US Pat. No. 10,766,875

CRYSTALLINE FORMS OF AN ANDROGEN RECEPTOR MODULATOR

Aragon Pharmaceuticals, I...

1. A crystalline Form D of 4-[7-(6-cyano-5-trifluoromethylpyridin-3-yl)-8-oxo-6-thioxo-5,7-diazaspiro[3.4]oct-5-yl]-2-fluoro-N-methylbenzamide that is characterized as exhibiting at least one of:(a) an X-ray powder diffraction (XRPD) pattern with characteristic peaks at 6.3±0.1° 2-Theta, 13.9±0.1° 2-Theta, 16.4±0.1° 2-Theta, 17.0±0.1° 2-Theta, 23.7±0.1° 2-Theta, and 24.8±0.1° 2-Theta; or
(b) an X-Ray powder diffraction (XRPD) pattern substantially the same as shown in FIG. 4.
US Pat. No. 10,767,131

MOTOR FUEL FORMULATION

SWIFT FUELS, LLC, West L...

1. A motor fuel comprising:20-40 wt % cyclopentane, 35-40 wt % isooctane and 20-30 wt % aromatics,
the aromatics being selected from the group consisting of toluene, xylene and trimethylbenzene,
the motor fuel comprising less than 0.1 ml/gallon of tetraethyl lead, less than 0.3 vol % of MTBE, less than 0.3 vol % of ETBE and less than 0.3 vol % of TAME,
the motor fuel further comprising less than 0.5 wt % aromatic amines.
US Pat. No. 10,765,083

COTTON VARIETY 16R043

Monsanto Technology LLC, ...

1. A plant of cotton variety 16R043, wherein representative seed of said variety have been deposited under ATCC Accession No. PTA-125962.
US Pat. No. 10,766,876

COCRYSTAL, PRODUCTION METHOD THEREOF, AND MEDICAMENT CONTAINING COCRYSTAL

Takeda Pharmaceutical Com...

1. A cocrystal of (S)-3-(1-((1-acryloylpyrrolidin-3-yl)oxy)isoquinolin-3-yl)-1H-1,2,4-triazol-5(4H)-one and gentisic acid, wherein the cocrystal shows a powder X-ray diffraction pattern having characteristic peaks at lattice spacings (d) of 13.04±0.2, 5.96±0.2, 4.67±0.2, 3.63±0.2 and 3.28±0.2 angstroms.
US Pat. No. 10,768,157

MATERIALS AND METHODS FOR THE DETECTION OF TRACE AMOUNTS OF SUBSTANCES IN BIOLOGICAL AND ENVIRONMENTAL SAMPLES

THE FLORIDA INTERNATIONAL...

1. A method of synthesizing a molecularly imprinted polymer (MIP) matrix, comprising:mixing a template analyte with more than one sol-gel precursor to form a template-precursor complex, the sol-gel precursors comprising silane groups;
hydrolyzing the sol-gel precursors of the template-precursor complex and a cross-linking agent with a hydrolytic agent in the presence of a reaction catalyst;
combining the hydrolyzed cross-linking agent with the template-precursor complex having hydrolyzed sol-gel precursors;
adding a basic solution to the combination of the hydrolyzed cross-linking agent and the template-precursor complex to form a sol-gel polymer network surrounding the template analyte;
and
extracting the template analyte using a solvent, leaving behind molecular cavities in the sol-gel polymer network that are complementary in size, shape, and functionality to the template analyte.
US Pat. No. 10,765,084

METHOD FOR IMPROVING THE MEAN DRY SHOOT WEIGHT, MEAN DRY GRAIN WEIGHT, AND SUPPRESSING SEED-BORNE INFECTION IN A CEREAL CROP

University College Dublin...

12. A method of preparing a seed having (a) increased grain yield and dry shoot weight or (b) with increased tolerance to the development of seed-borne fungal infections on germinated and ungerminated seeds, the method comprising the step of inoculating the seed with a fungal root endophyte isolated from a root of a plant which produced said seed, wherein the endophyte is characterised in having a nuclear ribosomal internal transcribed spacer (nrITS) with 100% sequence identity to any one of SEQ ID NOs: 3 to 15, wherein the fungal root endophyte is isolated from a root of the plant Hordeum murinum, and wherein the plant and seeds are in low-nutrient conditions, or in drought-stressed conditions, or in multiply-stressed conditions.
US Pat. No. 10,767,647

GRAPHENE ENHANCED ELASTOMERIC STATOR

REME TECHNOLOGIES, LLC, ...

1. A method of forming a graphene enhanced elastomeric stator, wherein the method includes the following steps:forming a metal stator outer tubular having an inner tubular surface, and
forming a graphene enhanced elastomeric stator inner liner on said inner tubular surface comprising adding a co-agent to an elastomeric material mixture, the mixture including elastomeric material and graphene particles, to bridge peroxide induced cross-links.
US Pat. No. 10,767,137

CLEANING FORMULATIONS FOR CHEMICALLY SENSITIVE INDIVIDUALS: COMPOSITIONS AND METHODS

SageWay Solutions, LLC, ...

1. A cleaning composition suitable for use by chemically-sensitive individuals for cleaning fabrics or hard surfaces, comprising:a. water;
b. at least 0.05% by weight of an alkyl polyglucoside that contains no undesirable contaminants, wherein the undesirable contaminants are selected from the group consisting of residual petrochemical solvents, phenyl derivatives and unsafe byproducts;
c. at least 1.5% by weight of an organic solvent; and
d. an additional surfactant selected from the group consisting of:
i) 0.05 to 15% by weight of an anionic surfactant selected from the group consisting of sodium alkyl sulfates;
ii) 0.05 to 30% by weight of an amphoteric surfactant selected from the group consisting of trialkyl amine oxides;
iii) 0.05 to 30% by weight of a zwitterionic surfactant selected from the group consisting of betaine and sulphobetaine surfactants, derivatives thereof and mixtures thereof;
iv) combinations of i) and ii); and
v) combinations of i), ii), and iii);
wherein the pMC for each alkyl polyglucoside, each organic solvent, and each additional surfactant has a value of at least 80%;
wherein a headspace analysis of the cleaning composition confirms that the cleaning composition contains less than 1000 ?g/m3 of any VOCs which are regulated by governmental bodies;
wherein the cleaning composition has a pMC of at least 90%; and
wherein none of components b, c, or d has a vapor pressure greater than 0.1 mm Hg at 20° C.
US Pat. No. 10,770,210

FERRITE COMPOSITION AND ELECTRONIC DEVICE

TDK CORPORATION, Tokyo (...

1. A ferrite composition comprising a main component and an accessory component, whereinthe main component includes:
18.0 to 30.0 mol % of iron oxide in terms of Fe2O3;
4 to 14 mol % of copper oxide in terms of CuO;
0 to 6.0 mol % of zinc oxide in terms of ZnO; and
a remaining part of nickel oxide,
the accessory component includes:
0.30 to 1.83 pts. wt. of silicon compound in terms of SiO2;
4.00 to 10.00 pts. wt. of cobalt compound in terms of Co3O4; and
1.00 to 3.00 pts. wt. of bismuth compound in terms of Bi2O3 with respect to 100 pts. wt. of the main component, and
a cobalt compound content in terms of Co3O4 divided by a silicon compound content in terms of SiO2 is a value of 5.5 to 30.0.
US Pat. No. 10,770,722

METHOD FOR PREPARING SILICON NANOCOMPOSITE DISPERSION USING PLASMA, AND ANODE ACTIVE MATERIAL AND LITHIUM SECONDARY BATTERY USING SAME

1. A silicon nanocomposite consisting of:a silicon nanoparticle having an average diameter of 100-300 nm; and
a silicon carbide bonding which is configured on at least one region of a surface of the silicon nanoparticle with a thickness of 0.1-0.5 nm, wherein:
a surface area where the silicon carbide bonding is formed, as compared to a whole surface area of the silicon nanoparticle, accounts for 10-50%, and
a surface of the silicon nanocomposite further includes a carbon layer of a thickness of 3-15 nm.
US Pat. No. 10,766,626

SINGLE-PIECE EXTENDED LAMINAR FLOW INLET LIPSKIN

The Boeing Company, Chic...

1. A method for making a heat-treated structure formed of metal, the method comprising:performing a first heat-treating process on a metal workpiece in an annealed condition, to transition the metal workpiece from an annealed condition to a first-hardened condition, said metal workpiece comprising at least one friction stir weld;
forming the metal workpiece into a shaped metal workpiece while the metal workpiece is in the first-hardened condition; and
performing a second heat-treating process on the shaped metal workpiece to transition the shaped metal workpiece from the first-hardened condition to a second-hardened condition.
US Pat. No. 10,767,138

COMPOSITION FOR ALL NATURAL MULTIPURPOSE CLEANER

1. A composition for an all natural multipurpose cleaner comprising:distilled water in an amount of between 92.00% and 96.00% by weight of the composition;
lauryl glucoside (AG-60) in an amount of between 0.85% and 0.90% by weight of the composition;
aloe vera in an amount of between 0.51% and 0.53% by weight of the composition;
vitamin E in an amount of between 0.02% and 0.04% by weight of the composition;
ethyl alcohol (food grade) in an amount of between 3.90% and 4.10% by weight of the composition;
a preservative in an amount of between 0.04% and 0.06% by weight of the composition; and
citric acid in an amount of between 0.04% and 0.06% by weight of the composition.
US Pat. No. 10,770,723

POSITIVE ELECTRODE MATERIAL AND LITHIUM ION BATTERY

Ningde Amperex Technology...

1. A positive electrode material, comprising:a substrate material; and
a coating material formed on at least one portion of the surface of the substrate material;
the general formula of the substrate material being Li1+xCo1?yMyO2 or LiNiaCobN1?a?bO2, wherein 0?x<0.1, 0?y<0.1 and M is at least one of selected from the group of Mn, Ni, Al, Mg, Ti, Zr, Y, P and Cr; ??a?0.82, 0.1?b ??, 0.6?a+b, N is at least one of selected from the group of Mn, Al, Mg, Ti, Zr, La, Ce and Y;
the coating material includes CeZrO4?z, wherein 0?z<0.1.
US Pat. No. 10,766,883

AMINOPYRAZOLES AS JANUS KINASE INHIBITORS

1. A compound selected from:3-((4-Chloro-3-methoxyphenyl)amino)-1-(4-cyanotetrahydro-2H-pyran-3-yl)-1H-pyrazole-4-carboxamide;
3-((4-chloro-3-(methylthio)phenyl)amino)-1-(4-cyanotetrahydro-2H-pyran-3-yl)-1H-pyrazole-4-carboxamide;
3-((4-cyano-3-methoxyphenyl)amino)-1-(4-cyanotetrahydro-2H-pyran-3-yl)-1H-pyrazole-4-carboxamide;
3-((4-cyano-3-(2-fluoropropan-2-yl)phenyl)amino)-1-(4-cyanotetrahydro-2H-pyran-3-yl)-1H-pyrazole-4-carboxamide; and
1-(4-cyanotetrahydro-2H-pyran-3-yl)-3-((3-methylbenzo[d]isoxazol-5-yl)amino)-1H-pyrazole-4-carboxamide;
or a pharmaceutically acceptable salt thereof.
US Pat. No. 10,767,139

SYNERGISTIC PROTEIN SOIL REMOVAL THROUGH NOVEL CHELATOR COMBINATION

Ecolab USA Inc., Saint P...

1. A concentrated detergent composition comprising:from 0.5 wt. % to 5 wt. % of a nonionic surfactant,
at least 52 wt. % of an alkali metal carbonate, and
chelating/sequestering agents, wherein the chelating/sequestering agents comprise of from 5 wt. % to 25 wt. % of methyl glycine diacetic acid, from 5 wt. % to 10 wt. % glutamic acid N,N-diacetic acid, and from 5 wt. % to 17 wt. % of an alkali metal tripolyphosphate;
wherein the detergent composition removes protein soil;
wherein the total quantity of the chelating/sequestering agents is less than 45 wt. % of the composition; and
wherein the molar ratio of the glutamic acid N,N-diacetic acid to the sum of the methyl glycine diacetic acid and the alkali metal tripolyphosphate is 0.05 to 2 further wherein the wt % of each component is based on the total weight of the composition.
US Pat. No. 10,767,140

HIGH PERFORMANCE DISHWASHER COMPOSITIONS FOR SHORT DISHWASHER CYCLES AND METHODS OF MAKING THE SAME

Korex Canada Company, Et...

1. A dishwasher composition comprising:at least one strong chelant, at least one weak chelant, a structural constituent, at least one surfactant, and a primary polymer, the primary polymer comprising a copolymer which is a polymerized reaction product of sulfonic acid monomer units and monomer units comprising one or more supplemental monomers, wherein the primary polymer comprises from 10 wt. % to 50 wt. % sulfonic acid monomer units and has a weight average molecular weight of less than or equal to 20,000 g/mol;
wherein the dishwasher composition is a liquid or a gel having a pH of from 7.0 to 9.5, and the dishwasher composition includes less than 0.5 wt. % silicates, carbonates, and bicarbonates combined based on the total weight of the dishwasher composition.
US Pat. No. 10,767,141

THERMOLYSIN FOR EASY-CLEANING OF INSECT BODY STAINS

Toyota Motor Corporation,...

1. A method of facilitating the removal of a biological stain on a substrate or a coating comprising:providing a liquid coating material comprising an alcohol selected from the group consisting methanol, ethanol, isopropyl alcohol, propanol and butanol, wherein the concentration of said alcohol in said liquid coating is from 20 to 40% wt. %, wherein the pH of the liquid coating is geater than 5.0, and associating a themolysin-like protease, wherein the protease has an activity in excess of 20,000 U/mg, with said liquid coating material to form a liquid bioactive coating material such that said protease is capable of enzymatically degrading a component of a biological stain.
US Pat. No. 10,765,093

HUMANIZED TRANSGENIC ANIMAL

1. A humanized transgenic animal comprising a first human gene encoding a first human protein and a second human gene encoding a second human protein,wherein the first human protein and the second human protein directly interacts with each other in transducing signals from the exterior of a cell,
wherein the direct interaction between the first human protein and the second human protein is without the presence of a third protein,
wherein a first animal gene substantially homologous to the first human gene in the transgenic animal genome is replaced by the first human gene and a second animal gene substantially homologous to the second human gene in the transgenic animal genome is replaced by the second human gene, and the human genes are wild type human genes, and are operably linked to the transcriptional regulatory sequences of the endogenous animal genes, and
wherein the animal is mouse or rat.
US Pat. No. 10,767,142

PROTEASES WITH IMPROVED ENZYME STABILITY IN DETERGENTS

1. A protease having an amino-acid sequence which has an at least 90% sequence identity to the amino acid sequence set forth in SEQ ID NO:2 over the entire length thereof and which has an amino acid substitution at one or more of the positions P9, Q62, D101, N130, G166, N187, S216, N238 and Q271, each based on the numbering according to SEQ ID NO:2.
US Pat. No. 10,768,167

PLASMA MEMBRANE CITRATE TRANSPORTER FOR USE IN THE DIAGNOSIS AND TREATMENT OF CANCER

1. A method of treating cancer in a patient in need thereof, the method comprising administering to the patient an inhibitor of plasma membrane citrate transporter (pmCiC) activity, wherein said cancer is selected from the group consisting of prostate cancer, gastric cancer, pancreatic cancer, breast cancer, and colon cancer and wherein said inhibitor of pmCiC activity is gluconate.
US Pat. No. 10,765,094

INFLAMMATION REPORTER SYSTEM

TRANSGENIC INC., Fukuoka...

1. A vector comprising an inflammatory cytokine promoter operably linked to a nucleotide sequence comprising a gene encoding a luciferase reporter protein, a gene encoding an inflammatory cytokine, wherein the inflammatory cytokine is a mouse-derived IL-1? partial sequence consisting of amino acids 17-216, and a gene encoding a proteolytic signal sequence,wherein the luciferase reporter protein, the inflammatory cytokine and the proteolytic signal sequence are configured as a fusion protein, wherein the inflammatory cytokine is N-terminal to the proteolytic signal sequence and C-terminal to the luciferase reporter protein, and
wherein, in the presence of inflammatory stimulation, the inflammatory cytokine promoter becomes functional to thereby activate the expression of the nucleotide sequence and the inflammatory cytokine is cleavable by caspase-1 to separate the luciferase reporter protein from the proteolytic signal sequence while retaining luciferase activity.
US Pat. No. 10,768,168

METHODS FOR IDENTIFYING ARTHROPOD REPELLENTS AND ATTRACTANTS, AND COMPOUNDS AND COMPOSITIONS IDENTIFIED BY SUCH METHODS

The Regents of the Univer...

1. A method of attracting an arthropod comprising exposing the arthropod to a composition comprising 1H-pyrrole or 2-methyloxolane, or any combination thereof.
US Pat. No. 10,765,608

SPRAYABLE COMPOSITIONS FOR STYLING HAIR

1. A sprayable composition comprising a propellant and at least one binder being an ethylene vinly alkanoate copolymer, characterised in that the ethylene vinyl alkanoate copolymer is a random copolymer of ethylene and vinyl alkanoate having a vinyl acetate content within the range of 40 wt % to 42 wt %.
US Pat. No. 10,768,169

METHOD FOR DETERMINING THE DISTINCTIVE NUTRITIONAL REQUIREMENTS OF A PATIENT

Societe des Produits Nest...

1. A method for manufacturing a nutritional composition for administration to a subject suffering from an inflammatory bowel disease characterized by distinctive nutritional requirements in the subject over a healthy subject, the method comprising:a. determining in a sample of the subject suffering from the inflammatory bowel disease a profile of statuses of markers comprising direct and indirect markers indicating the nutritional profile of the subject, wherein each of the direct markers indicates an amount of a macronutrient or micronutrient, and each of the indirect markers are derived from the direct markers by quantifying a corresponding direct marker and quantifying one or more additional markers that indicate a status of the corresponding direct marker, at least one of the direct and indirect markers is selected from the group consisting of an amino acid marker, a fat marker, a carbohydrate marker, a nucleotide marker, an osmolyte marker, a peptide marker, a catabolism marker, a nitric synthase marker, and combinations thereof;
b. determining in a sample of the healthy subject a profile of the statuses of the same markers comprising the same direct and indirect markers determined in step a, at least one of the sample of the subject suffering from the inflammatory bowel disease or the sample of the healthy subject is a sample selected from the group consisting of whole blood, blood plasma, blood serum, red blood cells, urine, tissue biopsies, and combinations thereof;
c. comparing the profiles determined in steps a. and b., and determining distinctive nutritional requirements for nutrients comprising macronutrients and micronutrients in the subject suffering from the inflammatory bowel disease based on the comparison of the profiles determined in steps a. and b., wherein when a level of the markers determined in step a. is lower than a level of the same markers determined in step b., the distinctive nutritional requirements for the subject comprise a composition comprising the nutrients in an effective amount to enable a level of the nutrients in the subject suffering from the inflammatory bowel disease to match a level of the nutrients in the healthy subject; and
d. manufacturing the composition comprising the nutrients in the effective amount to restore the nutritional profile of the nutrients in the subject suffering from the inflammatory bowel disease to or toward that of the healthy subject as determined in step b.
US Pat. No. 10,765,609

ORAL COMPOSITION

Kao Corporation, Tokyo (...

1. An oral composition comprising the following ingredients (A), (B), (C), and (D):(A) 0.005 mass % or more and 2 mass % or less, in terms of fluorine atoms, of one or more fluoride ion-supplying compounds selected from the group consisting of sodium fluoride, ammonium fluoride, potassium fluoride, sodium monofluorophosphate, and tin fluoride;
(B) 4 mass % or more and 30 mass % or less of a higher alcohol having 12 or more and 22 or less carbon atoms comprising (b1) cetanol and (b2) stearyl alcohol;
(C) 0.1 mass % or more and 10 mass % or less of a surfactant comprising one or more selected from the group consisting of (c1) a nonionic surfactant selected from the group consisting of sorbitan fatty acid ester and polyoxyethylene sorbitan fatty acid ester and (c2) an anionic surfactant being fatty acid having 12 or more and 22 or less carbon atoms or a salt thereof; and
(D) water,wherein the content of the ingredient (c1) is 0.05 mass % or more; a mass ratio of the content of the ingredient (A) in terms of fluorine atoms to the content of the ingredient (B), (A)/(B), is 0.001 or more and 0.2 or less; and the molar amount of (E) a polyvalent metal compound other than the ingredient (A) is less than 0.1-fold the molar amount of the ingredient (A).
US Pat. No. 10,768,170

PREDICTIVE BIOMARKERS FOR CTLA-4 BLOCKADE THERAPY AND FOR PD-1 BLOCKADE THERAPY

H. Lee Moffitt Cancer Cen...

1. A method comprising assaying peripheral blood mononuclear cells (PBMCs) from a subject diagnosed with melanoma for expression of CD4, Ki67, and EOMES,wherein the frequency of Ki67+EOMES+CD4+ T cells in CD4+ T cells in the PBMCs is inversely proportional with the risk of an immune related adverse event (irAE) after CTLA-4 blockade treatment, and
treating the subject with a CTLA-4 blockade treatment if the frequency of Ki67+EOMES+CD4+ T cells in PBMCs of the subject is at least 0.45%.
US Pat. No. 10,765,610

ORAL CARE COMPOSITIONS CONTAINING POTASSIUM NITRATE AND PEROXIDE

1. A dentifrice composition comprising:a. a gel network phase comprising a cold dispersible fatty amphiphile and a secondary surfactant, wherein the cold dispersible fatty amphiphile comprises
i. about 40%, by weight of the cold dispersible fatty amphiphile, of cetyl alcohol,
ii. about 40%, by weight of the cold dispersible fatty amphiphile, of stearyl alcohol,
iii. about 10%, by weight of the cold dispersible fatty amphiphile, of sodium lauryl sulfate, and
iv. about 10%, by weight of the cold dispersible fatty amphiphile, of a sodium acrylate/sodium acryloyl dimethyl taurate copolymer;
b. potassium nitrate;
c. a peroxide source selected from the group consisting of hydrogen peroxide, urea peroxide, calcium peroxide, sodium peroxide, zinc peroxide, polyvinylpyrrolidone peroxide complex and combinations thereof;
d. an abrasive; and
e. a fluoride ion source selected from the group consisting of stannous fluoride, sodium fluoride, potassium fluoride, amine fluoride, sodium monofluorophosphate, indium fluoride, amine fluoride, and combinations thereof.
US Pat. No. 10,765,611

WATER-BASED COSMETIC COMPOSITION COMPRISING AN EFFECT PIGMENT AND A COSMETIC ACTIVE

1. A cosmetic composition comprising:a. pigment consisting of at least one effect pigment selected from the group consisting of i) at least one synthetic fluorphlogopite and ii) at least one synthetic fluorphlogopite and a metal oxide,
wherein the total amount of pigment present in the composition is an amount that is not more than about 0.02%, by weight, based on the total weight of the composition;
b. an emulsion comprising at least one oil and at least one surfactant;
c. at least one active; and
d. an aqueous carrier system comprising water, such that the cosmetic composition is water-based,
wherein the composition is characterized as providing an instant and lasting glowing and brightening effect when applied to keratinous tissue; and
wherein the pigment provides the instant and lasting glowing and brightening effect.
US Pat. No. 10,768,172

ANTI-BED BUG MONOCLONAL ANTIBODIES AND METHODS OF MAKING AND USES THEREOF

Redcoat Solutions, Inc., ...

1. An antibody produced by a hybridoma deposited at the American Type Culture Collection (ATCC) under Accession Number PTA-122644 [BB2] or PTA-122645 [BB7], or an antigen-binding fragment thereof.
US Pat. No. 10,765,612

DYE COMPOSITION COMPRISING 12-HYDROXYSTEARIC ACID, AN ORGANIC AMINE AND A DYE

1. A dye composition comprising:12-hydroxystearic acid,
at least one organic amine, and
at least one dye chosen from oxidation dyes or direct dyes.
US Pat. No. 10,767,148

ORGANIC MATTER DIGESTING APPARATUS

1. An organic matter digesting apparatus, the apparatus comprising:a digestion tank defining sidewalls extending between an upper and lower end, the digestion tank in fluid communication with a gas collection tower, the gas collection tower extending vertically and directly from an upper portion of the digestion tank, and the digestion tank being aligned at an angle other than normal from the bottom of the gas collection tower, the digestion tank being configured to receive organic matter for digestion that includes processing of solid carbon-based material via gravity along a lower portion of the digestion tank and the gas collection tower configured to output methane gas;
a manifold of a plurality of conduits extending to within the digestion tank, each conduit of the plurality of conduits linearly spaced apart from each other along a sidewall of the digestion tank, the manifold configured to output water from the digestion tank; and
an auger coupled to the lower end of the digestion tank configured to output the solid carbon-based material.
US Pat. No. 10,768,173

MULTIVALENT BINDING COMPOSITION FOR NUCLEIC ACID ANALYSIS

ELEMENT BIOSCIENCES, INC....

1. A method of determining an identity of a nucleotide in a target nucleic acid sequence, comprising:(a) providing a composition comprising:
(i) two or more copies of said target nucleic acid sequence;
(ii) two or more primer nucleic acid molecules that are complementary to one or more regions of said target nucleic acid sequence; and
(iii) two or more polymerase molecules;
(b) contacting said composition with a polymer-nucleotide conjugate under conditions sufficient to allow a multivalent binding complex to be formed between said polymer-nucleotide conjugate and said two or more copies of said target nucleic acid sequence in said composition of (a), wherein the polymer-nucleotide conjugate comprises two or more nucleotide moieties; and
(c) detecting said multivalent binding complex, thereby determining the identity of said nucleotide in the target nucleic acid sequence.
US Pat. No. 10,765,100

ATTRACTANTS AND BAIT STATIONS COMPRISING DATE-DERIVED SYRUP PRODUCTS FOR ATTRACTING FLIES AND METHODS THEREIN

WTO INVESTMENTS, LLC, Da...

1. A bait station for attracting biting flies, the bait station comprising:(a) a date-derived syrup product, adapted to exhibit sustained, long-term effectiveness, for attracting at least one type of biting fly selected from the group consisting of: mosquitoes, sand flies, stable flies, biting midges, and stomoxys, wherein said date-derived syrup product includes a syrup product derived from non-fermented fruit borne of the Genus Phoenix L. which includes the date palm, Family Arecaceae, the main species Phoenix dactylifera L., P. atlantica A. Chev., P. canariensis Chabeaud, P. reclinata Jacq., P. sylvestris Roxb., P. humilis Royle, P. hanceana Naudin, P. robelinic O'Brein, P. farinifera Roxb., P. rupicola T. Anders., P. acaulis Roxb., and P. paludosa Roxb., Canary Island date palm, Loureir's date palm, Senegal date palm, reclining date palm, pygmy date palm, wild date palm, and descendent species therein; and
(b) a substrate material for supporting said date-derived syrup product.
US Pat. No. 10,765,613

STABLE LOTION EMULSION COMPOSITION AND WET WIPE

1. A wet wipe comprising a substrate and a lotion emulsion composition; the lotion emulsion composition comprising from about 0.05% to about 0.29% of a preservative enhancing agent and from about 0.01% to about 0.06% of a rheology modifier, wherein:a. the preservative enhancing agent is sorbitan caprylate and/or glyceryl caprylate/caprate;
b. the rheology modifier is xanthan gum
c. the pH of the lotion emulsion composition is less than about 4.2;
d. the combined amount of preservative enhancing agent and rheology modifier is less than about 0.3% by weight of the total lotion emulsion composition; and
e. the lotion emulsion composition comprises greater than about 97% water;
wherein the substrate comprises at least 70% synthetic fibers, by weight of the substrate, and at least 20% natural fibers, by weight of the substrate;
wherein the synthetic fibers are selected from the group consisting of polyethylene terephthalate, polypropylene, and combinations thereof; and
wherein the lotion has an average drying rate of greater than about 6.5% mass/min based on the Lotion Drying Rate Method.
US Pat. No. 10,765,614

AQUEOUS SURFACTANT COMPOSITIONS

BASF SE, Ludwigshafen (D...

1. A composition comprising:one or more alkyl lactate sulfate (A) of the general formula (I),
R1(OCOCH(CH3))nOSO3M1  (I)in which the radical R1 is a linear or branched alkyl or alkenyl radical having 6 to 30 carbon atoms, the index n is a number in the range from 1 to 5, and the radical M1 is selected from the group consisting of H, Li, Na, K, Ca/2, Mg/2, ammonium, and alkanolamine,one or more compound (B) selected from the group consisting of phosphoric acid and the mono-, di- and tri-salts thereof, wherein a cation of these salts is selected from the group consisting of Li, Na, K, Ca, Mg, ammonium, and alkanolamine,
one or more compound (C) selected from the group consisting of citric acid and the mono-, di- and tri-salts thereof, wherein a cation of these salts is selected from the group consisting of Li, Na, K, Ca, Mg, ammonium, and alkanolamine, and
water;where the following provisos apply:the weight ratio of the sum total of the compounds (B) and (C) to the sum total of the compound (A) is in a range from 1:5 to 1:10;
the weight ratio of the sum total of the compound (B) to the sum total of the compound (C) is in a range from 1:1.2 to 1:3; and
the pH of the composition is in the range from 4.5 to 7.5.
US Pat. No. 10,768,176

HETERO FUNCTIONAL BINDING SYSTEMS

ANTEO TECHNOLOGIES PTY LT...

1. A modified substrate for binding of a target molecule thereon, the substrate including:a surface that is hydrophobic wherein the substrate is composed of a metal, a metal or metalloid composite, a synthetic polymer, a plastic, or carbon, and
an oligomeric chromium complex layer having:
(i) one or more chromium co-ordination sites occupied by a hydrophobic ligand for binding the oligomeric chromium complex layer to the hydrophobic surface wherein the hydrophobic ligand is of the form R—X, where X is independently selected from a carboxylic acid, aldehyde, polyalcohol, sulfonic acid, phosphonic acid, phosphate and bisulfate group, and R is independently selected from alkyl, heteroalkyl, alkenyl, alkynyl, cycloalkyl, heterocycloalkyl, alkylcycloalkyl, heteroalkylcycloalkyl, aryl, heteroaryl, aralkyl and heteroaralkyl groups which groups are optionally substituted and wherein the degree to which R—X coordinates with the oligomeric chromium complex layer is in the range of about 25% to about 75%, and
(ii) one or more chromium co-ordination sites available for binding to a target molecule,wherein the hydrophobic ligand binds to the hydrophobic surface by non-covalent and non-coordinative interactions such that the co-ordination sites available for binding to a target molecule are directed away from the hydrophobic surface.
US Pat. No. 10,768,178

COMPOSITIONS AND METHODS FOR IMPROVED CELL-BASED BOTULINUM NEUROTOXIN ASSAYS

BioMadison, Inc., Del Ma...

1. A method of increasing sensitivity of a cell based assay for Botulinum neurotoxin, comprising:(i) providing, in a media having a sub-physiological osmolarity and a temperature of at least 39° C., a transfected cell comprising a reporting peptide cleavable by Botulinum neurotoxin;
(ii) contacting the cell with Botulinum neurotoxin; and
(iii) measuring a cleavage product derived from the reporting peptide,
thereby providing a synergistic decrease in EC50 for Botulinum neurotoxin relative to the cell-based assay performed at physiological temperature and physiological osmolarity.
US Pat. No. 10,765,618

HAIR CONDITIONING COMPOSITIONS COMPRISING ALKYL ETHERS/ESTERS OF POLYETHYLENE GLYCOL, POLYPROPYLENE GLYCOL, AND/OR POLYGLYCERIN

The Procter and Gamble Co...

1. A hair conditioning composition comprising:a cationic surfactant;
a high melting point fatty compound;
an ionic benefit agent, wherein the ionic benefit agent is from about 0.5 wt % to about 10 wt % of salicylic acid;
a stearyl ether of polyethylene glycol having from about 100 to about 200 units of ethylene glycol; and
from about 70 wt % to about 95 wt % of an aqueous carrier;
and wherein the composition is substantially free of anionic surfactants, wherein all concentration ranges are based on the total weight of the composition.
US Pat. No. 10,768,179

METHOD FOR PREDICTING RESPONSIVENESS TO CANCER TREATMENT USING P300-INHIBITING COMPOUND

National Cancer Center, ...

1. A method for improving the response rate of the treatment of cancer, comprising using a biological sample derived from a cancer patient, detecting the presence of a CBP mutation contained in the biological sample, determining the patient is responsive to the treatment of cancer with a compound inhibiting p300, and treating the patient by a method consisting of administrating to the patient an amount of a compound inhibiting p300 and a pharmaceutically acceptable carrier effective to suppress the growth of cancer cells, wherein the mutation is a homozygous CBP deletion, a nonsense mutation, or one of the mutations Asn83Thr, Ser893Leu, Arg1446Cys, Trp1472Cys, Asn2175Ser, Glu1835Stop, Asn2111Ser, Leu551Ile, Gly1411Glu, or Ala2044Gly.
US Pat. No. 10,765,619

SILICONE RESIN, MAKING METHOD, AND COSMETICS

SHIN-ETSU CHEMICAL CO., L...

1. A method for preparing a silicone resin represented by the compositional formula (1) and has a weight average molecular weight of 1,000 to 8,000,[(C6H5)3SiO1/2]a[R13SiO1/2]b[R22SiO2/2]c[R3SiO3/2]d[SiO4/2]e  (1)
wherein R1 is a group, exclusive of phenyl, selected from among C1-C8 alkyl groups, C6-C12 aryl groups and C1-C8 fluorinated alkyl groups, R2 and R3 are each independently a group selected from among C1-C8 alkyl groups, C6-C12 aryl groups and C1-C8 fluorinated alkyl groups, a is a number of 0.01 to 0.2, b is a number of 0.1 to 0.5, c is a number of 0 to 0.2, d is a number of 0.01 to 0.5, e is a number of 0 to 0.6, a+b+c+d+e is equal to 1.0, R1 to R3 and a to e are selected such that at least one phenyl group is included in the molecule, and
a film of the silicone resin having a refractive index of at least 1.48;
the method comprising the following steps (i) and (ii):
(i) effecting hydrolytic condensation of at least one organosilicon compound selected from the general formulae (2) and (3) with at least one compound selected from silanes having the general formulae (4), (5) and (6) and partial hydrolytic condensates thereof in a solventless system or a solvent,
R13SiOSiR13  (2)
R13SiOH  (3)
wherein R1 is as defined above,
(R4O)2SiR22  (4)
(R4O)3SiR3  (5)
(R4O)4Si  (6)
wherein R2 and R3 are as defined above, R4 is each independently hydrogen or a substituted or unsubstituted monovalent hydrocarbon group; and
(ii) adding triphenylsilanol and a solvent to the hydrolytic condensate, and effecting condensation of the hydrolytic condensate with triphenylsilanol in the presence of a basic catalyst.
US Pat. No. 10,767,155

METHOD OF PREPARING A STRAIN OF SACCHAROMYCES CEREVISIAE AND A METHOD OF FERMENTATION TO PRODUCE ETHANOL

SCANDINAVIAN TECHNOLOGY G...

1. A method of preparing a strain of Saccharomyces cerevisiae comprising at least one native XKS1 gene in its genome encoding xylulokinase, at least one native XDH1 gene in its genome encoding xylitol dehydrogenase, and at least one modGre3 gene in its genome, said modGre3 gene encoding the protein of SEQ ID NO: 1 having xylose reductase activity, wherein said method comprises the following steps:a) sporulating a first strain of Saccharomyces cerevisiae to provide at least 20 tetrads of said strain,
b) introducing DNA encoding a xylose reductase and a xylitol dehydrogenase obtained from Scheffersomyces stipitis and a xylulokinase obtained from Saccharomyces cerevisiae, into a second strain of Saccharomyces cerevisiae which is a haploid strain that has the ?-lactamase gene removed and has been evolved to utilize xylose, wherein said second strain of Saccharomyces cerevisiae is a haploid strain obtained from (i) removing the ?-lactamase gene in the deposited yeast strain Taurus01 with deposit number CBS102679, Taurus03 with deposit number CBS128138, Taurus04 with deposit number CBS128139, Taurus07 with deposit number CBS128140, or Taurus10 with deposit number CBS128141, and (ii) evolving the strains of (i) to utilize xylose,
c) mating the first sporulated Saccharomyces cerevisiae strain with the Saccharomyces cerevisiae haploid strain obtained in step b) by mixing the Saccharomyces cerevisiae haploid strain obtained in step b) with each tetrad obtain in step a) to provide mated cells on a YPD agar plate,
d) screening for mated cells on xylose and geneticin agar plates,
e) growing the mated cells from step d) in minimal defined xylose liquid medium,
f) verifying that the mated cells exhibit basic morphology features of budding yeast by microscope inspection and selecting such mated cells with basic morphological features,
g) creating a mixture of the mated cells with basic morphological features by including in equal amounts each of the selected mated cells exhibiting basic morphological features of budding yeast from step f),
h) subjecting the mixture to continuous chemostat cultivation in a chemostat reactor firstly in a microaerobic environment and thereafter in an anaerobic environment using a feeding strategy wherein a defined xylose medium is fed in cycles of feeding and disrupted feeding at a dilution rate of at least 0.08 h?1 in a cycle time range of a few hours, followed by a constant feed at a dilution rate of at least 0.13 h?1,
i) subjecting the mixture to a continuous chemostat cultivation in an anaerobic environment using a feeding strategy wherein lignocellulose and a xylose medium are fed in cycles of feeding and disrupted feeding at a dilution rate of at least 0.08 h?1 in a cycle time range of a few hours, followed by a constant feed at a dilution rate of at least 0.13 h?1,
j) obtaining sugar fermenting Saccharomyces cerevisiae cells with capability to ferment xylose by collecting said cells subjected to the continuous chemostat cultivation of step i) which are capable of fermenting xylose from the chemostat reactor, and
k) diluting the cells capable of fermenting xylose of step j) with water, plating the cells onto a YPD agar plate, and incubating at 30° C. for at least 4 days to obtain single colonies.
US Pat. No. 10,768,180

POLYELECTROLYTE-COATED POLYMER DOTS AND RELATED METHODS

UNIVERSITY OF WASHINGTON ...

1. A nanoparticle comprising:a polymer dot comprising a condensed semiconducting polymer; and
a polyelectrolyte coating that surrounds the condensed semiconducting polymer, the polyelectrolyte coating comprising a first polyelectrolyte polymer and a second polyelectrolyte polymer, wherein the first polyelectrolyte polymer is poly(styrene sulfonate) and the second polyelectrolyte polymer is poly(sodium methacrylate).
US Pat. No. 10,767,156

POLYNUCLEOTIDES ENCODING BREX SYSTEM POLYPEPTIDES AND METHODS OF USING SAME

YEDA RESEARCH AND DEVELOP...

1. An expression vector comprising a nucleic acid sequence encoding a functionally active type 1 Bacteriophage Exclusion (BREX) system comprising a pglX polypeptide comprising an adenine-specific methylase domain (pfam13659, COG1002/COG0286), a brxC/pglY polypeptide comprising an ATP binding domain (pfam10923), a pglZ polypeptide comprising an alkaline phosphatase domain (pfam08665), a brxL polypeptide comprising a Lon-like protease domain (COG4930), a brxA polypeptide comprising a DUF1819 domain (pfam08849), and a brxB polypeptide comprising a DUF1788 domain (pfam08747);wherein the amino acid sequences of each of said type 1 BREX system polypeptides, are set forth as follows:
(a) the brxA polypeptide amino acid sequence is selected from the group consisting of SEQ ID NOs: 4953-5064, 5102-5367, 5399-5414, and 6225;
(b) the brxB polypeptide amino acid sequence selected from the group consisting of SEQ ID NO: 5570-5686, 5698-5939, 5944-5947, 6206, and 6227;
(c) the brxC/pglY polypeptide amino acid sequence selected from the group consisting of SEQ ID NO: 615, 617-735, 818-1110, 1170-1175, and 6229;
(d) a pglX polypeptide amino acid sequence selected from the group consisting of SEQ ID NO: 2766-2916, 2954-3251, 3276-3280, 6182, 6190, 6192, 6194, 6196, 6198, and 6231;
(e) a pglZ polypeptide amino acid sequence selected from the group consisting of SEQ ID NO: 1716-1834, 1905-2192, 2248, 2250, 6204, and 6233; and
(f) a brxL polypeptide amino acid sequence selected from the group consisting of SEQ ID NO: 4028-4298, 4300-4402, 6165, and 6235;
said expression vector further comprising a heterologous cis-acting regulatory element for directing expression of said nucleic acid sequence encoding the type 1 BREX system, wherein said type 1 BREX system confers phage resistance to a bacterium recombinantly expressing same, wherein said bacterium does not endogenously express a functional type 1 BREX system, and wherein said bacterium is a species selected from the group consisting of a Lactococcus species, a Streptococcus species, a Lactobacillus species, a Leuconostoc species, an Oenococcus species, a Pediococcus species, a Bifidobacterium species, and a Propionibacterium species.
US Pat. No. 10,765,621

EXTRACTS OF HALIMIONE PORTULACOIDES AND THEIR APPLICATION

Symrise AG, Holzminden (...

1. A non-pharmaceutical method comprising topically administering an effective amount of an extract of Halimione sp. to skin or scalp of a subject suffering from hair loss and/or whitening or in need of promoting hair follicle growth and/or pigmentation, for modulating(i) keratinocyte differentiation in human hair, and/or
(ii) melamin synthesis in human hair follicles, and/or
(iii) hair growth by improving general wellness of the organ and/or by delaying the catagen in the human hair follicles.
US Pat. No. 10,767,157

DEVICES, SYSTEMS AND METHODS FOR THE PRODUCTION OF HUMANIZED GUT COMMENSAL MICROBIOTA

1. A method of ex vivo production of human commensal gut microbiota expressing a synthetic gene, the method comprising:screening a stool sample obtained from a healthy human subject comprising human commensal gut microbiota to detect and remove ova, parasites, and viruses;
mixing the screened human commensal gut microbiota with a synthetic ex vivo culture medium to prepare a seed culture, wherein the culture medium comprises nutrients and metabolites present in the human intestine;
infusing the seed culture into catridges coated with human cells, tissue extracts, adhesive proteins, or commensal colonizing factors;
culturing the human commensal gut microbiota in the catridges, wherein the culturing comprises maintaining the temperature and gas gradients of the culture medium so as to be similar to the human gut, wherein the gas gradient comprises dissolved oxygen;
modifying the cultured human commensal gut microbiota, wherein the modifying comprises infusing a synthetic gene into the culture medium in a concentration effective to be taken up by the cultured human commensal gut microbiota and
harvesting the cultured human commensal gut microbiota.
US Pat. No. 10,768,182

METHOD FOR DETECTING NUCLEOSOMES CONTAINING HISTONE MODIFICATIONS AND VARIANTS

Belgian Volition SPRL, I...

1. A method for detecting the presence of a cell free nucleosome containing histone H1 or a histone H1 modification, variant or isoform in a sample which comprises the steps of:(i) contacting the sample with a first binding agent which binds to a non-histone H1 nucleosome epitope;
(ii) contacting the nucleosomes or sample with a second binding agent which binds to histone H1 or the histone H1 modification, variant or isoform;
(iii) detecting or quantifying the binding of said second binding agent to histone H1 or the histone H1 modification, variant or isoform in the sample; and
(iv) using the presence or degree of binding of said second binding agent as a measure of the presence of nucleosomes containing histone H1 or the histone H1 modification, variant or isoform in the sample.
US Pat. No. 10,765,622

PROCESS FOR THE PRODUCTION OF A COMPOSITION FOR PROTECTING SKIN FROM DRYING AND/OR UV DAMAGE AND/OR INFLAMMATION

CONOPCO, INC., Englewood...

1. A process for the production of a Camellia sinensis dedifferentiated stem cell extract, the process comprising the steps of:(a) preparing a cell culture comprising Camellia sinensis dedifferentiated stem cells; and
(b) performing a one-step extraction of the cell culture using only ethanol and/or methanol as an extraction solvent, to produce the Camellia sinensis dedifferentiated stem cell extract.
US Pat. No. 10,765,878

COMPOSITIONS AND METHODS TO MODULATE CELL ACTIVITY

THE ROCKEFELLER UNIVERSIT...

1. A method of inactivating a population of neurons, comprising the steps of:(a) providing a population of recombinant neurons, said neurons expressing an ion channel tethered to an iron binding protein which forms paramagnetic nanoparticles, wherein the ion channel is a TRPV1Mutant; and
(b) exposing the neurons to a static magnetic field, thereby activating the ion channel and inactivating the neurons.
US Pat. No. 10,766,646

ANTIPERSPIRANT SPRAY DEVICES AND COMPOSITIONS

1. A method of filling a hand held spray device comprising:providing a body having a reservoir comprising a total fill of materials;
filling the reservoir with a first composition comprising a non-volatile silicone fluid comprising an average viscosity from about 3×10?6m2/s to about 350×10?6m2/s, an antiperspirant active, an organoclay material, and at least one liquid that has a Hansen Solubility Parameter for Hydrogen Bonding, ?h, between about 2 and about 6 and a light transmittance value greater than 90% and wherein the at least one liquid comprises a combination of a first liquid selected from the group consisting of ethyl stearate, propyl stearate, butyl stearate, ethyl myristate, isopropyl myristate, ethyl palmitate, isopropyl palmitate, butyl palmitate, and combinations thereof and a second liquid that is selected from the group consisting of stearyl benzoate, palmityl benzoate, C12-15 alkyl benzoate, and combinations thereof;
filling the reservoir with a second composition comprising a liquid fragrance material after the reservoir is filled with the first composition;
wherein the first composition and the second composition form an antiperspirant composition comprising from about 2% to about 30% by weight of the antiperspirant composition, of the liquid, from about 30% to about 50% by weight of the antiperspirant composition, of non-volatile silicone fluid; and from about 4% to about 10% by weight of the antiperspirant composition, of liquid fragrance material;
providing a valve and attaching the valve to the body; and
filling the reservoir with a propellant wherein mixing of the first composition and the second composition is provided by the introduction of the propellant into the reservoir;
wherein the hand held spray device has a propellant concentration after filling from about 30% to about 90% by weight of the total fill of materials within the reservoir; and wherein the first composition further comprises a silicone gum having a concentration of 0.3% to 1.2% by weight of the antiperspirant composition; and wherein the viscosity of the antiperspirant composition is from about 2,000 centipoise to about 50,000 centipoise.
US Pat. No. 10,768,183

METABOLITE PANEL FOR IMPROVED SCREENING AND DIAGNOSTIC TESTING OF CYSTIC FIBROSIS

McMaster University, Ham...

1. A method of diagnosing and treating cystic fibrosis or CFTR (cystic fibrosis transmembrane conductor regulator)-related metabolic syndrome in a human infant subject comprising:i) detecting in a biological sample from the subject a level of each metabolic biomarker including L-glutamine (Gln), L-tyrosine (Tyr), L-serine, glycine and a metabolite having a m/z of 290.1347 and RMT of 1.2247, and/or L-glutamine, pilocarpic acid and mono(2-ethylhexyl)phthalate (MEHP);
ii) comparing the level of each of the biomarkers to a corresponding control level for each biomarker;
iii) determining that the infant subject has cystic fibrosis when the levels of L-glutamine, glycine, L-serine, L-tyrosine and a metabolite having a m/z of 290.1347 and RMT of 1.2247 are statistically significantly reduced from their corresponding control levels when the sample is a blood, serum or plasma sample, and/or the level of L-glutamine is increased, and the levels of MEHP and pilocarpic acid are reduced, in comparison to their corresponding control levels when the sample is a sweat sample;
iv) treating the infant subject determined to have cystic fibrosis with one or more of nutritional supplementation, a CFTR potentiator, a CFTR corrector, an antibiotic, an anti-inflammatory agent, a mucus-thinning drug, a bronchodilator and a pancreatic enzyme.
US Pat. No. 10,770,743

ELECTRODE MANUFACTURING METHOD, ELECTRODE, AND SECONDARY BATTERY

SEKISUI CHEMICAL CO., LTD...

1. A method for manufacturing an electrode having a laminated body comprising an insulating layer laminated on an electrode active material layer, said method comprising:forming the electrode active material layer comprising an electrode active material; and
laminating the insulating layer directly on the electrode active material layer formed on a base, the insulating layer comprising at least one of a polyolefin resin, a fluororesin, a polyacrylonitrile resin, a polystyrene resin, a polyvinyl acetal resin, a polyimide resin, a polyester resin, an acrylic resin, a polyether sulfone resin, a polysulfone resin, a polyamide resin, a polyamide-imide resin, a polyphenyl sulfone resin, an epoxy resin, a phenolic resin, a polyvinyl alcohol resin, a polyvinyl acetal resin, and carboxymethyl cellulose,
such that a thickness value of the insulating layer is at least twice a surface roughness Rz value of the electrode active material layer,
the surface roughness Rz value being a ten point average roughness as measured in accordance with JIS B0601 1994.
US Pat. No. 10,765,623

COMPOSITION FOR PREVENTING HAIR LOSS OR PROMOTING HAIR GROWTH COMPRISING EXTRACELLULAR FOLLICLE DERIVED FROM LACTIC ACID BACTERIA

AMOREPACIFIC CORPORATION,...

1. A method for promoting hair growth, comprising administering an effective amount of extracellular vesicles isolated from lactic acid bacteria for promoting hair growth to a subject in need thereof;wherein the lactic acid bacterium comprises a bacterium in the genus Lactobacillus and wherein the extracellular vesicles are administered at a concentration of 0.1-100 ?g/mL.
US Pat. No. 10,767,159

AUTOMATED METHOD FOR SELECTING MICROBIAL STRAINS WHICH CAN DEGRADE OR EMULSIFY OIL

EQUINOR ENERGY AS, Stava...

1. An automated method for selecting a microbial strain from within a microbial strain library which can degrade or emulsify a target oil substrate, said method comprising in no particular order, unless specified:(a) providing a plurality of receptacles adapted to receive a liquid microbial cell culture as part of a multi-well culture plate wherein the internal surface(s) of the receptacles are coated, at least in part, with a layer of the target oil substrate;
(b) applying to each of said oil-coated receptacle a sample of one of the members of the strain library, wherein a plurality of members of the strain library are applied to the plate;
(c) culturing said samples in a liquid cell culture medium and monitoring said oil layer coating at least part of the internal surface(s) of said receptacles for a change in its appearance, wherein a change in the appearance of said oil layer coating at least part of the internal surface(s) of said receptacles is indicative of degradation or emulsification of said target oil substrate;
(d) selecting those samples from step (c) which caused degradation or emulsification of the oil substrate;
(e) separately culturing either (i) all the members of the library applied in step (b) or (ii) the library members selected in step (d) in the presence of an n-alkane and monitoring for degradation of said n-alkane;
(f) separately culturing either (i) all the members of the library applied in step (b) or (ii) the library members selected in step (d) in the presence of a polycyclic aromatic hydrocarbon (PAH) and monitoring for degradation of said PAH;
(g) subjecting either (i) all the members of the library applied in step (b) or (ii) the library members selected in step (d) to environmental tolerance testing, wherein said testing comprises culturing the library members under varying environmental conditions and determining the limits of these conditions at which colony viability ceases, wherein said environmental conditions tested comprising temperature, pH and ionic concentration, and optionally further comprising O2 concentration or pressure;
(h) optionally repeating steps (a) to (c) with the library members selected at step (d); and
(i) selecting a microbial strain on the basis of its performance in steps (c), (e), (f), (g) and optionally (h).
US Pat. No. 10,768,184

METHODS FOR INCREASING PALATABILITY OF PET FOODSTUFF

MARS, INCORPORATED, McLe...

1. A method for increasing palatability of a pet foodstuff comprising:a. contacting a polypeptide with a compound, wherein the polypeptide comprises CD36 comprising the amino acid sequence set forth in SEQ ID NO:3 or SEQ ID NO:7,
b. measuring the biological activity of the polypeptide in the absence and in the presence of the compound, and
c. admixing the compound or a composition comprising the compound with a pet foodstuff when there is a difference between the biological activity in the absence, compared to the presence of the compound.
US Pat. No. 10,765,111

CRYOSOLUTIONS AND USES THEREOF

Akron Biotechnology, LLC,...

1. A composition for cryopreservation consisting of: polyethylene glycol (PEG), a saccharide, and an organic amphoteric agent, wherein the polyethylene glycol is present in the composition from 0.001% to 20% v/v, the saccharide is present in the composition from 0.1 ?g/ml to 1 mg/ml and the organic amphoteric agent is present in the composition from 0.1% to 20% v/v, wherein:said organic amphoteric agent is ectoin and/or hydroxyectoin;
said saccharide is trehalose and/or dextran-40;
said composition being added to a biological medium.
US Pat. No. 10,767,160

METHODS FOR MODULATING PRODUCTION PROFILES OF RECOMBINANT PROTEINS

ARES TRADING S.A., Aubon...

1. A method of increasing production of a recombinant protein, said method comprising culturing a mammalian host cell expressing said protein in a cell culture medium comprising a triazine dye, wherein the triazine dye is selected from the group consisting of Cibacron Blue 3GA and Reactive Red 120 and wherein the triazine dye is present at a concentration of 0.01 ?M to 150 ?M, wherein production of the recombinant protein is thereby increased.
US Pat. No. 10,765,112

PESTICIDAL MICROCAPSULES WITH A SHELL MADE OF TETRAMETHYLXYLYLENE DIISOCYANATE, CYCLOALIPHATIC DIISOCYANATE, AND ALIPHATIC DIAMINE

BASF SE, Ludwigshafen (D...

1. A composition comprising microcapsules, which comprise a polyurea shell and a core, wherein the core comprises a pesticide and the shell comprises a polymerization product ofa) a tetramethylxylylene diisocyanate,
b) an cycloaliphatic diisocyanate, and
c) an aliphatic diamine,
wherein:
the composition is the product of a method comprising reacting the tetramethylxylylene diisocyanate and the cycloaliphatic diisocyanate with the aliphatic diamine in the presence of water and the pesticide, and wherein the pesticide has a solubility in water of up to 10 g/1 at 20° C.;
the composition is an aqueous composition comprising an aqueous phase, and the aqueous phase comprises a lignosulfonate; and
the core is free from acetamide herbicides.
US Pat. No. 10,765,625

KNOTTIN-DRUG CONJUGATES AND METHODS OF USING THE SAME

The Board of Trustees of ...

1. A knottin-drug conjugate, comprising:a knottin peptide comprising an engineered loop that binds to a receptor on a cancer cell surface; and
a chemotherapeutic nucleoside drug conjugated to the knottin peptide through an intracellularly cleavable linker.
US Pat. No. 10,766,905

[1,2,4]TRIAZOLO[4,3-B]PYRIDAZINES FOR USE IN THE TREATMENT OF PROLIFERATIVE DISEASES

AstraZeneca AB, Sodertal...

1. A method of treating cancer in a human in need thereof, comprising administering to the human an effective amount of (R)-4-(2-(4-(1-(3-methoxy-[1,2,4]triazolo[4,3-b]pyridazin-6-yl)piperidin-4-yl)phenoxy)ethyl)-1,3-dimethylpiperazin-2-one or a pharmaceutically acceptable salt thereof, wherein the cancer is selected from ovarian cancer, multiple myeloma (MM), and diffuse large B-cell lymphoma (DLBCL).
US Pat. No. 10,767,161

ISOLATION, EXPANSION AND USE OF CLONOGENIC ENDOTHELIAL PROGENITOR CELLS

Indiana University Resear...

1. A method for expanding hematopoietic stem cells (HSCs) ex vivo, the method comprising:(a) culturing human high proliferative potential-endothelial colony forming cells (HPP-ECFCs) expressing CD31, CD141, CD105, CD146, CD144, vWF, and flk-1, but not CD45 and CD14, and having a nuclear diameter ranging from 8 microns to 10 microns on a collagen coated solid support; wherein one HPP-ECFC replicates into more than 2000 cells in 14 days; and
(b) co-culturing human HSCs with HPP-ECFCs of step (a), thereby expanding HSCs.
US Pat. No. 10,765,626

METHODS FOR TREATMENT OF CHARCOT-MARIE-TOOTH DISEASE WITH FOLLISTATIN POLYPEPTIDES

ACCELERON PHARMA INC., C...

1. A method of treating a patient having Charcot-Marie-Tooth disease, the method comprising administering an effective amount of a follistatin fusion protein by an intramuscular route of administration to a targeted muscle of a patient in need thereof, wherein the follistatin fusion protein comprises a first amino acid sequence and a second amino acid sequence, wherein the first amino acid sequence comprises an amino acid sequence that is at least 90% identical to SEQ ID NO: 15 or 16, wherein the first amino acid sequence ends at the amino acid corresponding to any one of amino acids 291-302 of SEQ ID NO: 4; wherein the second amino acid sequence comprises a constant domain of an immunoglobulin G (IgG); and wherein the follistatin fusion protein inhibits signaling by myostatin in a cell-based assay.
US Pat. No. 10,767,162

METHODS FOR DIFFERENTIATION

PRESIDENT AND FELLOWS OF ...

1. A method of differentiating a pluripotent stem cell, the method comprising:i) contacting the pluripotent stem cell with one or more nucleic acids encoding one or more terminal transcription factors; and
ii) inhibiting the cell cycle of the pluripotent stem cell, wherein the cell cycle is inhibited by one or more of the following:
reducing serum levels; reducing serum levels below 5%; contacting the cell with a PI3K inhibitor; contacting the cell with a Myc inhibitor; contacting the cell with a MAPK inhibitor; contacting the cell with a MEK1/2 inhibitor; contacting the cell with a CDK inhibitor; contacting the cell with an Id inhibitor; contacting the cell with a Ink family agonist; contacting the cell with a Cip/Kip family agonist; and culturing the cell in a media lacking a factor selected from the group consisting of: Bmp; Fgf; Activin; or TGF?;
wherein steps i) and ii) occur either:
a) concurrently; or
b) within 15 days of each other in either order; and
whereby a differentiated cell is generated.
US Pat. No. 10,770,747

LITHIUM SECONDARY BATTERY WITH NATURAL GRAPHITE ANODE

SK INNOVATION CO., LTD., ...

1. A lithium secondary battery, comprising:a cathode;
an anode; and
a non-aqueous electrolyte,
wherein the anode comprises an anode active material comprising a natural graphite, and an average particle diameter (D50) of the natural graphite is in a range from 9 ?m to 14 ?m, and the amount of the natural graphite is 90 weight percent or more based on a total weight of the anode active material; and
the anode has an expansion ratio of 17% or less, and the expansion ratio is represented by Equation 3:
Expansion ratio of the anode (%)=100×(T2?T1)/(T1)  [Equation 3]
wherein, in the Equation 3, T1 denotes a thickness of the anode before charging, and T2 denotes a thickness of the anode after a full charging,
a change ratio of particle density, represented by Equation 1, of the natural graphite is 0.06 or less:
Change ratio of particle density=(Da?Db)/(a?b)  [Equation 1]
wherein, in the Equation 1, Da indicates a particle density (g/cc) measured when 2.5 g of the natural graphite is put in a hole having a radius of 1 cm and a pressure of 8 kN is applied for 5 seconds, Db indicates a particle density measured when a pressure of 1 kN is applied for 5 seconds, a is 8 kN, and b is 1 kN.
US Pat. No. 10,767,163

METHOD FOR INDUCING OLIGODENDROCYTE PRECURSOR CELLS FROM OCT4-INDUCED HUMAN SOMATIC CELLS THROUGH DIRECT REPROGRAMMING

Stemlab Inc., Seoul (KR)...

1. A method of inducing oligodendrocyte precursor cells (OPCs) from human somatic cells through direct reprogramming, comprising:culturing human somatic cells, into which a nucleic acid molecule encoding an Oct4 protein is introduced, in a medium containing (i) a TGF-? type I receptor inhibitor; (ii) an inhibitor of Rho-associated kinase (ROCK inhibitor); (iii) a histone deacetylase inhibitor; and (iv) a sonic hedgehog agonist (Shh agonist).
US Pat. No. 10,765,115

METHOD FOR SUPPRESSING REDUCTION OF ISOTHIAZOLINE COMPOUND CONCENTRATION

KURITA WATER INDUSTRIES L...

1. A method for suppressing a decrease in concentration of an isothiazoline compound, the method comprising:feeding an isothiazoline compound to a water system, with an addition concentration of 0.2 mg/L or more and less than 1 mg/L; and
adding a combined chlorine agent consisting of a chlorine stabilizer and a chlorine-based oxidant to the water system, so as to maintain a concentration of the combined chlorine agent in the water system at 0.3 mg/L as Cl2 or more and 6 mg/L as Cl2 or less;
wherein a residual concentration of the isothiazoline compound after 24 hours is 15% or more.
US Pat. No. 10,765,628

METHOD OF PROVIDING BIRTH CONTROL

The Population Council, I...

1. A method of preventing pregnancy in a female of reproductive potential, the method comprising:(a) initially inserting into the vagina of the female of reproductive potential on either day 2, 3, 4, or 5 of the female's menstrual cycle, a vaginal system comprising:
a silicone elastomer ring body having an overall diameter of approximately 56 mm and a cross-sectional diameter of approximately 8.4 mm, a first channel within the ring body, a second channel within the ring body, a first core disposed within the first channel, a second core disposed within the second channel, 103 mg of segesterone acetate, and 17.4 mg ethinyl estradiol, wherein the 103 mg of segesterone acetate is distributed throughout the first core and the second core; and wherein one of the first or second cores contains the 17.4 mg of ethinyl estradiol;
wherein the system releases an average of approximately 0.15 mg/day of segesterone acetate and an average of approximately 0.013 mg/day of ethinyl estradiol in a 21-day first period as measured across thirteen 28-day product-use cycles; and
wherein the initial insertion on day 2, 3, 4, or 5 is the first day of the 21-day first period;
(b) removing the vaginal system from the female's vagina for more than two cumulative hours during the 21-day first period;
(c) reinserting the vaginal system into the vagina of the female of reproductive potential following the removal of the vaginal system from the female's vagina in step (b) and employing a secondary contraception product that does not comprise estrogen for seven days after reinserting the vaginal system;
(d) removing the vaginal system on the day following the end of the 21-day first period;
(f) repeating steps (a) and (d) and optionally repeating steps (b) and (c), wherein steps (a) and (d) are each repeated up to 13 times including the initial insertion for a total of no more than 13 product-use cycles.
US Pat. No. 10,766,908

CALCIUM L-LACTATE FRAMEWORKS AS NATURALLY DEGRADABLE CARRIERS

The Regents of the Univer...

1. A Ca2+-based metal-organic framework (MOF) composition comprising chelating L-lactate and acetate, the MOF of formula: [Ca14(L-lactate)(16-24) (Acetate)(12-4)] or [Ca6(L-lactate)(2-4) (acetate)(10-8)], wherein the lactate and acetate sum to 28 and 12, respectively.
US Pat. No. 10,767,164

MICROENVIRONMENTS FOR SELF-ASSEMBLY OF ISLET ORGANOIDS FROM STEM CELLS DIFFERENTIATION

The Research Foundation f...

1. A synthetic pancreatic organoid, comprising:at least one cross-linked collagen-containing surface, coated with osmotically processed acellular tissue-specific matrix extracted from a mammalian organ without use of detergent, and cell growth factors comprising collagen, mucopolysaccharides, and basement membrane factors; and
stem cells cultured and induced into differentiation on the surface, having at least two differentiated pancreatic cell types.
US Pat. No. 10,765,629

SOLID COMPLEX, PREPARATIONS AND USES THEREOF

ALLERGAN, INC., Irvine, ...

1. A solid complex of (Z)-7-((1R,2R,3R,5S)-2-((S,E)-5-(2,5-dichlorothiophen-3-yl)-3-hydroxypent-1-en-1-yl)-3,5-dihydroxycyclopentyl)hept-5-enamide with ?-cyclodextrin.
US Pat. No. 10,767,165

REPROGRAMMING METHOD FOR PRODUCING INDUCED PLURIPOTENT STEM CELLS (IPSC)

Centre National de la Rec...

1. An in vitro method for producing mammalian induced pluripotent stem cells (iPSCs), comprising:a) transducing isolated mammalian somatic cells with:
i) at least one vector encoding a ?133p53? isoform, ?133p53? isoform, or both ?133p53? and ?133p53? isoforms, and
ii) vectors encoding reprogramming factors Oct4, Sox2, Klf4, and cMyc;
b) culturing the cells obtained in step a) in a medium supporting pluripotent cell expansion; and
c) isolating iPSCs from the culture in step b).
US Pat. No. 10,765,630

METHODS AND COMPOSITIONS TO TREAT ENTEROPATHIC ARTHRITIS

SEN-JAM PHARMACEUTICAL LL...

12. A pharmaceutical composition consisting of: a) an NSAID, and/or a salt thereof; b) a co-agent selected from the group consisting of:fexofenadine, ketotifen, desloratadine, cetirizine salts thereof and combinations thereof; and c) optionally, a pharmaceutical carrier, a pharmaceutical excipient, a sweetening agent, a flavoring agent, a taste masking ingredient, a diluent, alum, a stabilizer, a buffer, a coloring agent, a breath neutralizer, an emulsifying agent, a suspending agent, and combinations thereof.
US Pat. No. 10,765,118

METHODS FOR IMPROVING PLANT GROWTH-MONITORING

FMC Corporation, Philade...

1. A method of improving the growth of a plant comprising applying a plant growth effective amount of a plant growth composition comprising a hydrated aluminum-magnesium silicate and at least one dispersant selected from the group consisting of a sucrose ester, a lignosulfonate, an alkylpolyglycoside, a naphthalenesulfonic acid formaldehyde condensate and a phosphate ester to plant propagation material in the absence of insect pest pressure, wherein the plant growth composition excludes an insecticidally active component.
US Pat. No. 10,765,631

LIPOSOMES FOR MODULATING WISKOTT-ALDRICH SYNDROME PROTEIN

BAR-ILAN UNIVERSITY, Ram...

1. A method for the treatment of a disease in a patient suffering from a condition selected from the group consisting of a hematopoietic malignancy, Wiskott-Aldrich syndrome (WAS), and X-linked thrombocytopenia (XLT) using a therapeutic agent that modifies expression or degradation of WASp in a cell, the method comprising: administering to said patient a liposome or a pharmaceutical composition comprising said liposome, wherein said liposome comprises a lipid bilayer having an internal cavity, a therapeutic agent within the internal cavity configured to modify expression or degradation of WASp in a cell, and a targeting moiety external to the lipid bilayer configured to target an extracellular domain of a cell and wherein said therapeutic agent is (a) a WASp specific-siRNA that, when contacted with a cell, reduces the expression of WASp or increases WASp degradation in said cell; or (b) a peptide that binds to WASp at lysine residues 76 or 81, thereby protecting WASp from ubiquitylation and subsequent degradation.
US Pat. No. 10,767,167

POLYNUCLEOTIDES ENCODING MHC CLASS I-RESTRICTED HTERT EPITOPES, ANALOGUES THEREOF OR POLYEPITOPES

INSTITUT PASTEUR, Paris ...


US Pat. No. 10,765,632

METHODS OF IMPROVING DELIVERY OF COMPOUNDS FOR THERAPY, PROPHYLAXIS OR DIAGNOSIS

CURADIGM SAS, Paris (FR)...

1. A method for treating cancer in a subject, the method comprising a step of intravenously administering to the subject at least one carrier comprising at least one pharmaceutical compound, the at least one pharmaceutical compound being encapsulated in the at least one carrier, and the at least one pharmaceutical compound being a chemotherapeutic agent, and a distinct step of intravenously administering to the subject at least one biocompatible lipid-based nanoparticle, wherein the at least one carrier is devoid of any surface sterically stabilizing agent and wherein the longest dimension of the at least one biocompatible nanoparticle is between about 4 nm and about 500 nm, the surface charge value of the at least one biocompatible nanoparticle is a negative surface charge value below ?10 mV, the at least one biocompatible nanoparticle is not used as a pharmaceutical compound, and said at least one biocompatible nanoparticle is administered to the subject about 10 minutes, or more than 10 minutes, and less than about 72 hours before administering the at least one carrier comprising the at least one pharmaceutical compound.
US Pat. No. 10,767,168

ENGINEERED CRISPR-CAS9 NUCLEASES WITH ALTERED PAM SPECIFICITY

The General Hospital Corp...

1. A method of regulating a gene in a cell, the method comprising contacting the cell witha fusion protein comprising a heterologous functional domain sequence fused to a catalytically inactive Staphylococcus aureus Cas9 (SaCas9) protein comprising an amino acid sequence that has at least 95% sequence identity to the amino acid sequence of SEQ ID NO: 2, wherein the amino acid corresponding to E782 of SEQ ID NO: 2, the amino acid corresponding to N968 of SEQ ID NO: 2, and/or the amino acid corresponding to R1015 of SEQ ID NO: 2 is mutated in the SaCas9 protein, and
a guide RNA having a region complementary to a selected portion of the genome of the cell, wherein the SaCas9 protein is capable of binding to the guide RNA.
US Pat. No. 10,766,913

MIXTURES OF CYCLIC BRANCHED SILOXANES OF THE D/T TYPE AND CONVERSION PRODUCTS THEREOF

Evonik Operations GmbH, ...

1. A mixture of cyclic branched siloxanes having exclusively D and T units, wherein the cumulative proportion of the D and T units having Si-alkoxy and/or SiOH groups that are present in the siloxane matrix, determinable by 29Si NMR spectroscopy, is less than 2 mole percent based on the totality of silicon detected by spectroscopy, and further comprising at least 5% by weight of siloxane cycles selected from the group consisting of octamethylcyclotetrasiloxane (D4), decamethylcyclopentasiloxane (D5), dodecamethylcyclohexasiloxane (D6) and mixtures thereof.
US Pat. No. 10,767,169

NUCLEIC ACID-GUIDED NUCLEASES

Inscripta, Inc., Boulder...

1. A coding sequence for a nucleic acid-guided nuclease comprising a nucleic acid sequence of any of SEQ ID Nos. 20, 21, 22 or 24.
US Pat. No. 10,765,121

SUGAR-FREE BREAD

Mauri Technology B.V., M...

1. Bread dough, comprising:one or more fructans having two or more fructosyl moieties linked by a beta(2,1) bond, selected from the group consisting of inulins and inulin hydrolysates, being in the range of 1-10 wt. %, based on dry weight,
one or more extracellular inulinases (EC 3.2.1.7 and EC 3.2.1.80) wherein the inulinase content is 5-1,000 ppm, and
one or more extracellular invertases (3.2.1.26), the bread dough having a total added sugar content of 0-15 wt. %, based on dry weight and/or a total sugar content of 0-20 wt. %, based on dry weight.
US Pat. No. 10,765,634

CONTROLLED RELEASE FORMULATIONS FOR THE INDUCTION AND PROLIFERATION OF BLOOD CELLS

1. A method for inducing folate receptor 4 expressing regulatory T-cells at a tissue of a subject having an inflammatory disorder, wherein the tissue exhibits at least one symptom of the inflammatory disorder, comprising:administering a formulation locally to said target the tissue, wherein the formulation comprises a first sustained release microparticle population comprising transforming growth factor beta, a second sustained release microparticle population comprising rapamycin, and a third sustained release microparticle population comprising IL-2;
wherein the transforming growth factor beta, the rapamycin, and IL-2 are released at the tissue to induce the folate receptor 4 expressing regulatory T-cells.
US Pat. No. 10,767,170

HIGH-TEMPERATURE NEUTRAL CELLULASE AS WELL AS CODING GENE AND APPLICATION THEREOF

FEED RESEARCH INSTITUTE, ...

1. A method of degrading cellulose contained in a raw textile fiber, comprising applying a cellulase to said raw textile fiber, wherein said cellulase has the amino acid as shown in SEQ ID NO: 1 or SEQ ID NO: 2.
US Pat. No. 10,767,171

BETA-LACTAMASES WITH IMPROVED PROPERTIES FOR THERAPY

Synthetic Biologics, Inc....

1. A beta-lactamase comprising an amino acid sequence having at least 98% sequence identity with SEQ ID NO: 1 and a mutation at all of positions 232, 237, 238, and 240, according to Ambler classification,wherein the beta-lactamase demonstrates greater cephalosporin antibiotic degradation activity as compared to a beta-lactamase having the amino acid sequence of SEQ ID NO: 1.
US Pat. No. 10,767,172

METHOD FOR EPOXIDATION TO PRODUCE ALKENE OXIDE

CORNELL UNIVERSITY, Itha...

1. A method for epoxidation reactions of alkenes, the method comprising reacting alkenes in the presence of oxygen with a hierarchical catalyst composition comprising a continuous macroporous scaffold in which is incorporated self-assembled mesoporous aggregates of magnetic nanoparticles containing an oxygen-transfer enzyme embedded in mesopores of said mesoporous aggregates of magnetic nanoparticles, to produce an alkene oxide.
US Pat. No. 10,767,173

METHOD FOR CONVERTING GENOME SEQUENCE OF GRAM-POSITIVE BACTERIUM BY SPECIFICALLY CONVERTING NUCLEIC ACID BASE OF TARGETED DNA SEQUENCE, AND MOLECULAR COMPLEX USED IN SAME

NATIONAL UNIVERSITY CORPO...

1. A method of modifying a targeted site in a double stranded DNA of a gram-positive bacterium, comprising a step of contacting a complex wherein a nucleic acid sequence-recognizing module that specifically binds to a target nucleotide sequence in a given double stranded DNA and a deaminase are bonded, with said double stranded DNA, to convert one or more nucleotides in the targeted site to other one or more nucleotides or delete one or more nucleotides, or insert one or more nucleotides into said targeted site, without cleaving at least one strand of said double stranded DNA in the targeted site, wherein the double stranded DNA is contacted with the complex by introducing the nucleic acid encoding the complex into the gram-positive bacterium, and wherein the gram-positive bacterium is a microorganism other than of the genus Bacillus.
US Pat. No. 10,767,174

METHOD FOR RGEN RNP DELIVERY USING 5?-PHOSPHATE REMOVED RNA

INSTITUTE FOR BASIC SCIEN...

1. A method of decreasing expression of a gene involved in a Type I interferon response following delivery of an RNA-guided endonuclease ribonucleoprotein into a cell wherein the cell comprises the gene involved in the Type I interferon response, the method comprisingpreparing a guide RNA having a 5? end free of both a diphosphate residue and a triphosphate residue by in vitro transcription using a prokaryote RNA polymerase followed by removing the diphosphate and the triphosphate residues of the guide RNA,
forming the RNA-guided endonuclease ribonucleoprotein by combining a Cpf1 protein with the guide RNA having the 5? end free of both the diphosphate residue and the triphosphate residue, administering the RNA-guided endonuclease ribonucleoprotein directly to the cell, and
wherein the gene involved in the Type I interferon response comprises a gene selected from the group consisting of IFN-? (Interferon-beta), RIG-1 (retinoic acid-inducible gene 1), and OAS2 (2?-5?-oligoadenylate synthetase 2) genes, and the expression level of the gene involved in the type I interferon response is decreased compared to a control in which a RNA-guided endonuclease ribonucleoprotein comprising a Cpf1 protein and a guide RNA having the diphosphate residue or the triphosphate residue at the 5? end is administered.
US Pat. No. 10,765,639

NANOCAPSULES, METHODS OF MANUFACTURE AND USES THEREOF

ADISSEO FRANCE S.A.S., A...

1. Nanocapsules comprising an oily fraction comprising an active ingredient in the form of an oil, an ionic surfactant, a nonionic surfactant, and a hydrophilic polymer surrounding said oily fraction, wherein said ionic surfactant and said hydrophilic polymer have opposite charges.
US Pat. No. 10,767,175

HIGH SPECIFICITY GENOME EDITING USING CHEMICALLY MODIFIED GUIDE RNAS

AGILENT TECHNOLOGIES, INC...

1. A synthetic guide RNA comprising:(a) a crRNA segment comprising (i) a guide sequence capable of hybridizing to a target polynucleotide, wherein the target polynucleotide comprises a target sequence adjacent to a PAM site, and (ii) a stem sequence; and
(b) a tracrRNA segment comprising a nucleotide sequence that is partially or completely complementary to the stem sequence,
wherein the guide sequence consists of 20-N nucleotides, where N is an integer between ?10 and 3; and wherein the guide sequence comprises at least one modification located at position 4-N, 5-N, 7-N, 9-N, 10-N or 11-N relative to the 5?-end of the guide sequence, or a combination thereof; wherein the synthetic guide RNA has enhanced specificity for the target sequence compared to a guide RNA without said modification, and wherein said at least one modification is 2?-deoxy-3?-phosphonoacetate (DP), a 2?-deoxy-3?-thiophosphonoacetate (DSP), a 2?-O-methyl-3?-phosphonoacetate (MP), a 2?-O-methyl-3?-thiophosphonoacetate (MSP), a 2?-O-methyl-3?-phosphorothioate (MS), a 2?-O-(2-methoxyethyl) (MOE), a 2?-O-(2-methoxyethyl)-3?-phosphorothioate (MOES), a 2?-O-(2-methoxyethyl)-3?-phosphonoacetate (MOEP), or a 2?-O-(2-methoxyethyl)-3?-thiophosphonoacetate (MOESP).
US Pat. No. 10,765,640

NON-AQUEOUS PATCH

ITOCHU CHEMICAL FRONTIER ...

1. A non-aqueous patch comprising 0.5 to 7 mass % lidocaine, and a dissolving agent comprising an organic acid and a polyalcohol, wherein the lidocaine and the dissolving agent are in a plaster, the plaster being held by a support, wherein the support has a stretch strength of less than 2,000g/50 mm when the support is stretched by 50% longitudinal extension; and wherein the support comprises a biaxially-oriented stretch cloth, whereinthe organic acid is isostearic acid, which is present in the plaster in an amount of 0.9 mass % to 2.5 mass %, and
the polyalcohol is dipropylene glycol, which is present in the plaster in an amount of 0.2 mass % to 1.5 mass % dipropylene glycol.
US Pat. No. 10,767,176

CRISPR-BASED COMPOSITIONS AND METHODS OF USE

INTEGRATED DNA TECHNOLOGI...

1. An isolated tracrRNA selected from the group consisting of SEQ ID NOS:19-21, and 449-451, wherein the isolated tracrRNA is active in a Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)/CRISPR-associated protein endonuclease system.
US Pat. No. 10,765,641

COSMETIC COMPOSITION COMPRISING A COMBINATION OF PONGAMIA OIL AND 4-T-BUTYLCYCLOHEXANOL FOR THE TREATMENT OF ROSACEA

PIERRE FABRE DERMOT-COSME...

1. A method for treating rosacea or skin redness comprising administering to a patient in need thereof, a composition comprising a therapeutically effective amount of a combination comprising pongamia oil and 4-t-butylcyclohexanol, wherein the 4-t-butylcyclohexanol is solubilized in 1,5-pentanediol.
US Pat. No. 10,767,177

STEROL REGULATORY ELEMENT BINDING PROTEIN (SREBP) CHAPERONE (SCAP) IRNA COMPOSITIONS AND METHODS OF USE THEREOF

Alnylam Pharmaceuticals, ...

1. A double stranded ribonucleic acid (RNAi) agent for inhibiting expression of a sterol regulatory element binding protein (SREBP) chaperone (SCAP) gene, wherein the dsRNA agent comprises a sense strand and an antisense strand forming a double stranded region, andwherein the antisense strand comprises a region of complementarity to an mRNA encoding SCAP, wherein the region of complementarity comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from nucleotides 1132-1156 of SEQ ID NO:1.
US Pat. No. 10,765,129

POWDERED EMULSION FOR ANIMAL FEED

SEVECOM S.P.A., Milan (I...

1. A solid mixture comprising:a solid composition in powder form comprising:
a carrier or support in powder form,
with at least one emulsifier incorporated, or adsorbed, or absorbed, or applied on an outer face of the carrier or support in powder form, the at least one emulsifier chosen from the group consisting of:
(i) a mixture comprising an ethoxylated castor oil and at least one vegetable olein;
(ii) a mixture comprising an ethoxylated castor oil, at least one vegetable olein and a propylene glycol;
(iii) a mixture of (i)-(ii),
and
a mineral inert comprising magnesium oxide with a content by weight of at least 95%, calcium oxide with a content by weight below 2.5% and the mineral inert further comprising silicon dioxide with a content by weight below 1%, and iron (III) oxide and aluminum oxide each with a content by weight below 0.04%;wherein said solid mixture comprises said solid composition in powder form in an amount by weight from 5% to 30% and said mineral inert in an amount by weight from 70% to 95%.
US Pat. No. 10,765,642

COMPOSITION FOR PREVENTING OR TREATING MUSCLE WEAKNESS-RELATED DISEASES COMPRISING SOBREROL

KOREA RESEARCH INSTITUTE ...

1. A method for treating a subject suffering from muscle weakness-related disease, comprising administering an effective amount of a composition comprising sobrerol or a pharmaceutically acceptable salt thereof to the subject,wherein the muscle weakness-related disease is age-related sarcopenia.
US Pat. No. 10,767,178

COMPOSITIONS AND METHODS OF USING PIRNAS IN CANCER DIAGNOSTICS AND THERAPEUTICS

YALE UNIVERSITY, New Hav...

1. A method of treating a subject for liver cancer comprising administering the subject an effective amount of a pharmaceutical composition comprising a compound that increases the level of piR-37213 or a mimic thereof in cells of the liver cancer.
US Pat. No. 10,766,923

METHODS AND COMPOSITIONS TO INCREASE THE RATE OF LIGATION REACTIONS CATALYZED BY A SORTASE

The Regents of the Univer...

1. A reagent for ligating a desired polypeptide to a target moiety having a linking peptide attached thereto where the linking peptide comprises an LPXTG (SEQ ID NO: 2) amino acid motif in the carboxyl terminal of the linking peptide, said reagent comprising:a polypeptide comprising an amino terminal polyglycine sequence comprising at least three contiguous Gly residues sequence followed by said desired polypeptide sequence followed by a sequence comprising the catalytic domain of a Sortase A enzyme.
US Pat. No. 10,767,179

MICRORNA COMPOSITION FOR THE TREATMENT OF NEUROBLASTOMA

THE BOARD OF REGENTS OF T...

1. A synthetic microRNA mimic comprising a double stranded RNA comprising (i) a first RNA component comprising a seed sequence of aaggcac (SEQ ID NO:3) and a mature sequence that is at least 90% identical to uaaggcacccuucugaguaga (SEQ ID NO:1), and (ii) a second RNA component comprising a complement of the first RNA component.
US Pat. No. 10,765,131

NISIN PRODUCTION PROCESS

PURAC BIOCHEM B.V., Gori...

1. A process of producing a nisin-containing lactate ferment in dry powder form, comprising the consecutive steps of:(a) inoculating a nutrient medium comprising a solution of a fermentable substrate and a nitrogen source in an aqueous medium with nisin producing lactic acid bacteria; and
(b) incubating the inoculated nutrient medium under conditions favorable to the growth and/or metabolic activity of said lactic acid bacteria for a period sufficient to produce a fermentation broth containing at least 20 g/l of lactate equivalents and/or at least 1000 IU/ml of nisin equivalent activity, during which period the pH of the fermentation broth is controlled by addition of one or more alkalization agents comprising sodium hydroxide and calcium hydroxide, wherein the Na:Ca (w/w) ratio of the added hydroxides is between ? 1/1; and
(c) spray drying the ferment obtained in step (b) to obtain a free flowing powder containing anhydrous calcium lactate in combination with sodium lactate as the bulk of the powder, by evaporating substantially all water.
US Pat. No. 10,765,644

METHODS FOR THE TREATMENT OF HEPATITIS C

Cipla Limited, Mumbai (I...

1. A pharmaceutical composition comprising hexestrol, or a pharmaceutically acceptable salt or ester thereof, in an amount effective to treat hepatitis C and sofosbuvir.
US Pat. No. 10,766,924

AFFINITY SUPPORT AND METHOD FOR ISOLATING IMMUNOGLOBULIN

JSR CORPORATION, Minato-...

1. An affinity support, comprising:a solid phase support and
a protein ligand,
wherein the protein ligand has the following formula(1):
R—R1  (1),
wherein
R is a linker binding to the solid phase support, which comprises a polyproline comprising from 12 to 24 proline residues, and
R1 is a protein having an affinity to an immunoglobulin, and
R is bound to a C terminal or an N terminal of an amino acid sequence of the protein R1.
US Pat. No. 10,767,180

RNAI INDUCED HUNTINGTIN GENE SUPPRESSION

UNIQURE IP B.V., Amsterd...

1. A method of reducing expression of an RNA transcript comprising SEQ ID NO:1 in a neuron, method comprising introducing into the neuron a double stranded RNA comprising a first RNA sequence and a second RNA sequence wherein the first and second RNA sequence are substantially complementary, wherein the first RNA sequence comprises SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, or SEQ ID NO:7.
US Pat. No. 10,765,645

SULFUR(VI) FLUORIDE COMPOUNDS AND METHODS FOR THE PREPARATION THEREOF

THE SCRIPPS RESEARCH INST...

1. A method of preparing a compound of Formula (I):Y?Z?X1—S(O)(X2)F)m]n  (I)
wherein at least one Z of the compound is N or NR;
the method comprising reacting a precursor antibiotic bearing an NH2 or NHR substituent with CH2?CH—SO2F by a Michael addition to replace the hydrogens of the NH2 or the hydrogen of the NHR with —CH2CH2—SO2F;wherein:Y is an antibiotic core group comprising one or more unsubstituted or substituted moiety selected from an aryl group, a heteroaryl aryl group, a nonaromatic hydrocarbyl group, a nonaromatic heterocyclic group, to which each Z independently is covalently bonded;
n is 1, 2, 3, 4 or 5;
each Z independently is NR, or N;
when Z is NR, m is 1, X1 is a covalent bond or CH2CH2, and the Z is covalently bonded to a nonaromatic hydrocarbyl, a nonaromatic heterocyclic, an aryl, or heteroaryl moiety of Y;
when Z is N, either (a) m is 2, X1 is CH2CH2 and the Z is covalently bonded to a nonaromatic hydrocarbyl, a nonaromatic heterocyclic, an aryl, or a heteroaryl moiety of Y; or (b) m is 1, X1 is a covalent bond or CH2CH2, and the Z is a nitrogen in an aromatic or non-aromatic heterocyclic ring portion of core group Y;
each X2 independently is O or NR; and
each R independently comprises H or a substituted or unsubstituted group selected from an aryl group, a heteroaryl aryl group, a nonaromatic hydrocarbyl group, and a nonaromatic heterocyclic group.
US Pat. No. 10,767,181

OLIGOMERS AND OLIGOMER CONJUGATES

Hoffmann-La Roche Inc., ...

1. An oligomer conjugate comprising:a) at least a first oligomer that is 10 to 20 nucleotides in length and comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 24; 25; 26; 27; 28; 183; 184; 185; 186; 187; 188; 189; 190; 191; 192; 193; 194; 195; 196 and 197;
b) a carrier component comprising an asialoglycoprotein receptor (ASGP-R) targeting moiety, wherein the carrier component is covalently attached to the first oligomer.
US Pat. No. 10,765,646

METHODS OF TREATING DEVELOPMENTAL ENCEPHALOPATHIES

OVID THERAPEUTICS INC., ...

1. A method of treating Lennox-Gastaut syndrome (LGS) comprising intranasally administering to a patient in need thereof a pharmaceutical composition comprising S-ketamine or a pharmaceutically acceptable salt thereof in an amount ranging from about 1 mg to about 100 mg.
US Pat. No. 10,766,926

COMPOSITION FOR AUTOPHAGY INHIBITING IN CELL, AND PHARMACEUTICAL COMPOSITION FOR PREVENTING OR TREATING TUMOR DISEASE, OR INHIBITING ANTI-CANCER AGENTS RESISTANCE CONTAINING THE SAME

L-BASE CO., LTD, Seoul (...

1. A method of inhibiting autophagy in a cell, comprising administering to the cell a polypeptide consisting of the amino acid sequence ofX3-X1-T-X1-K—X2,
wherein,
T is threonine,
K is lysine;
X1 is alanine, isoleucine, or proline;
X2 is alanine, or threonine; and
X3 is glutamine-threonine, glycine-asparagine-threonine, or serine.
US Pat. No. 10,767,182

DIRECT AND SELECTIVE INHIBITION OF MDM4 FOR TREATMENT OF CANCER

VIB VZW, Ghent (DE) Agen...

1. A method of treating a subject having a tumor with an inhibitor of MDM4, the method comprising:determining, in the tumor, or in a sample from the tumor, that the ratio of MDM4 full-length RNA transcript to MDM4 transcript lacking exon 6 is higher than 1; and
administering the inhibitor of MDM4 to the subject;
wherein the inhibitor of MDM4 induces exon 6 skipping in MDM4 mRNA.
US Pat. No. 10,765,647

COMPOSITION FOR TREATING DIABETES, CONTAINING EXTRACT OF YUKMIJIHWANGTANG

COMPREHENSIVE AND INTEGRA...

1. A method for treating type I diabetes, comprising:administering a composition comprising metformin and a composition comprising Yukmijihwang-tang extract to a subject in need thereof,
wherein the Yukmijihwang-tang extract comprises Rehmanniae Radix Preparat, Dioscoreae Rhizoma, Corni Fructus, Alismatis Rhizoma, Hoelen, and Moutan Cortex with the weight ratio of 2:1:1:1:1:1.
US Pat. No. 10,766,927

PEPTIDES THAT STIMULATE SUBCUTANEOUS ADIPOGENESIS

The Regents of the Univer...

1. A pharmaceutical or cosmetic composition comprising a pharmaceutically or cosmetically acceptable carrier and a modified peptide or peptidomimetic, wherein the modified peptide or peptidomimetic is at least 6 amino acids in length, but not more than 8 amino acids in length, and comprises a motif having the sequence: KSEVSK (SEQ ID NO: 3), wherein the modified peptide:comprises a protecting group, wherein the modified peptide has improved ex vivo and/or in vivo peptide stability and/or improved skin penetration when administered topically, relative to an unmodified peptide of the same sequence; or
is functionalized with a polymer selected from the group consisting of a polyethylene glycol, a cellulose, and a modified cellulose, wherein the modified peptide has increased bioavailability, relative to an unmodified peptide of the same sequence; and
wherein the peptidomimetic comprises one or more peptide linkages replaced with a linkage selected from the group consisting of —CH2NH—, —CH2S—, —CH2—CH2—, —CH?CH—, —COCH2—, —CH(OH)CH2—, and —CH2SO, wherein the peptidomimetic has an improvement in a property, relative to an unmodified peptide of the same sequence, wherein the property is selected from the group consisting of: economy of production, chemical stability, half-life, absorption, potency, efficacy, and/or reduced antigenicity.
US Pat. No. 10,767,183

COMBINATION VECTORS AND METHODS FOR TREATING CANCER

American Gene Technologie...

1. A viral vector comprising a therapeutic cargo portion, wherein the therapeutic cargo portion comprises:a first small RNA sequence that is capable of binding to a first pre-determined complementary mRNA sequence, wherein the first pre-determined complementary mRNA sequence comprises a FDPS mRNA sequence; and
a second small RNA sequence that is capable of binding to a second pre-determined complementary mRNA sequence, wherein the second pre-determined complementary mRNA sequence comprises a CD47 mRNA sequence or a cMyc mRNA sequence.
US Pat. No. 10,766,928

TARGETED CONFORMATIONALLY-CONSTRAINED KINKED ENDOSOMAL DISRUPTING PEPTIDES

The University of Kansas,...

1. A peptide sequence comprising:one of SEQ ID NOs: 92-97.
US Pat. No. 10,767,184

CHIMERIC ANTIGEN RECEPTORS TARGETING B-CELL MATURATION ANTIGEN

The United States of Amer...

1. A chimeric antigen receptor (CAR) comprising an antigen recognition moiety directed against B-cell Maturation Antigen (BCMA), a transmembrane domain, and one or more intracellular T cell signaling domains.
US Pat. No. 10,765,136

DIETARY SUPPLEMENT COMPOSITIONS

Melaleuca, Inc., Idaho F...

1. A powdered dietary supplement composition contained in a bulk package, the bulk package containing a measuring scoop and the powdered dietary supplement composition, the measuring scoop being sized to scoop an amount of the powdered dietary supplement composition suitable for blending with a liquid to form a beverage, wherein the amount of the powdered dietary supplement composition is 15 to 60 g and consists essentially of:a) between 10 and 50 weight percent protein, wherein the protein comprises dairy protein, soy protein, whey protein, or a combination thereof;
b) between 5 weight percent and 35 weight percent maltodextrin fiber;
c) between 18 weight percent and 25 weight percent oil creamer;
d) between 10 mg and 1000 mg sweet potato extract;
e) between 20 ?g and 360 ?g chromium; and
f) an extract or extracts selected from the group consisting of:
i) between 50 mg and 5000 mg mulberry extract;
ii) between 10 mg and 1000 mg green tea extract;
iii) between 10 mg and 1000 mg cinnamon extract;
iv) between 10 mg and 1000 mg ginseng extract; and
v) combinations thereof;and wherein the dietary supplement composition optionally comprisesg) one or more of an artificial sweetener, a flavorant, inulin, calcium caseinate, salt, and a component selected from the group consisting of dextrin, carboxymethyl cellulose, hydroxypropyl cellulose, hydroxyethyl cellulose, hydroxypropyl methyl cellulose, methyl cellulose, konjac, collagen, casein, wheat gluten, carrageenan, alginates, propylene glycol alginate, xanthan, dextrin, pullulan, curdlan, gellan, locust bean gum, guar gum, tara gum, gum tragacanth, pectin, agar, zein, karaya, gelatin, psyllium seed, chitin, chitosan, gum acacia, polyvinyl pyrrolidone, polyethylene oxide, and polyvinyl alcohol.
US Pat. No. 10,766,929

DE NOVO DESIGNED HEMAGGLUTININ BINDING PROTEINS

University of Washington,...

1. An isolated polypeptide, comprising an amino acid sequence having the amino acid sequence of any one of SEQ ID NOS: 1, 351-352, 378-379, 381-382, and 455-462.
US Pat. No. 10,765,650

ARTIFICIAL SALIVA

Forward Science Technolog...

1. An oral rinse composition comprising an oral care mixture to be dissolved in water to form an oral rinse solution, supersaturated in calcium phosphate, for use in a human oral cavity, wherein the oral care mixture consists of, by weight:from 0.5% to 5.0% of monobasic sodium phosphate;
from 0.5% to 5.0% dibasic sodium phosphate;
from 40.0% to 75.0% of sodium chloride;
from 10.0% to 30.0% of calcium chloride;
from 0.5% to 5.0% of silicon dioxide; and
a therapeutically effective amount of benzocaine and/or lidocaine as an analgesic and/or anaesthetic.
US Pat. No. 10,766,930

FUSION PROTEINS AND USE THEREOF FOR PREPARING VACCINES

UNIVERSITE DE TOURS, Tou...

1. An immunogenic fusion protein comprising at least two peptides:a) on the C-terminal side, a first peptide which consists of:
an amino acid sequence of the protein S or the protein M of a human hepatitis B virus (HBV) isolate, wherein the sequence of the protein S is chosen from the group consisting of SEQ ID NO: 1 and 2, and the sequence of the protein M is chosen from the group consisting of SEQ ID NO: 3 and 4, or
an amino acid sequence with a percent identity of at least 95% with said amino acid sequence of the protein S or the protein M, provided that said amino acid sequence maintains the ability to form subviral, non-infectious particles and/or immunogenic properties against the HBV virus, or, and
b) on the N-terminal side, a second peptide which consists of:
a sequence of amino acids comprising at least one transmembrane domain and the ectodomain of at least one protein of a Zika virus isolate, or
an amino acid sequence with a percent identity of at least 95% with said amino acid sequence of at least one transmembrane domain and the ectodomain of at least one protein of a Zika virus isolate, provided that said amino acid sequence maintains the ability to form subviral, non-infectious particles and/or immunogenic properties against the Zika virus, said protein of a Zika virus isolate being chosen from among the envelope protein E represented by SEQ ID NO. 15 or a fusion peptide comprising the envelope protein E and the protein prM represented by SEQ ID NO. 50.
US Pat. No. 10,767,186

ORGANIC COMPOUNDS

Novartis AG, Basel (CH)

1. A method for selection of a CHO cell capable of stably expressing a product of interest encoded by an expression vector which has been introduced into the cell, comprising(i) providing a plurality of CHO cells for which cellular viability is dependent upon folate uptake, and into which cells a first polynucleotide located on an expression vector and encoding a functional membrane-bound folate receptor alpha as selection marker and a second polynucleotide located on an expression vector and encoding the product of interest have been introduced, wherein the first polynucleotide and the second polynucleotide are located on the same expression vector or on separate expression vectors,
(ii) culturing said plurality of CHO cells in a cell culture medium having a limiting concentration of a folic acid, wherein the concentration in the cell culture medium is from 0.001 nM to 100 nM, thereby obtaining a CHO cell wherein stable expression of the product of interest is achieved, and
(iii) identifying and isolating a CHO cell wherein stable expression of the product of interest is achieved.
US Pat. No. 10,765,138

SHEET-SHAPED FOOD PRODUCT

TANAKA FOODS CO., LTD., ...

1. A sheet-shaped food product that is molded by containing a mixture of a raw food material and a binding agent,in which the sheet-shaped food product is provided with a surface layer at both sides, and
an inner side layer, which is present between the surface layers and has lower density than each of the surface layers, and
mass ratio (WA/WB) of dry mass of the raw food material (WA) to dry mass of the binding agent (WB) is 4.9 to 7.3, and
the mass ratio WA/WB of the inner side layer and each of the surface layers is the same.
US Pat. No. 10,766,931

MUTANT FRAGMENTS OF OSPA AND METHODS AND USES RELATING THERETO

Valneva Austria GmbH, Vi...

1. A polypeptide comprising a first disulfide bond-stabilized C-terminal fragment of an outer surface protein (OspA), wherein said first disulfide bond-stabilized C-terminal fragment is a hybrid C-terminal OspA fragment consisting of, from the N- to C-terminal direction, a fusion of a first and a second OspA portion from two different Borrelia strains, wherein said polypeptide induces an immune response protective against a Borrelia infection and whereini) said first OspA portion consists of amino acids 125-176 or amino acids 126-175 of OspA from a Borrelia strain that is not B. garinii, strain PBr, and
ii) said second OspA portion consists of amino acids 176-274 or amino acids 177-274 of OspA from B. garinii, strain PBr (SEQ ID NO: 8), wherein the second OspA portion differs from the corresponding wild-type sequence at least by the substitution of the wild-type amino acid at position 182+/?3 of SEQ ID NO: 8 by a cysteine and by the substitution of the wild-type amino acid at position 269+/?3 of SEQ ID NO: 8 by a cysteine and wherein a disulfide bond between the introduced cysteines is present; and
wherein the numbering of the amino acids and of the cysteine substitutions is according to the numbering of corresponding amino acids of the full length OspA of B. burgdorferi s.s., strain B31 (SEQ ID NO: 5).
US Pat. No. 10,767,187

IDENTIFICATION AND CHARACTERIZATION OF UDP-GLUCOSE:PHLORETIN 4?-O-GLUCOSYL TRANSFERASE FROM MALUS X DOMESTICA BORKH

1. A method of producing trilobatin, the method comprising contacting a polypeptide comprising an amino acid sequence at least 98% identical to SEQ ID NO: 8 and having a 4?-0-glycosyltransferase activity with phloretin and UDP-glucose under conditions which allow the formation of trilobatin, thereby producing trilobatin, and purifying said trilobatin, wherein said polypeptide is exogenously expressed in a plant cell, a bacterial or a yeast cell.
US Pat. No. 10,766,932

MULTIPLE ANTIGEN PRESENTING IMMUNOGENIC COMPOSITION, AND METHODS AND USES THEREOF

1. An immunogenic composition comprising an immunologically effective amount of at least one antigenic polysaccharide, an immunologically effective amount of one to ten different peptide or polypeptide antigens, and one to ten different pairs of affinity molecules, wherein each pair comprises a first affinity molecule and a second affinity molecule complementary to the first affinity molecule, wherein in each pair:the first affinity molecule is associated with the at least one antigenic polysaccharide, and
the complementary second affinity molecule is covalently attached to one of the peptide or polypeptide antigens to form a fusion protein, and
the first affinity molecule non-covalently associates with the complementary second affinity molecule to link the respective peptide or polypeptide antigen and the at least one antigenic polysaccharide; and
wherein the immunogenic composition, upon administration to a subject, elicits (i) an immune response to the at least one antigenic polysaccharide, and (ii) an immune response to at least one of the one to ten different peptide or polypeptide antigens, in the subject.
US Pat. No. 10,767,188

METHODS AND COMPOSITIONS FOR OBTAINING USEFUL PLANT TRAITS

NUTECH VENTURES, Lincoln...

1. A grafted plant comprising a scion to which a rootstock had been grafted, wherein:(i) the scion is from a wild type plant;
(ii) MSH1 gene expression is suppressed in the rootstock;
(iii) the rootstock confers an improvement in yield or growth rate in progeny of the grafted plant in comparison to a control plant, wherein the control plant comprises either: (a) progeny of a scion grafted to rootstock that had not been subjected to suppression of MSH1 gene expression; (b) a whole plant that lacks any root graft and that had not been subjected to suppression of MSH1 gene expression; (c) a wild-type plant; or (d) progeny of a plant that is isogenic to the plant source of the scion of the grafted plant; and,
(iv) the MSH1 gene expression is suppressed in the rootstock by a mutation in an endogenous MSH1 gene of the rootstock or by a small inhibitory RNA (siRNA), a microRNA (miRNA), a co-suppressing sense RNA, and/or an anti-sense RNA having complementarity to the endogenous MSH1 gene promoter, 5? or 3? untranslated region, intron, coding region, and/or any combination thereof.
US Pat. No. 10,765,140

TOBACCO COMPOSITIONS

U.S. Smokeless Tobacco Co...

1. A smokeless tobacco product comprising:a unitary porous insoluble matrix having interstices, the porous insoluble matrix including open cell polyurethane; and
a tobacco composition coated on the unitary porous insoluble matrix, the tobacco composition including,
a non-combustible tobacco configured to be orally consumed and having an average particle size of less than or equal to about 250 ?m, and
a plasticizer, wherein
the tobacco composition forms a coating that saturates the smokeless tobacco product and uniformly covers all of the interstices of the unitary porous insoluble matrix, and
the smokeless tobacco product has a maximum dimension ranging from about 5 mm to about 15 mm.
US Pat. No. 10,765,653

FATTY ACID FORMULATIONS AND METHODS OF USE THEREOF

1. A method of treating apraxia and/or autism spectrum disorder, the method comprising orally administering to an individual in need thereof an effective amount of a formulation comprising:a) eicosapentaenoic acid (EPA);
b) docosahexaenoic acid (DHA);
c) ?-tocopherol; and
d) ?-tocopherol,
wherein the ratio of EPA to DHA is in a range of from about 1.5:1 to about 5:1,
wherein the EPA is present in an amount of from 500 mg to 3000 mg per unit dose,
wherein the DHA is present in an amount of from 100 mg to 400 mg per unit dose,
wherein the ?-tocopherol is present in an amount of from about 300 mg to about 3000 mg per unit dose, and
wherein the ?-tocopherol is present in an amount of from about 100 mg to about 1000 mg per unit dose.
US Pat. No. 10,766,933

MUTATED IMMUNOGLOBULIN-BINDING PROTEIN HAVING INCREASED ALKALINE TOLERANCE

Amicogen, Inc., Gyeongsa...

1. An immunoglobulin-binding protein defined by SEQ ID NO: 2 of which an amino acid residue at one or more positions selected from the group consisting of 18th, 36th, 43th and 52nd positions is mutated, wherein the mutation is at one or more positions selected from the group consisting of N18H, D36V, N43Y/L and N52S.
US Pat. No. 10,767,189

METHODS FOR PRODUCING COTTON PLANTS WITH ENHANCED DROUGHT TOLERANCE AND COMPOSITIONS THEREOF

MONSANTO TECHNOLOGY LLC, ...

1. A method of creating a population of cotton plants or seeds, said method comprising the steps of:a. identifying in a first population of staygreen (STG) cotton plants or seeds, cotton plants having at least one marker linked within 3.0 cM to at least one haplotype comprising three or more representative STG alleles in at least one polymorphic locus;
b. selecting from said first population one or more cotton plants or seeds comprising said at least one marker linked to said at least one haplotype comprising three or more representative STG alleles; and
c. crossing said selected one or more cotton plants or seeds to produce a second population of cotton plants or seeds comprising an STG phenotype and said at least one haplotype comprising three or more representative STG alleles;
wherein said haplotype comprises three representative STG alleles of the haplotype of quantitative trail locus (QTL) 1 selected from the group consisting of:
an A nucleotide at position 61 of SEQ ID NO:1,
an A nucleotide at position 61 of SEQ ID NO:2,
an A nucleotide at position 61 of SEQ ID NO:3,
a T nucleotide at position 440 of SEQ ID NO:4,
a C nucleotide at position 61 of SEQ ID NO:5,
an A nucleotide at position 61 of SEQ ID NO:6, and
an A nucleotide at position 61 of SEQ ID NO:7,
the haplotype of QTL 2 selected from the group consisting of: an A nucleotide at position 61 of SEQ ID NO:8,
a G nucleotide at position 61 of SEQ ID NO:9,
a G nucleotide at position 61 of SEQ ID NO:10,
an insertion beginning at position 224 of SEQ ID NO:11,
an A nucleotide at position 61 of SEQ ID NO:12,
a G nucleotide at position 61 of SEQ ID NO:13,
a G nucleotide at position 61 of SEQ ID NO:14,
a C nucleotide at position 61 of SEQ ID NO:15,
a T nucleotide at position 292 of SEQ ID NO:16, and
a C nucleotide at position 104 of SEQ ID NO:17;
the haplotype of QTL 3 selected from the group consisting of:
an A nucleotide at position 61 of SEQ ID NO:18,
a C nucleotide at position 61 of SEQ ID NO:19,
a G nucleotide at position 50 of SEQ ID NO:20, and
an A nucleotide at position 61 of SEQ ID NO:21;
the haplotype of QTL 4 selected from the group consisting of:
an A nucleotide at position 61 of SEQ ID NO:22,
a G nucleotide at position 61 of SEQ ID NO:23,
a T nucleotide at position 230 of SEQ ID NO:24,
a G nucleotide at position 61 of SEQ ID NO:25,
an A nucleotide at position 61 of SEQ ID NO:26,
a C nucleotide at position 150 of SEQ ID NO:27, and
an A nucleotide at position 391 of SEQ ID NO:28;
the haplotype of QTL 5 selected from the group consisting of:
a C nucleotide at position 61 of SEQ ID NO:29,
a C nucleotide at position 61 of SEQ ID NO:30,
a T nucleotide at position 61 of SEQ ID NO:31,
and an A nucleotide at position 230 of SEQ ID NO:32;
the haplotype of QTL 6 selected from the group consisting of:
a C nucleotide at position 61 of SEQ ID NO:33,
a T nucleotide at position 61 of SEQ ID NO:34,
a G nucleotide at position 61 of SEQ ID NO:35,
a T nucleotide at position 156 of SEQ ID NO:36,
an A nucleotide at position 61 of SEQ ID NO:37,
a T nucleotide at position 61 of SEQ ID NO:38,
a C nucleotide at position 61 of SEQ ID NO:39, and
a C nucleotide at position 61 of SEQ ID NO:40; or
the haplotype of QTL 7 selected from the group consisting of:
an A nucleotide at position 61 of SEQ ID NO:41;
an A nucleotide at position 61 of SEQ ID NO:42,
an A nucleotide at position 61 of SEQ ID NO:43; and
a C nucleotide at position 61 of SEQ ID NO:44.
US Pat. No. 10,766,934

GENETICALLY MODIFIED MICROALGAE

RELIANCE INDUSTRIES LIMIT...

1. Genetically modified Chlorella sorokiniana having Accession Number CCAP 211/132.
US Pat. No. 10,767,190

BRASSICACEAE PLANTS RESISTANT TO PLASMODIOPHORA BRASSICAE (CLUBROOT)

BASF AGRICULTURAL SOLUTIO...

1. A method for increasing clubroot resistance in a Brassica plant comprising: introducing a CRL clubroot resistance locus in said Brassica plant, and selecting said CRL clubroot resistant Brassica plant for the presence of the CRL clubroot resistance locus by analyzing genomic DNA from said plant for the presence of at least one molecular marker, wherein said at least one molecular marker is linked to the CRL clubroot resistance locus, wherein said CRL clubroot resistance locus comprises the CRL1 and CRL2 clubroot resistance genes, whereina) said CRL1 clubroot resistance gene comprises a nucleotide sequence
i) having at least 95% sequence identity to the sequence of nucleotide positions 32750 to 51049 of SEQ ID NO: 1;
ii) having a coding sequence having at least 95% sequence identity to the sequence of nucleotide positions 52 to 5343 of SEQ ID NO: 2, nucleotide positions 52 to 5340 of SEQ ID NO: 4, nucleotide positions 52 to 5361 of SEQ ID NO: 6, or to SEQ ID NO: 10; or
ii) encoding a protein having at least 95% sequence identity to SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, or SEQ ID NO: 11; and
b) said CRL2 clubroot resistance gene comprises a nucleotide sequence having at least 95% sequence identity to the sequence of nucleotide positions 220 to 2898 of SEQ ID NO: 8, or encoding a protein having at least 95% sequence identity to SEQ ID NO: 9.
US Pat. No. 10,766,935

PLANT TRAITS CONFERRED BY ISOLATED POLYNUCLEOTIDES AND POLYPEPTIDES

Evogene Ltd., Rehovot (I...

1. A method of increasing at least one trait selected from the group consisting of biomass, plot coverage, rosette area, rosette diameter photosynthetic capacity, nitrogen use efficiency, and tolerance to nitrogen deficiency stress of a plant as compared to a control plant, comprising over-expressing within the plant a polypeptide at least 95% identical to an amino acid sequence set forth by SEQ ID NO: 15889 as compared to a control plant of the same species which is grown under the same growth conditions, wherein said amino acid sequence comprises the domains depicted by InterPro numbers IPR032675 and IPR001810, thereby increasing the at least one trait selected from biomass, plot coverage, rosette area, rosette diameter, photosynthetic capacity, nitrogen use efficiency, and tolerance to nitrogen deficiency of the plant as compared to the control plant.
US Pat. No. 10,767,191

GENE CONFERRING RESISTANCE TO CERCOSPORA BETICOLA IN BEETS

1. A pelleted seed of a sugar beet plant comprising a nucleic acid molecule encoding a polypeptide that is able to confer resistance to Cercospora beticola in a sugar beet plant in which the polypeptide is expressed, wherein the polypeptide comprises an amino acid sequence that is at least 95% identical to the amino acid sequence according to SEQ ID NO: 3.
US Pat. No. 10,765,656

ISOTHIOCYANATE FUNCTIONAL COMPOUNDS AUGMENTED WITH SECONDARY ANTINEOPLASTIC MEDICAMENTS AND ASSOCIATED METHODS FOR TREATING NEOPLASMS

The William M. Yarbrough ...

1. A method for treating a benign neoplasm, an in situ neoplasm, a malignant neoplasm, and/or a neoplasm of uncertain or unknown behavior in a patient, comprising the steps of:administering a medicament formulation to a patient having a benign neoplasm, an in situ neoplasm, a malignant neoplasm, and/or a neoplasm of uncertain or unknown behavior, wherein the medicament formulation comprises:
a first medicament, wherein the first medicament comprises an isothiocyanate functional surfactant; and
a second medicament, wherein the second medicament comprises an antineoplastic agent.
US Pat. No. 10,766,936

TREATMENT OF ISCHEMIA

MOREHOUSE SCHOOL OF MEDIC...

1. A method of treating ischemia, comprising:administering a therapeutically effective amount of an acid sensing ion channel 1a (ASIC1a) inhibitor to an ischemic subject in order to reduce injury resulting from ischemia, wherein the ion channel 1a (ASIC1a) inhibitor is a peptide that includes a cystine knot.
US Pat. No. 10,767,192

BACULOVIRUS SYSTEM FOR THE EXPRESSION OF A GENE THERAPY VECTOR

GENETHON, Evry (FR)

1. A recombinant baculovirus genome comprising:(i) one or more expression cassettes comprising adeno-associated virus (AAV) rep and cap genes under the control of a promoter suitable for expression of said genes in an insect host cell, and
(ii) a recombinant genome of an AAV vector,
wherein said one or more expression cassettes and said recombinant genome of an AAV vector are each inserted into a locus selected from the egt locus and the polyhedrin locus.
US Pat. No. 10,765,657

SELAMECTIN FOR TREATMENT OF SEA LICE INFESTATIONS

Zoetis Services LLC, Par...

1. A method for treating a parasitic infection or infestation from sea lice in a fish, the method comprising orally administering to said fish a therapeutically effective amount of about 50-150 ?g/kg/day of selamectin with a dietary fish feed admixed with selamectin.
US Pat. No. 10,766,937

COMPOSITIONS AND METHODS OF TREATING CANCER

DANA-FARBER CANCER INSTIT...

1. A p600 deoxyribonucleic acid (DNA) fragment consisting of a DNA sequence selected from the group consisting of SEQ ID NO: 7, 9, 11, 13, 15, 17, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77 and 79 wherein the p600 DNA fragment encodes a polypeptide that when expressed in a cell induces cell death.
US Pat. No. 10,767,193

ENGINEERED CAS9 SYSTEMS FOR EUKARYOTIC GENOME MODIFICATION

Sigma-Aldrich Co. LLC, S...

1. A system for eukaryotic genome modification comprising (a) an engineered Bacillus smithii Cas9 protein comprising a nuclear localization signal (NLS), and (b) an engineered guide RNA, wherein the engineered guide RNA is designed to complex with the engineered Bacillus smithii Cas9 protein and the engineered guide RNA comprises a 5? guide sequence designed to hybridize with a target sequence in a double-stranded sequence, and wherein the target sequence is 5? to a protospacer adjacent motif (PAM) comprising the sequence 5?-NNNNCAAA-3?, wherein N is A, C, G, or T.
US Pat. No. 10,765,658

ORAL COMPOSITIONS DELIVERING THERAPEUTICALLY EFFECTIVE AMOUNTS OF CANNABINOIDS

Mastix LLC, Hunt Valley,...

1. A composition consisting of:about 0.1% to about 20% by weight hemp oil extract,
about 35% to about 80% by weight of a sugar alcohol, or a blend of sugar alcohols,
about 1% to about 20% by weight of flavoring,
about 0.1% to about 10% by weight of tableting lubricants and powder flow agents,
about 0.01% to about 2% by weight of intensive sweeteners, and
about 5% to about 25% of a gum base,
based on the total weight of the composition.
US Pat. No. 10,766,938

NUCLEIC ACID ENCODING HUMAN IL-2 VARIANT

Delinia, Inc., Emeryvill...

1. A nucleic acid encoding a fusion protein comprising:a. a human IL-2 variant protein domain comprising a substitution selected from the group consisting of: N88R, N88G, D20H, Q126L, and Q126F;
b. a peptide linker domain of from 5 to 30 amino acid residues, wherein the peptide linker domain comprises glycine residues, serine residues, or a mixture of glycine and serine residues; and
c. an IgG Fc protein domain,wherein each domain has an amino-terminus (N-terminus) and a carboxy-terminus (C-terminus); and wherein the fusion protein is configured so that the C-terminus of the human IL-2 variant protein domain is fused through a peptide bond to the N-terminus of the peptide linker domain, and the N-terminus of the IgG Fc protein domain is fused through a peptide bond to the C-terminus of the peptide linker domain, wherein protein yield of the fusion protein is increased by at least two-fold relative to a fusion protein that comprises the human IL-2 variant protein domain and the IgG Fc protein domain, but does not comprise the peptide linker domain.
US Pat. No. 10,767,194

RNA-GUIDED TRANSCRIPTIONAL REGULATION

President and Fellows of ...

1. A method of inserting a donor nucleic acid sequence into a cell using homologous recombination comprisingproviding to the cell two guide RNAs with each guide RNA having a spacer sequence, a tracr mate sequence and a tracr sequence, and with a portion of the tracr sequence being hybridized to the tracr mate sequence and with the tracr mate sequence and the tracr sequence being linked by a linker nucleic acid sequence and with each spacer sequence being complementary to an adjacent site in a DNA target nucleic acid,
providing to the cell a donor nucleic acid sequence,
providing to the cell a Cas9 protein nickase, and
wherein each of the two guide RNAs co-localize with the Cas9 protein nickase to the DNA target nucleic acid resulting in an offset nick with 5?-overhangs, and
wherein the donor nucleic acid sequence is inserted into the target nucleic acid at the offset nick using homologous recombination.
US Pat. No. 10,765,659

POTENTIATED TULATHROMYCIN

SEPTEOS, Paris (FR)

1. A method for treating a microbial infection in an animal, in need thereof, comprising co-administering tulathromycin and cineole; with a cineole:tulathromycin mass ratio varying from 8:1 to 1:10, and wherein the microbial infection is induced by a microbial pathogen and the concentration of cineole ([C]) is <[MIC]/x where [MIC] is the minimal inhibitory concentration measured for cineole alone, for the microbial pathogen and x is from 100 to 10,000.
US Pat. No. 10,766,939

AMYLIN ANALOGUES


wherein
X3 is selected from the group consisting of Asn, Gly, Pro and Gln;
X10 is selected from the group consisting of Gln, Asp and Glu;
X14 is selected from the group consisting of Asp, His, Asn and Aad;
X17 is selected from the group consisting of His, Asn, Gln, Glu, Thr, Val, Lys and Aad;
X19-X20 is selected from the group consisting of Ser-Ser, Val-Val, Ser-Val and Val-Ser, or is absent;
X31 is selected from the group consisting of Asp, Glu and Asn;
X35 is selected from the group consisting of Asp, Glu, Asn, Ser, Phe, Orn, Aad, Gly and Thr; and
X37 is selected from the group consisting of Pro, Apr and Hyp;
and wherein the compound has at least one residue selected from:
X3 is Gln;
X14 is His, Asn or Aad;
X17 is Asn, Gln, Glu, Thr or Aad;
X19-X20 is Val-Ser or Ser-Val; and
X35 is Ser, Phe, Orn, Aad, Gly or Thr;
or a pharmaceutically acceptable salt thereof.
US Pat. No. 10,767,195

METHODS AND PRODUCTS FOR EXPRESSING PROTEINS IN CELLS

Factor Bioscience Inc., ...

1. An in vitro method for editing a nucleic acid sequence in a genome of a cell comprising a Duchenne muscular dystrophy (DMD) gene, comprising transfecting in vitro the cell with a synthetic ribonucleic acid encoding a gene-editing protein,wherein the gene-editing protein targets a nucleic acid sequence within the DMD gene and within about 1 kilobase (kb) of a splice acceptor site upstream of an exon to be skipped and
the gene-editing protein comprises: (a) a DNA-binding domain and (b) a nuclease domain, wherein:
(a) the DNA-binding domain comprises a plurality of repeat sequences and at least one of the repeat sequences comprises the amino acid sequence: LTPvQWAlAwxyzGHGG (SEQ ID NO: 75) and is between 36 and 39 amino acids long, wherein:
“v” is Q, D or E,
“w” is S or N,
“x” is N or H,
“y” is D, A, H, N, K, or G, and
“z” is GGKQALETVQRLLPVLCQD (SEQ ID NO: 670) or GGKQALETVQRLLPVLCQA (SEQ ID NO: 671); and
(b) the nuclease domain comprises a catalytic domain of a nuclease,to result in editing of the nucleic acid sequence in the cell.
US Pat. No. 10,766,940

BRAIN PENETRANT AMYLIN RECEPTOR BASED PEPTIDES FOR ALZHEIMER'S DISEASE

The Governors of the Univ...

1. An amylin receptor antagonist selected from the group consisting of cyclic AC253 having the amino acid sequence of SEQ ID NO: 2 and a peptide fragment of AC253 consisting of an amino acid sequence selected from the group consisting of SEQ ID NO: 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, and 16, wherein the amylin receptor antagonist is brain penetrant and capable of binding to an amylin receptor and inhibiting activity of amylin, amyloid-beta protein, or both.
US Pat. No. 10,767,196

ENGINEERING AN INCREASE IN ETHANOL PRODUCTION BY ALTERING COFACTOR SPECIFICITY

Enchi Corporation, Welle...

1. A recombinant cellulolytic Clostridium host cell comprising at least one heterologous nucleic acid sequence encoding a bifunctional alcohol-acetaldehyde dehydrogenase, wherein the bifunctional alcohol-acetaldehyde dehydrogenase is AdhE;wherein the bifunctional AdhE is encoded by a heterologous nucleic acid identical to a polynucleotide that encodes the polypeptide of SEQ ID NO:21, wherein the bifunctional AdhE uses NADPH as a cofactor instead of NADH;
wherein the recombinant Clostridium host cell further comprises a genetic modification that leads to the down-regulation of the native enzyme lactate dehydrogenase;
and wherein the recombinant Clostridium host cell has an increased production of ethanol compared to a wildtype cellulolytic Clostridium cell without the heterologous nucleic acid and the down-regulation of the native enzyme lactate dehydrogenase.
US Pat. No. 10,768,477

BACKLIGHT MODULE

Unique Materials Co., Ltd...

1. A backlight module, comprising:a light guide plate;
a light source disposed at one side of the light guide plate; and
a light conversion layer disposed over the light guide plate, wherein the light conversion layer comprises an optical composite material, and the optical composite material comprises:
0.1 wt % to 15 wt % of a luminescent material; and
85 wt % to 99.9 wt % of an acrylate-based polymer,
wherein the acrylate-based polymer is prepared from precursors comprising:
5 wt % to 30 wt % of a surfactant having a thiol group;
30 wt % to 50 wt % of a first acrylate monomer;
15 wt % to 30 wt % of a second acrylate monomer;
5 wt % to 20 wt % of a cross-linker; and
1 wt % to 2 wt % of an initiator.
US Pat. No. 10,765,661

METHOD FOR IMPROVING FEED DIGESTIBILITY AND GROWTH PERFORMANCE

DSM IP ASSETS B.V., Heer...

1. A method for improving growth performance of a farm animal, comprising the step of administering to the farm animal a regular animal diet with an efficient amount of one or more proteases in combination with vitamin C, wherein administration of the regular animal diet with an efficient amount of one or more proteases in combination with vitamin C improves growth performance of the farm animal relative to the growth performance of a farm animal that has been administered the regular animal diet with an efficient amount of one or more proteases without vitamin C.
US Pat. No. 10,766,941

GLYCOPROTEIN HORMONE LONG-ACTING SUPERAGONISTS

Trophogen Inc., Rockvill...

1. A modified bovine alpha subunit polypeptide comprising SEQ ID NO:7.
US Pat. No. 10,767,197

METHOD TO ENHANCE YEAST GROWTH FOR FERMENTATIVE BIOPRODUCT PRODUCTION, AND NUTRIENT COMPOSITION FOR SAME

BUCKMAN LABORATORIES INTE...

12. A method for fermentative bioproduct production, comprising: culturing at least one yeast in a growth medium containing a nutrient composition to obtain a propagated yeast culture, wherein the nutrient composition comprises corn steep liquor and at least one of (a) at least one antifoaming agent wherein the at least one organic antifoaming agent is a polyglycol, a blend of polyglycol and silicone, a fatty acid ethoxylate, an ethoxylated fatty amine, or any combination thereof, or (b) at least one surfactant wherein the at least one surfactant is a nonionic surfactant that is an ethoxylated sorbitan ester, a glyceride ethoxylate, an ethoxylated castor oil, an alcohol ethoxylate, an alkylphenol ethoxylate, a phenol ethoxylate, an amide ethoxylate, a fatty acid ethoxylate, a fatty amine ethoxylate, a fatty amide ethoxylate, a fatty mono or di-ethanolamide, an alkyl glycoside, a polyethylene glycol (PEG), an acetylenic glycol, a polypropylene glycol (PPG), a poloxamer, an alkali metal arylsulfonate, an ethoxylated fatty amide, or any combination thereof,wherein said at least one yeast comprises Saccharomyces cerevisiae, Saccharomyces pastorianus (carlsbergiensis), Kluyveromyces lactis, Kluyveromyces fragilis, Fusarium oxysporum, or any combinations thereof;
inoculating a fermentation substrate with the propagated yeast culture to produce a fermentable biomass;
fermenting the fermentable biomass to produce a fermented biomass comprising at least one bioproduct and non-fermented solids content; and
separating at least a portion of the at least one bioproduct from the solids content,
wherein a) addition of the nutrient composition results in an increased yeast concentration in the propagation and fermentation tanks of at least 3 million cells per gram as compared to a yeast concentration in the propagation and fermentation tanks wherein the culturing is done with addition of only the same amount of said corn steep liquor and without the at least one antifoaming agent, or
wherein b) addition of the nutrient composition results in an increased ethanol concentration in the fermented biomass of at least 1% w/v as compared to an ethanol concentration in the propagation and fermentation tanks wherein the culturing is done with addition of only the same amount of corn steep liquor and without the at least one antifoaming agent and at least one surfactant, or both.
US Pat. No. 10,766,942

FRAGMENTS OF SYNDECAN-2 HAVING ANTI-ANGIOGENIC ACTIVITY

Queen Mary University of ...

1. An anti-angiogenic peptide consisting of up to 25 amino acids comprising a) amino acid residues 123-140 of SEQ ID NO 1 or amino acid residues 124-141 of SEQ ID NO 2, or b) amino acid residues 123-140 of SEQ ID NO 1 and having conservative amino acid substitutions at one or more positions selected from the group consisting of E125, E126, D127, N129, and S138, or amino acid residues 124-141 of SEQ ID NO 2 and having conservative amino acid substitutions at one or more positions selected from the group consisting of I126, K127, S128, D130, and N139.
US Pat. No. 10,767,198

METHOD FOR PRODUCING BRANCHED ALDEHYDES

SYMRISE AG, Holzminden (...

1. A method for producing branched aldehydes comprising:(a) providing a culture of one or more fungi of the genus Conidiobolus, wherein the one or more fungi is selected from the group consisting the species of C. denaeosporus and C. heterosporus, and producing biomass containing branched carboxylic acids in free form and/or bound form;
(b) extracting the biomass from step (a) to produce a first intermediate containing free and/or bound carboxylic acids;
(c) optionally chemically, enzymatically, or microbially hydrolyzing the bound carboxylic acids from the first intermediate;
and
(d) treating the first intermediate with a reducing agent of a chemical nature to convert the free and/or bound carboxylic acids into the corresponding alcohols and optionally separating one or more alcohols from interfering by-products and producing the chemically produced second intermediate containing these alcohols as a mixture or in enriched form;
and
(e) treating the chemically produced second intermediate with an oxidizing agent of a chemical nature to convert the free and/or bound alcohols into the corresponding aldehydes;
or
(f) treating the first intermediate with a reducing agent of a biological nature to convert the free and/or bound carboxylic acids into the corresponding aldehydes having the same number of carbon atoms compared to the free and/or bound carboxylic acids or into the corresponding aldehydes having a reduced number of carbon atoms by one compared to the free and/or bound carboxylic acids and producing the biologically produced second intermediate containing these aldehydes;
and optionally
(g) removing interfering by-components from the fractions obtainable after step(s) (d) and/or (e) and/or (f).
US Pat. No. 10,765,663

NUTRITION COMPOSITION

AJINOMOTO CO., INC., Tok...

1. A method of regulating food intake in a subject in need thereof, wherein said subject suffers from a reduction in appetite or suffers from undernutrition due to a reduction in appetite or wherein said subject suffers from overeating or a lifestyle-related disease caused by overeating, comprising administering a composition to said subject comprising, by weight percent:a) 3.5% to 40% tryptophan,
b) 5% to 65% threonine,
c) 6% to 45% methionine, and
d) not more than 20% of isoleucine; and
wherein the composition does not contain any amino acid other than tryptophan, threonine, methionine and isoleucine.
US Pat. No. 10,766,175

METHOD FOR PRODUCING A TRIM ELEMENT WITH A GENUINE CARBON APPEARANCE

HIB TRIM PART SOLUTIONS G...

1. A method for producing a trim element for vehicles which has a genuine carbon appearance, comprising a sized carbon fiber layer which is arranged on an exposed side of the trim element and is visible from the outside, and which is made of a fiber structure composed of prefabricated carbon fibers with interstices, comprising the following process steps:wet impregnating the prefabricated, sized carbon fiber layer with an aqueous polymer dispersion based on polyurethane, acrylate or polyvinyl acetate or a mixture thereof, so that the polymer dispersion penetrates at least partially into the carbon fiber layer, increasing the suitability thereof for penetration of a coating into the interstices of the fiber structure of the carbon layer, wherein the wet impregnation alters the surface structure of the carbon fibers or carbon fiber filaments of the prefabricated, sized carbon fiber layer, so that the coating becomes cross-linked with the carbon fiber layer and no air pockets remain,
drying the wet impregnated carbon fiber layer,
affixing the carbon fiber layer onto a trim element support, aligned toward the exposed side of the trim element,
applying a coating layer to the carbon fiber layer that is arranged on the trim element support, in order to form a transparent surface layer on the exposed side of the trim element, with coating material penetrating into the interstices of the carbon fiber layer and wherein for wet impregnation, the carbon fiber layer is passed through a dispersion bath as an integral part of the production process,
wherein the carbon fiber layer is mounted onto the trim element support by lamination, and the carbon fiber layer additionally comprises a supporting fabric.
US Pat. No. 10,766,943

UNIVERSAL CHIMERIC ANTIGEN EXPRESSING IMMUNE CELLS FOR TARGETING OF DIVERSE MULTIPLE ANTIGENS AND METHOD OF MANUFACTURING THE SAME AND USE OF THE SAME FOR TREATMENT OF CANCER, INFECTIONS AND AUTOIMMUNE DISORDERS

GEMoaB Monoclonals GmbH, ...

1. An antibody or fragment thereof that specifically binds CD33, wherein said antibody or antibody fragment comprises a single chain variable fragment (scFV) that comprises a humanized light chain variable domain comprising the amino acid sequence of SEQ ID NO:40 and a humanized heavy chain variable domain comprising the amino acid sequence of SEQ ID NO:41, wherein said light chain variable domain and said heavy chain variable domain are connected by a linker peptide that is about 10 to 25 amino acids in length.
US Pat. No. 10,767,199

ENZYMATIC PREPARATION OF PROPAMOCARB

Eastman Chemical Company,...

1. A process for preparing propyl-3-(dimethylamino)propylcarbamate comprising contacting dipropylcarbonate with 3-dimethylaminopropylamine in the presence of at least one enzymatic catalyst, wherein said catalyst comprises a lipase enzyme.
US Pat. No. 10,765,664

TREATMENT OF INFECTIOUS DISEASES

14. A method of increasing an anti-viral stress response in a cell, the method consisting essentially of contacting a cell with nitazoxanide in vivo, thereby increasing an anti-viral stress response in the cell.
US Pat. No. 10,766,944

PEPTIDES AND COMBINATION OF PEPTIDES FOR USE IN IMMUNOTHERAPY AGAINST VARIOUS TUMORS

INMATICS BIOTECHNOLOGIES ...

1. A method of treating a patient who has hepatocellular carcinoma (HCC), colorectal cancer (CRC), glioblastoma (GB), gastric cancer (GC), esophageal cancer, non-small cell lung cancer (NSCLC), pancreatic cancer (PC), renal cell carcinoma (RCC), benign prostate hyperplasia/prostate cancer (BPH, PCA), ovarian cancer (OC), melanoma, breast cancer (BRCA), chronic lymphocytic leukemia (CLL), Merkel cell carcinoma (MCC), small cell lung cancer (SCLC), non-Hodgkin lymphoma (NHL), acute myeloid leukemia (AML), gallbladder adenocarcinoma and cholangiocarcinoma (GBC, CCC), urinary bladder cancer (UBC), and/or uterine cancer (UEC), comprising administering to said patient a composition comprising a peptide in the form of a pharmaceutically acceptable salt and an adjuvant, wherein said peptide consists of the amino acid sequence of ILAEEPIYI (SEQ ID NO: 81), thereby inducing a T-cell response to the HCC, CRC, GB, GC, esophageal cancer, NSCLC, PC, RCC, BPH, PCA, OC, melanoma, BRCA, CLL, MCC, SCLC, NHL, AML, GBC, CCC, UBC, and/or UEC.
US Pat. No. 10,767,200

METHOD FOR PRODUCING L-AMINO ACID

AJINOMOTO CO., INC., Tok...

1. A method for producing a basic amino acid or a fermentation product containing the basic amino acid, the method comprising:(A) culturing a microorganism able to produce a basic amino acid in a culture medium so that bicarbonate ions and/or carbonate ions serve as counter ions for the basic amino acid, to obtain a fermentation broth containing the basic amino acid; and
(B) heat treating the fermentation broth under a pressure sufficient to prevent generation of carbon dioxide gas from the fermentation broth.
US Pat. No. 10,765,665

COMPOSITION COMPRISING COMBINATION OF RAPAMYCIN AND AN ACTIVATOR OF AMP KINASE AND USE THEREOF FOR TREATING DISEASES

1. A method for treating symptoms of inflammatory arthritis in a subject, wherein the method comprises locally administering an effective amount of a topical formulation directly over an inflamed joint affected by inflammatory arthritis, the topical formulation comprising a combination of rapamycin and metformin, wherein the molar ratio of rapamycin to metformin is in the range of about 20:1 to about 1:1, and wherein metformin acts as an adjuvant to enhance efficacy of rapamycin in the topical formulation.
US Pat. No. 10,766,945

STABLE PROTEINS

Heptares Therapeutics Lim...

1. A fusion protein comprising, from N-terminus to C-terminus:a. a first portion of a Family B G-protein coupled receptor (GPCR) that comprises transmembrane helix (TM)-1, TM2 and TM3 of the GPCR, wherein the TM1 and the TM2 are joined by intracellular loop 1 (ICL1), and the TM2 and TM3 are joined by extracellular loop 1 (ECL1);
b. a stable protein domain; and
c. a second portion of the GPCR comprising TM4, TM5, TM6 and TM7 of the GPCR wherein the TM4 and the TM5 are joined by extracellular loop 2 (ECL2), the TM5 and the TM6 are joined by intracellular loop 3 (ICL3), and the TM6 and the TM7 are joined by extracellular loop 3 (ECL3);
wherein the stable protein domain comprises a soluble, well-folded polypeptide that provides N- and C-termini, the distance between which approximates the distance between helices 3 and 4 in the Family B GPCR, and that provides a hydrophilic surface for crystal lattice contacts, thereby facilitating crystallisation,
wherein the stable protein domain is inserted into the intracellular loop 2 (ICL2) region of the GPCR which loop joins the TM3 in the first portion of the GPCR and the TM4 in the second portion of the GPCR, and
wherein the fusion protein displays reduced aggregation in the presence of a detergent solution, as compared to a GPCR without insertion of the stable protein domain into the ICL2 region of the GPCR.
US Pat. No. 10,767,201

CYP76AD1-BETA CLADE POLYNUCLEOTIDES, POLYPEPTIDES, AND USES THEREOF

YEDA RESEARCH AND DEVELOP...

1. A recombinant polynucleotide comprising a nucleic acid sequence encoding (i) a cytochrome P450 enzyme CYP76AD6 that converts tyrosine to L-3,4-dihydroxyphenylalanine (L-DOPA), wherein the nucleic acid sequence encoding the CYP76AD6 enzyme is set forth in SEQ ID NO:31, or (ii) a cytochrome P450 enzyme CYP76AD15 that converts tyrosine to L-3,4-dihydroxyphenylalanine (L-DOPA), wherein the nucleic acid sequence encoding the CYP76AD15 enzyme is set forth in SEQ ID NO:35, wherein said nucleic acid encoding the CYP76AD6 enzyme or the CYP76AD15 enzyme is under the control of a promoter, and wherein said promoter is a constitutive promoter, an inducible promoter, a fruit-specific promoter, or a flower-specific promoter.
US Pat. No. 10,770,274

COPPER ALLOY SPUTTERING TARGET AND MANUFACTURING METHOD OF COPPER ALLOY SPUTTERING TARGET

MITSUBISHI MATERIALS CORP...

1. A manufacturing method of a copper alloy sputtering target, the sputtering target formed by a copper alloy containing: the content of Ca being 0.3 to 1.7% by mass; the total content of Mg and Al being 5 ppm or less by mass; the content of oxygen being 20 ppm or less by mass; and the remainder is Cu and inevitable impurities, the manufacturing method comprising the steps of:preparing a copper having purity of 99.99% or more by mass;
melting the copper by a high frequency induction heating in a crucible in an inert gas atmosphere or a reducing gas atmosphere so as to obtain a molten copper;
controlling component so as to obtain a molten metal having a predetermined component compositions by the addition of Ca having purity of 98.5% or more by mass into the molten copper and by melting the Ca;
casting the molten metal having the predetermined component compositions in a cooled casting mold so as to obtain an ingot; and
performing stress relieving annealing after performing hot-rolling to the ingot,
and wherein the copper alloy sputtering target causes no abnormal discharge when sputtering for 8 hours at an output of 600 W by using direct current system as a power supply,
wherein the abnormal discharge is counted using an arc counter provided in the power supply, and
wherein the sputtering is performed under conditions of evacuating a vacuum chamber of a sputtering apparatus to a vacuum pressure of 4×10?5 Pa or less, and then supplying an oxygen-Ar mixed gas including pure Ar gas or oxygen in a proportion of 10% by volume into the vacuum chamber as a sputtering gas to set a pressure of a sputtering atmosphere to 0.67 Pa.
US Pat. No. 10,765,666

USE OF GABOXADOL FOR THE TREATMENT OF TOURETTE SYNDROME, TICS AND STUTTERING

OVID THERAPEUTICS INC, N...

1. A method of treating Tourette syndrome comprising administering to a patient in need thereof about 0.05 mg to about 30 mg gaboxadol or a pharmaceutically acceptable salt thereof, wherein the method provides improvement in one or more symptoms of Tourette syndrome in the patient.
US Pat. No. 10,766,946

FAST-OFF RATE SERUM ALBUMIN BINDING FIBRONECTIN TYPE III DOMAINS

BRISTOL-MYERS SQUIBB COMP...

1. A polypeptide comprising a fibronectin type III tenth (10Fn3) domain, wherein the 10Fn3 domain binds to human serum albumin (HSA) with a KD of 1 ?M or less and comprises AB, BC, CD, DE, EF, and FG loops, wherein the CD loop has 1 amino acid substitution relative to the CD loop of a 10Fn3 domain comprising the amino acid sequence set forth in SEQ ID NO: 23, and wherein the substitution is selected from the group consisting of:(i) the arginine (R) at position 2 of the CD loop (SEQ ID NO: 28) is substituted with an amino acid selected from D, E, A, Q, or N;
(ii) the glutamine (Q) at position 5 of the CD loop (SEQ ID NO: 28) is substituted with D;
(iii) the tyrosine (Y) at position 7 of the CD loop (SEQ ID NO: 28) is substituted with an amino acid selected from S or A;
(iv) the leucine (L) at position 10 of the CD loop (SEQ ID NO: 28) is substituted with an amino acid selected from S, T, or A;
(v) the leucine (L) at position 13 of the CD loop (SEQ ID NO: 28) is substituted with an amino acid selected from D, S, or A;
(vi) the tyrosine (Y) at position 14 of the CD loop (SEQ ID NO: 28) is substituted with an amino acid selected from A or T;
(vii) the isoleucine (I) at position 15 of the CD loop (SEQ ID NO: 28) is substituted with an amino acid selected from D, S, or A; and
(viii) the tyrosine (Y) at position 16 of the CD loop (SEQ ID NO: 28) is substituted with an amino acid selected from Q, E, S, or A.
US Pat. No. 10,765,667

METHODS FOR TREATING IRRITABLE BOWEL SYNDROME (IBS)

Salix Pharmaceuticals, In...

1. A method of treating one or more symptoms of irritable bowel syndrome (IBS) in a subject 65 years of age or older, said method comprising administering, 550 mg of rifaximin TID for 14 days to the subject, thereby treating one or more symptoms of IBS in the subject 65 years of age or older.
US Pat. No. 10,766,947

POLYMERIC FORMS OF H-NOX PROTEINS

Omniox, Inc., San Carlos...

1. A method of treating a disease or condition in a mammal in need thereof comprising administering to the mammal a trimeric H-NOX protein comprising three H-NOX monomers, wherein each H-NOX monomer comprises a T. tengcongensis H-NOX domain and a trimerization domain, wherein the H-NOX domain in each H-NOX monomer comprises a L144F substitution, and wherein the trimerization domain in each H-NOX monomer is a foldon domain of bacteriophage T4 fibritin,wherein the disease or condition is a cardiovascular disease in which blood volume is lost or O2 carrying capacity is reduced, loss of blood, a trauma in which blood volume is lost or O2 carrying capacity is reduced, hemorrhage, hemorrhagic shock, a surgery, hemodilution, a wound, a diabetic ulcer, anemia, a tissue ischemia, a stroke, a transient ischemic attack, myocardial stunning and hibernation, acute angina, unstable angina, emerging angina, myocardial infarction, cardioplegia, or traumatic brain injury.
US Pat. No. 10,767,203

ARYLALKYLAMINE N-ACETYLTRANSFERASE AND USES THEREOF

Danmarks Tekniske Univers...

1. A catalytically active variant of arylalkylamine N-acetyltransferase (AANAT) from Streptomyces griseofuscus (SEQ ID NO:1), the variant AANAT having at least 85% sequence identity to SEQ ID NO:1, comprising a mutation in residue D63 and providing for an increased yield in vivo of N-acetylserotonin from serotonin relative to native enzyme.
US Pat. No. 10,767,204

ADVANCED AUGER AND FILTRATION SYSTEM FOR THE SACCHARIFICATION OF BIOMASS

Edeniq, Inc., Visalia, C...

1. A method for generating glucose from biomass, comprising:(a) pretreating the biomass at a temperature of about 150° C. to about 210° C. and a pH of 4.0 to 6.0;
(b) contacting the biomass with cellulase and hemicellulase under conditions suitable to hydrolyze components of the biomass to sugars, thereby producing a mixture of solids, liquids, and sugars;
(c) once formed, separating the mixture into a liquid phase containing sugars and a solids phase;
(d) prior to further hydrolysis steps, washing the solids phase to remove at least a portion of the sugars, thereby forming a washed solids phase, wherein the sugars inhibit saccharification enzyme activity; followed by
(e) incubating the washed solids phase with cellulase and hemicellulase to hydrolyze components of the solid phase to glucose, thereby producing additional glucose; then
(f) separating the liquid phase into a permeate comprising dissolved solids and sugars and a retentate comprising undissolved solids, enzymes, and sugars; and
(g) combining the retentate with the biomass or solids phase under conditions wherein the biomass is converted to glucose.
US Pat. No. 10,766,949

METHOD FOR PREPARING WHOLE BOVINE-DERIVED BROADLY NEUTRALIZING ANTIBODY AGAINST SEROTYPE O FOOT-AND-MOUTH DISEASE VIRUS

Lanzhour Veterinary Resea...

1. A method for preparing a whole bovine-derived broadly neutralizing antibody against serotype O foot-and-mouth disease virus, comprising the following steps:1) conducting a first immunization on a cattle by using a serotype O foot-and-mouth disease virus, conducting a second immunization within 30-60 days after the first immunization, and conducting a third immunization within 120-150 days after the first immunization; wherein the Serotype O foot-and-mouth disease virus comprises the following three topotypes: a virus strain of South-East Asia topotype, a virus strain of Middle East-South Asia topotype, and a virus strain of Cathay topotype; and the serotype O foot-and-mouth disease viruses employed in the first immunization, the second immunization and the third immunization are of viruses from different topotypes;
2) after the third immunization, isolating a peripheral blood mononuclear cell, and screening for serotype O foot-and-mouth disease virus antigen-specific single B cells by using a bait antigen; wherein the bait antigen comprises serotype O foot-and-mouth disease virus labeled by biotin or a fluorescent protein; and wherein the bait antigen is a 146S antigen;
3) using the cDNA of the serotype O foot-and-mouth disease virus antigen-specific single B cell obtained in step 2) as a template to amplify variable region genes of heavy and light chains of the bovine antibody; wherein the amplification comprises a nested PCR amplification method, and the primers used in the nested PCR amplification comprise: an IgG variable region outer primer pair, an IgG variable region inner primer pair, an IgM variable region outer primer pair, an IgM variable region inner primer pair, an IgD variable region outer primer pair, an IgD variable region inner primer pair, an Ig lambda outer primer pair, and an Ig lambda inner primer pair; where the upstream primer of each of the IgG variable region outer primer pair, the IgM variable region outer primer pair and the IgD variable region outer primer pair are identical and have the sequence of SEQ ID NO. 1, and the downstream primers of the IgG variable region outer primer pair, the IgM variable region outer primer pair and the IgD variable region outer primer pair have the sequences of SEQ ID NO. 2, SEQ ID NO. 3 and SEQ ID NO. 4 respectively; the upstream primer of each of the IgG variable region inner primer pair, the IgM variable region inner primer pair and the IgD variable region inner primer pair are identical and have the sequence of SEQ ID NO. 5, and the downstream primers of the IgG variable region inner primer pair, the IgM variable region inner primer pair and the IgD variable region inner primer pair have the sequences of SEQ ID NO. 6, SEQ ID NO. 7 and SEQ ID NO. 8 respectively; the nucleotide sequences of the Ig lambda outer primer pair are the sequences of SEQ ID NO. 9 and SEQ ID NO. 10; and
the nucleotide sequences of the Ig lambda inner primer pair are the sequences of SEQ ID NO. 11 and SEQ ID NO. 12;
4) using the total cDNA of the bovine peripheral blood mononuclear cell as a template to amplify the full-length sequences of the heavy and light chains of the bovine antibody, thereby obtaining constant region sequences of the heavy and light chains of the bovine antibody; the amplification comprises a method of rapid amplification of cDNA ends, and the primers used for the rapid amplification of cDNA ends comprise: an IgG heavy chain 5? rapid amplification of cDNA end primer with the nucleotide sequence of SEQ ID NO. 13, an IgG heavy chain 3? rapid amplification of cDNA end primer with the nucleotide sequence of SEQ ID NO. 14, an IgG Lambda light chain 5? rapid amplification of cDNA end primer with the nucleotide sequence of SEQ ID NO. 15, an IgG Lambda light chain 3? rapid amplification of cDNA end primer with the nucleotide sequence of SEQ. ID NO. 16, an IgG Kappa light chain 5? rapid amplification of cDNA end primer with the nucleotide sequence of SEQ ID NO. 17, and an IgG Kappa light chain 3? rapid amplification of cDNA end primer with the nucleotide sequence of SEQ ID NO. 18;
5) constructing the heavy chain variable region gene of the bovine antibody obtained in step 3) and the heavy chain constant region sequence of the bovine antibody obtained in step 4) into an expression vector to obtain a full-length heavy chain vector of the whole bovine-derived monoclonal antibody; and constructing the light chain variable region gene of the bovine antibody obtained in step 3) and the light chain constant region sequence of the bovine antibody obtained in step 4) into an expression vector to obtain a full-length light chain vector of the whole bovine-derived monoclonal antibody; and
6) mixing the full-length heavy chain vector of the whole bovine-derived monoclonal antibody and the full-length light chain vector of the whole bovine-derived monoclonal antibody obtained in step 5) at a mass ratio of 1:(1-3) to co-transfect a cell, taking a supernatant after culture of the transfected cells, and purifying to obtain a whole bovine-derived broadly neutralizing antibody against the serotype O foot-and-mouth disease virus; wherein there is no limitation in the order of steps 3) and 4).
US Pat. No. 10,767,205

BACTERIUM FOR THE PRODUCTION OF AN EXOPOLYSACCHARIDE COMPRISING N-ACETYLGLUCOSAMINE AND D-GLUCOSE

DePuy Synthes Products, I...

1. A bacterium for the production of an exopolysaccharide comprising N-acetylglucosamine and D-glucose, wherein:the bacterium belongs to a genus comprising Komagataeibacter, Agrobacterium, Aerobacter, Achromobacter, Azotobacter, Rhizobium, Sarcina, or Salmonella and the bacterium expresses
a. an Escherichia coli N-acetylglucosamine phosphoenolpyruvate-dependent sugar phosphotransferase system permease; and
b. an Escherichia coli N-acetylglucosamine kinase, a Mus musculus phosphoacetyl-glucosamine mutase, and an Escherichia coli bifunctional UDP-N-acetylglucosamine pyrophosphorylase/glucosamine-1-phosphate N-acetyltransferase, and
the bacterium produces an exopolysaccharide that comprises N-acetylglucosamine and D-glucose.
US Pat. No. 10,765,670

USE OF ANTI-CONNEXIN AGENTS FOR ENHANCING THE THERAPEUTIC EFFECT OF ACETYLCHOLINESTERASE INHIBITORS

1. Therapeutic substance combination product containing at least one connexin-blocking agent and one acetylcholinesterase inhibitor (AChEI), wherein said connexin-blocking agent is mefloquine and said acetylcholinesterase inhibitor (AChEI) is donepezil or a pharmaceutical salt thereof, wherein the therapeutic substance combination product is for improving cognitive function in a patient suffering from Alzheimer's disease, Parkinson disease, vascular dementia or senile dementia.
US Pat. No. 10,766,950

METHODS, COMPOSITIONS AND KITS FOR TREATING A SUBJECT USING A RECOMBINANT NEUTRALIZING BINDING PROTEIN

TUFTS UNIVERSITY, Boston...

1. An isolated recombinant binding protein comprising an amino acid sequence selected from SEQ ID NO: 100, SEQ ID NO: 102, SEQ ID NO: 104, SEQ ID NO: 106, SEQ ID NO: 108, SEQ ID NO: 110, SEQ ID NO: 112, SEQ ID NO: 114, SEQ ID NO: 116, SEQ ID NO: 118, SEQ ID NO: 120, or SEQ ID NO: 122, which specifically binds to Anthrax protective antigen (PA) toxin.
US Pat. No. 10,767,206

NITROGEN SOURCE FEEDING FERMENTATION PROCESS FOR PRODUCING GELLAN GUM

DSM IP ASSETS B.V., Te H...

1. A fermentation process for producing a gellan gum, comprising the following steps:1) inoculating a culture medium with a strain capable of producing a gellan gum to form a broth; and
2) initiating a fermentation, and feeding a nitrogen source into the broth during the fermentation;
wherein the strain capable of producing the gellan gum is selected from a group consisting of Sphingomonas paucimobilis, Sphingomonas Azotofigens, and Sphingomonas elodea:
wherein the nitrogen source is fed into the broth during the fermentation after inoculation with the strain according to FIG. 1 feeding curve diagram, which falls into the shaded area of FIG. 1;
wherein a total amount of the nitrogen source fed into the broth is 0.01 mol/L to 0.1 mol/L calculated as the nitrogen element in the broth in relative to the total volume of the broth.
US Pat. No. 10,765,671

STABLE NIMODIPINE PARENTERAL FORMULATION

NORTIC HOLDINGS INC., Ea...

1. A nimodipine injection concentrate formulation, comprising nimodipine base or a pharmaceutically acceptable nimodipine salt in a concentration from about 0.01 to about 5 mg/ml; an organic solvent consisting of ethanol; a pharmaceutically acceptable aqueous carrier; an optional preservative; and an effective amount of a single hydrophilic surfactant which is polysorbate 80 and the polysorbate 80 is from about 6% to about 10% of the injection concentrate formulation , such that nimodipine in the injection concentrate formulation is contained in micelles and the formulation is stable and clear, wherein the nimodipine injection concentrate formulation does not contain poloxamer, a phospholipid, or polyoxyethylene castor oil derivatives.
US Pat. No. 10,766,951

ANTIBODIES AGAINST INFECTIOUS DISEASES

TAIPEI MEDICAL UNIVERSITY...

1. An isolated anti-CaENO1 antibody or an antigen-binding portion thereof, comprising a light chain complementarity determining region 1 (L-CDR1) of SEQ ID NO:5; a light chain CDR2 (L-CDR2) of SEQ ID NO:6; and a light chain CDR3 (L-CDR3) of SEQ ID NO:7; and a heavy chain CDR1 (H-CDR1) of SEQ ID NO:8; a heavy chain CDR2 (H-CDR2) of SEQ ID NO:9; and a heavy chain CDR3 (H-CDR3) of SEQ ID NO:10; such that said isolated antibody or antigen-binding portion thereof binds to CaENO1.
US Pat. No. 10,767,207

TRICHODERMA REESEI HOST CELLS EXPRESSING A GLUCOAMYLASE FROM ASPERGILLUS FUMIGATUS AND METHODS OF USE THEREOF

Danisco US INC, Palo Alt...

1. A recombinant Trichoderma reesei (T. reesei) host cell expressing an AfGATR having at least 90% sequence identity to SEQ ID NO: 12 or 13, wherein the AfGATR is more thermostable than an AfGA having the same amino acid sequence of AfGATR and wherein the AfGA is expressed in an A. fumigatus host cell.
US Pat. No. 10,766,952

METHODS FOR REDUCING MIGRAINE FREQUENCY IN A SUBJECT IN NEED THEREOF

Beth Israel Deaconess Med...

1. A method for reducing migraine frequency in a subject suffering from chronic or episodic migraine comprising administering to the subject an antibody or antigen-binding fragment thereof that blocks, inhibits, suppresses, or reduces the calcitonin gene related peptide (CGRP) pathway, wherein the antibody or antigen-binding fragment thereof is an anti-CGRP antagonist antibody or an anti-CGRP receptor antibody, thereby reducing migraine frequency in the subject, wherein, prior to administration of the antibody or antigen-binding fragment thereof, the subject is known to exhibit allodynia and/or hyperalgesia during an acute phase of a migraine but not during an interictal phase of the migraine.
US Pat. No. 10,767,208

CLOSED NUCLEIC ACID STRUCTURES

GEN-PROBE INCORPORATED, ...

1. A method of forming a closed nucleic acid structure comprising a segment of a target nucleic acid, the method comprising:(a) contacting the target nucleic acid with a primer pair under amplification conditions, each of the primers of the pair including a 5? phosphate group and a 3? segment, the 3? segments of the primers being target-binding segments; thereby forming an amplified nucleic acid comprising duplex target nucleic acid flanked by the primers of the pair duplexed with their complementary segments, wherein each strand of the amplified nucleic acid includes a 5? phosphate group and a 3? hydroxyl group;
(b) denaturing the amplified nucleic acid and contacting a strand of the denatured amplified nucleic acid with a stem-loop adaptor having a 5? phosphate group, a 5? segment, a 3? segment having a stem-loop structure, and a 3? hydroxyl group, wherein the 5? segment is complementary to a segment at the 5? end of the amplified nucleic acid strand;
(c) annealing the 5? segment of the stem-loop adaptor to the 5? end segment of the amplified nucleic acid strand, thereby forming a partially duplex, two-stranded intermediate structure wherein the 5? phosphate group of the amplified nucleic acid strand is separated by a nick from the 3? hydroxyl group of the stem-loop adaptor; and
(d) providing a ligase that seals the nick between the 5? phosphate group of the amplified nucleic acid strand and the 3? hydroxyl group of the stem-loop adaptor and additionally links the 5? phosphate group of the stem-loop adaptor to the 3? hydroxyl group of the amplified nucleic acid strand, thereby forming a closed nucleic acid structure.