US Pat. No. 11,028,126

MATRIPTASE AND U-PLASMINOGEN ACTIVATOR SUBSTRATES AND OTHER CLEAVABLE MOIETIES AND METHODS OF USE THEREOF

CytomX Therapeutics, Inc....

1. An isolated polypeptide comprising a cleavable moiety (CM) comprising one of the amino acid sequences selected from the group consisting of SEQ ID NOs: 366-368, wherein the cleavable moiety is a substrate for a protease.
US Pat. No. 11,028,382

LYOPHILIZED FORMULATIONS FOR FACTOR XA ANTIDOTE

Alexion Pharmaceuticals, ...

1. A method for preparing a lyophilized formulation, comprising lyophilizing an aqueous solution comprising about 45 mM arginine, from 1% to 3% sucrose (w/v), from 2% to 8% mannitol (w/v), from about 0.01% to about 0.02% (w/v) polysorbate 80 and at least 5 mg/mL of a two-chain polypeptide comprising a first chain comprising the amino acid sequence of SEQ ID NO. 4, a second chain comprising the amino acid sequence of SEQ ID NO. 5, and a disulfide bond between a first Cysteine residue at position 98 (Cys98) of SEQ ID NO. 4 and a second Cysteine residue at position 108 (Cys108) of SEQ ID NO. 5, wherein the aqueous solution has a pH from 7.7 to 7.9.
US Pat. No. 11,032,225

RNA TARGETING METHODS AND COMPOSITIONS

Salk Institute for Biolog...

1. A method of targeting one or more target ribonucleic acid (RNA) molecules, comprising:contacting one or more target RNA molecules with a non-naturally occurring or engineered clustered regularly interspaced short palindromic repeats (CRISPR)-associated (Cas) system comprising:
at least one Cas13d protein comprising at least 95% sequence identity to SEQ ID NO: 198, or a nucleic acid molecule encoding the at least one Cas13d protein; and
at least one CRISPR-Cas system guide RNA (gRNA) comprising one or more direct repeat (DR) sequences and one or more spacer sequences, which hybridizes with the one or more target RNA molecules, or at least one nucleic acid molecule encoding the gRNA,
whereby the Cas13d protein forms a complex with the gRNA, wherein the gRNA directs the complex to the one or more target RNA molecules and targets the one or more target RNA molecules.
US Pat. No. 11,028,127

PEPTIDES CAPABLE OF REACTIVATING P53 MUTANTS

Yeda Research and Develop...

1. A recombinant or synthetic peptide comprising the amino-acid sequence selected from the group consisting of SEQ ID NO: 139, 140, 203, 216 and 227, wherein said peptide at least partially reactivates a mutant p53 protein; and wherein said peptide is up to 15 amino-acids in length.
US Pat. No. 11,028,383

POLYPEPTIDE ASSEMBLIES AND METHODS FOR THE PRODUCTION THEREOF

University of Washington,...

1. A multimeric assembly, comprising a plurality of oligomeric substructures, wherein each oligomeric substructure comprises a plurality of proteins that self-interact around at least one axis of rotational symmetry, wherein each protein comprises:(a) one or more polypeptide-polypeptide interface (“O interface”); and
(b) one or more polypeptide domain that is capable of effecting membrane scission and release of an enveloped multimeric assembly from a cell by recruiting the ESCRT machinery to the site of budding by binding directly or indirectly to one or more ESCRT or ESCRT-associated proteins (“L domain”);
wherein one or more protein in the multimeric assembly comprises one or more polypeptide domain that is capable of interacting with a lipid bilayer (“M domain”), wherein the one or more M domains are selected from the group consisting of SEQ ID NOs: 52-151, 283-297, and 299-300 and wherein (i) at least one protein in each oligomeric substructure comprises one or more M domain, or (ii) wherein each protein comprises one or more M domain;
wherein the M domain, L domain, and O interface are not each present in a single naturally occurring protein, wherein the plurality of oligomeric substructures interact with each other at the one or more O interfaces.
US Pat. No. 11,028,128

INHIBITION OF THE AGGREGATION OF TRANSTHYRETIN BY SPECIFIC BINDING OF PEPTIDES TO AGGREGATION-DRIVING SEGMENTS

THE REGENTS OF THE UNIVER...


wherein:
at least one of the amino acids in the at least one peptide comprises an amino acid comprising a N-methyl group moiety; and/or
the at least one peptide is coupled to a heterologous peptide tag comprising a plurality of arginine (R) amino acids; and
a pharmaceutically acceptable carrier, wherein the pharmaceutically acceptable carrier comprises an agent that inhibits microbial growth.
US Pat. No. 11,028,384

PYRUVATE CARBOXYLASE AND PYRUVATE CARBOXYLASE-ENCODING DNA, PLASMID CONTAINING SAID DNA AND MICROORGANISM FOR THE PRODUCTION THEREOF, AND METHODS FOR THE PRODUCTION OF PRODUCTS THE BIOSYNTHESIS OF WHICH INCLUDES OXALOACETATE AS PRECURSOR, AND CHROMOSOME

FORSCHUNGSZENTRUM JUELICH...

1. An isolated DNA sequence encoding a pyruvate carboxylase, comprising:at least 97% identity with respect to SEQ ID NO: 1,
wherein a triplet at position 1027-1029 codes for alanine.
US Pat. No. 11,028,129

COMPOSITIONS FOR EXPANDING REGULATORY T CELLS (TREG) POPULATIONS, AND TREATING AND AMELIORATING AUTOIMMUNE DISEASES AND CONDITIONS

The Regents of the Univer...


and a pharmaceutically acceptable excipient.
US Pat. No. 11,028,385

STABLE LIGNOCELLULOLYTIC ENZYME COMPOSITION

Indian Oil Corporation Li...

1. A lignocellulolytic enzyme composition, said composition comprising:(a) 65% to 85% w/w lignocellulolytic enzyme mixture having a cellulase activity of 96 Filter Paper Unit (FPU)/ml, a ?-glucosidase activity of about 850 ?-glucosidase (BGL)/ml, a xylanase activity of about 1300 Units (U)/ml and a protein content of about 350 mg/ml;
(b) 10% to 15% w/w additive; and
(c) 5% to 20% w/w molasses;wherein the additive is a petrochemical waste stream comprising 0-0.5% w/w MEG (mono-ethylene glycol), 0.5-30% w/w DEG (di-ethylene glycol), 40-50% w/w TEG (tri-ethylene glycol), 25-50% w/w TTEG (tetra-ethylene glycol), 1.3% w/w ethylene glycols having 5-12 monomeric units, 5842 ppm of iron, 196 ppm sodium, 126 ppm chromium, 112 ppm boron, and 78 ppm of manganese.
US Pat. No. 11,028,130

PR13.5 PROMOTER FOR ROBUST T-CELL AND ANTIBODY RESPONSES

1. A method of inducing an antibody response and/or a CD8 T-cell response against a neoantigen in a human comprising administering one or more administrations of a recombinant modified Vaccinia Ankara (MVA) virus to the human;wherein the recombinant MVA comprises a Pr13.5 promoter operably linked to a nucleotide sequence encoding the neoantigen,
wherein the Pr13.5 promoter comprises at least 1 copy of a first nucleotide sequence set forth in any one of SEQ ID NOs:8-27 and at least 1 copy of a second nucleotide sequence set forth in any one of SEQ ID NOs:8-27, and
wherein said first nucleotide sequence and said second nucleotide sequence are separated by 20-80 nucleotides.
US Pat. No. 11,028,386

MORPHOLINO OLIGONUCLEOTIDE MANUFACTURING METHOD

AJINOMOTO CO., INC., Tok...

1. A method of producing an n+p-mer morpholino oligonucleotide, comprising:(a) condensing:
(i) a p-mer morpholino oligonucleotide, wherein p is any integer of one or more,
wherein:
a 5?-hydroxy group is activated phosphoramidated, and
a morpholine ring nitrogen atom is protected by a temporary protecting group removable under acidic conditions, with
(ii) an n-mer morpholino oligonucleotide, wherein n is any integer of one or more,
wherein 5?-terminus and/or a nucleic acid base are/is each independently protected by a protecting group having an alkyl group having not less than 10 and not more than 300 carbon atoms and/or an alkenyl group having not less than 10 and not more than 300 carbon atoms or a protecting group removable under conditions different from those for the aforementioned temporary protecting group of the morpholine ring nitrogen atom, and the morpholine ring nitrogen atom is not protected,
by a phosphoramidate bond or phosphorodiamidate bond via the morpholine ring nitrogen atom,
to obtain a reaction mixture comprising said n+p-mer morpholino oligonucleotide; and
(b) subjecting said reaction mixture to an extraction operation to separate said n+p-mer morpholino oligonucleotide as a resultant product into an organic phase,
wherein at least one of said 5?-terminus and said nucleic acid base of said n-mer morpholino oligonucleotide, and said nucleic acid base of said p-mer morpholino oligonucleotide is protected by a protecting group having a branched chain alkyl group having not less than 10 and not more than 300 carbon atoms and/or a branched chain alkenyl group having not less than 10 and not more than 300 carbon atoms.
US Pat. No. 11,028,387

DOUBLE-STRANDED AGENTS FOR DELIVERING THERAPEUTIC OLIGONUCLEOTIDES

National University Corpo...

1. A double-stranded nucleic acid agent comprising a first nucleic acid strand annealed to a second nucleic acid strand, wherein:the first nucleic acid strand comprises
(i) an RNA region with 8-11 consecutive natural RNA nucleotides that can be recognized by RNase H when the first nucleic acid strand is hybridized to the second nucleic acid strand,
(ii) a therapeutic oligonucleotide region wherein at least one internucleotide linkage at the 3? end and at the 5? end of the therapeutic oligonucleotide region is more nuclease-resistant than a natural internucleotide linkage, wherein the at least one nuclease-resistant internucleotide linkage is a phosphorothioate group, and wherein the therapeutic oligonucleotide region is
(a) a single-stranded region that hybridizes to a precursor mRNA (pre-mRNA) or a micro-RNA, but does not hybridize to the second nucleic acid strand,
(b) a splice-switching oligonucleotide, an intron targeting gapmer, or an antagomir,
(c) linked to the 3? end or 5? end of the RNA region of the first nucleic acid strand, and
(d) released from the double-stranded nucleic acid agent in vivo via RNase H-mediated cleavage of the RNA region of (c), and
(e) comprised of one or more of modified nucleotides, nucleotide analogues, or DNA nucleotides comprising a phosphorothioate group, and
(iii) at least one internucleotide linkage at the 3? end and at the 5? end of the RNA region of the first nucleic acid strand is more nuclease-resistant than a natural internucleotide linkage, wherein the at least one nuclease-resistant internucleotide linkage is a phosphorothioate group, and
the second nucleic acid strand comprises
(i) a 13 consecutive DNA/LNA gapmer or DNA/LNA mixmer region that is hybridized to the RNA region of the first nucleic acid strand and can promote the recognition of the 8-11 consecutive natural RNA nucleotides in the first nucleic acid strand by RNase H, and
(ii) at least one internucleotide linkage at the 3? end and at the 5? end of the second nucleic acid strand is more nuclease-resistant than a natural internucleotide linkage, wherein the at least one nuclease-resistant internucleotide linkage is a phosphorothioate group,
and wherein
the double-stranded nucleic acid agent further comprises a targeting moiety which is (a) selected from a lipid, a sugar, a peptide, and a protein and (b) joined to the 3?-terminal nucleotide or the 5?-terminal nucleotide of the second nucleic acid strand, or to the 3?-terminal nucleotide or the 5?-terminal nucleotide of the first nucleic acid strand.
US Pat. No. 11,028,132

HALF-LIFE OPTIMIZED LINKER COMPOSITION

1. A composition comprising a half-like optimized fusion protein linked by a Half-Life Optimizing (H-Lo) linker, said composition comprising:a receptor binding domain (RBD) of a SARS CoV-2 virus;
a half-life extending domain (LED), wherein the LED is a Fc fragment of a humanized Camelid IgG monoclonal antibody; and
the H-Lo linker with an (X+7 amino acid) length fusing a C-terminus of said RBD with an N-terminus of said LED (RBD-LED fusion), wherein a value for said x varies depending on a structural conformation of an interacted RBD-LED fusion and wherein the 7 is the number of amino acids representing a spacer portion of the H-Lo linker and consists of the amino acids TESIVRF (SEQ ID NO: 1).
US Pat. No. 11,028,388

CRISPR/CAS-RELATED METHODS AND COMPOSITIONS FOR TREATING USHER SYNDROME AND RETINITIS PIGMENTOSA

EDITAS MEDICINE, INC., C...

1. A method of altering a cell comprising contacting the cell with:(a) a first gRNA comprising a first targeting domain which is complementary with a first target domain from the USH2A gene, wherein the first targeting domain is configured to provide a first cleavage event selected from a first double strand break and a first single strand break in a region of the USH2A gene which is complementary to a sequence that is the same as, or differs by no more than 3 nucleotides from, a nucleic acid sequence selected from the group consisting of SEQ ID NO:635, SEQ ID NO:392, SEQ ID NO:393, SEQ ID NO:394, SEQ ID NO:395, SEQ ID NO:396, SEQ ID NO:397, SEQ ID NO:398, SEQ ID NO:399, SEQ ID NO:400, and SEQ ID NO:401; and
(b) a Cas9 molecule,
wherein an NHEJ-mediated indel is generated by the first break, resulting in a deletion in the USH2A gene.
US Pat. No. 11,028,133

MODIFIED FLAVIVIRUS ENVELOPE SEQUENCES COMPRISING UNIQUE GLYCOSYLATION SITES

Excivion LTD, Willingham...

1. An isolated recombinant glycosylation site modified flavivirus E-protein fusion loop epitope, wherein the epitope comprises at least one glycosylation site for an N-linked glycan that is not present in a natural flavivirus E-protein fusion loop sequence, wherein the at least one glycosylation site is an N-linked glycosylation sequon (Asn-X-Ser/Thr) and the Asn (N) residue of the sequon occupies any of positions 98-110 (DRGWGNGCGLFGK) SEQ ID NO: 1 of the natural flavivirus E-protein fusion loop amino acid sequence, wherein X is any amino acid residue except proline and Ser/Thr denotes a serine or threonine residue.
US Pat. No. 11,028,389

METHODS FOR ENHANCING UTROPHIN PRODUCTION VIA INHIBITION OF MICRORNA

THE TRUSTEES OF THE UNIVE...

1. A pharmaceutical composition comprising an antisense oligonucleotide that specifically hybridizes to a Let-7c microRNA binding sequence in a 3?-UTR of a utrophin mRNA 3? untranslated region (UTR) and inhibits the binding of the Let-7c microRNA to the utrophin mRNA 3?-UTR and at least one pharmaceutically acceptable excipient, wherein the antisense oligonucleotide is present in an amount effective in a human subject to inhibit the binding of Let-7 micro RNA with its utrophin mRNA 3?-UTR binding sequence, and wherein the antisense oligonucleotide comprises the sequence of SEQ ID NO: 25 (5?-CUG AGG UAG AAA GGU GGU CAU GGC UU-3?).
US Pat. No. 11,028,134

MODIFIED VIP3 POLYPEPTIDES

Syngenta Participations A...

1. A modified Vip3A polypeptide comprising a heterologous carbohydrate binding module (CBM), wherein the CBM is from a bacterial ?-1,4-mannanase and is substituted for all or a portion of Domain III of a Vip3A polypeptide, and wherein the modified Vip3A polypeptide comprises all or a portion of SEQ ID NO:2 and is pesticidal against an insect.
US Pat. No. 11,028,135

LACTOBACILLUS ACIDOPHILUS SURFACE LAYER PROTEIN A (SLPA) AS A THERAPEUTIC AGENT FOR THE TREATMENT OF INFLAMMATORY DISEASES

UNIVERSITY OF FLORIDA RES...

1. A recombinant lactic acid bacterium that is genetically modified to express a polypeptide comprising SEQ ID NO: 4 or a polypeptide that is at least 95% identical to SEQ ID NO: 4 and does not express (i) a polypeptide comprising SEQ ID NO: 1 or orthologs thereof or a polypeptide having at least 95% sequence identity to SEQ ID NO: 1; (ii) a polypeptide comprising SEQ ID NO: 2 or orthologs thereof or a polypeptide having at least 95% sequence identity to SEQ ID NO: 2; and (iii) a polypeptide comprising SEQ ID NO: 3 or orthologs thereof or a polypeptide having at least 95% sequence identity to SEQ ID NO: 3.
US Pat. No. 11,028,391

METHODS AND COMPOSITIONS TO INHIBIT METASTASIS AND TO TREAT FIBROSIS AND TO ENHANCE WOUND HEALING

ALBERT EINSTEIN COLLEGE O...


or a sequence fully complementary thereto.
US Pat. No. 11,028,136

TUMOR ANTIGEN PEPTIDE

Sapporo Medical Universit...

1. A method for inducing a cytotoxic T cell (CTL) that specifically recognizes a cell expressing a BORIS gene belonging to isoform A or C or a BORIS gene belonging to subfamily 5 or 6, the method comprising contacting in vitro:(a) a polypeptide comprising the amino acids of SEQ ID NO: 3, SEQ ID NO: 10, SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 67 or SEQ ID NO: 72, and having HLA-A11 antigen-binding capacity or HLA-A24 antigen-binding capacity, with a peripheral blood lymphocyte (PBL) expressing on the cell surface HLA-A11 antigen or HLA-A24 antigen,
(b) a polypeptide comprising the amino acids of SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 10, SEQ ID NO: 47, or SEQ ID NO: 57, and having HLA-A2 antigen binding capacity, with a PBL expressing on the cell surface HLA-A2 antigen, or
(c) an expression vector encoding at least one of the polypeptides of (a) with the PBL expressing on the cell surface the HLA-A11 antigen or the HLA-A24 antigen or the polypeptide of (b) above with the PBL expressing on the cell surface the HLA-A2 antigen, wherein the sequence encoding the polypeptide of (a) or the polypeptide of (b) is operably linked to an expression control sequence:wherein the polypeptide induces the CTL.
US Pat. No. 11,028,392

COMPOSITIONS AND METHODS FOR INHIBITING EXPRESSION OF THE ALAS1 GENE

Alnylam Pharmaceuticals, ...

1. A double-stranded ribonucleic acid (dsRNA) for inhibiting expression of ALAS1, wherein said dsRNA comprises a sense strand and an antisense strand, the antisense strand comprising a region of complementarity to an ALAS1 RNA transcript, which antisense strand comprises at least 22 contiguous nucleotides from the antisense sequence of UAAGAUGAGACACUCUUUCUGGU (SEQ ID NO: 4153) or UAAGAUGAGACACUCTUUCUGGU (SEQ ID NO: 4154).
US Pat. No. 11,028,137

MUTANT ISLET AMYLOID POLYPEPTIDES WITH IMPROVED SOLUBILITY AND METHODS FOR USING THE SAME

The Research Foundation f...

1. An isolated mutant-human islet amyloid polypeptide hIAPP comprising an amino acid sequence that comprises at least two amino acid substitutions relative to the wild-type hIAPP polypeptide set forth in SEQ ID NO: 1 at positions 21, 22, 31 and 35, wherein said at least two amino acid substitutions comprise a substitution with lysine or arginine.
US Pat. No. 11,028,393

SIRNA COMPOSITIONS THAT SPECIFICALLY DOWN REGULATE EXPRESSION OF A VARIANT OF THE PNPLA3 GENE AND METHODS OF USE THEREOF FOR TREATING A CHRONIC LIVER DISEASE

Purdue Research Foundatio...

1. A composition comprising a small interfering RNA (siRNA) molecule that specifically downregulates expression of a rs738409 C>G variant of a patatin-like phospholipase domain-containing (PNPLA3) gene, wherein the siRNA molecule comprises a nucleotide sequence of at least one of SEQ ID NOs 288-297.
US Pat. No. 11,028,138

COMPOSITIONS AND METHODS FOR USING ACTIN-BASED PEPTIDES TO MODULATE CELLULAR BIOACTIVITY AND CELLULAR SUSCEPTIBILITY TO INTRACELLULAR PATHOGENS

1. An actin-based peptide, comprisingan actin core domain and a cell penetration domain, operably linked together by a spacer domain,
wherein an N-terminus or C-terminus may have either the actin core domain or the cell penetration domain; and
wherein the actin core domain is a B11 core domain having the sequence of YVALDFE, which are the amino acid residues 3-9 of SEQ ID NO:857.
US Pat. No. 11,028,394

CRISPR/CAS-RELATED METHODS AND COMPOSITIONS FOR TREATING CYSTIC FIBROSIS

EDITAS MEDICINE, INC., C...

1. A CRISPR/Cas system, comprising:a) a gRNA molecule comprising a targeting domain that is complementary with a target sequence of a cystic fibrosis transmembrane conductance regulator (CFTR) gene or a sodium channel epithelial 1 alpha (SCNN1A) gene, wherein said target sequence of said CFTR gene is within intron 2 or intron 10 of said CFTR gene; and
b) a Cas9 molecule,
wherein said targeting domain that is complementary to said CFTR gene comprises or consists of a nucleotide sequence that is the same as, or differs by no more than 3 nucleotides from, a targeting domain sequence selected from the targeting domain sequences set forth in SEQ ID NOs: 15101-27265 and wherein said targeting domain that is complementary to said SCNN1A gene comprises or consists of a nucleotide sequence that is the same as, or differs by no more than 3 nucleotides from, a targeting domain sequence selected from the targeting domain sequences set forth in SEQ ID NOs: 497-654, 803-916, and 4176-15100.
US Pat. No. 11,028,395

TNF-ALPHA-BINDING APTAMER, AND THERAPEUTIC USE FOR SAME

BIOIS CO., LTD., Seoul (...

1. An RNA aptamer or a variant thereof, comprising SEQ ID NO: 1 or SEQ ID NO: 2 and binding to TNF-?.
US Pat. No. 11,028,140

OSTEOGENIC BIOMATERIAL

Northeast Ohio Medical Un...

1. A composition for enhancing bone tissue repair or regeneration, comprising:an active peptide fragment of osteoactivin having the amino acid sequence of SEQ ID NO: 1, and
a biocompatible polymer; wherein the biocompatible polymer is covalently bound to the active peptide fragment of osteoactivin.
US Pat. No. 11,028,396

DNA APTAMER SPECIFICALLY BINDING TO CFP10, AND USE THEREOF

MD APTUS INC.

1. A DNA aptamer that specifically binds to culture filtrate protein 10 kDa (CFP10), wherein the DNA aptamer consists of a nucleotide sequence of SEQ ID NO: 6.
US Pat. No. 11,028,141

THERAPEUTIC FOR THE PREVENTION AND/OR TREATMENT OF WEIGHT GAIN AND/OR DIABETES

Baylor College of Medicin...

1. A method of treating a medical condition in an individual having insufficient levels of glucagon-like peptide-1 (GLP-1), comprising the step of administering to the individual a therapeutically effective amount of a peptide comprising MAADIISTIGDLVKWIIDTVNKFKK (SEQ ID NO:1), or a functionally active fragment or derivative thereof; wherein the functionally active fragment comprises at least the amino acids between, and including, positions 3-24 of SEQ ID NO:1; wherein the derivative comprises only conservative amino acid substitutions to SEQ ID NO:1, wherein the medical condition is obesity, type II diabetes, being overweight, Metabolic syndrome, Non-alcoholic fatty liver disease (NAFLD), short bowel syndrome, or a combination thereof.
US Pat. No. 11,028,397

5?-TRIPHOSPHATE OLIGORIBONUCLEOTIDES

1. A synthetic oligoribonucleotide at least 41 nucleotides in length that can form a hairpin structure comprising at least 17 base pairs, the synthetic oligoribonucleotide comprising a 5? end triphosphate group, wherein the synthetic oligoribonucleotide comprises SEQ ID NO: 17.
US Pat. No. 11,027,374

PARTICLES, CONNECTING MATERIAL AND CONNECTION STRUCTURE

SEKISUI CHEMICAL CO., LTD...

1. A connecting material comprising:resin particles; and
metal atom-containing particles,
the resin particles having an average particle diameter of 0.1 ?m or more and 15 ?m or less,
the resin particles having a 10% K value of exceeding 3000 N/mm2 and 20000 N/mm2 or less,
the resin particles having a particle diameter CV value of 50% or less,
the resin particles having a thermal decomposition temperature of 200° C. or more, and
the metal atom-containing particles being metal atom-containing particles that are capable of being sintered by heating at less than 400° C.
US Pat. No. 11,028,142

COMPOSITIONS AND METHODS FOR TCR REPROGRAMMING USING FUSION PROTEINS

TCR2 Therapeutics Inc., ...

1. A T cell from a human subject, wherein the T cell comprises a recombinant nucleic acid molecule encoding a T cell receptor (TCR) fusion protein (TFP) comprising:(a) a TCR subunit comprising (i) an extracellular domain, (ii) a transmembrane domain, and (iii) a TCR intracellular domain comprising a stimulatory domain from an intracellular signaling domain; and
(b) a murine, human or humanized scFv or single domain antibody comprising an antigen binding domain; and a pharmaceutically acceptable carrier;
wherein the TCR subunit and the antigen binding domain are operatively linked;
wherein the extracellular domain, the transmembrane domain and the intracellular signaling domain are derived from a single subunit, wherein the single subunit is CD3 epsilon or wherein the single subunit is CD3 gamma;
wherein the extracellular domain comprises an extracellular domain of the single subunit;
wherein the TFP functionally interacts with an endogenous TCR when expressed in a T cell; and
wherein the T cell exhibits increased cytotoxicity to a human cell expressing an antigen that specifically interacts with the antigen binding domain compared to a T cell not containing the TFP.
US Pat. No. 11,028,398

FUSION PROTEINS HAVING MUTATED IMMUNOGLOBULIN HINGE REGION

NOVAGEN HOLDING CORPORATI...

1. A fusion protein comprising from N-terminus to C-terminus:a non-immunoglobulin polypeptide comprising a cysteine residue nearest to the C-terminus, wherein said polypeptide is selected from the group consisting of human erythropoietin (EPO) and human granulocyte-macrophage colony stimulating factor (GM-CSF); and
an immunoglobulin component comprising a human IgG1 Fc fragment having a mutated IgG1 hinge region, wherein the non-immunoglobulin polypeptide is directly coupled to the immunoglobulin component without an external linker peptide,
wherein said IgG1 Fc fragment comprises said IgG1 mutated hinge region and IgG1 CH2 and CH3 domains;
wherein the amino acid sequence of said mutated IgG1 hinge region is set forth in VEPKSGDKTSTCPPCP (SEQ ID NO: 24) or the amino acid sequence of SEQ ID NO:24, wherein one or more amino acid residues N-terminal to the glycine residue is deleted in SEQ ID NO:24; and
wherein the fusion protein has enhanced biological activity in vivo in comparison to the native non-immunoglobulin polypeptide and in comparison to a fusion protein comprising the native non-immunoglobulin polypeptide and a human IgG1 Fc fragment comprising a native IgG1 hinge region and IgG1 CH2 and CH3 domains.
US Pat. No. 11,028,143

ENHANCED ANTIGEN PRESENTING ABILITY OF RNA CAR T CELLS BY CO-INTRODUCTION OF COSTIMULATORY MOLECULES

Novartis AG, Basel (CH) ...

1. A T cell comprising an exogenous nucleic acid, wherein:(a) the nucleic acid comprises a first nucleic acid sequence encoding a chimeric antigen receptor (CAR) comprising an extracellular domain, a transmembrane domain, and an intracellular signaling domain, wherein the intracellular signaling domain comprises a costimulatory signaling domain that is a functional signaling domain from a protein selected from the group consisting of OX40, CD27, CD28, CD30, CD40, PD-1, CD2, CD7, CD258, NKG2C, B7-H3, ICAM-1, LFA-1 (CD11a/CD18), ICOS and 4-1BB (CD137), or any combination thereof, and
(b) the nucleic acid comprises a second nucleic acid sequence encoding a polypeptide which enhances T cell priming, or a functional fragment or variant thereof, wherein the polypeptide is selected from the group consisting of CD70, CD86, and CD252,
wherein the polypeptide is expressed at a level that: (1) the T cell enhances the priming of another T cell that does not comprise the exogenous nucleic acid and (2) expression of the polypeptide does not inhibit the cell-killing function of the CAR by more than 40%, provided that
(i) the first and/or second nucleic acid sequence comprises an RNA; or
(ii) the CAR further comprises a second intracellular signaling domain.
US Pat. No. 11,028,399

CTLA4/PD1 TARGETED/IMMUNOMODULATORY FUSION PROTEINS

BIOCON LIMITED

1. A method for binding of a bispecific chimeric fusion protein to CTLA4 and PD-L1, the method comprising contacting CTLA4 and PD-L1 with a bispecific chimeric fusion protein, wherein the bispecific chimeric fusion protein comprises a targeting moiety and an immunomodulating moiety wherein the targeting moiety and the immunomodulating moiety are linked by an amino acid spacer of sufficient length of amino acid residues so that both moieties can successfully bind to their individual targets, wherein the immunomodulating moiety is PD1 with SEQ ID NO: 10, wherein the amino acid spacer is selected from SEQ ID NO: 3 or SEQ ID NO: 11; and wherein the targeting moiety is an Anti-CTLA4 antibody consisting of heavy chain SEQ ID NO: 7 and light chain SEQ ID NO: 8; wherein SEQ ID NO: 10 is attached via the amino acid spacer to the C-terminus of SEQ ID NO: 7 or SEQ ID NO: 8.
US Pat. No. 11,028,144

SOLUBLE GLYCOPROTEIN V FOR TREATING THROMBOTIC DISEASES

1. A method for the treatment and/or prevention of a thrombotic disease in a subject, comprising administering to the subject an effective amount of a soluble polypeptide comprising a modified glycoprotein V (GPV) lacking a functional transmembrane domain,wherein the modified GPV comprises an amino acid sequence at least 75% identical to amino acids 1-503 of SEQ ID NO:3 or amino acids 1-502 of SEQ ID NO:7, and
wherein the thrombotic disease is selected from the group consisting of thrombo-inflammatory conditions, venous thrombosis, arterial thrombosis, capillary thrombosis, portal vein thrombosis, renal vein thrombosis, jugular vein thrombosis, cerebral venous sinus thrombosis, thrombus formation during or after contacting blood with an artificial surface, atherosclerosis, arthritis, coagulopathy, deep venous thrombosis (DVT), disseminated intravascular coagulopathy (DIC), a chronic or acute thromboembolism, pulmonary thromboembolism, Budd-Chiari syndrome, Paget-Schroetter diseases, stroke, and myocardial infarction.
US Pat. No. 11,028,145

ALK7:ACTRIIB HETEROMULTIMERS AND USES THEREOF

ACCELERON PHARMA INC., C...

1. A method of treating a kidney disorder in a subject in need thereof, comprising administering to the subject a soluble recombinant heteromultimer comprising:(i) an ALK7 polypeptide comprising an amino acid sequence that is at least 90% identical to amino acids 28-92 of SEQ ID NO: 9, and
(ii) an ActRIIB polypeptide comprising an amino acid sequence that is at least 90% identical to amino acids 29-109 of SEQ ID NO: 1, and
wherein the heteromultimer binds to one or more of: activin B, activin C, and activin AC; and
wherein the kidney disorder is selected from a group consisting of kidney fibrosis and kidney inflammation.
US Pat. No. 11,028,401

MANIPULATION OF GENES INVOLVED IN SIGNAL TRANSDUCTION TO CONTROL FUNGAL MORPHOLOGY DURING FERMENTATION AND PRODUCTION

Zymergen Inc., Emeryvill...

1. A variant strain of Aspergillus that is genetically altered compared to a parental strain, wherein cells of the variant strain possess a genetic alteration in an osmotic response pathway gene that causes cells of the variant strain to produce a reduced amount and/or less active form of functional protein encoded by the osmotic response pathway gene as compared to cells of the parental strain when grown under submerged culture conditions,wherein the osmotic response pathway gene is selected from an Aspergillus niger (A. niger) orthologue of a Saccharomyces cerevisiae (S. cerevisiae) sln1 gene and a Neurospora crassa (N. crassa) nik1 gene, and wherein the genetic alteration is replacement of a native promoter of the osmotic response pathway gene with a promoter that weakly expresses the osmotic response pathway gene compared to the native promoter, wherein the promoter that weakly expresses the osmotic response pathway gene as compared to the native promoter is selected from an Aspergillus amyB gene promoter and an Aspergillus manB gene promoter.
US Pat. No. 11,026,610

METHOD OF PRODUCING THIN ENZYME-BASED SENSING LAYERS ON PLANAR SENSORS

CALIFORNIA INSTITUTE OF T...

1. A method, comprising:depositing a masking layer onto a device comprising a plurality of electrodes, wherein the masking layer covers the plurality of electrodes;
depositing an adhesion promoter onto the device and onto the masking layer, wherein deposition of the adhesion promoter onto the plurality of electrodes is avoided due to the masking layer;
removing the masking layer from the device coated with the adhesion promoter;
after removing the masking layer, spin coating a signal transduction enzyme onto the device, the signal transduction enzyme being configured to detect an active compound capable of generating an electric current; and
crosslinking the signal transduction enzyme by depositing a crosslinker onto the spin coated signal transduction enzyme to produce a cross-linked enzyme film having a thickness of less than 1 micrometer, and
wherein the signal transduction enzyme is configured so that a current measured by the plurality of electrodes settles within about 5% of its stable value within 1 second.
US Pat. No. 11,028,146

RECOMBINANT YEAST STRAINS

MODERN MEADOW, INC., Nut...

1. A recombinant yeast cell, comprising a polynucleotide encoding an Escherichia coli alpha ketoglutarate transporter and at least one polynucleotide that encodes collagen, wherein the Escherichia coli alpha ketoglutarate transporter has the amino acid sequence set forth in SEQ ID NO: 1.
US Pat. No. 11,028,147

HYDROLYZED COLLAGEN COMPOSITIONS AND METHODS OF MAKING THEREOF

AVICENNA NUTRACEUTICAL, L...

1. A method for producing hydrolyzed collagen, the method comprising(a) heating avian cartilage in the presence of an aqueous acid to at a temperature of from 50° C. to 100° C. for 8 to 48 hours to produce a first composition, wherein the avian cartilage comprises the ribcage and sternum;
(b) optionally filtering the first composition to remove the supernatant;
(c) neutralizing the acid present in the supernatant to produce a neutralized supernatant; and
(d) removing the water in the neutralized supernatant to produce the hydrolyzed collagen,
wherein the process does not use an enzyme.
US Pat. No. 11,028,403

METHODS OF INCREASING PLANT BIOMASS AND OILSEED PRODUCTION

University of Guelph, Gu...

1. A transgenic plant produced using a method comprising:a. contacting a plant cell with a nucleic acid molecule encoding an exogenous starch-branching enzyme selected from starch-branching enzyme 1 (SBEI) and starch-branching enzyme 2b (SBEIIb) to obtain a transformed plant cell,
b. expressing the nucleic acid molecule in the transformed plant cell, and
c. producing a plant from the transformed plant cell,wherein the nucleic acid molecule is from a cereal plant and wherein the plant is a dicotyledon,wherein the plant has increased biomass, seed production and/or oil production compared to a wild-type plant not transformed with the nucleic acid molecule,wherein the nucleic acid molecule comprises a nucleic acid sequence that has at least 80% sequence identity with a nucleic acid sequence selected from SEQ ID NO: 1 or 3, andwherein the cereal plant is maize, wheat, barley, sorghum, oat, rye, millet, triticale or rice.
US Pat. No. 11,026,868

PATCH FOR TOOTH ATTACHMENT ABLE TO BE REMOVED BY TOOTH BRUSHING

1. A method for using a patch for attaching to teeth or a surrounding part of teeth,comprising:
attaching a patch to teeth or a surrounding part of teeth, and
removing the patch after moisture absorption by tooth brushing,
wherein the patch comprises:
a drug layer including a drug component; and
a backing layer which is positioned on one side of the drug layer,
wherein the backing layer includes a water-soluble polymer and water-insoluble polymer,
wherein the water-insoluble polymer is at least one selected from the group consisting of cellulose acetate phthalate, shellac, polyvinyl acetate, ethyl cellulose, polymethyl methacrylate, methacryloyl ethyl betaine/methacrylate copolymer, methacrylic acid copolymer and aminoalkyl methacrylate copolymer, and
the water-soluble polymer is at least one selected from the group consisting of polyalkyl vinyl ether-maleic acid copolymer (PVM/MA copolymer), polyvinyl alcohol, polyacrylic acid, Poloxamer 407, polyethyleneoxide (Polyox), polyvinyl pyrrolidone-vinyl acetate copolymer (PVP/VA copolymer), polyvinyl pyrrolidone (PVP), polyquaternium-11, polyquaternium-39, carboxypolymethylene (Carbomer), hydroxypropyl methyl cellulose, hydroxyethyl cellulose, hydroxypropyl cellulose, gelatin and sodium alginate, and
wherein the patch backing layer is capable of being degraded, dispersed into particles and detached by tooth brushing.
US Pat. No. 11,028,148

RECOMBINANT COLLAGEN AND ELASTIN MOLECULES AND USES THEREOF

GELTOR, INC., San Leandr...

1. A recombinant polypeptide comprising the amino acid sequence of SEQ ID NO: 1 having an internal truncation of from 50 amino acids to 250 amino acids.
US Pat. No. 11,028,404

METHODS OF IMPROVING MYCORRHIZATION IN PLANTS AND GENETICALLY MODIFED PLANTS WITH IMPROVED MYCORRHIZATION

UT-Battelle, LLC, Oak Ri...

1. A method for improving mycorrhization in a plant or plant cell, comprising expressing an exogenous nucleic acid encoding a Lectin receptor-like kinase 1 (LecRLKI) variant or homolog in the plant or plant cell, wherein the expression of the LecRKL1 variant or homolog improves mycorrhizal symbiosis in the plant or plant cell, and wherein the LecRLKI variant or homolog comprises an amino acid sequence that is at least 98% identical to the amino acid sequence shown by SEQ ID NO: 78.
US Pat. No. 11,026,869

PROCESS FOR PRODUCING SMALL DROPLET EMULSIONS AT LOW PRESSURE

CONOPCO, INC., Englewood...

1. A process for making a nanoemulsion composition comprising:a) an internal phase comprising (i) 55 to 75% by wt. of total nanoemulsion composition of oils selected from the group consisting of triglyceride, petrolatum and mixtures thereof, wherein the melting point of the petrolatum is 30 to 60° C.; and (ii) 1.1 to 8% by wt. nanoemulsion of a C8 to C18 fatty acid; and
b) an external aqueous phase comprising 2 to 15% by wt. of total nanoemulsion composition of a surfactant or surfactants which are N-acyl derivatives of amino acid salt;wherein the surfactant of (b) comprises 50% or greater of all surfactant present in said external aqueous phase;wherein the volume average diameter of droplets of (a) is 20 to 600 nanometers,wherein said process comprises:1) adding the C8 to C18 fatty acid of component (a)(ii) to oil of (a)(i);
2) heating oil phase (a) to a sufficient temperature so that all compounds are molten; and
3) Heating the aqueous phase to a temperature range of 45 to 75° C.; and
4) Simultaneously pumping the heated aqueous and oil phases via a sonolator or a conventional homogenizer using process pressure of 500 pounds per square inch (psi) or less.
US Pat. No. 11,028,149

RECOMBINANT POLYPEPTIDE PRODUCTION METHOD

Chugai Seiyaku Kabushiki ...

1. A method of producing an antibody comprising culturing a cell into which a DNA encoding a desired antibody and APES (Antibody Production Enhancing Sequence) have been exogenously introduced by transfection, thereby producing the desired antibody, whereinthe APES is a nucleic acid molecule that increases the ability of the cultured cells to produce the antibody, wherein the APES is selected from nucleic acid molecules each consisting of any of the following nucleotide sequences:
(a) a DNA consisting of the nucleotide sequence of any of SEQ ID NOs:1 to 16 and 29;
(b) a DNA consisting of 19 to 25 nucleotides in the sequence of SEQ ID NO: 2;
(c) an RNA that is a transcript of (a), or (b); and
(d) a DNA or RNA consisting of a sequence that can bind 19 to 25 nucleotides in the sequence of SEQ ID NO: 2 by base pairing.
US Pat. No. 11,028,405

NUCLEOTIDE SEQUENCES AND CORRESPONDING POLYPEPTIDES CONFERRING MODULATED GROWTH RATE AND BIOMASS IN PLANTS GROWN IN SALINE AND OXIDATIVE CONDITIONS

Ceres, Inc., Thousand Oa...

1. A method of producing a plant having increased tolerance to salinity or increased tolerance to oxidative stress, said method comprising growing plant cells transformed with an exogenous nucleic acid, said exogenous nucleic acid comprising a heterologous promoter operably linked to a nucleotide sequence encoding a polypeptide, wherein said polypeptide has 95 percent or greater amino acid sequence identity to the amino acid sequence of SEQ ID NO:86, and wherein overexpression of said polypeptide in a transformed plant grown from said transformed plant cells results in an increased level of tolerance to salinity or oxidative stress as compared to the corresponding level in tolerance to salinity or oxidative stress of a control plant of the same species cultivated under the same conditions that does not comprise said exogenous nucleic acid.
US Pat. No. 11,026,870

SYSTEMS, COMPOSITIONS, AND METHODS FOR CLEANSING AND DETOXIFYING KERATIN FIBERS

1. A method for cleansing keratin fibers comprising:(1) mixing a first composition comprising:
a) at least one carbon dioxide-generating compound selected from the group consisting of carbonate or bicarbonate salts of alkaline metals or alkaline earth metals, or mixtures thereof; and
b) from about 20% to about 85% by weight of the first composition of at least one clay selected from the group consisting of Aluminum Silicate, Calcium Silicate, Magnesium Aluminum Silicate, Magnesium Silicate, Magnesium Trisilicate, Sodium Magnesium Silicate, Zirconium Silicate, Attapulgite, Bentonite, Fuller's Earth, Hectorite, Kaolin, Lithium Magnesium Silicate, Lithium Magnesium Sodium Silicate, Montmorillonite, Pyrophyllite, Zeolite, or mixtures thereof;
with a second composition comprising a liquid shampoo to form a cleansing composition, wherein the first composition and the second composition are combined to form a cleansing composition at or near the time of use;
(2) applying the cleansing composition to the keratin fibers; and
(3) optionally rinsing the cleansing composition from the keratin fibers.
US Pat. No. 11,028,150

ANTI-SARS-COV-2 ANTIBODIES DERIVED FROM 2DD8

Centivax, Inc., South Sa...

1. An antibody or an antigen-binding fragment that selectively binds to a severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), that comprises a variable heavy chain (VH) complementarity determining region 1 (CDR1) having an amino acid sequence of SEQ ID NO: 70; a VH CDR2 having an amino acid sequence of SEQ ID NO: 116; a VH CDR3 having an amino acid sequence of SEQ ID NO: 165; a variable light chain (VL) CDR1 having an amino acid sequence of SEQ ID NO: 3; a VL CDR2 having an amino acid sequence of SEQ ID NO: 6; and a VL CDR3 having an amino acid sequence of SEQ ID NO: 26.
US Pat. No. 11,028,406

PODOSPHAERA LEUCOTRICHA RESISTANCE PROVIDING GENES IN MALUS DOMESTICA

1. A Malus domestica plant which is resistant to Podosphaera leucotricha comprising a non-natural modification introduced into its genome that results in:reduced transcription of a nucleic acid sequence of SEQ ID NO: 2 as compared to a Malus domestica plant that is not resistant to Podosphaera leucotricha,
wherein the non-natural modification is in the nucleic acid sequence of SEQ ID NO. 2.
US Pat. No. 11,026,871

ORAL CARE COMPOSITIONS AND METHODS OF USING THE COMPOSITIONS

Colgate-Palmolive Company...

1. An oral care composition, comprising:zinc phosphate, wherein the zinc phosphate is added to the oral care composition as a preformed salt, and wherein the zinc phosphate is in an amount of 1% by weight, relative to the weight of the oral care composition; and
a silicate compound comprising calcium silicate in an amount of 3% by weight, relative to the weight of the oral care composition, wherein the amount of calcium silicate is effective to reduce tooth enamel erosion.
US Pat. No. 11,028,151

MONOVALENT, BIVALENT AND TRIVALENT ANTI HUMAN RESPIRATORY SYNCYTIAL VIRUS (HRSV) NANOBODY CONSTRUCTS FOR THE PREVENTION AND/OR TREATMENT OF RESPIRATORY TRACT INFECTIONS

Ablynx N.V., Ghent-Zwijn...

1. Polypeptide that specifically binds F protein of hRSV, comprising or essentially consisting of at least three amino acid sequences with SEQ ID NO: 5, in which in at least one of said amino acid sequences one or more (such as two, three, four, five, six, seven, eight or nine, ten, eleven, or twelve) amino acid residues have been mutated selected from the following: Val5Leu, Ala14Pro, Ser19Arg, Ile20Leu, Glu44Gly, Ala74Ser, Gly78Leu, Ala83Arg, Asp85Glu, Arg105Gln, Gln108Leu and Gly54Asp.
US Pat. No. 11,028,407

INSECTICIDAL COMBINATIONS OF POLYPEPTIDES HAVING IMPROVED ACTIVITY SPECTRUM AND USES THEREOF

PIONEER HI-BRED INTERNATI...

1. A DNA construct comprising a nucleic acid molecule encoding a variant Cry1B polypeptide having at least 95% sequence identity to SEQ ID NO: 29 and having insecticidal activity; and a nucleic acid molecule encoding a PtIP-83 polypeptide having at least 95% sequence identity to SEQ ID NO: 62, 64, or 66 and having insecticidal activity.
US Pat. No. 11,026,872

COSMETIC COMPOSITION COMPRISING COMPOSITE SUNSCREEN PARTICLES

1. A cosmetic composition comprising:(i) at least one composite pigment comprising:
(a) at least one small particle comprising a styrene/acrylate copolymer, wherein the at least one small particle is at least partially covered with at least one coating layer comprising at least one particulate titanium dioxide,
(b) at least one large particle comprising a polymethyl methacrylate polymer, and
(c) optionally at least one coloring pigment,
wherein the at least one small particle has a mean particle size ranging from about 100 nm to about 600 nm,
wherein the at least one large particle has a mean particle size of greater than about 2 ?m,
wherein the weight ratio of the at least one small particles to the at least one large particle ranges from 50:50 to 90:10, and
wherein the composite pigment is obtained by a mechanochemical fusion process;
(ii) at least one non-emulsifying organopolysiloxane elastomer chosen from dimethicone crosspolymers, present in an amount ranging from about 8.3% to about 10% by weight relative to the total weight of the composition; and
(iii) at least one porous oil absorbing agent with an oil absorption capability of from 1 to 15 mL/g,
wherein the at least one porous oil absorbing agent is present in an amount greater than about 1% by weight, relative to the total weight of composition.
US Pat. No. 11,028,152

SINGLE DOMAIN ANTIBODIES TO CHIKUNGUNYA VIRUS

The Government of the Uni...

1. An isolated antibody comprising a protein sequence selected from the group consisting of SEQ ID Nos. 1-14.
US Pat. No. 11,028,408

RECOMBINANT INFLUENZA VIRUSES AND CONSTRUCTS AND USES THEREOF

UNIVERSITY OF MARYLAND, C...

6. A recombinant type A influenza virus comprising a rearranged influenza type A viral genome segment 2, wherein the rearranged influenza type A viral genome segment 2 comprises:a) a first influenza type A viral genome segment, wherein the first influenza type A viral genome segment is influenza type A viral genome segment 2 which comprises a nucleic acid sequence that encodes PB1 and
b) a portion of a second influenza type A viral genome segment, wherein the portion of the second influenza type A viral genome segment comprises the portion of influenza type A viral genome segment 8 comprising a nucleic acid sequence that encodes the influenza type A viral protein, NS2, wherein the NS2 nucleic acid sequence is removed from RNA segment 8 of the genome, wherein the NS2 nucleic acid sequence is downstream of the nucleic acid sequence that encodes PB1,
wherein a cleavage site is present between the nucleic acid sequence that encodes PB1 and the NS2 nucleic acid sequence,
wherein the cleavage site is a 2A-like-cis-acting hydrolase element (CHYSEL) site, and
wherein the nucleic acid sequence that encodes PB1 and the NS2 nucleic acid sequence are co-translatable.
US Pat. No. 11,026,873

PERSONAL CARE COMPOSITION COMPRISING TAURINE, ARGININE, GLYCINE

Colgate-Palmolive Company...

1. A personal care composition comprising an amino acid complex consisting of taurine, arginine and glycine in a taurine:arginine:glycine weight ratio of about (65):(34):(1);wherein taurine, arginine and glycine are the only amino acids present in the personal care composition; and
wherein the personal care composition is selected from a rinse off composition and a leave-on composition.
US Pat. No. 11,028,153

TARGETING IMMUNOLOGICAL FUNCTIONS TO THE SITE OF BACTERIAL INFECTIONS USING CELL WALL TARGETING DOMAINS OF BACTERIOLYSINS

INTEGRATED BIOTHERAPEUTIC...

1. A method for treating a bacterial infection, disease, or disorder, comprising administering to a subject in need of treatment an effective amount of a therapeutic polypeptide comprising a cell wall targeting (CWT) domain of a bacteriolysin fused to an immune function mediating component (IFMC) through a peptide linker:wherein the bacteriolysin is a bacteriocin selected from the group consisting of: Lysostaphin, Bacteriocin AS-48, Bacteriocin ColE9, adherence binding domain DSL peptides of the pilin protein, an E-colicin, Autolysin, and the FyuA binding domain of pesticin fused to the N-terminus of T4 lysozyme, or
wherein the bacteriolysin is a phage encoded lysin selected from the group consisting of: Phage phiKZ gp144 lysin, ?NM3 lysin, ?11 lysin, ?68 P17 lysin, ?B30 lysin, OK LysK lysin, ? MR11 MV-L lysin, ?Ss2 PlySs2bacteriophage lysin, OBPgp279 endolysin, PVP-SE1gp146 lysin, E201?2-1gp229 lysin, Endolysin PlyL, Endolysin PlyG, LambdaSa2 cpl-7 lysin, bacteriophage SM1 lysin, Endolysin CD27L, and mycobacteriophage Ms6 lysin,
wherein the IFMC comprises an antibody or antigen binding fragment thereof to a bacterial toxin or toxoid, or a fragment thereof, wherein the antibody or antigen binding fragment thereof lacks the ability to recognize a bacterial cell wall, and wherein the CWT domain of the therapeutic polypeptide can target the IFMC to a bacterial target.
US Pat. No. 11,028,409

REPLICATION-DEFICIENT RNA VIRUSES AS VACCINES

1. A recombinant Sendai virus, containing a viral genome with a deletion of amino acids 2-77 of the protein encoded by gene P, which leads to loss of capacity for replication without loss of capacity for secondary transcription, and at least one sequence coding for a heterologous gene product, wherein the heterologous gene product is a viral antigen.
US Pat. No. 11,026,874

SYSTEMS AND METHODS FOR CHANGING THE COLOR OF HAIR

1. A system for changing the color of the hair, comprising:(i) a first composition comprising at least one pigment, and
(ii) a second composition comprising at least one color changing agent,
wherein the at least one pigment is capable of imparting a first color to the hair that can be changed to a second hair color by the color changing agent of the second composition, and
wherein the pH of the first and second compositions are different; and
wherein the at least one pigment comprises at least one anthocyanin.
US Pat. No. 11,028,154

AGROCHEMICAL COMPOSITIONS COMPRISING ANTIBODIES BINDING TO SPHINGOLIPIDS

Biotalys NV, Ghent (BE)

1. A polypeptide comprising: one or more of the combinations selected from the group consisting of:a CDR1 region having SEQ ID NO: 86, a CDR2 region having SEQ ID NO: 170, and a CDR3 region having SEQ ID NO: 254;
a CDR1 region having SEQ ID NO: 146, a CDR2 region having SEQ ID NO: 230, and a CDR3 region having SEQ ID NO: 313; and
a CDR1 region having SEQ ID NO: 154, a CDR2 region having SEQ ID NO: 238, and a CDR3 region having SEQ ID NO: 321.
US Pat. No. 11,028,410

HYBRID PROMOTER AND USES THEREOF

JUST-EVOTEC BIOLOGICS, IN...

1. A hybrid promoter, comprising:(i) a murine cytomegalovirus (mCMV) enhancer sequence, comprising a mCMV enhancer element (mCMV-E) and a CMV promoter (CMV-P) sequence at its 3? end, operably linked 5? to a rat EF-1alpha intron sequence;
(ii) an intervening first leader sequence operably linked, 3? to the CMV promoter sequence of the mCMV enhancer sequence, and 5? to the rat EF-1alpha intron sequence; and
(iii) a second leader sequence operably linked 3? to the rat EF-1alpha intron sequence.
US Pat. No. 11,026,875

SKIN RESTORATION PRODUCT

Givaudan S.A., Vernier (...

1. A composition comprising 50 to 75 mmoles/kg N-acetyl-glucosamine-6-phosphate, 55 to 83 mmoles/kg glucuronic acid, and 33 to 66 mmoles/kg of a magnesium sulfate.
US Pat. No. 11,028,155

ENHANCED DELIVERY OF DRUGS TO THE BRAIN

Nascent Biotech, Inc., S...

1. An antibody comprising a heavy chain and a light chain, wherein the heavy chain comprises a heavy chain acceptor framework of SEQ ID NO: 1; and wherein the light chain comprises a light chain acceptor framework of SEQ ID NO: 2, wherein the light chain CDR1, CDR2 and CDR3 at amino acids 28-34, 50-56, and 91-97 of SEQ ID NO:2, respectively, are replaced with the CDR1, CDR2 and CDR3 at amino acids 148-152, 170-172 and 208-216 of SEQ ID NO:4, respectively; and wherein the heavy chain CDR1, CDR2 and CDR3 at amino acids 31-35, 50-59, and 101-109 of SEQ ID NO:1, respectively, are replaced with the CDR1, CDR2 and CDR3 at amino acids 26-33, 51-58, and 97-110 of SEQ ID NO:4, respectively.
US Pat. No. 11,028,411

SYSTEMS AND METHODS FOR ONE-SHOT GUIDE RNA (OGRNA) TARGETING OF ENDOGENOUS AND SOURCE DNA

EDITAS MEDICINE, INC., C...

1. A method of altering a target site in a cell comprising delivering to the cell a transiently active genome editing system comprising a guide RNA (gRNA) and an engineered Cas9 protein, or a nucleic acid composition encoding the gRNA and the Cas9 protein, whereina) the gRNA comprises a targeting domain that is complementary to a eukaryotic nucleic acid sequence; and
b) the Cas9 protein is encoded by a nucleic acid comprising the eukaryotic nucleotide sequence and a protospacer adjacent motif (PAM), wherein the PAM is recognized by the Cas9 protein and is within or adjacent to the eukaryotic nucleotide sequence, and wherein the Cas9 protein comprises:
i) an amino acid insertion relative to SEQ ID NO: 2 selected from the group consisting of: E271_N272insGX6-10G, L371_N372insGX6-10G, and Q737_A738insGX6-10G; or
ii) an amino acid insertion S12_M13insGX6-10G relative to SEQ ID NO: 10,
wherein the amino acid insertion relative to SEQ ID NO:2 or SEQ ID NO: 10 results in a polypeptide comprising an amino acid sequence having at least 95% sequence identity to the sequence set forth in SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, or SEQ ID NO: 10, and having an RNA-guided nuclease activity.
US Pat. No. 11,026,876

COMPOSITION FOR IMPROVING SKIN CONDITION COMPRISING CHEMOKINES

Tego Science Inc., Seoul...

1. A method for skin improvement comprising applying a cosmetic composition comprising at least one active ingredient selected from the group consisting of a B lymphocyte chemoattractant (BLC) and a thymus-expressed chemokine (TECK) to skin for skin improvement.
US Pat. No. 11,028,156

METHODS AND COMPOSITIONS FOR INCREASING IDURONATE 2-SULFATASE ACTIVITY IN THE CNS

ARMAGEN, INC., Calabasas...

1. A method for increasing iduronate-2-sulfatase (IDS) activity in a central nervous system of a subject with Hunter's syndrome, comprising systemically administering to the subject with Hunter's syndrome a therapeutically effective dose of a fusion antibody comprising:(a) an immunoglobulin that crosses a blood brain barrier (BBB), wherein the immunoglobulin comprises an immunoglobulin heavy chain; and
(b) an iduronate-2-sulfatase, wherein the amino acid sequence of the iduronate-2-sulfatase is covalently linked to the amino terminus of the amino acid sequence of the immunoglobulin heavy chain, thereby forming a fusion protein;
wherein the fusion antibody crosses the blood brain barrier (BBB) and catalyzes hydrolysis of 2-sulfate groups of the L-iduronate 2-sulfate units of dermatan sulfate, heparan sulfate or heparin, wherein the iduronate-2-sulfatase retains at least 20% of its activity compared to its activity as a separate entity after crossing a BBB of the subject with Hunter's syndrome and entering a lysosomal compartment of a cell in a central nervous system of the subject with Hunter's syndrome, and wherein the iduronate-2-sulfatase specific activity of the fusion antibody is at least 10,000 units/mg.
US Pat. No. 11,028,412

METHODS AND COMPOSITIONS FOR RNA-DIRECTED TARGET DNA MODIFICATION AND FOR RNA-DIRECTED MODULATION OF TRANSCRIPTION

The Regents of the Univer...

1. A composition comprising:a nucleic acid encoding a single molecule DNA-targeting RNA, wherein the single molecule DNA-targeting RNA comprises, in 5? to 3? order:
(i) a targeter-RNA comprising a nucleotide sequence that is complementary to a target sequence of a target DNA; and (ii) an activator-RNA that hybridizes with the targeter-RNA to form a double-stranded RNA duplex, wherein the activator-RNA hybridizes with the targeter-RNA to form a total of 8 to 15 base pairs, and
wherein the activator-RNA and the targeter-RNA are covalently linked by intervening nucleotides,
wherein the single molecule DNA-targeting RNA is capable of forming a complex with a Cas9 protein and hybridization of the targeter-RNA to the target sequence is capable of targeting the complex to the target DNA.
US Pat. No. 11,026,877

COSMETIC COMPOSITIONS FOR BLEACHING THE SKIN

1. A cosmetic composition for skin bleaching, comprisinga) at least one oily plant extract from a root of Glycyrrhiza glabra using isopropyl myristate as the extracting agent, and
b) ascorbyl tetraisopalmitate,
wherein the weight ratio of components a) to b) is 10:1.
US Pat. No. 11,028,157

BINDING MOLECULES THAT SPECIFICALLY BIND TO TAU

1. A binding molecule that is adapted to specifically bind to tau, comprising:a heavy chain CDR1 comprising the amino acid sequence of SEQ ID NO: 1,
a heavy chain CDR2 comprising the amino acid sequence of SEQ ID NO: 2,
a heavy chain CDR3 comprising the amino acid sequence of SEQ ID NO: 3,
a light chain CDR1 comprising the amino acid sequence of SEQ ID NO: 4,
a light chain CDR2 comprising the amino acid sequence of SEQ ID NO: 5, and
a light chain CDR3 comprising the amino acid sequence of SEQ ID NO: 6,
wherein the binding molecule is capable of inhibiting aggregation of tau.
US Pat. No. 11,028,413

MICROBIAL ENGINEERING FOR THE PRODUCTION OF CHEMICAL AND PHARMACEUTICAL PRODUCTS FROM THE ISOPRENOID PATHWAY

Massachusetts Institute o...

1. A method for making a pharmaceutical product, the method comprising:providing an Escherichia coli (E. coli) that produces isopentenyl pyrophosphate (IPP) and dimethylallyl pyrophosphate (DMAPP) through an upstream methylerythritol pathway (MEP) and converts the IPP and DMAPP to amorphadiene or derivative thereof through a recombinantly expressed downstream synthesis pathway comprising farnesyl diphosphate synthase and amorphadiene synthase;
culturing the E. coli to produce the amorphadiene or derivative thereof, wherein the accumulation of indole in the culture is controlled to below 100 mg/L to thereby increase production of amorphadiene or derivative thereof; and
incorporating the amorphadiene or derivative thereof, into a pharmaceutical product.
US Pat. No. 11,026,878

MAKEUP-FIXING COSMETIC COMPOSITION

LABORATOIRE GARANCIA, Pa...

1. A makeup fixing cosmetic composition comprising: an association of styrene/acrylates copolymer and Biosaccharide Gum-4;between 0.25% and 20% styrene/acrylates copolymer;
between 0.012% and 0.36% Biosaccharide Gum-4;
between 1% and 10% rice powder;
between 0.05% and 0.5% Buddleja officinalis flower extract;
between 1% and 30% rose water;
between 1% and 30% cornflower water;
between 1% and 30% hammamelis water;
between 1% and 30% sage water;
between 0.1% and 3% perfume or perfumed composition; and
qs distilled water.
US Pat. No. 11,028,414

INOSITOL PREPARATION METHOD

BONUMOSE, INC., Charlott...

1. A method for preparing inositol, comprising:(1) using starch or starch derivative as substrate, adding ?-glucan phosphorylase, phosphoglucomutase, Archaeoglobus fulgidus inositol 3-phosphate synthase and Thermatoga maritime inositol monophosphatase to establish an in vitro multi-enzyme reaction system and perform an enzyme-catalyzed reaction; and
(2) separating and purifying reaction product to obtain inositol, wherein the starch derivative of step (1) is selected from the group consisting of partially hydrolyzed starch, starch dextrin, maltodextrin, malto-oligosaccharide, and maltose,wherein the enzyme-catalyzed reaction is performed at 60-80° C., and is performed in one pot,wherein the multi-enzyme reaction system further comprises starch debranching enzyme, amylase, and one or both of maltose phosphorylase and glucanotransferase,wherein the starch debranching enzyme is one or both of isoamylase and pullulanase,wherein the multi-enzyme reaction system further comprises polyphosphate glucokinase and polyphosphate, wherein the polyphosphate is sodium polyphosphate.
US Pat. No. 11,026,879

DISPERSION OF DROPS OF A FIRST PHASE, DISPERSED IN A SECOND PHASE SUBSTANTIALLY IMMISCIBLE WITH THE FIRST PHASE

CAPSUM, Marseilles (FR)

1. A dispersion of drops of a first phase in a second phase, the solubility of the first phase in the second phase being less than 5% by mass, each drop including a core formed with the first phase and a shell formed with a coacervate layer interposed between the first phase and the second phase,wherein the coacervate layer comprises a first precursor polymer of the coacervate and a second precursor polymer of the coacervate, one of the first phase and of the second phase being aqueous, and the other of the first phase and of the second phase being oily,
wherein one of the first precursor and of the second precursor comprises a lipophilic polymer that is capable of being ionized upon contact with an aqueous phase, and
wherein the other of the first precursor polymer and of the second precursor polymer comprises a hydrophilic polymer capable of being ionized.
US Pat. No. 11,028,159

COMPOSITION AND METHODS FOR TREATING SNAKE ENVENOMATION

VENOMYX, INC., San Diego...

1. A single-domain antibody (sdAb) that binds to snake venom metalloproteinase (SVMP), comprising an amino acid sequence which is at least 70% identical to SEQ ID NOs. 1 or 2.
US Pat. No. 11,028,415

PROCESS FOR THE PRODUCTION OF LIPIDS FROM BIOMASS DERIVED FROM GUAYULE PLANTS

Versalis S.P.A., San Don...

1. A process for the production of lipids from biomass derived from guayule plants comprising:obtaining a hydrolysate comprising 5 carbon atom (C5) sugars from biomass derived from guayule plants, said 5 carbon atom (C5) sugars being present in said hydrolysate in a quantity greater than or equal to 80% by weight, with respect to the total weight of said hydrolysate;
feeding said hydrolysate to a fermentation device in the presence of at least one oleaginous yeast to obtain a fermentation broth;
conducting fermentation of said fermentation broth;
at the end of said fermentation, subjecting said fermentation broth to separation obtaining an aqueous suspension of oleaginous cellular biomass comprising lipids and an aqueous phase.
US Pat. No. 11,026,880

EXTRACT OF PASSIONFLOWER SEEDS AND COSMETIC, PHARMACEUTICAL, DERMATOLOGICAL AND NUTRACEUTICAL COMPOSITIONS COMPRISING SAME

LABORATOIRES EXPANSCIENCE...

1. A cosmetic, dermatological and pharmaceutical composition comprising a peptide and sugar extract of passionflower seeds, as active agent, and a suitable excipient, wherein the peptide and sugar extract is obtained by enzymatic hydrolysis of passionflower seeds, in the presence of at least one acid protease and at least one carbohydrase, wherein the peptide and sugar extract comprises 20% to 70% by weight peptides and 20% to 60% by weight sugars.
US Pat. No. 11,028,160

TREATING REFRACTORY MIGRAINE

Teva Pharmaceuticals Inte...

1. A method of treating or preventing migraine in a subject having refractory migraine, the method comprising:selecting a subject who has been treated with two or more different classes of preventative migraine treatments wherein at least one of the classes of preventative migraine treatments is selected from the group consisting of beta-blockers, anticonvulsants, tricyclics, calcium channel blockers, angiotensin II receptor antagonists, onabotulinumtoxinA, and valproates; and
administering to the subject a therapeutically effective amount of a humanized monoclonal anti-calcitonin gene-related peptide (CGRP) antagonist antibody comprising the amino acid sequence of the heavy chain variable region set forth in SEQ ID NO: 63 and the amino acid sequence of the light chain variable region set forth in SEQ ID NO: 62.
US Pat. No. 11,028,416

ENGINEERED BIOSYNTHETIC PATHWAYS FOR PRODUCTION OF TYRAMINE BY FERMENTATION

ZYMERGEN INC., Emeryvill...

1. An engineered Yarrowia lipolytica or Corynebacterium glutamicum cell, wherein the engineered cell expresses:(a) a heterologous tyrosine decarboxylase (TYDC) having at least 95% amino acid sequence identity to a pyridoxal-dependent decarboxylase (TYDC) from Enterococcus faecium Com15 comprising SEQ ID NO:1; and
(b) a heterologous, 3-deoxy-D-arabino-heptulosonate-7-phosphate (DAHP) synthase having at least 95% amino acid sequence identity to a wild-type phospho-2-dehydro-3-deoxyheptonate aldolase (DAHP synthase) from Saccharomyces cerevisiae S288c comprising SEQ ID NO:9;
wherein, when cultured, the engineered Yarrowia lipolytica or Corynebacterium glutamicum cell produces tyramine at a level greater than 50 mg/L of culture medium.
US Pat. No. 11,026,881

SEDATIVE LACED TOOTHPASTE

1. A method for manufacturing a cannabis laced toothpaste, comprising:1) weighing silicas and mixing into a quart mason jar;
2) weighing essential oils as they are added on top of the silica mixture;
3) weighing glycerin and cannabis and then mixing the glycerin and cannabis together, and then heating to 180° F. in a water bath for thirty minutes until homogeneously mixed;
4) weighing sodium lauryl sulfate and adding the sodium lauryl sulfate to the silicas mixture;
5) weighing sorbitol and adding the sorbitol to the silica mixture;
6) weighing Benzyl Alcohol and adding it to the silica mixture;
7) adding the cannabis glycerin mixture to the silica mixture to form a composition;
8) weighing water, and adding water to the composition;
9) weighing and adding terpenes to the composition;
10) mixing the composition until the composition hydrates; and
11) mixing at an increased speed compared to the prior step for one minute.
US Pat. No. 11,028,161

TREATING REFRACTORY MIGRAINE

Teva Pharmaceuticals Inte...

1. A method of treating or preventing migraine in a subject having refractory migraine, the method comprising:selecting a subject who has been treated with two or more different preventative migraine treatments wherein at least one of the preventative migraine treatments is selected from topiramate, carbamazepine, divalproex sodium, sodium valproate, valproic acid, divalproex, flunarizine, candesartan, pizotifen, amitriptyline, venlafaxine, nortriptyline, duloxetine, atenolol, nadolol, metoprolol, propranolol, bisopropol, timolol, onabotulinumtoxin A, lisinopril, and oxeterone; and
administering to the subject a therapeutically effective amount of a humanized monoclonal anti-calcitonin gene-related peptide (CGRP) antagonist antibody comprising the amino acid sequence of the heavy chain variable region set forth in SEQ ID NO: 63 and the amino acid sequence of the light chain variable region set forth in SEQ ID NO: 62.
US Pat. No. 11,028,417

ISOLATED CODON SEQUENCE

CB THERAPEUTICS, INC., C...

1. An isolated nucleic acid molecule comprising a nucleotide sequence that is at least 95% identical to the nucleotides 5052 to 6671 of SEQ ID NO: 35, wherein the isolated nucleic acid molecule: (i) is non-naturally occurring; (ii) has a nucleotide sequence that is codon-optimized for expression in a host organism and encodes olivetolic acid cyclase (OAC) polypeptide; and (iii) produces olivetolic acid or divarinolic acid in the host organism when inserted and expressed in the host organism, and wherein the host organism is Escherichia coli, Saccharomyces cerevisiae or Pichia pastoris.
US Pat. No. 11,026,882

METHODS AND COMPOSITIONS FOR TREATING MIGRAINE AND CONDITIONS ASSOCIATED WITH PAIN

Achelios Therapeutics, In...

1. A method of treating pain or inflammation associated with a temporomandibular disorder (TMD) in a subject in need thereof, said method comprising topically administering to said subject a sustained release composition comprising from about 0.5% (w/w) to about 5% (w/w) of a therapeutic agent and a dermatologically acceptable excipient, wherein said composition is in an amount effective to treat said temporomandibular disorder (TMD) in said subject; wherein administration of said composition to said subject results in a peak plasma concentration of said therapeutic agent at three hours that is at most about 450 ng/mL; wherein said therapeutic agent is ketoprofen; and wherein said composition comprises from about 20 mg to about 200 mg of ketoprofen in unit dosage form.
US Pat. No. 11,028,162

METHODS FOR MANUFACTURING ACTIVATABLE BINDING POLYPEPTIDES COMPRISING MATRIX METALLOPROTEASE CLEAVABLE MOIETIES

The Regents of the Univer...

1. A method for manufacturing an activatable binding polypeptide (ABP), wherein the ABP comprises a target binding moiety (TBM), a masking moiety (MM), and a cleavable moiety (CM), and wherein the TBM specifically binds to a target protein, wherein the target protein is VEGF-A, the method comprising:a) selecting a MM from a plurality of candidate polypeptides, wherein the selected MM inhibits binding of the TBM to its target protein, and wherein the selected MM does not have an amino acid sequence of a naturally occurring binding partner of the TBM; and
b) constructing the ABP comprising the following structure MM-CM-TBM or TBM-CM-MM, comprising synthesizing a polypeptide construct that includes the ABP,
wherein the VL of the TBM comprises the complementarity determining regions (CDRs) of the VL domain of SEQ ID NO: 30 and the VH of the TBM comprises the complementarity determining regions (CDRs) of the VH domain of SEQ ID NO: 30,
wherein the MM is positioned in the ABP such that it is capable of binding the TBM and is capable of inhibiting binding of the TBM to the target protein when the ABP is in an uncleaved state, and
wherein the CM is a substrate for a protease, wherein the CM is a matrix metalloprotease (MMP) substrate, wherein the MMP substrate is a matrix metalloprotease 1 (MMP-1) substrate, a matrix metalloprotease 2 (MMP-2) substrate, a matrix metalloprotease 9 (MMP-9) substrate, or a matrix metalloprotease 14 (MMP-14) substrate, and wherein said CM is positioned in the ABP such that in a cleaved state in the presence of the target protein, the TBM binds the target protein, and in an uncleaved state in the presence of the target protein, binding of the TBM to the target protein is inhibited by the MM.
US Pat. No. 11,028,418

MICROORGANISMS AND METHODS FOR PRODUCING 2-PYRONE-4,6-DICARBOXYLIC ACID AND OTHER COMPOUNDS

WISCONSIN ALUMNI RESEARCH...

1. A recombinant microorganism comprising modifications with respect to a corresponding native microorganism not comprising the modifications, wherein the recombinant microorganism is a bacterium capable of producing 2-pyrone-4,6-dicarboxylic acid, wherein the recombinant microorganism is Novosphingobium aromaticivorans, wherein the modifications comprise:a first modification, wherein the first modification comprises a mutation of a native 2-pyrone-4,6-dicarboxylic acid (PDC) hydrolase gene present in the corresponding native microorganism, wherein the first modification reduces PDC hydrolase activity in the recombinant microorganism with respect to the corresponding native microorganism;
a second modification, wherein the second modification comprises a mutation of a native 4-carboxy-2-hydroxy-6-methoxy-6-oxohexa-2,4-dienoate (CHMOD) cis-trans isomerase gene present in the corresponding native microorganism, wherein the second modification reduces CHMOD cis-trans isomerase activity in the recombinant microorganism with respect to the corresponding native microorganism; and
a third modification, wherein the third modification comprises a mutation of a native 4-carboxy-2-hydroxy-6-methoxy-6-oxohexa-2,4-dienoate (CHMOD) methyl esterase gene present in the corresponding native microorganism, wherein the third modification reduces CHMOD methyl esterase activity in the recombinant microorganism with respect to the corresponding native microorganism.
US Pat. No. 11,028,163

HEAVY CHAIN ONLY ANTIBODIES TO PDGF

ALLERGAN, INC., Irvine, ...

1. A method of treating an ophthalmologic disorder comprising administering to a subject in need thereof a heavy-chain only antibody (HCAb) comprising homodimeric variable heavy chain (VH) regions wherein each VH region comprises:a CDR1 having the amino acid sequence of SEQ ID NO:23;
a CDR2 having the amino acid sequence of SEQ ID NO:24; and
a CDR3 having the amino acid sequence of SEQ ID NO:25;
wherein the HCAb retains its specificity for PDGF-BB; and
wherein the HCAB binds to PDGF-BB and treats the ophthalmologic disorder, and wherein the ophthalmologic disorder is selected from the group consisting of dry age-related macular degeneration, wet age-related macular degeneration, choroidal neovascularization (CNV), cystoid macula edema (CME), myopia-associated choroidal neovascularization, vascular streaks, diabetic macular edema (DME), macular edema, retinal vein occlusion, abnormal corneal angiogenesis, pterygium conjunctivae, subretinal edema, or intraretinal edema.
US Pat. No. 11,028,419

BIOSYNTHESIS OF HUMAN MILK OLIGOSACCHARIDES IN ENGINEERED BACTERIA

Glycosyn LLC, Waltham, M...

1. A method for producing a fucosylated oligosaccharide in an E.coli bacterium, comprising(a) providing an E.coli bacterium comprising a ?-galactosidase activity between 0.05 and 5 units and a mutation in a lacA gene, wherein said E.coli bacterium further comprises an exogenous lactose-accepting fucosyltransferase gene;
(b) culturing said E.coli bacterium in the presence of lactose; and
(c) retrieving a fucosylated oligosaccharide from said E.coli bacterium or from a culture supernatant of said E.coli bacterium,
wherein a functional ?-galactosidase gene is inserted into an endogenous gene of said E. coli bacterium.
US Pat. No. 11,026,884

METHODS FOR IMPROVING VISION

Eye Therapies LLC, Dana ...

1. A method of improving night vision comprising administering to an eye of subject in need thereof a composition comprising from about 0.025% to about 0.050% w/v brimonidine, from about 1% to about 5% w/v of polysorbate, mannitol at about 0.1-2.0%, hydroxypropyl methyl cellulose (HPMC) at about 0.10-1.20%, NaCl at about 0.4%, BAK at about 0.01%, and boric acid at about 5 mM wherein w/v denotes weight by total volume of the composition and wherein the composition has a pH of about 7.5, wherein the improvement of night vision occurs for at least four weeks without tachyphylaxis.
US Pat. No. 11,028,164

ANTI-CXCL13 ANTIBODIES

I-Mab Biopharma US Limite...

1. An antibody or fragment thereof having specificity to a human chemokine (C-X-C motif) ligand 13 (CXCL13) protein, wherein the antibody or fragment thereof comprises a heavy chain variable region comprising heavy chain complementarity determining regions HCDR1, HCDR2, and HCDR3, and a light chain variable region comprising light chain complementarity determining regions LCDR1, LCDR2, and LCDR3, wherein:the HCDR1 comprises the amino acid sequence of SEQ ID NO: 127 (RYWMS);
the HCDR2 comprises the amino acid sequence of SEQ ID NO: 128 (EINPDSSTINY APSLKD);
the HCDR3 comprises the amino acid sequence of SEQ ID NO: 130 (QDDYEYYAMDY);
the LCDR1 comprises the amino acid sequence of SEQ ID NO: 131 (KASQDVNTGVA);
the LCDR2 comprises the amino acid sequence of SEQ ID NO: 132 (SASYRYT);
and the LCDR3 comprises the amino acid sequence of SEQ ID NO: 133 (QQYYSTPLT), or
the HCDR1 comprises the amino acid sequence of SEQ ID NO: 127 (RYWMS);
the HCDR2 comprises the amino acid sequence of SEQ ID NO: 129 (EINPESSTINYAPSLKD);
the HCDR3 comprises the amino acid sequence of SEQ ID NO: 130 (QDDYEYYAMDY);
the LCDR1 comprises the amino acid sequence of SEQ ID NO: 131 (KASQDVNTGVA);
the LCDR2 comprises the amino acid sequence of SEQ ID NO: 132 (SASYRYT);
and the LCDR3 comprises the amino acid sequence of SEQ ID NO: 133 (QQYYSTPLT), or
the HCDR1 comprises the amino acid sequence of SEQ ID NO: 127 (RYWMS);
the HCDR2 comprises the amino acid sequence of SEQ ID NO: 129 (EINPESSTINYAPSLKD);
the HCDR3 comprises the amino acid sequence of SEQ ID NO: 359 (QDDYEYYTMDY);
the LCDR1 comprises the amino acid sequence of SEQ ID NO: 360 (KVSQDVNTGVA),
The LCDR2 comprises the amino acid sequence of SEQ ID NO: 132 (SASYRYT);
the LCDR3 comprises the amino acid sequence of SEQ ID NO: 361 (QQYWSTPLT), or
the HCDR1 comprises the amino acid sequence of SEQ ID NO: 127 (RYWMS);
the HCDR2 comprises the amino acid sequence of SEQ ID NO: 129 (EINPESSTINYAPSLKD);
the HCDR3 comprises the amino acid sequence of SEQ ID NO: 359 (QDDYEYYTMDY);
the LCDR1 comprises the amino acid sequence of SEQ ID NO: 360 (KVSQDVNTGVA),
the LCDR2 comprises the amino acid sequence of SEQ ID NO: 132 (SASYRYT);
and the LCDR3 comprises the amino acid sequence of SEQ ID NO: 133 (QQYYSTPLT), or
the HCDR1 comprises the amino acid sequence of SEQ ID NO: 127 (RYWMS);
the HCDR2 comprises the amino acid sequence of SEQ ID NO: 129 (EINPESSTINYAPSLKD);
the HCDR3 comprises the amino acid sequence of SEQ ID NO: 367 (QDDYETYTMDY),
the LCDR1 comprises the amino acid sequence of SEQ ID NO: 360 (KVSQDVNTGVA),
the LCDR2 comprises the amino acid sequence of SEQ ID NO: 132 (SASYRYT); and the LCDR3 comprises the amino acid sequence of SEQ ID NO: 133 (QQYYSTPLT).
US Pat. No. 11,028,420

METHOD FOR PRODUCING D-PSICOSE FROM D-PSICOSE BORATE COMPLEX USING CHROMATOGRAPHY AND COMPOSITION CONTAINING D-PSICOSE

CJ CHEILJEDANG CORPORATIO...

1. A method for producing D-psicose, the method comprising:a step of putting a composition comprising a D-psicose borate complex into a chromatography comprising divalent cations; and
a step of separating the composition comprising the D-psicose borate complex into a D-psicose-containing fraction (i) and a borate-containing fraction (ii); and
wherein the chromatography is a simulated moving bed chromatography.
US Pat. No. 11,028,165

NUCLEIC ACID ENCODING ANTI-GM-CSF ANTIBODIES

MORPHOSYS AG, Martinsrie...

1. An isolated nucleic acid sequence that encodes a Granulocyte-macrophage colony stimulating factor (GM-CSF) binding protein, wherein the GM-CSF binding protein is specific for human GM-CSF, and wherein the GM-CSF binding protein comprises:(a) a VH region comprising a sequence at least 95% identical to the sequence of SEQ ID NO:20; and/or
(b) a VL region comprising a sequence at least 95% identical to the sequence of SEQ ID NO:40.
US Pat. No. 11,028,421

RECOMBINANT PSEUDOMONAS PLECOGLOSSICIDA FOR PRODUCING L-XYLOSE AND APPLICATION THEREOF

LINKCHEM CO. LTD., Shang...

1. A recombinant strain for producing L-xylose, comprising nucleic acid sequences for expressing a 2-ketogluconate dehydrogenase gene, a 2,5-diketogluconate reductase gene, and a pyruvate decarboxylase gene, wherein the recombinant strain uses Pseudomonas plecoglossicida as a host strain, wherein the 2-ketogluconate dehydrogenase gene comprises nucleic acid sequences for three subunits, which are set forth in SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, respectively, wherein the 2,5-diketogluconate reductase gene is from Corynebaterium ATCC 31090, and wherein the pyruvate decarboxylase gene is from Saccharomyces cerevisiae.
US Pat. No. 11,026,886

BLEND COMPOSITIONS FOR ORAL ADMINISTRATION AS A RAPIDLY DISSOLVING POWDER AND/OR SUSPENSION

Marenda Pharmaceuticals L...

1. A free flowing dry powder oral formulation suitable for administration in each of an aqueous solution, aqueous dispersion, tablet, and powder dosage form,wherein the formulation comprises an active pharmaceutical ingredient (API) in an amount from about 3% w/w to about 15% w/w, a surfactant or emulsifier in an amount from 0.1% w/w to 1% w/w, a galactomannan in an amount from about 0.05% w/w to about 0.5% w/w, one or more sweetening agents in an amount up to about 1.0% w/w, one or more diluents in an amount up to about 90% w/w, one or more flavoring agents in an amount from about 0.5% w/w to about 5% w/w and an organic acid in an amount from about 0.05% w/w to about 0.5% w/w, in a pharmaceutically acceptable preparation.
US Pat. No. 11,028,166

ALBUMIN BINDING DOMAIN FUSION PROTEINS

SONNET BIO THERAPEUTICS, ...

1. A composition comprising an albumin binding domain (ABD), said ABD comprising:a) a variable heavy chain comprising a vhCDR1, a vhCDR2 and a vhCDR3 of a variable heavy chain having SEQ ID NO: 25; and
b) a variable light chain comprising a vlCDR1, a vlCDR2 and a vlCDR3 of a variable light chain having SEQ ID NO: 29.
US Pat. No. 11,028,422

PROCESS FOR THE PRODUCTION OF ULTRAPURE GALACTO-OLIGOSACCHARIDES

Ritter Pharmaceuticals, I...

1. A method of purifying a galactooligosaccharides (GOS) composition with a purity ?95% in which an overall percentage of the digestible sugars lactose, glucose and galactose is ?5%, comprising providing a GOS mixture of a lower purity and subjecting the GOS mixture to at least one fermentation step with Streptococcus thermophilus and at least one fermentation step with Saccharomyces cerevisiae, where said purity is calculated by any analytical method able to distinguish and quantify GOS and said digestible sugars.
US Pat. No. 11,026,887

METHODS OF TREATING EOSINOPHILIC ESOPHAGITIS

ELLODI PHARMACEUTICALS, L...

1. A method of topically treating eosinophilic esophagitis (EoE) in a patient in need thereof with an oral corticosteroid, comprising:a. administering the oral corticosteroid while the patient is lying down or immediately prior to the patient lying down,
wherein a therapeutically effective amount of the oral corticosteroid contacts the esophagus, thereby topically treating EoE.
US Pat. No. 11,028,167

ANTI-SARS-COV-2 ANTIBODIES DERIVED FROM 3BGF

Centivax, Inc., South Sa...

1. An antibody or an antigen-binding fragment that selectively binds to a severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), that comprises a variable heavy chain (VH) complementarity determining region 1 (CDR1) having an amino acid sequence of SEQ ID NO: 76; a VH CDR2 having an amino acid sequence of SEQ ID NO: 102; a VH CDR3 having an amino acid sequence of SEQ ID NO: 130; a variable light chain (VL) CDR1 having an amino acid sequence of SEQ ID NO: 13; a VL CDR2 having an amino acid sequence of SEQ ID NO: 31; and a VL CDR3 having an amino acid sequence of SEQ ID NO: 48.
US Pat. No. 11,028,423

HEAT TREATMENT TO PRODUCE GLYCOSIDES

CARGILL, INCORPORATED, W...

1. A method of releasing steviol glycosides from a yeast host cell, comprising the steps of:(a) providing a composition, comprising the host cell producing one or more steviol glycosides; and
(b) releasing the one or more steviol glycosides from the host cell by heating the composition to a temperature in a range from 50° C. to 95° C. for 5 minutes to 48 hours, wherein the one or more steviol glycosides are released from an intracellular portion of the host cell into an extracellular portion of the composition.
US Pat. No. 11,026,888

FUNCTIONAL BEVERAGE COMPOSITIONS AND METHODS OF USING AND MAKING SAME

NUTRITION THERAPEUTICS, I...

1. An emulsion consisting essentially of water, pomegranate seed oil, dissolved carbon dioxide, lecithin, and hemp oil, wherein the hemp oil and the pomegranate seed oil are stably suspended within the water.
US Pat. No. 11,028,168

USE OF A CD6 BINDING PARTNER AND METHOD BASED THEREON

BIOCON LIMITED, Bangalor...

1. A method of treatment for an autoimmune disease in a subject, wherein the autoimmune disease is an Inflammatory Bowel Disease, the method comprising administering to the subject a binding partner that specifically binds to CD6, wherein the binding partner is a humanized antibody Itolizumab or a functional fragment thereof that specifically binds to D1 of CD6; and wherein the subject has an increased number of T helper 17 (Th17) cells when compared to a healthy subject.
US Pat. No. 11,028,169

ANTIBODY MOLECULES FOR CANCER TREATMENT

Boehringer Ingelheim Inte...

1. An anti-PD1 antibody molecule comprising a heavy chain variable domain comprising heavy chain CDRs comprising the amino acid sequence of SEQ ID NO:13 (hcCDR1), SEQ ID NO:14 (hcCDR2) and SEQ ID NO:15 (hcCDR3) and a light chain variable domain comprising light chain CDRs comprising the amino acid sequence of SEQ ID NO:16 (lcCDR1), SEQ ID NO:17 (lcCDR2) and SEQ ID NO:18 (lcCDR3).
US Pat. No. 11,028,425

DIAGNOSIS AND MONITORING OF LIVER DISEASE

GLYMPSE BIO, INC., Cambr...

1. A method for characterizing liver disease, the method comprising:detecting, in a sample from a subject, a quantity of each of a plurality of distinct reporters that are released from activity sensors, wherein different members of the plurality of reporters are released by proteases that are differentially active in diseased liver tissue versus healthy liver tissue, the proteases comprising at least 4 different proteases selected from the group consisting of FAP, MMP2, ADAMTS2, FURIN, MMP14, GZMB, PRSS8, MMP8, ADAM 12, CTSS, CTSA, CTSZ, CASP1, ADAMTS12, CTSD, CTSW, MMP11, MMP12, GZMA, MMP23B, MMP7, ST14, MMP9, MMP15, ADAMDEC1, ADAMTS1, GZMK, KLK11, MMP19, PAPPA, CTSE, PCSK5, and PLAU;
determining and classifying that the subject has nonalcoholic steatohepatitis (NASH) at one of stages NASH F1, NASH F2, NASH F3, or NASH F4, based upon relative quantities of the detected reporters, thereby characterizing the disease.
US Pat. No. 11,026,890

OIL-IN-WATER EMULSIONS THAT CONTAIN NUCLEIC ACIDS

GlaxoSmithKline Biologica...

1. An immunogenic cationic oil-in-water emulsion comprising emulsion particles that contain an oil core and a cationic lipid, and a nucleic acid molecule that is complexed to the emulsion particles, wherein:a) the nucleic acid is RNA that encodes a tumor antigen,
b) the average diameter of the emulsion particles is from about 80 nm to about 180 nm, and
c) the N/P of the emulsion is at least 4:1;with the proviso that the nucleic acid molecule does not encode secreted alkaline phosphatase, and the further proviso that the nucleic acid molecule is not the RNA encoded by the plasmid A317, the sequence of which is given by SEQ ID NO:1.
US Pat. No. 11,028,170

INHIBITORS OF T-CELL ACTIVATION

GENZYME CORPORATION, Cam...

1. A method of tolerizing a T-cell to an antigen, comprising contacting said T-cell with an antigen-presenting cell which is presenting a peptide derived from said antigen complexed to a MHC molecule and a bispecific fusion protein comprising a ligand specific for CTLA-4 and a ligand specific for a peptide-MHC class II (pMHCII) complex, wherein the T-cell expresses a T-cell receptor (TCR) and cell surface CTLA-4, and the ligand specific for CTLA-4 is selected from the group consisting of CD80 (B7-1), CD86 (B7-2), and mutants thereof with greater binding avidity for CTLA-4 than CD28, thereby crosslinking CTLA-4 to the pMHCII complex and the TCR.
US Pat. No. 11,028,426

NUCLEIC ACID SEQUENCE AMPLIFICATION METHOD

KYOTO UNIVERSITY, Kyoto ...

1. A method of preparing a nucleic acid population comprising an amplification product maintaining a relative relationship of gene expression level in a biological sample, which method comprising(a) a step of amplifying a double-stranded DNA comprising a sense strand and an antisense strand, wherein the double-stranded DNA is constituted of (1) any additional nucleic acid sequence X, (2) poly T sequence, (3) cDNA sequence prepared using mRNA sequence isolated from a biological sample as a template, (4) poly A sequence and (5) any additional nucleic acid sequence Yin this order in the orientation from 5? to 3? of the sense strand by using the double-stranded DNA as a template, a first primer comprising any additional nucleic acid sequence X having amine added to the 5?-terminus, and optionally further comprising a poly T sequence at the downstream thereof, and a second primer comprising any additional nucleic acid sequence Y, and optionally further comprising a poly T sequence at the downstream thereof, wherein the additional nucleic acid sequence X is different from the additional nucleic acid sequence Y, such that the first primer cannot hybridize to the 3?-terminus of the sense strand of the double-stranded DNA,
(b) a step of fragmenting the double-stranded DNA obtained in step (a),
(c) a step of phosphorylating the 5?-termini of the fragmented double-stranded DNA obtained in step (b),
(d) a step of preparing cDNA by using the double-stranded DNA obtained in step (c) and having a phosphorylated 5?-termini as a template, and a third primer comprising any additional nucleic acid sequence Z and said additional nucleic acid sequence Y in this order, and optionally further comprising a poly T sequence at the downstream thereof, and adding adenine (A) to the 3?-termini of the cDNA,
(e) a step of linking a double-stranded DNA containing any sequence V having 3?-overhang thymine (T) to the double-stranded DNA obtained in step (d), and
(f) a step of amplifying the double-stranded DNA by using the double-stranded DNA obtained in step (e) as a template, a fourth primer comprising the sequence V, and a fifth primer comprising the additional nucleic acid sequence Z, and optionally further comprising the additional nucleic acid sequence Y downstream thereof,
thereby selectively amplifying a fragment of the double stranded DNA comprising the 3?-terminus of the sense strand of the cDNA generated in step (b).
US Pat. No. 11,028,171

BISPECIFIC ANTIBODY CONSTRUCTS FOR CDH3 AND CD3

AMGEN RESEARCH (MUNICH) G...

1. A bispecific single chain antibody construct comprising a first human binding domain which binds to an epitope cluster of human CDH3 and macaque CDH3 on the surface of a target cell; anda second binding domain which binds to human CD3 on the surface of a T cell,
wherein the epitope cluster of human CDH3 is comprised within amino acid positions 291-363 (SEQ ID NO: 36) of human CDH3, and
wherein the first binding domain comprises a VH region and a VL region selected from the group consisting of:
a) a VH region comprising a CDR-H1 as depicted in SEQ ID NO: 169, a CDR-H2 as depicted in SEQ ID NO: 170, and a CDR-H3 as depicted in SEQ ID NO: 171, and a VL region comprising a CDR-L1 as depicted in SEQ ID NO: 172, a CDR-L2 as depicted in SEQ ID NO: 173, and a CDR-L3 as depicted in SEQ ID NO: 174;
b) a VH region comprising a CDR-H1 as depicted in SEQ ID NO: 279, a CDR-H2 as depicted in SEQ ID NO: 280, and a CDR-H3 as depicted in SEQ ID NO: 281, and a VL region comprising a CDR-L1 as depicted in SEQ ID NO: 282, a CDR-L2 as depicted in SEQ ID NO: 283, and a CDR-L3 as depicted in SEQ ID NO: 284;
c) a VH region comprising a CDR-H1 as depicted in SEQ ID NO: 289, a CDR-H2 as depicted in SEQ ID NO: 290, and a CDR-H3 as depicted in SEQ ID NO: 291, and a VL region comprising a CDR-L1 as depicted in SEQ ID NO: 292, a CDR-L2 as depicted in SEQ ID NO: 293, and a CDR-L3 as depicted in SEQ ID NO: 294;
d) a VH region comprising a CDR-H1 as depicted in SEQ ID NO: 299, a CDR-H2 as depicted in SEQ ID NO: 300, and a CDR-H3 as depicted in SEQ ID NO: 301, and a VL region comprising a CDR-L1 as depicted in SEQ ID NO: 302, a CDR-L2 as depicted in SEQ ID NO: 303, and a CDR-L3 as depicted in SEQ ID NO: 304;
e) a VH region comprising a CDR-H1 as depicted in SEQ ID NO: 309, a CDR-H2 as depicted in SEQ ID NO: 310, and a CDR-H3 as depicted in SEQ ID NO: 311, and a VL region comprising a CDR-L1 as depicted in SEQ ID NO: 312, a CDR-L2 as depicted in SEQ ID NO: 313, and a CDR-L3 as depicted in SEQ ID NO: 314.
US Pat. No. 11,028,427

SYSTEMS AND METHODS FOR PROTEOMIC ACTIVITY ANALYSIS USING DNA-ENCODED PROBES

Purdue Research Foundatio...

1. A method for detecting proteomic activity in a sample comprising active proteins, the method comprising the steps of:providing a population of probes, each of the probes comprising a substrate linked to a DNA construct, the DNA construct comprising one or more amplifiable identification barcode regions, wherein at least one of the barcode regions of the double-stranded DNA is unique;
contacting the population of probes with the sample comprising active proteins in an initial pool and under conditions and for a sufficient time to allow said protein to turnover via chemical transformation of the substrate of a probe into a product wherein the protein comprises a farnesyltransferase, a protein kinase, or a protease;
quenching protein activity within the initial pool;
combining the probes from multiple samples into an initial pool;
separating the DNA probe constructs of the initial pool that are linked to the product or that are linked to the protein to form a purified pool, wherein the separating is performed by selectively linking a tag to said probes, wherein the tag is appended utilizing chemical or biochemical steps that selectively modify product molecules, but not substrate molecules, or wherein the tag is appended using chemical or biochemical steps that selectively modify substrate molecules, but not product molecules, and wherein the tag comprises a moiety for selective affinity purification;
quantifying the DNA constructs of the initial pool and the DNA constructs of the purified pool by quantitative PCR, parallel DNA sequencing or high-throughput DNA sequencing; and
detecting the presence or absence of a detectable signal in the quantified DNA constructs, the detectable signal comprising identifying a change in probe frequency between the initial pool and the purified pool.
US Pat. No. 11,028,172

ANTI-TIGIT ANTIBODIES AND USES THEREOF

Lepu Biopharma Co., Ltd.,...

1. An antibody or antigen-binding fragment thereof, wherein the antibody or fragment thereof has specificity to a T cell immunoreceptor with Ig and ITIM domains (TIGIT) protein and comprises a heavy chain variable region (VH) comprising a VH CDR1 comprising the amino acid sequence of SEQ ID NO:1, a VH CDR2 comprising the amino acid sequence of SEQ ID NO:2, and a VH CDR3 comprising the amino acid sequence of SEQ ID NO:3, and a light chain variable region (VL) comprising a VL CDR1 comprising the amino acid sequence of SEQ ID NO:4, a VL CDR2 comprising the amino acid sequence of SEQ ID NO:5, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO:6.
US Pat. No. 11,028,428

PEPTIDE NUCLEIC ACID PROBE FOR MULTIPLEX DETECTION OF BCR/ABL NEGATIVE MYELOPROLIFERATIVE NEOPLASM-ASSOCIATED GENE MUTATIONS

THE CATHOLIC UNIVERSITY O...

1. A kit for multiplex detection of a BCR/ABL negative myeloproliferative neoplasm-associated gene mutation, comprisinga set of peptide nucleic acid (PNA) probes, wherein each probe consists of the sequences of
SEQ ID NO: 7 binding to a mutation region of a Janus Tyrosine Kinase 2 (JAK2) gene;
SEQ ID NO: 8 binding to a mutation region of a Mythroproliferative leukemia protein (MPL) gene;
SEQ ID NO: 9 binding to a deletion region of a Calreticulin (CALR) Gene; and
SEQ ID NO: 10 binding to an insertion region of the CALR Gene; respectively, wherein the peptide nucleic acid probe optionally contains a reporter molecule and a quencher molecule at each end of the probe, and
a set of amplification forward and reverse primers comprising the sequences of SEQ ID NOS: 1 to 6, wherein each primer complementarily binds to a BCR/ABL negative myeloproliferative neoplasm-associated gene to specifically amplify a region of a mutation site, and
wherein the BCR/ABL negative myeloproliferative neoplasm-associated gene mutation comprises one or more selected from the group consisting of (i) a substitution of valine at position 617 of the JAK2 gene with phenylalanine (JAK2 V617F), (ii) a substitution of tryptophan at position 515 of the MPL gene with leucine (MPL W515L), (iii) a substitution of tryptophan at position 515 of the MPL gene with lysine (MPL W515K), (iv) a substitution of tryptophan at position 515 of the MPL gene with arginine (MPL W515R), (v) a substitution of tryptophan at position 515 of the MPL gene with alanine (MPL W515A), (vi) a substitution of tryptophan at position 515 of the MPL gene with serine (MPL W515S), (vii) a c.1092_1143del52 base deletion of the CALR gene (L367fs*46) and (viii) a c.1154_1155insTTGTC base insertion of the CALR gene (K385fs*47).
US Pat. No. 11,026,381

METHOD FOR PRODUCING HAPLOID, DIHAPLOID AND DOUBLED HAPLOID PLANTS BY ISOLATED MICROSPORE CULTURE

1. A method for producing haploid, dihaploid, polyhaploid and/or doubled haploid plants of the family Cucurbitaceae from isolated microspores, wherein said method comprises:a) culturing isolated microspores to obtain embryos competent for plant regeneration, wherein the microspores have been isolated from plant material of a donor plant of the family Cucurbitaceae; and
b) regenerating plants from the embryos;
wherein step (a) comprises contacting the microspores with one or more inhibitor of histone deacetylase (HDACi) and one or more aliphatic polyamine.
US Pat. No. 11,026,893

TASTE MASKING DRUG FORMULATIONS

Adare Pharmaceuticals USA...

1. A method for producing a microcapsule comprising the following steps:(1) dissolving an active pharmaceutical ingredient in ethanol to produce an active pharmaceutical ingredient-ethanol mixture;
(2) co-melting the active pharmaceutical ingredient-ethanol mixture with a hydrophilic excipient to provide a core dispersion;
(3) melting a pH-responsive material and a hydrophobic material comprising a wax or lipid to form a shell mixture which comprises about 1% to 25% by weight of the pH-responsive material in a hydrophobic matrix; and
(4) applying the core dispersion through a central portion of a nozzle and simultaneously applying the shell mixture through an annular portion of the nozzle surrounding the central portion in the presence of vibrational excitation thereby forming the microcapsule, wherein the microcapsule comprises a core portion and a shell portion.
US Pat. No. 11,028,173

ANTI-PD-1 ANTIBODIES

Shanghai Henlius Biotech,...

1. An anti-PD-1 antibody comprising an amino acid sequence selected from the group consisting of:(a) a light chain variable domain (VL) sequence comprising (1) a CDR-L1 comprising the amino acid sequence KASQDVTTAVA (SEQ ID NO:9); (2) a CDR-L2 comprising the amino acid sequence WASTRHT (SEQ ID NO:10); and (3) a CDR-L3 comprising the amino acid sequence QQHYTIPWT (SEQ ID NO:11), and a heavy chain variable domain (VH) sequence comprising: (1) a CDR-H1 comprising the amino acid sequence FTFSNYGMS (SEQ ID NO:12); (2) a CDR-H2 comprising the amino acid sequence TISGGGSNIY (SEQ ID NO:13); and (3) a CDR-H3 comprising the amino acid sequence VSYYYGIDF (SEQ ID NO:14);
(b) a light chain variable domain (VL) sequence comprising (1) a CDR-L1 comprising the amino acid sequence KASTDVTTAVA (SEQ ID NO:15); (2) a CDR-L2 comprising the amino acid sequence WASLRHT (SEQ ID NO:16); and (3) a CDR-L3 comprising the amino acid sequence QQHYGIPWT (SEQ ID NO:17), and a heavy chain variable domain (VH) sequence comprising (1) a CDR-H1 comprising the amino acid sequence FRFSNYGMS (SEQ ID NO:18); (2) a CDR-H2 comprising the amino acid sequence TISGGGSNAY (SEQ ID NO:19); and (3) a CDR-H3 comprising the amino acid sequence TSYYYGIDF (SEQ ID NO:20);
(c) a light chain variable domain (VL) sequence comprising (1) a CDR-L1 comprising the amino acid sequence KAKQDVTTAVA (SEQ ID NO:21); (2) a CDR-L2 comprising the amino acid sequence WASTRHT (SEQ ID NO:10); and (3) a CDR-L3 comprising the amino acid sequence QQHYWIPWT (SEQ ID NO:22), and a heavy chain variable (VH) domain sequence comprising (1) a CDR-H1 comprising the amino acid sequence FTFSNYGMS (SEQ ID NO:12); (2) a CDR-H2 comprising the amino acid sequence TISGGGSNIY (SEQ ID NO:13); and (3) a CDR-H3 comprising the amino acid sequence VSYYYGIDL (SEQ ID NO:23); and
(d) a light chain variable domain (VL) sequence comprising (1) a CDR-L1 comprising the amino acid sequence KASQDVTNAVA (SEQ ID NO:24); (2) a CDR-L2 comprising the amino acid sequence WASTRHT (SEQ ID NO:10); and (3) a CDR-L3 comprising the amino acid sequence QQHYTIPWT (SEQ ID NO:11), and a heavy chain variable domain (VH) sequence comprising (1) a CDR-H1 comprising the amino acid sequence FTFSNYGMS (SEQ ID NO:12); (2) a CDR-H2 comprising the amino acid sequence TISGGGSNIY (SEQ ID NO:13); and (3) a CDR-H3 comprising the amino acid sequence SSYYYGIDL (SEQ ID NO:25).
US Pat. No. 11,026,382

PRODUCING METHOD OF CANNABIS SATIVA L. SEED

FAMENITY CO., LTD., Gwac...

1. A method for producing Cannabis sativa L. seed capable of cultivating Cannabis female plants, the method comprising:spraying a first fertilizer composition on soil before sowing Cannabis sativa L. seeds;
sowing Cannabis sativa L. seeds after tilling and preparing the soil on which the first fertilizer composition is sprayed;
inducing the formation of budding flowers by providing Cannabis sativa L. germinated from the Cannabis sativa L. seeds with light, wherein the light is provided under a photosynthetic photon flux density (PPFD) condition of 15 to 20 ?Mm?2s?1 for 5 to 16 hours for 15 to 30 days: and then providing light under a photosynthetic photon flux density (PFFD) condition of 30 to 40 ?Mm?2s?1 for 5 to 16 hours for 15 to 30 days;
inducing the formation of male budding flowers in Cannabis female plants by removing all Cannabis sativa L. male plants and retaining female plants where male budding flowers are formed by spraying a second fertilizer composition on Cannabis sativa L. female plants;
after the second fertilizer composition was sprayed the light is provided under a photosynthetic photon flux density (PPFD) condition of 10 ?Mm?2s?1 for 10 to 12 hours and;
producing seeds by fertilizing pollen in the male budding flowers formed in the Cannabis female plants with female flowers.
US Pat. No. 11,028,174

BIFUNCTIONAL MOLECULES TARGETING PD-L1 AND TGF-?

Lepu Biopharma Co., Ltd.,...

1. A multifunctional molecule, comprising an anti-PD-L1 (programmed death-ligand 1) antibody or fragment thereof and an extracellular domain of human TGF-? RII (TGF-beta receptor type-2),wherein the anti-PD-L1 antibody or fragment thereof has specificity to the human PD-L1 protein and comprises a heavy chain variable region (VH) comprising a VH CDR1, a VH CDR2 and a VH CDR3, and a light chain variable region (VL) comprising a VL CDR1, a VL CDR2, and a VL CDR3,
wherein the VH CDR1, VH CDR2, VH CDR3, VL CDR1, VL CDR2, and VL CDR3, respectively, comprise the amino acid sequences of
SEQ ID NO:13-18,
wherein the human TGF-? RII extracellular domain comprises the amino acid sequence of SEQ ID NO:72 and is fused to the anti-PD-L1 antibody or fragment thereof.
US Pat. No. 11,028,430

METHODS FOR CREATING DIRECTIONAL BISULFITE-CONVERTED NUCLEIC ACID LIBRARIES FOR NEXT GENERATION SEQUENCING

NUGEN TECHNOLOGIES, INC.,...

1. A method for generating a nucleic acid library, the method comprising:a) fragmenting double-stranded DNA, thereby generating a double-stranded DNA fragment;
b) performing end repair on the double-stranded DNA fragment, thereby generating an end repaired double-stranded DNA fragment;
c) ligating a first strand of a first adapter duplex to a first 5? end of the end repaired double-stranded DNA fragment, wherein a second strand of the first adapter duplex is incapable of ligation to a 3? end of the end-repaired double-stranded DNA fragment, and ligating a first strand of a second adapter duplex to a second 5? end of the double-stranded DNA fragment, wherein the first adapter duplex and the second adapter duplex have the same sequence, wherein the first strand of each adapter comprises a guanine, thereby generating an adapter-ligated double-stranded DNA fragment;
d) extending 3? ends of the adapter-ligated double-stranded DNA fragment with a DNA polymerase in a presence of a dCTP analog resistant to bisulfite treatment thereby generating a double-stranded DNA extension product comprising 3? ends comprising the dCTP analog and wherein the 3? ends are complementary to the first strands of the first adapter duplex and wherein the dCTP analog is complementary to the guanine in the first strand of the adapter;
e) denaturing the double-stranded DNA extension product, thereby creating a single-stranded DNA fragment comprising the first strand of the first adapter duplex ligated to a first 5? end and a 3? end comprising the dCTP analog;
f) subjecting the single-stranded DNA fragment to bisulfite treatment, wherein the bisulfite treatment converts cytosine residues to uracils in the first strand of the first adapter duplex of the single-stranded DNA fragment, thereby generating a bisulfite treated single-stranded DNA fragment comprising the first strand of the first adapter duplex comprising the uracils and the 3? end comprising the dCTP analog;
g) extending a first oligonucleotide primer annealed to the bisulfite treated single-stranded DNA fragment wherein the first oligonucleotide primer is annealed to the 3? end comprising the dCTP analog and wherein a guanine in the first oligonucleotide primer hybridizes with the dCTP analog in the 3? end of the single-stranded DNA fragment, thereby generating a first extension product comprising sequence complementary to the first strand of the first adapter duplex comprising the uracils;
h) extending a second oligonucleotide primer annealed to the first extension product, wherein the second oligonucleotide primer is annealed to the sequence complementary to the first strand of the first adapter duplex comprising the uracils, wherein the second oligonucleotide primer has the same sequence as the first oligonucleotide primer except that the second oligonucleotide primer has an adenine at a location corresponding to the guanine in first oligonucleotide primer that hybridizes with the dCTP analog in the 3? end of the single-stranded DNA fragment, thereby generating a second extension product; and
i) performing polymerase chain reaction (PCR) with the first oligonucleotide primer, the second oligonucleotide primer, the first extension product, and the second extension product, thereby generating a nucleic acid library comprising an amplified product.
US Pat. No. 11,026,383

TOMATO HYBRID SVTM5655 AND PARENTS THEREOF

Seminis Vegetable Seeds, ...

1. A tomato plant of tomato hybrid SVTM5655, a sample of seed of said hybrid SVTM5655 having been deposited under ATCC Accession Number PTA-123583.
US Pat. No. 11,026,895

MEDICATED PLASTER FOR TREATING WAIST PAIN

SHANGHAI JUKU COSMETIC CO...

1. A method of treating waist pain comprising applying to a patient in need thereof a therapeutically effective amount of a medicated plaster comprising, by weight parts, the following raw materials: Abalone shell 10-20; Fructus Xanthii 10-20; Herba Lysimachiae 15-20; Lonicera japonica 10-15; and mint oil 2-4.
US Pat. No. 11,028,175

DEPLETION OF PLASMACYTOID DENDRITIC CELLS

The University of North C...

1. A method of depleting plasmacytoid dendritic cells (pDC) in a subject, comprising delivering to the subject an effective amount of an antibody or a fragment thereof that specifically binds to blood dendritic cell antigen-2 (BDCA2) and depletes pDC, thereby depleting pDC;wherein the antibody or a fragment thereof comprises a heavy chain variable region comprising the three complementarity determining regions of the amino acid sequence of SEQ ID NO:2 or SEQ ID NO:6; and
the antibody or a fragment thereof comprises a light chain variable region comprising the three complementarity determining regions of the amino acid sequence of SEQ ID NO:4 or SEQ ID NO:8,
wherein the subject has cancer.
US Pat. No. 11,028,431

DETECTION OF SHORT HOMOPOLYMERIC REPEATS

BIOCARTIS, NV, Mechelen ...

1. A method for deducing the number of nucleotides present in a target homopolymeric repeat sequence equal to or shorter than 15bp in length, the method comprising the steps of:a) generating amplicons by amplifying a nucleic acid sequence comprising the target homopolymeric repeat sequence;
b) heating the generated amplicons in the presence of at least one signal-generating oligonucleotide probe comprising a sequence capable of hybridizing to the target homopolymeric repeat sequence, and detecting the changes in the strength of the signal generated by said probe in the function of temperature to obtain at least one melting curve; and
c) deducing the number of nucleotides present in the target homopolymeric repeat sequence from the at least one melting curve;
wherein the sequence capable of hybridizing to the target homopolymeric repeat sequence comprises a sequence identical to or complementary to a mutant sequence comprising a deletion of at least one homonucleotide in said target homopolymeric repeat sequence, and
wherein the step of generating amplicons is performed in a PCR comprising a polymerase having 3?-5? exonuclease activity.
US Pat. No. 11,026,384

BARLEY AND USES THEREOF

The Healthy Grain Pty Lim...

1. A method for providing starch to improve one or more indicators of health in a human, wherein the method comprises administering, to the human, a composition comprising barley grain, or wholemeal or flour obtained from barley grain, wherein the barley grain comprises (i) a loss of function mutation in an endogenous gene encoding starch synthase IIa (SSIIa), and (ii) an amo1-AC38 allele, wherein the barley grain is homozygous for the loss of function mutation in the endogenous gene encoding SSIIa and for the amo1-AC38 allele, and the barley grain lacks detectable SSIIa protein in endosperm of the grain.
US Pat. No. 11,026,896

TRANSDERMAL PENETRANT FORMULATIONS CONTAINING CANNABIDIOL

DYVE BIOSCIENCES, INC., ...

1. A method of treating a patient with an ailment by applying a transdermal formulation to the skin of the patient, the transdermal formulation comprising the following components:a. Cannabidiol at a concentration from 1% to 7%;
b. a phosphatidylcholine at a concentration from 4% to 15%;
c. glucose at a concentration from 0% to 3%;
d. benzyl alcohol at a concentration from 0.25% to 5%;
e. deionized water at a concentration from 10% to 75%;
f. safflower oil at a concentration from 1% to 20%;
g. oleic acid at a concentration from 0.2% to 7.5%;
h. stearic acid at a concentration from 0.1% to 7%; and
i. isopropyl palmitate at a concentration from 5% to 30%,wherein the ailment is pain, seizures or Parkinson's disease and wherein all amounts are percent by weight relative to the total weight of said transdermal formulation (w/w).
US Pat. No. 11,028,176

ANTI-PERIPHERAL LYMPH NODE ADDRESSIN ANTIBODIES AND USES THEREOF

1. An anti-peripheral lymph node addressin (PNAd) antibody, or a PNAd-binding fragment thereof, comprising:(a) a heavy chain variable region (VH), wherein the VH comprises a VH complementarity determining region 1 (CDR1) comprising the amino acid sequence of SEQ ID NO:3, a VH CDR2 comprising the amino acid sequence of SEQ ID NO:4, and a VH CDR3 comprising the amino acid sequence of SEQ ID NO:5; and
(b) a light chain variable region (VL), wherein the VL comprises a VL CDR1 comprising the amino acid sequence of SEQ ID NO:8, a VL CDR2 comprising the amino acid sequence of SEQ ID NO:9, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO:10.
US Pat. No. 11,026,385

WATERMELON VARIETY ‘RED GARNET’

Enza Zaden Beheer B.V., ...

1. A watermelon seed designated as ‘Red Garnet’, a representative sample of said seed having been deposited under NCIMB Accession Number 43653.
US Pat. No. 11,026,897

COMPOSITION OF CURCUMAGALACTOMANNOSIDE AND HOPS EXTRACT

METAGENICS, INC., Aliso ...

1. A composition for treatment of inflammation in a mammal, the mammal having a neutrophil to lymphocyte ratio (NLR), the composition comprising:a curcumagalactomannoside; and
a hops extract;
wherein the curcumagalactomannoside and the hops extract cooperate to decrease the NLR of the mammal 12 weeks after ingestion of the composition.
US Pat. No. 11,028,177

EFFECTIVE TARGETING OF PRIMARY HUMAN LEUKEMIA USING ANTI-CD123 CHIMERIC ANTIGEN RECEPTOR ENGINEERED T CELLS

Novartis AG, Basel (CH) ...

1. A method of eradicating at least a portion of existing CD123-expressing cells in the bone marrow in a subject, the method comprising administering to the subject an effective amount of T cells expressing a chimeric antigen receptor (CAR) molecule comprising an anti-CD123 binding domain, a transmembrane domain, and an intracellular signaling domain, thereby eradicating at least a portion of the existing CD123-expressing cells in the bone marrow in a subject, wherein said anti-CD123 binding domain comprises:(a) a light chain variable region comprising:a light chain complementarity determining region 1 (LC CDR1) comprising the sequence of SEQ ID NO: 20, a light chain complementarity determining region 2 (LC CDR2) comprising the sequence of SEQ ID NO: 21, and a light chain complementarity determining region 3 (LC CDR3) comprising the sequence of SEQ ID NO: 22, anda heavy chain variable region comprising:a heavy chain complementarity determining region 1 (HC CDR1) comprising the sequence of SEQ ID NO: 16, a heavy chain complementarity determining region 2 (HC CDR2) comprising the sequence of SEQ ID NO: 17, and a heavy chain complementarity determining region 3 (HC CDR3) comprising the sequence of SEQ ID NO: 18; or(b) a light chain variable region comprising:a light chain complementarity determining region 1 (LC CDR1) comprising the sequence of SEQ ID NO: 28, a light chain complementarity determining region 2 (LC CDR2) comprising the sequence of SEQ ID NO: 29, and a light chain complementarity determining region 3 (LC CDR3) comprising the sequence of SEQ ID NO: 30, anda heavy chain variable region comprising:a heavy chain complementarity determining region 1 (HC CDR1) comprising the sequence of SEQ ID NO: 24, a heavy chain complementarity determining region 2 (HC CDR2) comprising the sequence of SEQ ID NO: 25, and a heavy chain complementarity determining region 3 (HC CDR3) comprising the sequence of SEQ ID NO: 26; or(c) a light chain variable region comprising:a light chain complementarity determining region 1 (LC CDR1) comprising the sequence of SEQ ID NO: 87, a light chain complementarity determining region 2 (LC CDR2) comprising the sequence of SEQ ID NO: 88, and a light chain complementarity determining region 3 (LC CDR3) comprising the sequence of SEQ ID NO: 89, anda heavy chain variable region comprising:a heavy chain complementarity determining region 1 (HC CDR1) comprising the sequence of SEQ ID NO: 84, a heavy chain complementarity determining region 2 (HC CDR2) comprising the sequence of SEQ ID NO: 85, and a heavy chain complementarity determining region 3 (HC CDR3) comprising the sequence of SEQ ID NO: 86.
US Pat. No. 11,028,433

METHODS FOR PERFORMING MULTIPLEXED PCR

Roche Molecular Systems, ...

1. A method for amplification and detection of a target nucleic acid in a sample comprising the steps of:(a) contacting said sample containing said target nucleic acid in a single reaction vessel with
(i) one pair of oligonucleotide primers, each oligonucleotide primer capable of hybridizing to opposite strands of a subsequence of said target nucleic acid;
(ii) an oligonucleotide probe that comprises an annealing portion and a tag portion, wherein the tag portion comprises a nucleotide sequence non-complementary to the target nucleic acid sequence, wherein the annealing portion comprises a nucleotide sequence at least partially complementary to the target nucleic acid sequence and hybridizes to a region of said subsequence of said target nucleic acid that is bounded by said pair of oligonucleotide primers, wherein said probe further comprises an interactive dual label comprising a reporter moiety located on said tag portion and a first quencher moiety located on said annealing portion and wherein said reporter moiety is separated from said first quencher moiety by a nuclease susceptible cleavage site; and wherein prior to step (b), said tag portion is reversibly bound in a temperature-dependent manner to a quenching oligonucleotide comprising a nucleotide sequence at least partially complementary to the tag portion of the oligonucleotide probe and binds to the tag portion by hybridization, wherein said quenching oligonucleotide comprises at least a second quencher moiety capable of quenching said reporter moiety on said tag portion when said quenching oligonucleotide is bound to said tag portion;
(b) following step (a), amplifying said target nucleic acid by polymerase chain reaction (PCR) using a nucleic acid polymerase having 5? to 3? nuclease activity such that during an extension step of each PCR cycle, the nuclease activity of the polymerase allows cleavage and separation of the tag portion from the first quencher moiety on the annealing portion of the probe;
(c) measuring one or more signals from the reporter moiety at a first temperature at which the quenching oligonucleotide is bound to the tag portion;
(d) measuring one or more signals from the reporter moiety at a second temperature, which is higher than the first temperature, at which the quenching oligonucleotide is not bound to the tag portion;
(e) obtaining a calculated signal value by subtracting a median or average of the one or more signals detected at the first temperature from a median or average of the one or more signals detected at the second temperature; whereby a calculated signal value that is higher than a threshold signal value allows determination of the presence of the target nucleic acid.
US Pat. No. 11,026,386

MAIZE HYBRID X08N746

PIONEER HI-BRED INTERNATI...

1. A seed of hybrid maize variety X08N746, representative seed produced by crossing a first plant of variety PH41W7 with a second plant of variety PH41 M2, wherein representative seed of the varieties PH41W7 and PH41 M2 have been deposited under NCMA Accession Number 202006054 and ATCC Accession Number PTA-124813 and, respectively.
US Pat. No. 11,026,898

EUTECTIC FORMULATIONS OF CYCLOBENZAPRINE HYDROCHLORIDE

Tonix Pharma Holdings Lim...

1. A pharmaceutical composition comprising a eutectic of ?-mannitol and Cyclobenzaprine HCl, wherein the eutectic comprises 65%±2% Cyclobenzaprine HCl and 35%±2% ?-mannitol by weight.
US Pat. No. 11,028,178

METHOD OF TREATING NONALCOHOLIC STEATOHEPATITIS BY ADMINISTERING AN ANTAGONIST HUMAN TUMOR NECROSIS FACTOR RECEPTOR 1 (HUTNFR1) ANTIBODY

BALIOPHARMA AG, Basel (C...

1. A method of treating nonalcoholic steatohepatitis (NASH) and disease conditions associated thereto in a subject in need thereof, comprising administering to the subject an effective amount of an antagonist antibody specifically recognizing human tumor necrosis factor receptor 1 (huTNFR1).
US Pat. No. 11,032,021

TREATMENT FOR IMPROVING THE USE OF DIETARY SUGAR FOR ENERGY PURPOSES

NUTRAVIS S.R.L., Genoa (...

1. A method for therapeutically treating, or controlling hyperglycemia in a subject in need thereof, without an increase in insulinemia, said method comprisingorally administering to said subject an effective amount of abscisic acid (ABA) or an in vivo hydrolyzable ABA-conjugate at a dose of between 0.15 and 95 ?g/day per Kg of body weight of said subject.
US Pat. No. 11,026,387

SOYBEAN VARIETY 01073016

Monsanto Technology LLC, ...

1. A plant of soybean variety 01073016, wherein representative seed of said soybean variety have been deposited under ATCC Accession No. PTA-11126435.
US Pat. No. 11,026,899

TREATMENT OR PREVENTION OF CARDIOVASCULAR EVENTS VIA THE ADMINISTRATION OF A COLCHICINE DERIVATIVE

MURRAY AND POOLE ENTERPRI...

1. A method for treating and/or reducing the risk of a cardiovascular event in a subject in need thereof, which comprises: administering to the subject a therapeutically effective amount of a composition comprising about 0.5 total mg of (i) colchicine, (ii) a salt of (i), or any combination of (i) and (ii), wherein the composition is administered orally and once per day.
US Pat. No. 11,027,155

METHOD FOR PREVENTION AND TREATMENT OF DIABETIC KIDNEY DISEASE

1. A method for delaying the progression of Diabetic Kidney Disease through the inhibition of hyaluronan synthesis in a subject in need thereof, wherein said method comprises the administration to said subject of a composition containing a therapeutically effective amount of at least one active agent from the Coumarin group (4-Methylumbelliferone, a 4-Methylumbelliferone metabolite, or a salt thereof) that reduces the amount of hyaluronans in diabetic kidneys.
US Pat. No. 11,028,179

ANTI-TRANSFERRIN RECEPTOR ANTIBODIES AND USES THEREOF

AVIDITY BIOSCIENCES, INC....

1. An antibody or antigen-binding fragment thereof that binds to transferrin receptor, wherein the antibody or antigen-binding fragment comprises i) a variable heavy chain (VH) region comprising a sequence selected from SEQ ID NOs: 13-16, and ii) a variable light chain (VL) region comprising a sequence selected from SEQ ID NOs: 18-21.
US Pat. No. 11,026,388

SOYBEAN VARIETY 01073060

Monsanto Technology LLC, ...

1. A plant of soybean variety 01073060, wherein representative seed of said soybean variety have been deposited under ATCC Accession No. PTA-126436.
US Pat. No. 11,026,900

TREATMENT OR PREVENTION OF CARDIOVASCULAR EVENTS VIA THE ADMINISTRATION OF A COLCHICINE DERIVATIVE

MURRAY AND POOLE ENTERPRI...

1. A method for treating and/or reducing the risk of a cardiovascular event in a subject in need thereof, that comprises:administering to the subject a therapeutically effective amount of a composition comprising about 0.5 total mg of (i) colchicine, (ii) a salt of (i), or any combination of (i) and (ii),
wherein the composition is administered orally and once per day,
and wherein the subject has clinically stable coronary disease.
US Pat. No. 11,028,180

ANTI-JAGGED1 ANTIGEN BINDING PROTEINS

AMGEN INC., Thousand Oak...

1. An isolated antigen binding protein that specifically binds to a human Jagged1 polypeptide, wherein the antigen binding protein is an antibody or a fragment thereof, and wherein the antibody comprises a CDRL1, a CDRL2, a CDRL3, a CDRH1, a CDRH2, and a CDRH3, wherein each CDRL1, CDRL2, CDRL3, CDRH1, CDRH2, and CDRH3, respectively, comprises a sequence selected from the group consisting of SEQ ID NO: 98, SEQ ID NO: 99, SEQ ID NO: 100, SEQ ID NO: 230, SEQ ID NO: 231, and SEQ ID NO: 232.
US Pat. No. 11,026,389

SOYBEAN VARIETY 01072367

Monsanto Technology LLC, ...

1. A plant of soybean variety 01072367, wherein representative seed of said soybean variety have been deposited under ATCC Accession No. PTA-126412.
US Pat. No. 11,026,901

TREATMENT OR PREVENTION OF CARDIOVASCULAR EVENTS VIA THE ADMINISTRATION OF A COLCHICINE DERIVATIVE

MURRAY AND POOLE ENTERPRI...

1. A method for treating and/or reducing the risk of acute myocardial infarction in a subject comprising: administering to the subject a therapeutically effective amount of a composition comprising about 0.5 total mg of (i) colchicine, (ii) a salt of (i), or any combination of (i) and (ii), wherein the composition is administered orally and once per day.
US Pat. No. 11,028,181

GLYCAN-INTERACTING COMPOUNDS AND METHODS OF USE

Seagen Inc., Bothell, WA...

1. An isolated antibody that binds to sialyl(?2,6)N-acetylgalactosamine (STn), wherein the antibody comprises a heavy chain variable domain (VH) comprising an amino acid sequence selected from SEQ ID NOs: 237-241, and a light chain variable domain (VL) comprising an amino acid sequence selected from SEQ ID NOs: 235 and 236.
US Pat. No. 11,028,437

METHOD FOR EVALUATING THE RISK OF DRUG HYPERSENSITIVITY REACTION INDUCED BY SULFAMETHOXAZOLE AND TRIMETHOPRIM

Chang Gung Memorial Hospi...

1. A method for treating an indication in a patient treatable by sulfamethoxazole and/or trimethoprim, comprising:evaluating the risk of developing a drug hypersensitivity reaction caused by sulfamethoxazole and trimethoprim in a patient with an indication treatable by sulfamethoxazole and trimethoprim, comprising the step of detecting the presence of HLA-B*1301 allele from a sample from the patient, wherein the presence of the HLA-B*1301 allele indicates the patient has a higher risk of developing drug hypersensitivity reaction caused by sulfamethoxazole and trimethoprim compared to a subject without the HLA-B*1301 allele; and thereafter
based on the detecting the presence of HLA-B*1301 allele from the sample from the patient, administering an antibiotic other than sulfamethoxazole and/or trimethoprim in order to minimize the risk developing a drug hypersensitivity reaction caused by sulfamethoxazole and trimethoprim,
wherein said patient is of Asian ancestry and said drug hypersensitivity reaction caused by sulfamethoxazole and trimethoprim is maculopapular eruption, fixed drug eruption, Stevens-Johnson syndrome, toxic epidermal necrolysis or drug rash with eosinophilia and systemic symptoms.
US Pat. No. 11,026,390

SOYBEAN CULTIVAR 82201737

M.S. Technologies L.L.C.,...

1. A plant of soybean cultivar 82201737, representative seed of said soybean cultivar having been deposited under NCMA Accession No. 2019090976.
US Pat. No. 11,028,182

ANTIGEN-BINDING CONSTRUCTS TARGETING HER2

Zymeworks Inc., Vancouve...

1. An antigen-binding construct comprising a variant first antigen-binding polypeptide construct which monovalently binds a first HER2 ECD2 (human epidermal growth factor receptor 2 extracellular domain 2) antigen, the variant first antigen-binding polypeptide construct comprising a heavy chain variable (VH) domain as set forth in SEQ ID NO:2 and a light chain variable (VL) domain as set forth in SEQ ID NO:11 and comprising an amino acid modification at position 75 in the VH domain (Kabat numbering) wherein the lysine at position 75 has been substituted with a tryptophan (H_K75W), glutamic acid (H_K75E), or tyrosine (H_K75Y),optionally wherein the variant first antigen-binding polypeptide construct comprises H_K75W and further comprises the following substitutions or set of substitutions, numbering according to Kabat numbering system:H_T30Q; or
H_T30Y; or
H_G56Y; or
H_S99W; or
L_Y49W; or
L_Y96G; or
H_S99W and L_Y49W; or
L_Y49W and L_Y96G; or
H_T30Q and L_Y49W; or
H_T30Q and H_S99W; or
H_T30Q and L_Y96G; or
H_T30Y and L_Y49W; or
H_S99W and L_Y49W and L_Y96G; or
H_T3000 and H_S99W and L_Y96G or
H_T3000 and H_S99W and L_Y49W; or
H_T3000 and L_Y49W and L_Y96G; or
H_T30Y and L_Y49W and L_Y96G, andoptionally wherein the variant first antigen-binding polypeptide construct comprises H_K75E and further comprises the following substitutions or set of substitutions, numbering according to Kabat numbering systemL_Y49W; or
H_T30Q; or
H_S74W; or
H_S99W.
US Pat. No. 11,028,438

WINDOWED SEQUENCING

Life Technologies Corpora...

1. A method comprising:determining an operational characteristic of each sensor of a plurality of sensors located at a portion of a sensor array, the determining occurring prior to introducing known nucleotides to at least some of the plurality of sensors;
selecting a first group of sensors from the plurality of sensors located at the portion of the sensor array, wherein the selecting is based on determining that each sensor in the first group of sensors has a similar operational characteristic;enabling readout of the sensors in the first group of sensors;bypassing readout of other sensors of the sensor array that are not included in the first group of sensors, wherein the other sensors have a different operational characteristic than the first group of sensors; and
receiving output signals from the first group of sensors, the output signals received after introducing known nucleotides to the at least some of the plurality of sensors located at the portion of the sensor array.
US Pat. No. 11,026,391

SOYBEAN CULTIVAR 82152612

M.S. Technologies, L.L.C....

1. A plant of soybean cultivar 82152612, representative seed of said soybean cultivar having been deposited under NCMA Accession No. 2019004.
US Pat. No. 11,028,183

HER2/NEU-SPECIFIC ANTIBODIES AND METHODS OF USING SAME

MacroGenics, Inc., Rockv...

1. A method of treating a HER2/neu-expressing cancer in a patient in need thereof having a CD16A Fc Receptor comprising a Phe at position 158, comprising administering to said patient a therapeutically effective amount of an antibody that binds human HER2/neu and comprises:(A) an immunoglobulin light chain comprising an amino acid sequence of SEQ ID NO: 2; and
(B) an immunoglobulin heavy chain comprising an amino acid sequence of SEQ ID NO: 9, SEQ ID NO: 11, or SEQ ID NO: 13.
US Pat. No. 11,028,439

ASSAY FOR DETECTING HEPATITIS B VIRUS (HBV)

ABBOTT MOLECULAR INC., D...

1. A set of oligonucleotide sequences for amplifying and detecting a nucleic acid sequence from a hepatitis B virus (HBV) capable of infecting humans in a sample, which comprises:(a) a forward primer oligonucleotide sequence comprising SEQ ID NO: 1;
(b) a reverse primer oligonucleotide sequence comprising SEQ ID NO: 2;
(c) a first probe oligonucleotide sequence comprising SEQ ID NO: 3 and a detectable label;
(d) a second probe oligonucleotide sequence comprising SEQ ID NO: 4 and a detectable label,
(e) an internal control forward primer oligonucleotide sequence comprising SEQ ID NO: 5,
(f) an internal control reverse primer oligonucleotide sequence comprising SEQ ID NO: 6, and
(g) an internal control probe oligonucleotide sequence comprising SEQ ID NO: 7 and a detectable label.
US Pat. No. 11,026,392

COTTON VARIETY 18R421B3XF

Monsanto Technology LLC, ...

1. A plant of cotton variety 18R421B3XF, wherein representative seed of said variety have been deposited under Bigelow Accession No. 202010027.
US Pat. No. 11,028,184

LONG-ACTING PCSK9-SPECIFIC BINDING PROTEIN AND APPLICATION THEREOF

CHANGZHOU BOJIA BIOTECHNO...

1. A binding protein MV072 that specifically binds to PCSK9, wherein the binding protein MV072 has a light chain variable region and a heavy chain variable region, andthe amino acid sequence of the heavy chain variable region CDR1 thereof is set forth in SEQ ID NO: 7;
the amino acid sequence of the heavy chain variable region CDR2 thereof is set forth in SEQ ID NO: 8 or SEQ ID NO: 13;
the amino acid sequence of the heavy chain variable region CDR3 thereof is set forth in SEQ ID NO: 9 or SEQ ID NO: 14;
the amino acid sequence of the light chain variable region CDR1 thereof is set forth in SEQ ID NO: 10;
the amino acid sequence of the light chain variable region CDR2 thereof is set forth in SEQ ID NO:11; and
the amino acid sequence of the light chain variable region CDR3 thereof is set forth in SEQ ID NO: 12.
US Pat. No. 11,028,440

METHODS FOR IDENTIFYING AND USING SMALL RNA PREDICTORS

GATEHOUSE BIO, INC., Nee...

1. A method for identifying small RNA (sRNA) predictors for neurodegenerative disease, comprising:(1) providing sRNA sequencing data from an experimental cohort and a comparator cohort of solid tissue or biological fluid samples, the sRNA sequencing data being generated by a sequencing-by-synthesis sequencing platform;
wherein the samples of the experimental cohort and the samples of the comparator cohort are from patients having the presence or absence, respectively, of a neurodegenerative disease;
wherein the sRNA sequencing data comprises sequence reads having adaptor sequences at 5?- and 3?-ends, and sRNA sequences are defined from the sequence reads by deletion of the adaptor sequences so as to identify variations at the 3?- and 5?-ends of the sRNA sequences, the sRNA sequences being defined without consolidating sequence reads to a reference sequence;
(2) selecting sRNA sequences that are present in at least 10% of the samples in the experimental cohort and which are not present in any samples of the comparator cohort, thereby identifying positive sRNA predictors, and wherein
at least one selected sRNA sequence is an isomiR;
and
(3) detecting the presence and absence of the selected positive sRNA predictors in RNA extracted from samples of a validation cohort using a quantitative or qualitative PCR assay that is specific for the sRNA predictors, wherein the PCR assay employs a stem loop primer and a fluorescently-labeled probe; thereby identifying sRNA predictors for the neurodegenerative disease.
US Pat. No. 11,026,393

COTTON VARIETY NG 3994 B3XF

Americot, Inc., Lubbock,...

1. A plant of cotton variety N6 3994 B3XF, wherein a sample of seed of said variety has been deposited under ATCC Accession No. PTA-126392.
US Pat. No. 11,028,185

USING SORTASES TO INSTALL CLICK CHEMISTRY HANDLES FOR PROTEIN LIGATION

Whitehead Institute for B...

1. A bispecific, chimeric antibody comprisinga first antibody or antigen-binding antibody fragment comprising a sortase recognition sequence; and
a second antibody or antigen-binding antibody fragment comprising a sortase recognition sequence; wherein the first and the second antibody or antibody fragment are conjugated together via click chemistry.
US Pat. No. 11,028,441

IL-10 AS A PREDICTIVE BIOMARKER OF RESPONSIVENESS TO HOUSE DUST MITE ALLERGEN IMMUNOTHERAPY

STALLERGENES, Antony (FR...

1. A method for immunotherapy of house dust mite allergy in a patient comprising:(i) selecting a patient for immunotherapy by implementing a method comprising:
a) measuring abundance of IL-10 mRNA in a biological sample from said patient,
b) comparing said abundance of IL-10 mRNA with a control,
c) identifying said patient as likely to be a responder to immunotherapy when
(c1) the abundance of IL-10 mRNA in the patient sample is equal to or greater than the level of expression in a control derived from a responder subject, or group of responder subjects, known to respond to said immunotherapy; or
(c2) the abundance of IL-10 mRNA in the patient sample is greater than the level of expression in a control derived from a non-responder subject, or group of non-responder subjects; or
(c3) the abundance of IL-10 mRNA in the patient sample is greater than the level of expression in a control derived from a randomly selected group of subjects; and
wherein said biological sample is taken before the commencement of immunotherapy, and wherein said immunotherapy comprises administration of a house dust mite allergen to said patient in order to treat house dust mite allergy, and
(ii) administering said house dust mite allergen to said patient identified as likely to be a responder to said immunotherapy.
US Pat. No. 11,026,394

PEPPER LINE SBY-E717-0866

Seminis Vegetable Seeds, ...

1. A pepper plant comprising at least a first set of the chromosomes of pepper line SBY-E717-0866, a sample of seed of said line having been deposited under ATCC Accession Number PTA-125759.
US Pat. No. 11,026,906

PHARMACEUTICAL QUALITY STRONTIUM L-LACTATE

1. A method of preparing a pharmaceutical quality strontium L-lactate composition comprising:a. selecting an L-lactic acid having at most trace concentrations of metals selected from the group consisting of aluminum, arsenic, barium, calcium, cadmium, chromium, lead, mercury, and thallium;
b. selecting a strontium carbonate, strontium oxide, or strontium hydroxide having at most trace concentrations of metals selected from the group consisting of aluminum, arsenic, barium, calcium, cadmium, chromium, lead, mercury, and thallium;
c. dissolving the L-lactic acid in water to obtain a homogeneous 0.1 M solution;
d. adding portions of strontium carbonate, strontium oxide, or strontium hydroxide to the vessel containing the solution of L-lactic acid until a mass of said strontium salt equal to 0.45-0.55 mole equivalents of L-lactic acid has been added and agitating the reaction mixture until a homogeneous solution is obtained;
e. removing particulate from the reaction mixture by filtration or centrifugation to provide a clarified solution;
f. diluting the clarified solution with a water-miscible, aprotic organic solvent to form a precipitate; and
g. isolating the precipitate and drying to constant mass to provide a pharmaceutical quality strontium L-lactate composition, wherein said strontium L-lactate composition is characterized in having a strontium D-lactate content of less than about 3 weight percent strontium D-lactate.
US Pat. No. 11,028,186

CELLULOSE DERIVATIVE, CELLULOSE RESIN COMPOSITION, MOLDED BODY AND PRODUCT USING SAME

NEC CORPORATION, Tokyo (...

1. A cellulose derivative obtained by substituting at least part of hydrogen atoms of hydroxy groups of a cellulose with an acyl group having 2 to 4 carbon atoms, a long-chain organic group having 7 or more carbon atoms, and a high refractive-index organic group,wherein the high refractive-index organic group is an aromatic phosphoric acid ester group.
US Pat. No. 11,026,907

AZELAIC ACID GEL, PREPARATION METHOD AND APPLICATION THEREOF

CHENGDU JOY YOUNG BIOTECH...

1. An azelaic acid gel for preventing or treating acnes, comprising the following components by weight percentage: 10-20% of azelaic acid, 0.5-2% of salicylic acid, 1-3% of polyacrylate cross-linked polymer-6, 60-74% of 1,3-propylene glycol, and the remaining part being water.
US Pat. No. 11,028,187

DETERGENT COMPOSITIONS

1. A composition comprising a poly alpha-1,3-glucan derivative, wherein the poly alpha-1,3-glucan derivative comprises poly alpha-1,3-glucan substituted with one or more polyamine groups.
US Pat. No. 11,028,443

MOLECULAR METHODS FOR ASSESSING UROTHELIAL DISEASE

Showa Denko Materials Co....

1. A method for treating a urothelial cancer in a human subject comprising;identifying the subject for treating the urothelial cancer by identifying that an expression level of at least two markers selected from the group consisting of SLC2A1, S100A13, KRT17, GPRC5A, P4HA1, and HSD17B2 in urinary exosomes and microvesicles isolated from the subject is higher than an expression level of the at least two markers in a urine sample obtained from a non-urothelial cancer subject; and
administering a treatment selected from the group consisting of cystoscopy, tumor resection, surgery, chemotherapy, and cystectomy to the subject.
US Pat. No. 11,028,188

PROCESSES FOR RECOVERING RUBBER FROM AGED BRIQUETTES

Bridgestone Corporation, ...

1. A method of recovering rubber from rubber-containing briquettes comprising:a. utilizing aged briquettes comprising at least one antioxidant and chopped guayule plant matter that contains bagasse, rubber, resin and less than 5 weight % leaves of guayule plant, wherein the briquettes have been aged for about 21-200 days after formation;
b. mixing the briquettes with (i) at least one non-polar organic solvent and (ii) at least one polar organic solvent to produce a slurry where the total amount of (i) and (ii) is 50-90% by weight of the slurry, the briquettes comprise 10-50% by weight of the slurry, and the slurry contains 0.5-10 weight % water;
c. removing a majority of the bagasse from the slurry to produce a miscella and a first bagasse portion;
d. optionally adding additional polar organic solvent, non-polar solvent or a combination thereof to the miscella to form a reduced viscosity miscella, wherein any additional polar organic solvent and non-polar organic solvent that is added is the same or different than those utilized in (a) and the amount of any additional polar organic solvent added is less than the amount that causes the rubber contained with the reduced viscosity miscella to coagulate;
e. removing 80-95 weight % bagasse (based upon the total weight of bagasse present in the reduced viscosity miscella) from the miscella produced in (c) or (d) thereby forming a purified miscella and a second bagasse fraction, wherein a majority of the bagasse that is removed has a particle size of less than 105 microns;
f. optionally treating the purified miscella to remove additional bagasse thereby producing a clarified rubber solution that contains 0.01-1% by weight bagasse (based on the total weight of bagasse present in the slurry) thereby producing a clarified rubber solution;
g. increasing the relative amount of polar solvent as compared to non-polar solvent within the purified miscella or clarified rubber solution so as to coagulate the rubber; and
h. producing solid purified rubber from the coagulated rubber where when said solid purified rubber contains 0.8% volatile matter it also contains 0.05-0.5 weight % dirt, 0.2-1.5 weight % ash and 0.1-4 weight % resin,wherein at least (b)-(f) are conducted at a temperature or temperatures of 10-80° C. and a pressure of 35 to 1000 kPa.
US Pat. No. 11,028,444

SURVIVAL PREDICTOR FOR DIFFUSE LARGE B CELL LYMPHOMA

The United States of Amer...

1. A method of treating a subject for diffuse large B cell lymphoma (DLBCL) which method comprises:i) evaluating the subject for antiangiogenic therapy of DLBCL, comprising:
a) isolating gene expression product from one or more DLBCL biopsy samples from the subject;
b) obtaining a gene expression profile from the gene expression product by detecting an expression level for VWF, CD31 (PECAM1), EGFL7, MMRN2, GPR116, and SPARCL, KDR (VEGF receptor-2), Grb10, integrin alpha 9, TEK, ROBO4, ERG, CAV1, CAV2, and EHD2;
c) determining the subject's signature value from the gene expression profile; and
d) determining whether the subject's signature value is higher or lower than a standard value, wherein antiangiogenic therapy is indicated by a signature value that is higher than the standard value and antiangiogenic therapy is not indicated by a signature value that is not higher than the standard value,
ii) determining that the subject's signature value is higher than the standard value, and
iii) treating the subject with antiangiogenic therapy.
US Pat. No. 11,026,909

THERAPY FOR VIRAL INFECTIONS INCLUDING THE NOVEL CORONA VIRUS (COVID-19)

1. A pharmaceutical composition comprising 5-aminolevulinic acid and at least one of curcumin nano, zinc, vitamin C and methylene blue, or pharmaceutically acceptable salt thereof, each present in therapeutically effective amounts, in an admixture with pharmaceutically acceptable excipient.
US Pat. No. 11,028,445

MOLECULAR PROGNOSTIC SIGNATURE FOR PREDICTING BREAST CANCER METASTASIS, AND USES THEREOF

Celera Corporation, San ...

1. A method of treating a human at risk for breast cancer metastasis, the method comprising:(a) measuring mRNA expression levels of genes comprising CENPA, PKMYT1, MELK, BUB1, RACGAP1, TK1, UBE2S, DC13, RFC4, PRR11, DIAPH3, and ORC6L in estrogen receptor-positive tumor cells from said human to generate a sum total of said expression levels wherein the mRNA of each of said genes is reverse transcribed and amplified using at least one primer associated with the corresponding gene comprising a nucleotide sequence selected from the group consisting of SEQ ID NOS:1-2, 5-12, and 15-28;
(b) determining said human is at risk for breast cancer metastasis when said sum total exceeds a predefined cutoff threshold; and
(c) administering a breast cancer therapy to said human.
US Pat. No. 11,028,447

DETECTION OF NEOPLASIA BY ANALYSIS OF METHYLATED DNA

1. A method of processing a sample, the method comprising:a) assaying a sample from a subject for an amount of at least one methylation marker DNA from a gene selected from the group consisting of BARX1, LOC100129726, SPOCK2, TSC22D4, MAX.chr8.124, RASSF1, ZNF617, ST8SIA1, NKX6_2, FAM59B, DIDDO1, MAX_Chr1.110, AGRN, SOBP, MAX_chr10.226, ZMIZ1, MAX_chr8.145, MAX_chr10.225, PRDM14, ANGPT1, MAX.chr16.50, PTGDR_9, ANKRD13B, DOCK2, MAX_chr19.163, ZNF132, MAX chr19.372, HOXA9, TRH, SP9, DMRTA2, ARHGEF4, CYP26C1, ZNF781, PTGDR, GRIN2D, MATK, BCAT1, PRKCB_28, ST8SIA_22, FLJ45983, DLX4, SHOX2, EMX1, HOXB2, MAX.chr12.526, BCL2L11, OPLAH, PARP15, KLHDC7B, SLC12A8, BHLHE23, CAPN2, FGF14, FLJ34208, B3GALT6, BIN2_Z, DNMT3A, FERMT3, NFIX, SIPR4, SKI, SUCLG2, TBX15, DTX1, and ZNF329;
b) assaying said sample for an amount of a reference marker DNA;
c) comparing the amount of said at least one methylation marker DNA to the amount of reference marker DNA in said sample to determine a methylation state for said at least one methylation marker DNA in said sample; and optionally
d) generating a record reporting the methylation state for said at least one methylation marker DNA in said sample;
wherein said sample is a plasma sample obtained from a subject having or suspected of having a neoplasm, and wherein said method comprises:
A) combining the plasma sample with:
i) protease; and
ii) a first lysis reagent, said first lysis reagent comprising
guanidine thiocyanate; and
non-ionic detergent;
to form a mixture wherein proteins are digested by said protease;
B) to the mixture of step A) adding
iii) silica particles, and
iv) reagents comprising:
guanidine thiocyanate;
non-ionic detergent; and
isopropyl alcohol;
under conditions wherein DNA is bound to said silica particles in a mixture of the added reagents;
C) separating silica particles with bound DNA from the mixture of B);
D) to the separated silica particles with bound DNA adding a first wash solution, said first wash solution comprising a) guanidine hydrochloride or guanidine thiocyanate, and b) ethyl alcohol;
E) separating the silica particles with bound DNA from said first wash solution;
F) to the separated silica particles with bound DNA adding a second wash solution, said second wash solution comprising a buffer and ethyl alcohol;
G) separating washed silica particles with bound DNA from said second wash solution;
H) eluting DNA from the washed silica particles with bound DNA separated in step G) to produced eluted DNA;
I) assaying said eluted DNA for an amount of at least one methylated methylation marker and for an amount of reference marker in said eluted DNA;
wherein assaying said eluted DNA comprises analyzing multiple methylation marker DNAs using a PCR-flap assay by a process comprising:
I.a) combining eluted DNA comprising a plurality of different DNA methylation marker DNA target regions into a plurality of PCR-flap assay reaction mixtures, wherein each PCR-flap assay reaction mixture comprises:
i) primer pairs for amplifying one or more of said plurality of different methylation marker DNA target regions, if present in said sample, and for amplifying at least one target region of said at least one reference marker from said eluted DNA;
ii) thermostable DNA polymerase;
iii) dNTPs;
iv) a buffer comprising Mg++
v) a flap endonuclease;
vi) a flap oligonucleotide, and
vii) a hairpin oligonucleotide comprising a region that is complementary to a portion of said flap oligonucleotide;
and
I.b) detecting amplification of one or more different DNA methylation marker DNA target regions and at least one reference marker target region from said eluted DNA during PCR-flap assay reactions; and
J) comparing the amount of said at least one methylated methylation marker DNA to the amount of reference marker in said eluted DNA to determine a methylation state for said at least one methylation marker DNA in said plasma sample
wherein said at least one methylation marker DNA comprises a group of DNAs from methylation marker genes selected from:
the group consisting of ZNF781, BARX1, and EMX1;
the group consisting of SHOX2, SOBP, ZNF781, CYP26C1, SUCLG2, and SKI;
the group consisting of SLC12A8, KLHDC7B, PARP15, OPLAH, BCL2L11, MAX.chr12.526, HOXB2, and EMX1;
the group consisting of SHOX2, SOBP, ZNF781, BTACT, CYP26C1, and DLX4; and
the group consisting of ZNF781, BARX1, and EMX1, and further comprising SOBP and/or HOXA9.
US Pat. No. 11,026,912

AZELAIC ACID ESTERS IN THE TREATMENT OF INSULIN RESISTANCE

NEW FRONTIER LABS, LLC, ...

1. A method of treating Type 2 diabetes comprising administering to a subject a pharmaceutical composition comprising diethyl azelate at a dose in a range from 0.5 mg/kg/day to 2.5 mg/kg/day.
US Pat. No. 11,028,448

METHODS OF IDENTIFYING RISK OF VASCULAR ENDOTHELIAL GROWTH FACTOR (VEGF) PATHWAY INHIBITOR-INDUCED HYPERTENSION

The University of North C...

1. A method for reducing the risk of vascular endothelial growth factor (VEGF) pathway inhibitor-induced hypertension in a subject in need of treatment with a VEGF pathway inhibitor, the method comprising:(i) identifying the subject as having a single nucleotide polymorphism (SNP) at rs6770663, wherein the base identified at rs6770663 is a guanine; and
(ii) administering one or more antihypertensive agents to the subject identified as having a guanine at rs6770663.
US Pat. No. 11,026,913

NUTRITIONAL FORMULAS COMPRISING MEDIUM CHAIN FATTY ACIDS OR ESTERS THEREOF AND METHODS RELATED THERETO

Emory University, Atlant...

1. A method of treating autism spectrum disorder comprising orally administering daily to a subject diagnosed with an autism spectrum disorder, apraxia, and a gastrointestinal tract impairment, an effective amount of a dietary formulation comprising:a) a medium chain fatty acid, glycerol ester, or alkyl ester thereof,
b) an omega-3 fatty acid, glycerol ester, or alkyl ester thereof,
c) an omega-6 fatty acid, glycerol ester, or alkyl ester thereof, and
d) a vitamin E isomer from 100 mg to 10,000 mg,
e) 5-hydroxytryptophan, from 10 mg to 100 mg,
f) sulforaphane from 500 micrograms to 5000 micrograms, and
g) curcumin from 50 mg to 2500 mg; and
wherein the dietary formulation comprises less than 2% long chain saturated fatty acids by weight of the total weight of fatty acids.
US Pat. No. 11,028,449

MICROBIOME BASED SYSTEMS, APPARATUS AND METHODS FOR MONITORING AND CONTROLLING INDUSTRIAL PROCESSES AND SYSTEMS

Biota Technology, Inc., ...

11. A method comprising:performing operations at a computing system having one or more computer processors for communicating predictive microbiome information to a memory storage device for display in a human machine interface (HMI) of the memory storage device, the display having an interactive configuration for identifying patterns in the predictive microbiome information that are relevant to optimizing recovery of hydrocarbons, the operations comprising:
selecting, using the one or more computer processors, a machine-learned model from a plurality of machine-learned models based on a testing of a predictive accuracy of the machine-learned model when applied to a plurality of subsets of the microbiome information from a genetic material extracted from the first sample, the selecting based on a class of the machine-learned model being a specialized generative model that was generated using an embedded approach to feature selection having knowledge of a parameter-selection process;
generating, using the one or more computer processors, the predictive microbiome information, the predictive microbiome information corresponding to sequencing data extracted from genetic material from a second sample sourced at a well or an additional well, the generating of the predictive microbiome information including applying the selected machine-learned model to the sequencing data extracted from the genetic material from the second sample, the predictive microbiome information relating to a source production zone corresponding to a hydrocarbon formation or a characteristic of a reservoir corresponding to the hydrocarbon formation, the characteristic including at least one of pressure, temperature, or viscosity; and
performing, using the one or more computer processors, the communicating of the predictive microbiome information for the display in a user interface.
US Pat. No. 11,026,914

USE OF DIANHYDROGALACTITOL AND ANALOGS AND DERIVATIVES THEREOF TO TREAT RECURRENT MALIGNANT GLIOMA OR PROGRESSIVE SECONDARY BRAIN TUMOR

DEL MAR PHARMACEUTICALS (...

1. A method for the treatment of recurrent glioma or progressive secondary brain tumor comprising the administration of a therapeutically effective quantity of a hexitol derivative selected from the group consisting of dianhydrogalactitol and diacetyldianhydrogalactitol, wherein the recurrent glioma is resistant to temozolomide and bevacizumab, and wherein the hexitol derivative is administered at a therapeutically effective dose of up to 40 mg/m2 for 3 days followed by a nadir/recovery period of 18 to 21 days.
US Pat. No. 11,028,450

KITS FOR THE DIAGNOSIS OF BACTERIAL VAGINOSIS

Quest Diagnostics Investm...

1. A quantitative kit for diagnosing vaginitis in a female subject comprising no more than six primer pairs including:(i) a primer pair for amplifying a fragment of a nucleic acid from Atopobium vaginae, wherein the fragment of a nucleic acid is a fragment of a 16S ribosomal RNA gene;
(ii) a primer pair for amplifying a fragment of a nucleic acid from Megasphaera genus, wherein the fragment of a nucleic acid is a fragment of a 16S ribosomal RNA gene;
(iii) a primer pair for amplifying a fragment of a nucleic acid from Gardnerella vaginalis;
(iv) a primer pair for amplifying a fragment of a nucleic acid from Lactobacillus jensenii, wherein the fragment of a nucleic acid is a fragment of a 16S ribosomal RNA gene; and
(v) a primer pair for amplifying a fragment of a nucleic acid from Lactobacillus crispatus, wherein the fragment of a nucleic acid is a fragment of a 16S ribosomal RNA gene,
wherein at least one primer of each primer pair is detectably labeled to allow quantification of amplification products, and wherein all primer pairs in the kit are specific for organisms associated with vaginitis or Lactobacilli species.
US Pat. No. 11,026,915

PREPARATION OF A SOLUTION OF CANNABINOIDS FOR PERSONAL VAPING

1091665 B.C. Ltd., Sooke...

1. A method for producing a vaporizable cannabinoid solution comprising:preparing a solvent extract of a cannabis starting material;
filtering precipitate from the solvent extract;
distilling the solvent extract by heating the solvent extract to generate vapors and condensing the vapors at a vapor temperature in the range of 220° C. to 240° C. under a vacuum in the range of 0.1 TORR to 0.3 TORR to obtain a cannabis distillate containing a cannabinoid;
adding the cannabis distillate to polyethylene glycol (PEG) to form a mixture; and
combining the mixture with propylene glycol (PG) to form the solution.
US Pat. No. 11,028,195

HYDROXYARYL FUNCTIONALIZED POLYMERS

Bridgestone Corporation, ...

1. A method of making a functionalized polymer that comprises polyene mer and a terminal functional group, said method comprisinga) providing a solution that comprises a catalyst system and one or more types of ethylenically unsaturated monomers which include at least one type of polyene;
b) allowing said one or more types of ethylenically unsaturated monomers to polymerize, thereby providing a terminally active polymer;
c) reacting said terminally active polymer with a functionalizing compound that comprises
(1) a functional group that is reactive toward a terminally active polymer, and
(2) an aryl group having at least two directly bonded OR groups where each R is a hydrolyzable t-butyldimethylsilyl protecting group,
thereby providing said functionalized polymer.
US Pat. No. 11,028,451

COMPOSITIONS AND METHODS FOR DETECTION OF MYCOBACTERIUM TUBERCULOSIS

Roche Molecular Systems, ...

1. A kit for detecting a nucleic acid of Mycobacterium tuberculosis (MTB) and other members of the MTB-complex comprising:a first primer consisting of SEQ ID NO: 1, or the complement thereof, and optionally having at least one modified nucleotide, or SEQ ID NO: 7, or the complement thereof, and optionally having at least one modified nucleotide, or SEQ ID NO: 8, or the complement thereof, and optionally having at least one modified nucleotide;
a second primer consisting of SEQ ID NO: 15, or the complement thereof, and optionally having at least one modified nucleotide, or SEQ ID NO: 16, or the complement, thereof and optionally having at least one modified nucleotide, or SEQ ID NO: 17, or the complement thereof, and optionally having at least one modified nucleotide; and
a third fluorescently detectably labeled probe consisting of SEQ ID NO: 30, or the complement thereof, and optionally having at least one modified nucleotide, at least one donor fluorescent moiety and at least one corresponding acceptor moiety.
US Pat. No. 11,026,916

TREATMENT FOR NON-ALCOHOLIC FATTY LIVER DISEASES

DSM IP ASSETS B.V., Heer...

1. A method of treating a condition requiring modulation of inflammatory response associated with accumulation of fat in the liver which is not caused by consumption/abuse of alcohol, which comprises administering to a patient in need thereof a composition comprising vitamin E and ?-3 docosahexaenoic acid (DHA), wherein the ratio of vitamin E to the DHA provides a synergistic effect and is in the range of about 1:1 to about 1:2, wherein the vitamin E is calculated as ?-tocopherol, wherein the composition is administered as a daily dose of about 500 to about 2000 mg vitamin E and about 400 mg to about 4000 mg DHA, and wherein the inflammatory response is non-alcoholic fatty liver disease (NAFLD) or non-alcoholic steatohepatitis (NASH).