual leaky bucket decreases to a first upgrade threshold.

US Pat. No. 10,117,118

SIGNAL AMPLIFIERS THAT SWITCH TO AN ATTENUATED OR ALTERNATE COMMUNICATIONS PATH IN RESPONSE TO A POWER INTERRUPTION

CommScope, Inc. of North ...

1. A bi-directional RF signal amplifier, comprising:an RF input port;
a power divider network having a plurality of active RF output ports;
an active communications path connecting said RF input port to said power divider network, said active communications path including a power amplifier to amplify a downstream signal passing along said active communications path;
a passive RF output port, separate from said power divider network;
a passive communications path connecting said RF input port to said passive RF output port, wherein said passive communications path has no power amplifier and does not pass through said power divider network;
a switching device having an input that is coupled to said RF input port, a first output and a second output, wherein said first output of said switching device is directly coupled to an input of said power amplifier; and
an attenuator, wherein said second output of said switching device is connected to said attenuator.

US Pat. No. 10,117,109

SYSTEM AND METHOD FOR DETERMINING OPTIMAL PLACEMENT OF TELECOMMUNICATION EQUIPMENT

Tejas Networks, Ltd., Ka...

1. A method to determine placement of one or more telecommunication equipment comprising the steps of:constructing, at a computing device, based on given network parameters and service requirements of a network, using a genetic algorithm, an initial population of possible solutions that are each encoded as a chromosome, wherein
each solution of the possible solutions pertains to a specific deployment of the one or more telecommunication equipment;
iteratively performing, at said computing device, crossover operations comprising selecting two chromosomes and exchanging features of the two chromosomes to obtain daughter chromosomes as additional possible solutions to increase optimality of the chromosomes, based on a combination of cost of placement of the one or more telecommunication equipment and number of telecommunication equipment to be placed as well as the length of the paths over which traffic is routed; and
identifying, at the computing device, based on the iterative crossover operations, a most optimal chromosome as a final solution for the placement of the one or more telecommunication equipment to minimize network cost, maximize network utilization, and meet Service Level Agreements (SLA) for a given network topology and demand requirements.

US Pat. No. 10,117,102

MULTIMEDIA MESSAGE SERVICE METHOD AND SYSTEM

Samsung Electronics Co., ...

1. A server for sharing multimedia content, the server comprising:a transceiver; and
a controller configured to:
receive, via the transceiver from a terminal, a first message including first information for requesting to share multimedia content stored in the server with at least one specified user and second information related to expiration of time for sharing the multimedia content, and
based on the received first message:
establish a condition for sharing the multimedia content, and
transmit, via the transceiver to the at least one specified user, a second message notifying that the at least one specified user is allowed to access the multimedia content.

US Pat. No. 10,117,101

GEOGRAPHICALLY BASED ACCESS MANAGEMENT FOR INTERNET OF THINGS DEVICE DATA

CA, Inc., New York, NY (...

1. A method comprising:based on receiving first data from a first measuring device, determining a category of the first data;
identifying one or more geographical areas based, at least in part, on the category of the first data and a current location of the first measuring device;
generating an access policy for the first data based, at least in part, on the identified geographical areas; and
securing access to the first data based, at least in part, on the access policy.

US Pat. No. 10,117,098

USER AUTHENTICATION VERIFICATION SERVICE

Amazon Technologies, Inc....

1. A system comprisinga data store configured to store at least user information and device information; and
a processor in communication with the data store, the processor executing specific computer-executable instructions that configure the processor to at least:
receive, from a call center computing device associated with a call center, a request to confirm an identity of a first party, wherein the first party initiates a telephone call to the call center, and wherein the request to confirm the identity of the first party includes at least a telephone number associated with the telephone call;
identify, based at least in part on the telephone number, the user information, and the device information, a plurality of devices associated with a first user of a service associated with the call center;
identify, based at least in part on device information for the plurality of devices associated with the first user, a first device of the plurality of devices, wherein a first application on the first device can authenticate the first user;
transmit a push notification to the first device, wherein the push notification causes the first application to authenticate the first user;
receive, from the first device, information processed by the first application in response to the push notification;
identify the first party as the first user based at least in part on the information processed by the first application; and
transmit, to the call center computing device, confirmation of the identity of the first party.

US Pat. No. 10,117,091

METHOD FOR ADMINISTERING LIFE CYCLES OF COMMUNICATION PROFILES

IDEMIA FRANCE, Colombes ...

1. An administering method for administering life cycles of communication profiles, said profiles being managed by a subscriber identity module embedded in a telecommunications terminal, said method being performed by said module,each profile being configured to enable the terminal to communicate with a mobile telephone network in compliance with a communication profile when said communication profile is active,
said module being suitable for using at least one process of administering, said process being suitable for administering the life cycles of each of said profiles, said process using a set of at least one command and/or at least one rule,
the method comprising:
receiving a first message issued by the terminal and representative of capabilities of said terminal;
selecting or not selecting the set used by said process as a function of said capabilities of said terminal;
issuing a second message to the terminal including information about the capabilities of the module, wherein the second message comprises information about the process of administering the life cycles of the profiles that are supported by the module; and
if said set is selected, administering at least one life cycle of at least one of said profiles by using said set of at least one command and/or of at least one rule.

US Pat. No. 10,117,090

MULTIPLE DEVICE ASSOCIATION WITH A SINGLE TELEPHONE NUMBER

T-Mobile USA, Inc., Bell...

1. A computer-implemented method, comprising: receiving an input at a service portal of a mobile telecommunication network, the input for configuring a call session control function (CSCF) node to concurrently register multiple user devices to use a common telephone number to initiate and receive communications via the mobile telecommunication network; storing the input as a device association profile in a device association data store that is accessible by the CSCF node of the mobile telecommunication network, the device association profile including multiple IP Multimedia Private Identities (IMPIs) of the multiple user devices that are permitted to use the common telephone number; receiving the device association profile at the CSCF node from the device association data store; determining at the CSCF node based at least on the device association profile whether a user device is eligible to use the common telephone number to initiate and receive communications via the mobile telecommunication network; and in response to determining that the device association profile indicates that an IMPI of the user device is permitted to use the common telephone number, registering the user device to initiate and receive communications through the common telephone number via the CSCF node.

US Pat. No. 10,117,088

CONNECTION CONTROL METHOD BY COMMUNICATION TERMINAL

NEC Corporation, Tokyo (...

1. A connection control method executed by a communication terminal, the connection control method comprising:executing a discovery process including sequentially switching a plurality of communication channels and discovering another communication terminal existing around the communication terminal itself;
in a case of connecting to another communication terminal found in the discovery process, performing a determination of which of the communication terminals transmits a connection request, the connection request being a request for negotiation determining either the communication terminal itself or the other communication terminal as an access point; and
in a case where the communication terminal itself does not transmit the connection request, stopping the discovery process and waiting for reception of the connection request from the other communication terminal by using a given communication channel.

US Pat. No. 10,117,083

METHOD AND APPARATUS FOR AUDIO PRIORITIZATION

MOTOROLA SOLUTIONS, INC.,...

1. A mobile communication device, comprising:a controller having an operating system (OS) providing an open source platform and audio manager;
an application programming interface (API) providing public safety management to the audio manager for prioritizing public safety audio applications; and
a plurality of public safety audio applications, each public safety audio application sending a request to the API requesting priority, the API setting the priority of the plurality of public safety audio applications based on predetermined priorities associated with each of the plurality of public safety audio applications, the API notifying the audio manager to store each of the priorities associated with the plurality of public safety application, the audio manager granting priority to an application based on the stored priority.

US Pat. No. 10,117,081

SHORT-RANGE COMMUNICATION DEVICE

Orange, Paris (FR)

1. A communication device configured to communicate with a terminal through a short-range wireless connection, the terminal comprising several functions, each ongoing function of the several functions being able to be executed using a function identifier specific to the ongoing function,wherein the communication device comprises a plurality of interaction devices,
wherein the communication device is configured for:
/a/ detecting an event related to an interaction device of the plurality of interaction devices, the event being associated to a function identifier;
/b/ transmitting a message comprising the function identifier and intended to execute a corresponding function of the terminal;
/c/ receiving, from the terminal, and via local network, an access request linked to the detected event.

US Pat. No. 10,117,079

INFORMATION PROCESSING APPARATUS AND RECORDING MEDIUM

Ricoh Company, Ltd., Tok...

1. An information processing apparatus, comprising:a communication interface configured to perform communication with a short-distance wireless communication tag;
processing circuitry configured to determine whether an establishing signal for establishing the communication is received from the short-distance wireless communication tag, and in response to determining that the establishing signal is not received, display position information of the communication interface on a display; and
a sensor configured to detect whether the information processing apparatus is inclined,
wherein the communication interface is configured to perform the communication with the short-distance wireless communication tag in response to the processing circuitry determining that the establishing signal is received, and
when it is determined that the information processing apparatus is held near the short-distance wireless communication tag based on a detection result of the sensor, the processing circuitry displays position information of the communication interface.

US Pat. No. 10,117,070

APPARATUS AND METHOD OF GROUP COMMUNICATIONS

QUALCOMM, Incorporated, ...

1. A method for group communication, comprising:receiving, at a machine-type communication (MTC) interworking function (MTC IWF), a group message request including a group message and a group identifier;
mapping, by the MTC IWF in response to receiving the group message request, the group identifier to a temporary mobile group identifier (TMGI) or other message identifier associated with the group message;
obtaining, from a home subscriber service (HSS) or a home location service (HLR), subscriber information for each device of a plurality of devices in a group identified by the group identifier or TMGI or other message identifier, wherein the subscriber information comprises, for each device in the group, a device identifier and one or more delivery mechanisms supported by the device, with each device providing the one or more delivery mechanisms supported by the device to the HSS or HLR;
determining, by a decision component of the MTC IWF and based, at least in part, on the one or more delivery mechanisms supported by each device, a message delivery mechanism for delivering the group message to each device or subgroup of devices in the group, wherein a first delivery mechanism is determined for a first device in the group and a second delivery mechanism is determined for a subgroup of devices including a plurality of second devices in the group, with the first delivery mechanism being different than the second delivery mechanism;
transmitting the group message to the first device in the group in response to determining the first delivery mechanism for the first device, the transmission to the first device including a subscription identifier associated with the first device, via a point-to-point protocol as the first delivery mechanism; and
transmitting the group message to the plurality of second devices in response to determining the second delivery mechanism for the plurality of second devices, the transmission to the plurality of second devices including the group identifier, via a one-to-many communication protocol as the second different delivery mechanism.

US Pat. No. 10,117,056

METHOD AND SYSTEM FOR PROVIDING LOCATION-BASED SERVICE

Naver Business Platform C...

1. A location-based service providing method for determining a current location of a user terminal in conjunction with a server, the method comprising:receiving a request to provide a location-based service;
requesting the server for first information about a wireless access point associated with a first building in which the user terminal is located in response to the request;
receiving the first information from the server;
collecting second information about a wireless access point located around the user terminal;
determining the current location of the user terminal based on the first information received from the server and the second information,
receiving cell information corresponding to a cell in which the user terminal is located from a base station;
providing a service corresponding to a service application in response to the service application executed on the user terminal being an application supporting a country in which the user terminal is located based on the cell information; and
suspending execution of the service application in response to the application executed on the user terminal not being an application supporting the country in which the user terminal is located based on the cell information.

US Pat. No. 10,117,050

TECHNIQUES FOR WIRELESS COMMUNICATION OF PROXIMITY BASED CONTENT

FREELINC TECHNOLOGIES INC...

1. An apparatus of a Short Range Communication (SRC) device configured for the wireless communication of proximity based content, the apparatus configured to:define a proximity boundary with dimensions defined by a selected magnetic induction diversity communication range of the SRC device, wherein
the SRC device is configured to communicate using magnetic induction;
the SRC device includes at least two substantially orthogonal antennas to provide magnetic induction diversity; and
the SRC device is coupled to a mobile computing device;
communicate a proximity signal in the proximity boundary from the at least one selected antenna between the SRC device and a PSRC device using the magnetic induction diversity to substantially reduce a variability of the dimensions of the proximity boundary defined by the selected magnetic induction diversity communication range;
perform at least one action by at least one of the mobile computing device and the PSRC device when the proximity signal is detected between the SRC device and the PSRC device; and
set at least one rule for a proximity based communication filter module, which is associated with the mobile computing device, regarding the wireless communication of proximity based content, the at least one rule identifying the at least one action performed by the mobile computing device when the proximity signal is detected between the SRC device and the PSRC device.

US Pat. No. 10,117,049

METHODS CIRCUITS SYSTEMS AND ASSOCIATED COMPUTER EXECUTABLE CODE FOR LOCALIZING AND MESSAGING A WIRELESS COMMUNICATION DEVICE

LOYALBLOCKS LTD., Tel Av...

6. A localization server, comprising:a first database for storing records indicative of physical locations of each of a set of retailer stations;
a second database for storing correlations of unique identifiers of mobile devices within a first Client Device Access Network (CDAN) to unique identifiers of the mobile devices in a second communication network;
a communication module for receiving a message from a target device including a coarse location indicator of a coarse location of the target device and a first unique identifier of the target device associated with the CDAN; and
a controller adapted to:
(i) compare the coarse location to locations stored in the first database and identify a retailer station within the set in proximity to the coarse location; and
(ii) retrieve from said second database a second unique identifier of the target device associated with the second communication network;
(iii) automatically trigger direct communication, based on the retrieved second unique identifier, over the second network, between the identified retailer station and the target devicewherein said localization server communicates with the identified retailer station over a third network, distinct from the second communication network.

US Pat. No. 10,117,047

LOCATION AND TIME BASED APPLICATION MANAGEMENT

Amazon Technologies, Inc....

1. A method comprising:detecting an occurrence of a wake-up event on a user device;
determining a first time;
determining that the first time corresponds to one or more previous time periods when the user device has previously been used;
identifying, by a processing device, one or more application files that were previously accessed on the user device during the one or more previous time periods;
presenting an application interface with the one or more application files;
receiving a selection of at least one of the one or more application files; and
launching the at least one of the one or more application files on the user device.

US Pat. No. 10,117,046

DISCRETE LOCATION CLASSIFICATION

Apple Inc., Cupertino, C...

1. A method for identifying a location of a mobile device, the method comprising:during each of a plurality of instances of time:
measuring, by the mobile device, one or more signal properties of one or more other devices across a time interval;
obtaining, by the mobile device, an identifier from each of the one or more other devices;
creating, by the mobile device, a data point to include the one or more signal properties, wherein each dimension of the data point corresponds to respective one of the one or more other devices and a value for the dimension corresponds to a signal property for that dimension; and
storing, by the mobile device, the data point in a database of the mobile device, the database storing a plurality of data points corresponding to the plurality of instances of time;
analyzing, by the mobile device, the plurality data points in the database to determine clusters of data points, wherein different clusters of data points correspond to different locations in physical space;
after determining the clusters of data points, detecting, by the mobile device, an event at an input device of the mobile device;
in response to detecting the event, measuring, by the mobile device, one or more new signal properties of one or more of the plurality of other devices at one or more new times;
creating, by the mobile device, a new data point from the one or more new signal properties; and
identifying, by the mobile device, a first cluster of the clusters of data points corresponding to the new data point by comparing the new data point with one or more data points in the first cluster and determining that the new data point is within a threshold distance of the one or more data points in the first cluster, thereby determining the location of the mobile device.

US Pat. No. 10,117,042

ENVIRONMENT-AWARE CROSS-LAYER COMMUNICATION PROTOCOL IN UNDERGROUND OIL RESERVOIRS

Saudi Arabian Oil Company...

1. A method comprising:identifying, by each of a plurality of sensors in a wireless underground sensor network (WUSN) in an underground region, a plurality of environment-dependent parameters measured by the plurality of sensors;
identifying, by each of the plurality of sensors, respective communication functions for a plurality of layers of a protocol stack for magnetic induction (MI) communications among the plurality of sensors in the WUSN in the underground region;
identifying, by each of the plurality of sensors, an optimization problem for jointly optimizing the respective communication functions of the plurality of layers of the protocol stack based on the plurality of environment-dependent parameters, the optimization problem including a plurality of transmission parameters defining the respective communication functions of the plurality of layers of the protocol stack;
determining, by each of the plurality of sensors, the plurality of transmission parameters by solving the optimization problem; and
transmitting, by each of the plurality of sensors based on magnetic induction, signals using the plurality of transmission parameters defining the respective communication functions of the plurality of layers of the protocol stack.

US Pat. No. 10,117,039

AUDIO APPARATUS AND METHOD OF CONVERTING AUDIO SIGNAL THEREOF

SAMSUNG ELECTRONICS CO., ...

27. A method of converting an audio signal of an audio apparatus, the method comprising:determining an elevation component of a source by projecting a position of the source on a sound field of a two-dimensional (2D) plane onto a surface of a three-dimensional (3D) stereoscopic space, the source included in audio signals of a plurality of channels that form the sound field of the 2D plane; and
converting the audio signals of the plurality of channels into output audio signals of a plurality of channels based on the position and the elevation component of the source, wherein at least one channel among the output audio signals is an elevation channel.

US Pat. No. 10,117,035

ACTIVE OUTPUT DRIVER SUPPLY COMPENSATION FOR NOISE REDUCTION

SEMICONDUCTOR COMPONENTS ...

19. An audio noise reduction method, comprising:taking a first measurement of a power source voltage at a first time;
taking a second measurement of said power source voltage at a second time;
calculating a rate of change based on said first and second voltage measurements;
generating an amplitude correction signal based at least partially on the calculated rate of change and a target load voltage;
generating a switch control signal using the amplitude correction signal and an audio signal; and
controlling one or more switches using the switch control signal to regulate the provision of power to a load.

US Pat. No. 10,117,026

BONE CONDUCTION SPEAKER AND COMPOUND VIBRATION DEVICE THEREOF

SHENZHEN VOXTECH CO., LTD...

1. A vibration device in a bone conduction speaker, comprising:a first vibrating plate connected to a magnetic component; and
a second vibrating plate, at least a part of the first vibrating plate physically attaching to at least a part of the second vibrating plate, the first vibrating plate and the second vibrating plate being configured to generate vibrations having two different resonance peaks, sounds being generated by the vibrations transferred through a human bone.

US Pat. No. 10,117,011

ADJUSTABLE HOLDER FOR A MICROPHONE ACCESSORY AND METHOD OF USE

The Music People, Inc., ...

1. A holder for securing a microphone, comprising:a bracket having a body extending along a bracket axis between a first end and a second end;
a mounting bar having a body extending along a mounting bar axis between a first end and a second end, the mounting bar having a platform extending from the second end of the body;
a first fastener securing the mounting bar to the bracket such that the mounting bar axis is generally parallel to the bracket axis, the first fastener being releasable such that the mounting bar is adjustable in a direction parallel to the bracket axis when the first fastener is released and the mounting bar is fixed relative to the bracket when the first fastener is secured;
an arm having a body extending along an arm axis between a first end and a second end;
a second fastener securing the first end of the arm to the platform, the second fastener being releasable such that the arm is rotatable about the mounting bar axis when the second fastener is released and the arm is fixed relative to the platform when the second fastener is secured;
a threaded post disposed on the second end of the arm, the threaded post being configured to mate with a microphone accessory;
wherein the arm is a first arm and the holder further comprises:
a second arm having a body extending along a second arm axis between a first end and a second end;
a third fastener securing the first end of the second arm to the platform, the third fastener being releasable such that the second arm is rotatable about the mounting bar axis when the third fastener is released and the second arm is fixed about the mounting bar axis when the third fastener is secured.

US Pat. No. 10,117,000

METHOD AND SYSTEM FOR HARDWARE AGNOSTIC DETECTION OF TELEVISION ADVERTISEMENTS

Silveredge Technologies P...

1. A computer-implemented method for a hardware agnostic detection of one or more advertisements broadcasted across one or more channels, the computer-implemented method comprising:normalizing, at an advertisement detection system with a processor, each frame of a pre-determined number of frames of a video corresponding to a broadcasted media content on a channel, wherein each frame being normalized based on a histogram normalization and histogram equalization and wherein each frame being normalized by adjusting luminous intensity value of each pixel to a desired luminous intensity value;
scaling, at the advertisement detection system with the processor, each frame of the corresponding pre-determined number of frames of the video to a pre-defined scale corresponding to the broadcasted media content on the channel, wherein the scaling of each frame being done by keeping a constant aspect ratio;
trimming, at the advertisement detection system with the processor, a first pre-defined region and a second pre-defined region of each frame by a pre-defined percentage of a frame width, a frame height and a pre-defined number of pixels in each frame, wherein each frame being trimmed based on calculation of a pre-determined height and a pre-determined width corresponding to the first pre-defined region having a channel logo and the second pre-defined region having a ticker;
extracting, at the advertisement detection system with the processor, a first set of audio fingerprints and a first set of video fingerprints corresponding to each trimmed frame of the pre-determined number of frames corresponding to the media content broadcasted on the channel, wherein the first set of audio fingerprints and the first set of video fingerprints being extracted sequentially in real time; and
generating, at the advertisement detection system with the processor, a set of digital signature values corresponding to the first set of video fingerprints, wherein the generation of each digital signature value of the set of digital signature values being done by:
dividing each prominent frame of one or more prominent frames into a pre-defined number of blocks, wherein each block of the pre-defined number of blocks having a pre-defined number of pixels;
grayscaling each block of each prominent frame of the one or more prominent frames;
calculating a first bit value and a second bit value for each block of the prominent frame, wherein the first bit value and the second bit value being calculated from comparing a mean and a variance for the pre-defined number of pixels in each block of the prominent frame with a corresponding mean and variance for a master frame in a master database; and
obtaining a 32 bit digital signature value corresponding to each prominent frame, wherein the 32 bit digital signature value being obtained by sequentially arranging the first bit value and the second bit value for each block of the pre-defined number of blocks of the prominent frame.

US Pat. No. 10,116,983

SYSTEM AND METHOD FOR MANAGING ADVERTISING IN PROGRAM STREAMS

PRIME RESEARCH ALLIANCE E...

1. A method for managing advertisement opportunities in a network environment, the method comprising:retrieving advertisement parameters for a plurality of advertisements, the advertisement parameters provided by an advertiser;
creating a plurality of substreams by dividing a program stream;
identifying avails that are positioned within each of the plurality of substreams and dividing the avails into one or more subavails, each subavail having viewer characteristics related to a group of viewers of the subavail;
selecting a first subavail from a first substream of the plurality of substreams and a second subavail from a second substream of the plurality of substreams, the viewer characteristics of the first subavail being substantially similar to the viewer characteristics of the second subavail;
grouping the selected subavails, the grouped subavails having viewer characteristics based on the common viewer characteristics of the selected subavails;
correlating the viewer characteristics of the grouped subavails with the advertisement parameters of each of the plurality of advertisements; and
ranking the correlation of each of the plurality of advertisements to select one or more advertisements that are suitable to display in each of the grouped subavails.

US Pat. No. 10,116,897

PHOTOMETRIC STABILIZATION FOR TIME-COMPRESSED VIDEO

Adobe Systems Incorporate...

1. In a digital medium environment to reduce at least some photometric characteristic changes of time-compressed video, a method implemented by a computing device, the method comprising:determining, by the computing device, correspondences of pixels in adjacent frames of a time-compressed video;
determining, by the computing device, photometric transformations between the adjacent frames of the time-compressed video, the photometric transformations describing how photometric characteristics of the correspondences change between the adjacent frames;
computing, by the computing device, a measure of photometric similarity between the adjacent frames based on the photometric characteristics of the correspondences;
computing, by the computing device, filters for smoothing photometric characteristic changes across the time-compressed video as combinations of the determined photometric transformations by combining the determined photometric transformations according to weights indicating that photometric transformations between similar frames of the time-compressed video, as indicated by the measure of photometric similarity, influence the filters more than the photometric transformations between less similar frames; and
generating, by the computing device, digital content comprising photometrically stabilized time-compressed video, in part, by using the computed filters to smooth the photometric characteristic changes.