US Pat. No. 10,987,416

PURIFICATION OF RECOMBINANT EV71 VIRUS-LIKE PARTICLE AND METHOD FOR PREPARING VACCINE THEREOF

Beijing Minhai Biotechnol...

1. A method for purifying a recombinant EV71 virus-like particle, comprising steps of:(1) performing fermentation on engineered recombinant Hansenula yeast containing a EV71 capsid protein P1 gene and a 3CD protease gene;
(2) disrupting the engineered yeast, and performing precipitation, redissolution and ultrafiltration of the recombinant EV71 virus-like particle;
(3) performing ion exchange chromatography; and
(4) performing molecular sieve chromatography or hydroxyapatite chromatography, wherein the step of precipitating the recombinant EV71 virus-like particle in the step (2) comprises pouring cell solution after disruption into a centrifuge bowl, performing centrifugation at 6,000 to 8,000 rpm for 40 to 60 min, collecting a supernatant, and adding ammonium sulfate into the collected supernatant to a final concentration of 20 to 28%.
US Pat. No. 10,988,442

NITRITE SALTS OF 1,1-DIMETHYLBIGUANIDE, PHARMACEUTICAL COMPOSITIONS, AND METHODS OF USE

NovoMedix, LLC, San Dieg...

1. A solid nitrite salt of 1,1-dimethylbiguanide, or an isotopic variant thereof; or a pharmaceutically acceptable hydrate or solvate thereof.
US Pat. No. 10,991,514

METHOD FOR PRODUCING ELECTROLYTIC CAPACITOR

PANASONIC INTELLECTUAL PR...

1. A method for producing an electrolytic capacitor, the method comprising:a first step of preparing an anode body, and forming a dielectric layer on a surface of the anode body;
a second step of forming a first conductive polymer layer on a surface of the dielectric layer, the first conductive polymer layer including a first conductive polymer, iron, and a first silane compound;
a third step of bringing the first conductive polymer layer into contact with a first treatment liquid; and
a fourth step of providing a second silane compound to the first conductive polymer layer after the third step, wherein:
in the second step, a precursor of the first conductive polymer is polymerized in presence of an oxidant containing the iron to form the first conductive polymer layer on the surface of the dielectric layer,
in the third step, the first conductive polymer layer is immersed in the first treatment liquid to remove at least part of the iron contained in the first conductive polymer layer, and
in the fourth step, the first conductive polymer layer is immersed in a second treatment liquid containing the second silane compound so that the second silane compound is replenished into the first conductive polymer layer in place of the first silane compound that has flown out in the third step.
US Pat. No. 10,987,418

POLYPEPTIDE CARRIER FOR PRESENTING TARGET POLYPEPTIDE AND USES THEREOF

XIAMEN UNIVERSITY, Xiame...

1. A nucleic acid molecule, comprising a nucleotide sequence encoding a polypeptide carrier, wherein the polypeptide carrier is selected from the following polypeptide carriers:(1) RBHBcAg-T carrier, which differs from roundleaf bat HBV core antigen protein (RBHBcAg protein) by difference comprising the following:
(1a) one or more amino acid residues of the amino acid residues from positions 78-83 at N-terminus of RBHBcAg protein are deleted or substituted with a linker;
(1b) one or more amino acid residues of the amino acid residues from positions 18-27, one or more amino acid residues of the amino acid residues from positions 50-69 and/or one or more amino acid residues of the amino acid residues from positions 120-140 at N-terminus of RBHBcAg protein are each independently substituted with a human T cell epitope; and
(1c) optionally, 1-5, 5-10, 10-15, 15-20, 20-25, 25-30, 30-35, or 35-40 amino acid residues are deleted at C-terminus of RBHBcAg protein;
(2) TBHBcAg-T carrier, which differs from tent-making bat HBV core antigen protein (TBHBcAg protein) by difference comprising the following:
(2a) one or more amino acid residues of the amino acid residues from positions 80-84 at N-terminus of TBHBcAg protein are deleted or substituted with a linker;
(2b) one or more amino acid residues of the amino acid residues from positions 18-27, one or more amino acid residues of the amino acid residues from positions 54-73 and/or one or more amino acid residues of the amino acid residues from positions 124-144 at N-terminus of TBHBcAg protein are each independently substituted with a human T cell epitope; and
(2c) optionally, 1-5, 5-10, 10-15, 15-20, 20-25, 25-30, or 30-35 amino acid residues are deleted at C-terminus of TBHBcAg protein; and
(3) HBHBcAg-T carrier, which differs from horseshoe bat HBV core antigen protein (HBHBcAg protein) by difference comprising the following:
(3a) one or more amino acid residues of the amino acid residues from positions 78-83 at N-terminus of HBHBcAg protein are deleted or substituted with a linker;
(3b) one or more amino acid residues of the amino acid residues from positions 18-27, one or more amino acid residues of the amino acid residues from positions 50-69 and/or one or more amino acid residues of the amino acid residues from positions 120-140 at N-terminus of HBHBcAg protein are each independently substituted with a human T cell epitope; and
(3c) optionally, 1-5, 5-10, 10-15, 15-20, 20-25, 25-30, 30-35, or 35-40 amino acid residues are deleted at C-terminus of HBHBcAg protein.
US Pat. No. 10,988,443

METHODS FOR IMPROVED PRODUCTION OF VITAMINS D2 AND D3

NUCELIS LLC, San Diego, ...

1. A method of production of vitamin-D2 using ergosterol or a dihydroxy derivative thereof as a starting material, or production of vitamin-D3 using 7-dehydrocholesterol or a dihydroxy derivative thereof as the starting material, comprising:(a) irradiating the starting material with ultraviolet light in a solution comprising a base selected from the group consisting of triethylamine, dibenzyl ethylenediamine, and an organic solvent having a dielectric constant greater than 5, to obtain a product containing pre-vitamin-D2 or pre-vitamin-D3; and
(b) heating the product to convert the pre-vitamin-D2 or pre-vitamin-D3 to vitamin D2 or vitamin D3.
US Pat. No. 10,987,419

IMMUNOSTIMULATORY COMPOSITIONS, PARTICLES, AND USES RELATED THERETO

Emory University, Atlant...

1. A method of treating breast cancer comprising administering an effective amount of irradiated cells in combination with an anti-PD-1 antibody to a subject in need thereof, wherein the cells comprise:A B7-1 molecule anchored to a lipid membrane on the exterior of the cells;
A HER-2 molecule on the exterior of the cells;
And
An IL-12 anchored to the lipid membrane on the exterior of the cells, wherein the cells are transfected with a vector comprising SEQ ID NO:7.
US Pat. No. 10,987,420

SYNTHETIC CONJUGATE OF CPG DNA AND T-HELP/CTL PEPTIDE

CITY OF HOPE, Duarte, CA...

1. A conjugated vaccine molecule which comprises a fusion peptide covalently attached to a DNA oligomer, wherein the fusion peptide comprises a T-help epitope and an antigenic peptide CTL epitope, wherein the antigenic peptide CTL epitope is conjugated to the DNA oligomer, and wherein the antigenic peptide CTL epitope is amino acid residues 14-32 of SEQ ID NO:3 or amino acid residues 14-32 of SEQ ID NO:4.
US Pat. No. 10,988,445

COMPOUNDS

1. A method of treating a disease state in a human suffering from said disease state, which comprises administering to the human in need of such treatment a therapeutically effective amount of (1R)-2-acetyl-N-[4-(1,1,1,3,3,3-hexafluoro-2-hydroxypropan-2-yl)phenyl]-5-(methylsulfonyl)-2,3-dihydro-1H-isoindole-1-carboxamide, or a pharmaceutically acceptable salt thereof, and wherein the disease state is selected from ulcerative cholitis, Crohn's disease, multiple sclerosis, inflammatory bowel disease, rheumatoid arthritis, graft versus host disease, systemic lupus erythematosis, and lupus nephritis.
US Pat. No. 10,988,702

ZINC-FREE LUBRICATING COMPOSITION

The Lubrizol Corporation,...

1. A zinc-free lubricating composition comprising (a) an oil of lubricating viscosity, (b) a zinc-free phosphorus-containing antiwear agent selected from a phosphite, a phosphonate, and an amine phosphate salt in an amount to deliver 0.025 to 0.086 weight percent of phosphorous to the composition, (c) at least one ashless detergent comprising a tetra-hydrocarbyl ammonium alkylbenzene sulfonate having a total base number (D2896) of at least about 50 mg KOH/g and a total acid number (TAN) of less than about 5 mg KOH/g as measured by ASTM D664 where the hydrocarbyl is selected from ethyl, propyl, and butyl, and (d) an ashless antioxidant, wherein the lubricating composition is substantially free of metal.
US Pat. No. 10,988,703

METAL WORKING FLUID

Italmatch Chemicals SC LL...

1. A metal working fluid, comprising:a polymeric ester emulsifier that in and of itself is cross-linked; and
an amine represented by the following formula (1):
(H2N)a-Q-(NH2)b  (1),
where a and b are each integers, and Q is represented by Y—X—Z, where X is a cyclic ring system including 3 to 24 carbon atoms, Y and Z are groups that include at least one carbon atom directly attached to the cyclic ring system, and the amine groups are attached to the Y and Z groups, respectively.
US Pat. No. 10,987,423

METHODS FOR PROTECTING AND TREATING TRAUMATIC BRAIN INJURY, CONCUSSION AND BRAIN INFLAMMATION WITH INTRANASAL INSULIN

The Henry M. Jackson Foun...

1. A method for treating traumatic brain injury (TBI) in a patient diagnosed with TBI, comprising:administering at least an effective amount of insulin to the upper third of the nasal cavity of the patient, and thereby enabling at least an effective amount of insulin to directly access the patient's central nervous system by bypassing the blood-brain barrier; and
treating the patient's TBI by protecting the patient's brain from inflammation caused by TBI and reducing existing inflammation in the patient's brain that is caused by TBI, by increasing the expression of anti-inflammatory M2 microglia cells in the patient's brain, and thereby treating the patient's TBI.
US Pat. No. 10,987,424

LIQUID FORMULATION OF LONG-ACTING INSULIN CONJUGATE

HANMI PHARM. CO., LTD., ...

1. A pharmaceutical liquid formulation of long-acting insulin conjugate, consisting ofa pharmaceutically effective amount of a long-acting insulin conjugate, wherein an insulin which is a physiologically active peptide, is linked to an immunoglobulin Fc region;
5 mM to 50 mM of an acetate buffer having a pH of a range from 5.6 to 6.5;
2% to 10% (w/v) of a sugar alcohol
0.005% to 0.02% (w/v) of a polysorbate 20;
1.2 to 20 mg/ml of an isotonic agent; and
optionally a preservative.
US Pat. No. 10,987,425

LIQUID FORMULATION OF LONG-ACTING HUMAN GROWTH HORMONE IMMUNOGLOBULIN CONJUGATE

HANMI PHARM. CO., LTD., ...

1. A liquid formulation of a long-acting human growth hormone (hGH) conjugate, wherein the liquid formulation comprises a pharmaceutically effective amount of a long-acting human growth hormone conjugate in which the physiologically active human growth hormone is linked to an immunoglobulin Fc region and an albumin-free stabilizer,wherein the liquid formulation comprises a buffer, a non-ionic surfactant, a sugar alcohol, and preservative,
wherein the sugar alcohol is included with a concentration ranging from 2% (w/v) to 4.5% (w/v);
wherein the preservative is benzyl alcohol, m-cresol, or phenol;
wherein the formulation does not comprise sodium chloride;
wherein the buffer is a citrate buffer, an acetate buffer, or a histidine buffer;
wherein the non-ionic surfactant is polysorbate 80;
wherein the sugar alcohol is mannitol or sorbitol; and
wherein the concentration of the long-acting hGH conjugate ranges from 58.5 to 60 mg/mL.
US Pat. No. 10,987,426

COMPOSITIONS IN THE FORM OF AN INJECTABLE AQUEOUS SOLUTION COMPRISING HUMAN GLUCAGON AND A CO-POLYAMINO ACID

ADOCIA, Lyons (FR)

1. A composition in the form of an injectable aqueous solution, wherein the pH is from 6.0 to 8.0, comprising at least:a) human glucagon;
b) a co-polyamino acid consisting of glutamic or aspartic units chosen among the co-polyamino acids according to formula I as defined below:
[Q(PLG)k][Hy]j[Hy]j?  Formula I
wherein:
j?1; 0?j??n?1; k?2
said co-polyamino acid according to formula I bearing carboxylate charges and at least one hydrophobic radical -Hy, the co-polyamino acid including at least two chains of glutamic or aspartic units PLG bound together by an at least divalent linear or branched radical or spacer Q[-*]k consisting of an alkyl chain comprising one or a plurality of heteroatoms chosen from the group consisting of nitrogen and oxygen atoms and/or bearing one or a plurality of heteroatoms consisting of nitrogen and oxygen radicals and/or radicals bearing one or a plurality of heteroatoms consisting of nitrogen and oxygen atoms and/or carboxyl functions,
said radical or spacer Q[-*]k being bound to at least two glutamic or aspartic unit chains PLG by an amide function,
said amide functions binding said radical or spacer Q[-*]k bound to said at least two chains of glutamic or aspartic units result from the reaction between an amine function and an acid function respectively borne either by a precursor Q? of the radical or spacer Q[-*]k or by a glutamic or aspartic unit, and
said hydrophobic radical -Hy being bound either to a terminal amino acid unit and then j?1, or to a carboxyl function borne by one of the chains of the glutamic or aspartic units PLG and then j?=n?1 and n?1 is the mean number of monomeric units bearing a hydrophobic radical -Hy.
US Pat. No. 10,988,452

METHOD PRODUCING FOR 5-HYDROXYMETHYL-2-FURFURAL WITH SUPPRESSED BY-PRODUCT FORMATION

Nihon Shokuhin Kako Co., ...

1. A method for suppressing the production of byproducts in a reaction for producing 5-hydroxymethyl-2-furfural, through a dehydration reaction, from a carbohydrate comprising a hexose as a constituent sugar or a derivative thereof, wherein the dehydration reaction is performed in the presence of activated carbon.
US Pat. No. 10,987,428

PHOSPHOROTHIOATE-CONJUGATED MIRNAS AND METHODS OF USING THE SAME

CITY OF HOPE, Duarte, CA...

1. A cell penetrating nucleic acid conjugate comprising:(i) a non-cell penetrating ribonucleic acid compound comprising the sequence of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4 or SEQ ID NO:5;
(ii) a phosphorothioate polymer; and
(iii) a chemical linker attaching said phosphorothioate polymer to the 3? end of said non-cell penetrating ribonucleic acid compound;
wherein said phosphorothioate polymer enhances intracellular delivery of the non-cell penetrating nucleic acid compound and wherein said non-cell penetrating ribonucleic acid compound is a non-phosphorothioated ribonucleic acid.
US Pat. No. 10,988,453

COMPOSITIONS COMPRISING AN UROLITHIN COMPOUND

Amazentis SA, Ecublens (...

1. A composition comprising:a) a source of protein and
b) micronized urolithin A;
wherein the micronized urolithin A has a D50 size in the range 0.5 to 50 ?m, and a D90 size in the range 5 to 100 ?m.
US Pat. No. 10,988,454

MODULATORS OF THE CYSTIC FIBROSIS TRANSMEMBRANE CONDUCTANCE REGULATOR PROTEIN AND METHODS OF USE

Galapagos NV, Mechelen (...

1. A compound, or a pharmaceutically acceptable salt thereof, wherein the compound is selected from the group consisting of:1-(5-cyclobutyl-2-methoxypyridin-3-yl)-N-(2-methylquinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-(5-cyclobutyl-2-methoxypyridin-3-yl)-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-(5-cyclopropyl-2-methoxyphenyl)-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-{5-methoxy-5-[(propan-2-yl)oxy]phenyl}-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-(5-cyclobut-2-methoxypyridin)-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-(5-bromo-2-methoxyphenyl)-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-(5-cyclobutyl-2-methoxypyridin-3-yl)-N-(pyrazolo[1,5-a]pyridin-4-sulfonyl)cyclopropane-1-carboxamide;
1-(5-cyclobutyl-2-methoxypyridin-3-yl)-N-(1-methyl-1H-indole-7-sulfonyl)cyclopropane-1-carboxamide;
1-(5-cyclobutyl-2-methoxypyridin-3-yl)-N-(1H-indole-4-sulfonyl)cyclopropane-1-carboxamide;
N-(1H-indole-4-sulfonyl)-1-[2-methoxy-5-(trifluoromethyl)pyridin-3-yl]cyclopropane-1-carboxamide;
1-(5-cyclobutyl-2-methoxyphenyl)-N-(pyrazolo[1,5-a]pyridine-4-sulfonyl)cyclobutane-1-carboxamide;
1-(5-cyclobutyl-2-methoxyphenyl)-N-(1-methyl-1H-benzimidazole-7-sulfonyl)cyclobutane-1-carboxamide;
1-(5-cyclobutyl-2-methoxyphenyl)-N-(1-methyl-1H-indazole-7-sulfonyl)cyclobutane-1-carboxamide;
1-(5-cyclobutyl-2-methoxyphenyl)-N-(1H-indazole-4-sulfonyl)cyclobutane-1-carboxamide;
1-(2,5-dimethoxyphenyl)-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-(5-ethoxy-2-methoxyphenyl)-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[5-(cyclobutyloxy)-2-methoxyphenyl]-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-(5-cyclobutyl-2-methoxyphenyl)-N-(2-methylquinoline-5-sulfonyl)cyclobutane-1-carboxamide;
1-(5-tert-butyl-2-methoxyphenyl)-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[2-methoxy-5-(propan-2-yl)phenyl]-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[4-fluoro-2-methoxy-5-(propan-2-yl)phenyl]-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[2-methoxy-5-(trifluoromethyl)phenyl]-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[5-(bicyclo[1.1.1]pentan-1-yl)-2-methoxyphenyl]-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-(2,6-dimethoxy-3-methylphenyl)-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-(2,6-dimethoxy-3-methylphenyl)-N-(1H-indole-4-sulfonyl)cyclopropane-1-carboxamide;
1-(2,6-dimethoxy-3-methylphenyl)-N-(2-methylquinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-(2-methoxy-5-methylphenyl)-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-(2-ethoxy-6-methoxyphenyl)-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[2-(cyclopropylmethoxy)-6-methoxyphenyl]-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-(6-methoxy-2,3-dimethylphenyl)-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-(3-cyclopropyl-6-methoxy-2-methylphenyl)-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
N-(1H-indole-4-sulfonyl)-1-(2-methoxy-5-methylphenyl)cyclopropane-1-carboxamide;
1-[2-methoxy-6-(propan-2-yl)phenyl]-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-(2-cyclobutyl-6-methoxyphenyl)-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[2-methoxy-5-(2-methoxypropan-2-yl)phenyl]-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
N-(1H-indazole-4-sulfonyl)-1-(2-methoxy-5-methylphenyl)cyclopropane-1-carboxamide;
1-(5-cyclobutyl-2-methoxyphenyl)-N-(1H-indole-4-sulfonyl)cyclopropane-1-carboxamide;
1-(5-cyclobutyl-2-methoxyphenyl)-N-(1H-indazole-4-sulfonyl)cyclopropane-1-carboxamide;
1-[2-(dimethylamino)-5-(trifluoromethyl)pyridin-3-yl]-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-(5-cyclobutyl-2-methoxyphenyl)-N-(1-methyl-1H-indole-4-sulfonyl)cyclopropane-1-carboxamide;
1-(5-cyclobutyl-2-methoxyphenyl)-N-(1-methyl-1H-indole-7-sulfonyl)cyclopropane-1-carboxamide;
1-(5-cyclobutyl-2-methoxyphenyl)-N-(1-methyl-1H-indazole-7-sulfonyl)cyclopropane-1-carboxamide;
1-(5-cyclobutyl-2-methoxyphenyl)-N-(pyrazolo[1,5-a]pyridine-4-sulfonyl)cyclopropane-1-carboxamide;
1-(5-cyclobutyl-2-methoxyphenyl)-N-(2-methylquinoline-8-sulfonyl)cyclopropane-1-carboxamide;
1-(5-cyclobutyl-2-methoxyphenyl)-N-(2-methylquinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-(2-methoxy-5-methylphenyl)-N-(2-methylquinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[5-(difluoromethoxy)-2-methoxyphenyl]-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-(2,6-diethoxyphenyl)-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
N-(2-aminoquinoline-5-sulfonyl)-1-(5-cyclobutyl-2-methoxyphenyl)cyclopropane-1-carboxamide;
1-(5-cyclopropyl-2-methoxyphenyl)-N-(2-methylquinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-(5-ethoxy-2-methoxyphenyl)-N-(2-methylquinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-(5-tert-butyl-2-methoxyphenyl)-N-(2-methylquinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[2-methoxy-5-(propan-2-yl)phenyl]-N-(2-methylquinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[2-(dimethylamino)-5-(trifluoromethyl)pyridin-3-yl]-N-(2-methylquinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-{2-methoxy-5-[1-(methoxymethyl)cyclopropyl]phenyl}-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-{2-methoxy-5-[1-(methoxymethyl)cyclopropyl]phenyl}-N-(2-methylquinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-{5-methyl-2-[(propan-2-yl)oxy]phenyl}-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-{5-methyl-2-[(propan-2-yl)oxy]phenyl}-N-(2-methylquinoline-5-sulfonyl)cyclopropane-1-carboxamide;
N-(2-aminoquinoline-5-sulfonyl)-1-(2-methoxy-5-methylphenyl)cyclopropane-1-carboxamide;
1-(4-cyclobutyl-2,6-dimethoxyphenyl)-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
N-(2-aminoquinoline-5-sulfonyl)-1-(2,5-dimethylphenyl)cyclopropane-1-carboxamide;
1-(2-ethoxy-5-methylphenyl)-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-(2-ethoxy-5-methylphenyl)-N-(2-methylquinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-(5-ethyl-2-methoxyphenyl)-N-(2-methylquinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-{2-methoxy-5-[1-(methylamino)cyclopropyl]phenyl}-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-(4-cyclobutyl-2,6-dimethoxyphenyl)-N-(1H-indole-4-sulfonyl)cyclopropane-1-carboxamide;
N-(2-aminoquinoline-5-sulfonyl)-1-{5-methyl-2-[(propan-2-yl)oxy]phenyl}cyclopropane-1-carboxamide;
1-[2-methoxy-5-(1-methoxycyclobutyl)phenyl]-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
N-(2-aminoquinoline-5-sulfonyl)-1-(2-ethoxy-5-methylphenyl)cyclopropane-1-carboxamide;
1-[2-methoxy-5-(oxetan-3-yl)phenyl]-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-(2-ethoxy-5-methylphenyl)-N-(2-methyl-1H-indole-4-sulfonyl)cyclopropane-1-carboxamide;
N-(2-aminoquinoline-5-sulfonyl)-1-[2-methoxy-5-(2-methylpropoxy)pyridin-4-yl]cyclopropane-1-carboxamide;
1-{5-methyl-2-[(oxetan-3-yl)oxy]phenyl}-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[5-ethyl-2-(2-methylpropoxy)pyridin-3-yl]-N-(1H-indazole-4-sulfonyl)cyclopropane-1-carboxamide;
1-(2-{[(2R)-1-methoxypropan-2-yl]oxy}-5-methylphenyl)-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
N-(2-aminoquinoline-5-sulfonyl)-1-[5-methyl-2-(2-methylpropoxy)pyridin-3-yl]cyclopropane-1-carboxamide;
N-(2-aminoquinoline-5-sulfonyl)-1-{5-methyl-2-[(propan-2-yl)oxy]pyridin-3-yl}cyclopropane-1-carboxamide;
N-(2-aminoquinoline-5-sulfonyl)-1-[5-ethyl-2-(2-methylpropoxy)pyridin-3-yl]cyclopropane-1-carboxamide;
1-[2-ethoxy-5-(2-ethoxypropan-2-yl)phenyl]-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[2-(difluoromethoxy)-5-methylphenyl]-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[2-ethoxy-5-(1-methoxy-2-methylpropan-2-yl)phenyl]-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[2-ethoxy-5-(1-methoxycyclobutyl)phenyl]-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[2-ethoxy-5-(2-ethoxypropan-2-yl)phenyl]-N-(2-methylquinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[2-ethoxy-5-(2-methoxypropan-2-yl)phenyl]-N-(2-methylquinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[2-ethoxy-5-(1-methoxycyclobutyl)phenyl]-N-(2-methylquinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-{5-methyl-2-[(oxetan-3-yl)oxy]phenyl}-N-(2-methylquinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-(2-{[(2R)-1-methoxypropan-2-yl]oxy}-5-methylphenyl)-N-(2-methylquinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[3-(dimethylamino)-6-(2-methylpropoxy)pyridin-2-yl]-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[5-(dimethylamino)-2-(2-methylpropoxy)pyridin-3-yl]-N-(2-methylquinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[2-methoxy-5-(1-methoxy-2-methylpropan-2-yl)phenyl]-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-{2-[(2R)-2-methoxypropoxy]-5-methylphenyl}-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-{2-[(2R)-2-methoxypropoxy]-5-methylphenyl}-N-(2-methylquinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-(5-ethyl-2-{[(3S)-oxolan-3-yl]oxy}phenyl)-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-(5-ethyl-2-{[(3R)-oxolan-3-yl]oxy}phenyl)-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-(5-ethyl-2-{[(3R)-oxolan-3-yl]oxy}phenyl)-N-(2-methylquinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-(5-methyl-2-{[(3R)-oxolan-3-yl]oxy}phenyl)-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-(5-methyl-2-{[(3R)-oxolan-3-yl]oxy}phenyl)-N-(2-methylquinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-(5-methyl-2-{[(3S)-oxolan-3-yl]oxy}phenyl)-N-(2-methylquinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[2-methoxy-5-(trifluoromethyl)pyridin-3-yl]-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[2-methoxy-5-(trifluoromethyl)pyridin-3-yl]-N-(2-methylquinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-(5-cyclobutyl-2-methoxypyridin-3-yl)-N-(1-methyl-1H-benzimidazole-7-sulfonyl)cyclopropane-1-carboxamide;
1-(5-cyclobutyl-2-methoxypyridin-3-yl)-N-(1-methyl-1H-indazole-7-sulfonyl)cyclopropane-1-carboxamide;
1-(5-cyclobutyl-2-methoxypyridin-3-yl)-N-(1-methyl-1H-indole-4-sulfonyl)cyclopropane-1-carboxamide;
1-(5-cyclobutyl-2-methoxypyridin-3-yl)-N-(1H-indazole-4-sulfonyl)cyclopropane-1-carboxamide;
1-(5-cyclobutyl-2-methoxypyridin-3-yl)-N-(3-methylimidazo[1,2-a]pyridine-5-sulfonyl)cyclopropane-1-carboxamide;
1-[2-methoxy-5-(trifluoromethyl)pyridin-3-yl]-N-(1-methyl-1H-indole-7-sulfonyl)cyclopropane-1-carboxamide;
1-[2-methoxy-5-(trifluoromethyl)pyridin-3-yl]-N-(1-methyl-1H-indole-4-sulfonyl)cyclopropane-1-carboxamide;
1-[2-methoxy-5-(trifluoromethyl)pyridin-3-yl]-N-(3-methylimidazo[1,2-a]pyridine-5-sulfonyl)cyclopropane-1-carboxamide;
1-{2-methoxy-5-[(oxolan-3-yl)oxy]phenyl}-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[2-chloro-5-(trifluoromethoxy)phenyl]-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-(5-bromo-2-methoxyphenyl)-N-(2-methylquinoline-5-sulfonyl)cyclobutane-1-carboxamide;
methyl 1-(4-methoxy-3-{1-[(quinoline-5-sulfonyl)carbamoyl]cyclopropyl}phenyl)cyclopropane-1-carboxylate;
methyl 4-methoxy-3-{1-[(quinoline-5-sulfonyl)carbamoyl]cyclopropyl}benzoate;
1-(5-cyclobutyl-2-methoxy-4-methylpyridin-3-yl)-N-(2-methylquinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-(2-methoxy-6-methylphenyl)-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-(2,6-dimethoxy-3-methylphenyl)-N-(2-methylquinoline-8-sulfonyl)cyclopropane-1-carboxamide;
1-(5-cyclobutyl-2-methoxy-4-methylpyridin-3-yl)-N-(1-methyl-1H-indole-4-sulfonyl)cyclopropane-1-carboxamide;
1-(5-cyclobutyl-2-methoxy-4-methylpyridin-3-yl)-N-(1-methyl-1H-indole-7-sulfonyl)cyclopropane-1-carboxamide;
1-(5-cyclobutyl-2-methoxy-4-methylpyridin-3-yl)-N-(1-methyl-1H-indazole-7-sulfonyl)cyclopropane-1-carboxamide;
1-(5-cyclobutyl-2-methoxy-4-methylpyridin-3-yl)-N-(2-methylquinoline-8-sulfonyl)cyclopropane-1-carboxamide;
1-(2-methoxy-6-methylphenyl)-N-(2-methylquinoline-8-sulfonyl)cyclopropane-1-carboxamide;
1-(2-cyclobutyl-5-methoxyphenyl)-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-(2-cyclobutyl-5-methoxyphenyl)-N-(2-methylquinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[5-(hydroxymethyl)-2-methoxyphenyl]-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[2-methoxy-5-(methoxymethyl)phenyl]-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-(2-methoxy-6-methylphenyl)-N-(2-methylquinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-(6-methoxy-2,3-dimethylphenyl)-N-(2-methylquinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-(3-cyclopropyl-6-methoxy-2-methylphenyl)-N-(2-methylquinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-(3-chloro-2,6-dimethoxyphenyl)-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-(5-methoxy-2-methylphenyl)-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-(2-cyclopropyl-6-methoxyphenyl)-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[5-methoxy-2-(propan-2-yl)phenyl]-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-(5-methoxy-2-propylphenyl)-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-(2-cyclopropyl-6-methoxyphenyl)-N-(2-methylquinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-(2,5-dimethylphenyl)-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-(5-ethyl-2-methoxyphenyl)-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-(2-methoxy-4-methylphenyl)-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-(2-methoxy-3-methylphenyl)-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-(4-cyclobutyl-2,6-dimethoxyphenyl)-N-(1-methyl-1H-indole-4-sulfonyl)cyclopropane-1-carboxamide;
1-(4-cyclobutyl-2,6-dimethoxyphenyl)-N-(1-methyl-1H-indole-7-sulfonyl)cyclopropane-1-carboxamide;
1-(4-cyclobutyl-2,6-dimethoxyphenyl)-N-(1-methyl-1H-indazole-7-sulfonyl)cyclopropane-1-carboxamide;
1-(4-cyclobutyl-2,6-dimethoxyphenyl)-N-(pyrazolo[1,5-a]pyridine-4-sulfonyl)cyclopropane-1-carboxamide;
1-(4-cyclobutyl-2,6-dimethoxyphenyl)-N-(2-methylquinoline-5-sulfonyl)cyclopropane-1-carboxamide;
N-(2-aminoquinoline-5-sulfonyl)-1-(4-cyclobutyl-2,6-dimethoxyphenyl)cyclopropane-1-carboxamide;
N-(2-aminoquinoline-5-sulfonyl)-1-(5-ethyl-2-methoxyphenyl)cyclopropane-1-carboxamide;
1-(5-ethyl-2-methoxyphenyl)-N-(1H-indazole-4-sulfonyl)cyclopropane-1-carboxamide;
1-(2-ethyl-6-methoxyphenyl)-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-(2-ethoxy-5-methylphenyl)-N-(1H-indazole-4-sulfonyl)cyclopropane-1-carboxamide;
N-(1H-indazole-4-sulfonyl)-1-{5-methyl-2-[(propan-2-yl)oxy]phenyl}cyclopropane-1-carboxamide;
1-(4-cyclobutyl-2,6-dimethoxyphenyl)-N-(1H-indazole-4-sulfonyl)cyclopropane-1-carboxamide;
N-(1H-indazole-4-sulfonyl)-1-(6-methoxy-2,3-dimethylphenyl)cyclopropane-1-carboxamide;
1-(3-cyclopropyl-6-methoxy-2-methylphenyl)-N-(1H-indazole-4-sulfonyl)cyclopropane-1-carboxamide;
N-(1H-indole-4-sulfonyl)-1-{5-methyl-2-[(propan-2-yl)oxy]phenyl}cyclopropane-1-carboxamide;
1-(2,5-dimethylphenyl)-N-(1H-indole-4-sulfonyl)cyclopropane-1-carboxamide;
1-(2-cyclopropyl-6-methoxyphenyl)-N-(1H-indazole-4-sulfonyl)cyclopropane-1-carboxamide;
N-(2-aminoquinoline-5-sulfonyl)-1-{2-methoxy-5-[1-(methoxymethyl)cyclopropyl]phenyl}cyclopropane-1-carboxamide;
1-(2-ethoxy-5-methylphenyl)-N-(2-methoxyquinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-(2-ethoxy-5-methylphenyl)-N-[2-(methylamino)quinoline-5-sulfonyl]cyclopropane-1-carboxamide;
1-(2-ethoxy-5-methylphenyl)-N-(1H-indole-4-sulfonyl)cyclopropane-1-carboxamide;
1-[2-methoxy-5-(2,2,2-trifluoro-1-methoxyethyl)phenyl]-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[2-methoxy-5-(1-methoxyethyl)phenyl]-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
N-(1H-indole-4-sulfonyl)-1-[2-methoxy-5-(2-methoxypropan-2-yl)phenyl]cyclopropane-1-carboxamide;
1-[2-methoxy-5-(3-methyloxetan-3-yl)phenyl]-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
N-(2-aminoquinoline-5-sulfonyl)-1-{5-methyl-2-[(oxetan-3-yl)oxy]phenyl}cyclopropane-1-carboxamide;
N-(1H-indazole-4-sulfonyl)-1-[2-methoxy-5-(2-methylpropoxy)pyridin-4-yl]cyclopropane-1-carboxamide;
1-(2-{[(2S)-1-methoxypropan-2-yl]oxy}-5-methylphenyl)-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[5-cyclopropyl-2-(2-methylpropoxy)pyridin-3-yl]-N-(2-methoxyquinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[5-cyclobutyl-2-(2-methylpropoxy)pyridin-3-yl]-N-(2-methoxyquinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-{5-cyclopropyl-2-[(propan-2-yl)oxy]pyridin-3-yl}-N-(2-methoxyquinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[5-(2-ethoxypropan-2-yl)-2-methoxyphenyl]-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[2-ethoxy-5-(2-methoxypropan-2-yl)phenyl]-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[2-(difluoromethoxy)-5-ethylphenyl]-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[2-methoxy-5-(2-methoxypropan-2-yl)phenyl]-N-(2-methylquinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[2-methoxy-5-(1-methoxycyclobutyl)phenyl]-N-(2-methylquinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[2-(difluoromethoxy)-5-methylphenyl]-N-(2-methylquinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[5-chloro-2-(difluoromethoxy)phenyl]-N-(2-methylquinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[2-(difluoromethoxy)-5-ethylphenyl]-N-(2-methylquinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-(2-{[(2S)-1-methoxypropan-2-yl]oxy}-5-methylphenyl)-N-(2-methylquinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[2-ethoxy-5-(1-methoxy-2-methylpropan-2-yl)phenyl]-N-(2-methylquinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[2-(difluoromethoxy)-5-(2-ethoxypropan-2-yl)phenyl]-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[2-(difluoromethoxy)-5-(2-ethoxypropan-2-yl)phenyl]-N-(2-methylquinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[2-(difluoromethoxy)-5-(2-methoxypropan-2-yl)phenyl]-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[2-(difluoromethoxy)-5-(2-methoxypropan-2-yl)phenyl]-N-(2-methylquinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[5-(1-ethoxy-2-methylpropan-2-yl)-2-methoxyphenyl]-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[5-(1-ethoxy-2-methylpropan-2-yl)-2-methoxyphenyl]-N-(2-methylquinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[5-(dimethylamino)-2-(2-methylpropoxy)pyridin-3-yl]-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[2-methoxy-5-(1-methoxy-2-methylpropan-2-yl)phenyl]-N-(2-methylquinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-(5-ethyl-2-{[(3S)-oxolan-3-yl]oxy}phenyl)-N-(2-methylquinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-(5-methyl-2-{[(3S)-oxolan-3-yl]oxy}phenyl)-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
4-(5-methoxy-2-methylphenyl)-1-methyl-N-(quinoline-5-sulfonyl)piperidine-4-carboxamide;
1-[2-methoxy-5-(trifluoromethyl)pyridin-3-yl]-N-(pyrazolo[1,5-a]pyridine-4-sulfonyl)cyclopropane-1-carboxamide;
1-[2-methoxy-5-(trifluoromethyl)pyridin-3-yl]-N-(1-methyl-1H-benzimidazole-7-sulfonyl)cyclopropane-1-carboxamide;
1-[2-methoxy-5-(trifluoromethyl)pyridin-3-yl]-N-(1-methyl-1H-indazole-7-sulfonyl)cyclopropane-1-carboxamide;
N-(1H-indazole-4-sulfonyl)-1-[2-methoxy-5-(trifluoromethyl)pyridin-3-yl]cyclopropane-1-carboxamide;
1-(5-cyano-2-methoxyphenyl)-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-(2-methoxy-6-methylphenyl)-N-(1-methyl-1H-indole-4-sulfonyl)cyclopropane-1-carboxamide;
1-(3,5-dichloro-2,6-dimethoxyphenyl)-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[2-methoxy-6-(1-methyl-1H-pyrazol-4-yl)phenyl]-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-(4-cyclobutyl-2,6-dimethoxyphenyl)-N-(1-methyl-1H-benzimidazole-7-sulfonyl)cyclopropane-1-carboxamide;
1-(3-methoxy-6-methylpyridin-2-yl)-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-(3-methoxy-6-methylpyridin-2-yl)-N-(2-methylquinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-(2,5-dimethylphenyl)-N-(1H-indazole-4-sulfonyl)cyclopropane-1-carboxamide;
1-[2-methoxy-5-(3-methoxyoxetan-3-yl)phenyl]-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-{2-methoxy-5-[(3-2H)oxetan-3-yl]phenyl}-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
N-(1H-indazole-4-sulfonyl)-1-[5-methyl-2-(2-methylpropoxy)pyridin-3-yl]cyclopropane-1-carboxamide;
N-(1H-indazole-4-sulfonyl)-1-{5-methyl-2-[(propan-2-yl)oxy]pyridin-3-yl}cyclopropane-1-carboxamide;
1-(2-ethyl-6-methoxyphenyl)-N-(1H-indazole-4-sulfonyl)cyclopropane-1-carboxamide;
1-(2-ethyl-6-methoxyphenyl)-N-(2-methylquinoline-5-sulfonyl)cyclopropane-1-carboxamide;
N-[2-(dimethylamino)quinoline-5-sulfonyl]-1-(2-ethoxy-5-methylphenyl)cyclopropane-1-carboxamide;
1-{5-bromo-2-[(propan-2-yl)oxy]pyridin-3-yl}-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide
1-[2-propyl-6-(trifluoromethyl)pyridin-3-yl]-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[2-cyclopropyl-6-(trifluoromethyl)pyridin-3-yl]-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[2-(propan-2-yl)-6-(trifluoromethyl)pyridin-3-yl]-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[2-cyclopropyl-5-(2-methylpropoxy)pyridin-3-yl]-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[2-(pyrrolidin-1-yl)-6-(trifluoromethyl)pyridin-3-yl]-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-{2-methoxy-5-[(propan-2-yl)oxy]pyridin-4-yl}-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-{6-methoxy-4-[(propan-2-yl)oxy]pyridin-3-yl}-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-{6-methoxy-4-[(propan-2-yl)oxy]pyridin-3-yl}-N-(2-methylquinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[2-methoxy-5-(2-methylpropoxy)pyridin-4-yl]-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[2-methoxy-5-(2-methylpropoxy)pyridin-4-yl]-N-(2-methylquinoline-5-sulfonyl)cyclopropane-1-carboxamide;
N-(1H-indole-4-sulfonyl)-1-[2-methoxy-5-(2-methylpropoxy)pyridin-4-yl]cyclopropane-1-carboxamide;
1-{5-cyclobutyl-2-[(propan-2-yl)oxy]pyridin-3-yl}-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-{5-cyclobutyl-2-[(propan-2-yl)oxy]pyridin-3-yl}-N-(2-methylquinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-{5-cyclobutyl-2-[(propan-2-yl)oxy]pyridin-3-yl}-N-(1H-indole-4-sulfonyl)cyclopropane-1-carboxamide;
1-{2-cyclobutyl-5-[(propan-2-yl)oxy]pyridin-4-yl}-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-{2-cyclobutyl-5-[(propan-2-yl)oxy]pyridin-4-yl}-N-(2-methylquinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-{2-cyclobutyl-5-[(propan-2-yl)oxy]pyridin-4-yl}-N-(1H-indole-4-sulfonyl)cyclopropane-1-carboxamide;
1-[5-cyclobutyl-2-(pyrrolidin-1-yl)pyridin-3-yl]-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[5-cyclobutyl-2-(pyrrolidin-1-yl)pyridin-3-yl]-N-(2-methylquinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[5-cyclobutyl-2-(pyrrolidin-1-yl)pyridin-3-yl]-N-(1H-indole-4-sulfonyl)cyclopropane-1-carboxamide;
1-[5-cyclopropyl-2-(pyrrolidin-1-yl)pyridin-3-yl]-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[5-cyclopropyl-2-(pyrrolidin-1-yl)pyridin-3-yl]-N-(2-methylquinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[5-cyclopropyl-2-(pyrrolidin-1-yl)pyridin-3-yl]-N-(1H-indole-4-sulfonyl)cyclopropane-1-carboxamide;
1-[5-chloro-2-(pyrrolidin-1-yl)pyridin-3-yl]-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[5-chloro-2-(pyrrolidin-1-yl)pyridin-3-yl]-N-(2-methylquinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[5-ethyl-2-(pyrrolidin-1-yl)pyridin-3-yl]-N-(1H-indole-4-sulfonyl)cyclopropane-1-carboxamide;
1-{6-cyclobutyl-3-[(propan-2-yl)oxy]pyridin-2-yl}-N-(1H-indole-4-sulfonyl)cyclopropane-1-carboxamide;
1-{6-cyclobutyl-3-[(propan-2-yl)oxy]pyridin-2-yl}-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
N-(1H-indole-4-sulfonyl)-1-[5-methyl-2-(2-methylpropoxy)pyridin-3-yl]cyclopropane-1-carboxamide;
1-[5-ethyl-2-(2-methylpropoxy)pyridin-3-yl]-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[5-ethyl-2-(2-methylpropoxy)pyridin-3-yl]-N-(2-methylquinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[5-ethyl-2-(2-methylpropoxy)pyridin-3-yl]-N-(1H-indole-4-sulfonyl)cyclopropane-1-carboxamide;
1-[5-cyclopropyl-2-(2-methylpropoxy)pyridin-3-yl]-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[5-cyclopropyl-2-(2-methylpropoxy)pyridin-3-yl]-N-(1H-indole-4-sulfonyl)cyclopropane-1-carboxamide;
1-[5-cyclobutyl-2-(2-methylpropoxy)pyridin-3-yl]-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[5-cyclobutyl-2-(2-methylpropoxy)pyridin-3-yl]-N-(1H-indole-4-sulfonyl)cyclopropane-1-carboxamide;
1-[5-cyclobutyl-2-(2-methylpropoxy)pyridin-3-yl]-N-(2-methylquinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-{6-ethyl-3-[(propan-2-yl)oxy]pyridin-2-yl}-N-(2-methylquinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-{6-ethyl-3-[(propan-2-yl)oxy]pyridin-2-yl}-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-{6-ethyl-3-[(propan-2-yl)oxy]pyridin-2-yl}-N-(1H-indole-4-sulfonyl)cyclopropane-1-carboxamide;
1-[5-cyclobutyl-2-(4-methoxypiperidin-1-yl)pyridin-3-yl]-N-(1H-indole-4-sulfonyl)cyclopropane-1-carboxamide;
1-{5-methyl-2-[(propan-2-yl)oxy]pyridin-3-yl}-N-(2-methylquinoline-5-sulfonyl)cyclopropane-1-carboxamide;
N-(1H-indole-4-sulfonyl)-1-{5-methyl-2-[(propan-2-yl)oxy]pyridin-3-yl}cyclopropane-1-carboxamide;
N-(1H-indole-4-sulfonyl)-1-{2-[(propan-2-yl)oxy]-5-(pyrrolidin-1-yl)pyridin-3-yl}cyclopropane-1-carboxamide;
1-{2,5-bis[(propan-2-yl)oxy]pyridin-3-yl}-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-{2,5-bis[(propan-2-yl)oxy]pyridin-3-yl}-N-(1H-indole-4-sulfonyl)cyclopropane-1-carboxamide;
1-{2,5-bis[(propan-2-yl)oxy]pyridin-3-yl}-N-(2-methylquinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[2-(2-methylpropoxy)-5-(pyrrolidin-1-yl)pyridin-3-yl]-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[2-(2-methylpropoxy)-5-(pyrrolidin-1-yl)pyridin-3-yl]-N-(2-methylquinoline-5-sulfonyl)cyclopropane-1-carboxamide;
N-(1H-indole-4-sulfonyl)-1-[2-(2-methylpropoxy)-5-(pyrrolidin-1-yl)pyridin-3-yl]cyclopropane-1-carboxamide;
1-{5-(dimethylamino)-2-[(propan-2-yl)oxy]pyridin-3-yl}-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-{5-(dimethylamino)-2-[(propan-2-yl)oxy]pyridin-3-yl}-N-(2-methylquinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-{5-(dimethylamino)-2-[(propan-2-yl)oxy]pyridin-3-yl}-N-(1H-indole-4-sulfonyl)cyclopropane-1-carboxamide;
1-{5-methoxy-2-[(propan-2-yl)oxy]pyridin-3-yl}-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
N-(1H-indole-4-sulfonyl)-1-{5-methoxy-2-[(propan-2-yl)oxy]pyridin-3-yl}cyclopropane-1-carboxamide;
1-{5-methoxy-2-[(propan-2-yl)oxy]pyridin-3-yl}-N-(2-methylquinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[5-methoxy-2-(2-methylpropoxy)pyridin-3-yl]-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
N-(1H-indole-4-sulfonyl)-1-[5-methoxy-2-(2-methylpropoxy)pyridin-3-yl]cyclopropane-1-carboxamide;
1-[5-methoxy-2-(2-methylpropoxy)pyridin-3-yl]-N-(2-methylquinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-{6-methyl-2-[(propan-2-yl)oxy]pyridin-3-yl}-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-{6-methyl-2-[(propan-2-yl)oxy]pyridin-3-yl}-N-(2-methylquinoline-5-sulfonyl)cyclopropane-1-carboxamide;
N-(1H-indole-4-sulfonyl)-1-{6-methyl-2-[(propan-2-yl)oxy]pyridin-3-yl}cyclopropane-1-carboxamide;
1-{5-(azetidin-1-yl)-2-[(propan-2-yl)oxy]pyridin-3-yl}-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-{5-(azetidin-1-yl)-2-[(propan-2-yl)oxy]pyridin-3-yl}-N-(2-methylquinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-{5-(azetidin-1-yl)-2-[(propan-2-yl)oxy]pyridin-3-yl}-N-(1H-indole-4-sulfonyl)cyclopropane-1-carboxamide;
1-{6-(2-methylpropoxy)-3-[(propan-2-yl)oxy]pyridin-2-yl}-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[2-(cyclopropylmethoxy)-5-methoxypyridin-3-yl]-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[2-(cyclopropylmethoxy)-5-methoxypyridin-3-yl]-N-(1H-indole-4-sulfonyl)cyclopropane-1-carboxamide;
N-(1H-indole-4-sulfonyl)-1-{6-(2-methylpropoxy)-3-[(propan-2-yl)oxy]pyridin-2-yl}cyclopropane-1-carboxamide;
1-{6-(2-methylpropoxy)-3-[(propan-2-yl)oxy]pyridin-2-yl}-N-(2-methylquinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[5-(cyclopropylmethoxy)-2-methoxypyridin-4-yl]-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[2-(cyclopropylmethoxy)-5-methoxypyridin-3-yl]-N-(2-methylquinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[5-(cyclopropylmethoxy)-2-methoxypyridin-4-yl]-N-(2-methylquinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[5-cyclobutyl-2-(2-methoxyethoxy)pyridin-3-yl]-N-(2-methylquinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[5-(cyclopropylmethoxy)-2-methoxypyridin-4-yl]-N-(1H-indole-4-sulfonyl)cyclopropane-1-carboxamide;
1-[2-(cyclopropylmethoxy)-5-methylpyridin-3-yl]-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[2-(cyclopropylmethoxy)-5-methylpyridin-3-yl]-N-(1H-indole-4-sulfonyl)cyclopropane-1-carboxamide;
1-[5-cyclobutyl-2-(cyclopropylmethoxy)pyridin-3-yl]-N-(1H-indole-4-sulfonyl)cyclopropane-1-carboxamide;
1-[5-cyclobutyl-2-(2-methoxyethoxy)pyridin-3-yl]-N-(1H-indole-4-sulfonyl)cyclopropane-1-carboxamide;
1-[5-cyclobutyl-2-(cyclopropylmethoxy)pyridin-3-yl]-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[2-(cyclopropylmethoxy)-5-methylpyridin-3-yl]-N-(2-methylquinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-(5-ethyl-2-{4-[(propan-2-yl)oxy]piperidin-1-yl}pyridin-3-yl)-N-(1H-indole-4-sulfonyl)cyclopropane-1-carboxamide;
1-(5-cyclobutyl-2-{4-[(propan-2-yl)oxy]piperidin-1-yl}pyridin-3-yl)-N-(1H-indole-4-sulfonyl)cyclopropane-1-carboxamide;
1-(5-cyclobutyl-2-{4-[(propan-2-yl)oxy]piperidin-1-yl}pyridin-3-yl)-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[2-(cyclopropylmethoxy)-5-ethylpyridin-3-yl]-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[2-(cyclopropylmethoxy)-5-ethylpyridin-3-yl]-N-(2-methylquinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[2-(cyclopropylmethoxy)-5-ethylpyridin-3-yl]-N-(1H-indole-4-sulfonyl)cyclopropane-1-carboxamide;
1-[5-ethyl-2-(2-methoxyethoxy)pyridin-3-yl]-N-(1H-indole-4-sulfonyl)cyclopropane-1-carboxamide;
1-[5-cyclobutyl-2-(cyclopropylmethoxy)pyridin-3-yl]-N-(2-methylquinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[5-cyclobutyl-2-(2-methoxyethoxy)pyridin-3-yl]-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[5-ethyl-2-(2-methoxyethoxy)pyridin-3-yl]-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-(5-cyclobutyl-2-{4-[(propan-2-yl)oxy]piperidin-1-yl}pyridin-3-yl)-N-(2-methylquinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-(5-cyclobutyl-2-ethoxypyridin-3-yl)-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-(5-cyclobutyl-2-ethoxypyridin-3-yl)-N-(2-methylquinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-(2-ethoxy-5-ethylpyridin-3-yl)-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-(2-ethoxy-5-ethylpyridin-3-yl)-N-(2-methylquinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-{5-cyclobutyl-2-[4-(methoxymethyl)piperidin-1-yl]pyridin-3-yl}-N-(1H-indole-4-sulfonyl)cyclopropane-1-carboxamide;
1-{5-ethyl-2-[4-(methoxymethyl)piperidin-1-yl]pyridin-3-yl}-N-(1H-indole-4-sulfonyl)cyclopropane-1-carboxamide;
1-{5-cyclobutyl-2-[4-(methoxymethyl)piperidin-1-yl]pyridin-3-yl}-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-(5-chloro-2-methoxypyridin-4-yl)-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[5-methyl-2-(morpholin-4-yl)pyridin-4-yl]-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[5-methyl-2-(pyrrolidin-1-yl)pyridin-4-yl]-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[2-methoxy-6-(trifluoromethyl)pyridin-3-yl]-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide carboxamide;
1-[2-(dimethylamino)-5-methylpyridin-4-yl]-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-(2-methoxy-5-methylpyridin-4-yl)-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[2-cyclobutyl-6-(trifluoromethyl)pyridin-3-yl]-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-(2-cyclopropyl-5-methoxypyridin-3-yl)-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-{2-ethyl-5-[(propan-2-yl)oxy]pyridin-3-yl}-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-(2-ethoxy-5-methoxypyridin-3-yl)-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[2-cyclobutyl-6-(dimethylamino)-2-methoxypyridin-3-yl]-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-{5-cyclobutyl-3-[(propan-2-yl)oxy]pyridin-2-yl}-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[5-cyclobutyl-2-(morpholin-4-yl)pyridin-3-yl]-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[5-ethyl-2-(pyrrolidin-1-yl)pyridin-3-yl]-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[5-ethyl-2-(pyrrolidin-1-yl)pyridin-3-yl]-N-(2-methylquinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[5-ethyl-2-(morpholin-4-yl)pyridin-3-yl]-N-(2-methylquinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[5-methyl-2-(pyrrolidin-1-yl)pyridin-3-yl]-N-(2-methylquinoline-5-sulfonyl)cyclopropane-1-carboxamide;
N-(1H-indole-4-sulfonyl)-1-[5-methyl-2-(pyrrolidin-1-yl)pyridin-3-yl]cyclopropane-1-carboxamide;
1-[5-methyl-2-(pyrrolidin-1-yl)pyridin-3-yl]-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-(3-cyclopropyl-5-methylpyridin-2-yl)-N-(1H-indole-4-sulfonyl)cyclopropane-1-carboxamide;
1-[5-methoxy-2-(pyrrolidin-1-yl)pyridin-3-yl]-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[2-(dimethylamino)-5-methylpyridin-3-yl]-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[5-methoxy-2-(2-methoxyethoxy)pyridin-3-yl]-N-(2-methylquinoline-5-sulfonyl)cyclopropane-1-carboxamide;
N-(1H-indole-4-sulfonyl)-1-[5-methoxy-2-(2-methoxyethoxy)pyridin-3-yl]cyclopropane-1-carboxamide;
1-[5-methoxy-2-(2-methoxyethoxy)pyridin-3-yl]-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
N-(1H-indole-4-sulfonyl)-1-[2-methoxy-5-(2-methoxyethoxy)pyridin-4-yl]cyclopropane-1-carboxamide;
1-[2-methoxy-5-(2-methoxyethoxy)pyridin-4-yl]-N-(2-methylquinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[2-(dimethylamino)-5-ethylpyridin-3-yl]-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[2-(dimethylamino)-5-ethylpyridin-3-yl]-N-(2-methylquinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[2-(dimethylamino)-5-ethylpyridin-3-yl]-N-(1H-indole-4-sulfonyl)cyclopropane-1-carboxamide;
1-[2-(2-methoxyethoxy)-5-methylpyridin-3-yl]-N-(2-methylquinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-{2-(dimethylamino)-6-[(propan-2-yl)oxy]pyridin-3-yl}-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[2-(2-methoxyethoxy)-5-methylpyridin-3-yl]-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
N-(1H-indole-4-sulfonyl)-1-[2-(2-methoxyethoxy)-5-methylpyridin-3-yl]cyclopropane-1-carboxamide;
1-(5-ethyl-2-{4-[(propan-2-yl)oxy]piperidin-1-yl}pyridin-3-yl)-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-(5-ethyl-2-{4-[(propan-2-yl)oxy]piperidin-1-yl}pyridin-3-yl)-N-(2-methylquinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[5-ethyl-2-(2-methoxyethoxy)pyridin-3-yl]-N-(2-methylquinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[5-ethyl-2-(4-methoxypiperidin-1-yl)pyridin-3-yl]-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[5-ethyl-2-(4-methoxypiperidin-1-yl)pyridin-3-yl]-N-(1H-indole-4-sulfonyl)cyclopropane-1-carboxamide;
1-{5-ethyl-2-[4-(methoxymethyl)piperidin-1-yl]pyridin-3-yl}-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[3-chloro-5-(trifluoromethyl)pyridin-2-yl]-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[5-chloro-2-(trifluoromethyl)pyridin-3-yl]-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
N-(1H-indole-4-sulfonyl)-1-{6-methoxy-4-[(propan-2-yl)oxy]pyridin-3-yl}cyclopropane-1-carboxamide;
1-(3-cyclopropyl-5-methylpyridin-2-yl)-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[2-chloro-5-(2-methylpropoxy)pyridin-3-yl]-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-(6-methoxy-2-methylpyridin-3-yl)-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[5-cyclopropyl-2-(4-methylpiperazin-1-yl)pyridin-3-yl]-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[5-cyclopropyl-2-(trifluoromethyl)pyridin-3-yl]-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[2-methoxy-5-(2-methoxyethoxy)pyridin-4-yl]-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-{2-chloro-5-[(propan-2-yl)oxy]pyridin-3-yl}-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[5-(2,2-difluoroethoxy)-2-methoxypyridin-4-yl]-N-(2-methylquinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-(2-fluoro-5-methylpyridin-4-yl)-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[5-(2,2-difluoroethoxy)-2-methoxypyridin-4-yl]-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[5-(difluoromethoxy)-2-methoxypyridin-4-yl]-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[5-cyclopropyl-2-(morpholin-4-yl)pyridin-3-yl]-N-(2-methylquinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[5-(difluoromethoxy)-2-methoxypyridin-4-yl]-N-(2-methylquinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[5-ethyl-2-(morpholin-4-yl)pyridin-3-yl]-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-(2,4-dimethoxypyrimidin-5-yl)-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[5-cyclopropyl-2-(morpholin-4-yl)pyridin-3-yl]-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[5-methyl-2-(4-methylpiperazin-1-yl)pyridin-3-yl]-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[5-cyclopropyl-2-(4-methylpiperazin-1-yl)pyridin-3-yl]-N-(2-methylquinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[2-chloro-6-(trifluoromethyl)pyridin-3-yl]-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-(6-amino-2-methoxypyridin-3-yl)-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[5-cyclobutyl-2-(4-methylpiperazin-1-yl)pyridin-3-yl]-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[5-cyclobutyl-2-(4-methylpiperazin-1-yl)pyridin-3-yl]-N-(2-methylquinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-[5-ethyl-2-(4-methylpiperazin-1-yl)pyridin-3-yl]-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-(5-chloro-2-fluoropyridin-3-yl)-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide;
1-{5-(hydroxymethyl)-2-[(propan-2-yl)oxy]pyridin-3-yl}-N-(quinoline-5-sulfonyl)cyclopropane-1-carboxamide; and
1-[5-cyclopropyl-2-(4-methylpiperazin-1-yl)pyridin-3-yl]-N-(1H-indole-4-sulfonyl)cyclopropane-1-carboxamide.
US Pat. No. 10,988,711

CLEANING COMPOSITION WITH AN N-ALKYL-N,N-DIPOLYETHOXYETHYL-N-ALKYLAMMONIUM SALT IONIC LIQUID

1. An aqueous cleaning composition consisting essentially of:(a) an ionic liquid;
(b) amino alcohol, which comprises diisopropanolamine;
(c) at least about 85 wt. % water;
(d) an ethoxylated C10-15-aliphatic alcohol having an average of about 5 to 15 ethylene oxide subunits;
(e) an alkali metal iminodisuccinate salt; and
(f) a disinfecting quaternary benzylammonium surfactant; and
(g) optionally, a fragrance component;
wherein the ionic liquid comprises an N—(C1-2)-alkyl-N,N-bis(polyethoxyethyl)-N—(C8-22)-alkyl ammonium salt; and
other than the amino alcohol the composition does not contain any solvent.
US Pat. No. 10,987,432

THERAPEUTIC DELIVERY AND EXPRESSION SYSTEM, METHODS AND USES THEREOF

The University of Hong Ko...

1. A method to transfer a therapeutic vector from a bacterium to a tumor cell in a subject, said method comprising the steps of:(A) providing the bacterium, wherein the bacterium is a ST1/pIKR-shCAT bacterium; and
(B) administering the bacterium to the subject,
wherein the tumor cell is a breast tumor cell, a colon tumor cell, or a metastasized tumor cell.
US Pat. No. 10,988,714

METHODS OF FACILITATING REMOVAL OF A FINGERPRINT FROM A SUBSTRATE OR A COATING

Regents of the University...

1. A method of facilitating the removal of a fingerprint from a substrate or a coating comprising:providing a substrate or a coating formed of an organic crosslinkable polymer resin, wherein said substrate or coating further comprises a polyisocyanate crosslinker;
associating a lipase with said substrate or coating, said lipase capable of enzymatically degrading a fat or oil component of a fingerprint, wherein said lipase is entrapped within and crosslinked to said substrate or coating; and
facilitating by rinsing removal of a fingerprint from said substrate or said coating when contacted by a fingerprint.
US Pat. No. 10,987,434

DETECTION AND TREATMENT OF CARIES AND MICROCAVITIES WITH NANOPARTICLES

THE REGENTS OF THE UNIVER...

1. A method of making a nanoparticle for oral administration comprising:functionalizing a plurality of molecules of a starch polymer with a reactive group capable of reacting with a fluorescent imaging agent, wherein the plurality of molecules of the starch polymer are aggregated or crosslinked together to form the nanoparticle and the starch polymer comprises at least one cationic region capable of associating the nanoparticle with a subsurface portion of one or more carious lesions in a tooth in an oral cavity of a subject; and
reacting the reactive group on the starch polymer with the fluorescent imaging agent, so that the nanoparticle bears the fluorescent imaging agent that is capable of indicating the presence of one or more carious lesions in the subsurface portion when the nanoparticle is associated therewith, wherein the nanoparticle is non-toxic.
US Pat. No. 10,988,715

METHOD FOR TREATING COTTON

1. A method of treating cotton fabric comprising: (i) contacting the cotton fabric with an aqueous wash liquor comprising water and an endo-?-1,3-glucanase enzyme having at least 97% sequence identity to one or more of SEQ ID NO: 1 or SEQ ID NO: 2 or SEQ ID NO: 3 or SEQ ID NO: 4 or SEQ ID NO: 5 or SEQ ID NO: 6 or SEQ ID NO: 7; (ii) optionally rinsing the cotton fabric; and (iii) drying the cotton fabric.
US Pat. No. 10,988,716

POLYSACCHARIDE DERIVATIVES AS OPTICAL BRIGHTENING AGENTS

ABO AKADEMI UNIVERSITY, ...

1. A polysaccharide derivative composition comprising a polysaccharide derivative containing substituents:(a) at a degree of substitution (DS1) of at least 0.05 of a fluorescent group (FG) having a mono or polycyclic ring system containing at least one heteroatom consisting of N or both N and S, and conjugated double bonds, and having an absorption band in the UV region of light and an emission band in the visible region of light, and bonded via a first linker to any one of native functional groups (F) of polysaccharide repeating units; and
(b) at a degree of substitution (DS2) of at least 0.05 of a charged group (CG) bonded via a second linker to any one of the native functional groups of the polysaccharide repeating units.
US Pat. No. 10,987,436

SUPERPARAMAGNETIC NANOPARTICLES AS A CONTRAST AGENT FOR MAGNETIC RESONANCE IMAGING (MRI) OF MAGNETIC SUSCEPTIBILITY (T2*)

1. A process for obtaining a T2*-weighed image a tumor in vivo in an animal or human comprising the operations of:(a) intravenously administering of a contrast agent to an animal or a human, the contrast agent comprising a superparamagnetic nanoparticle having a single core less than 15 nm in diameter and a surface net negative electrical charge, and comprising: 1) an inorganic core and 2) a water-soluble polymer coating, which does not accumulate in the liver or spleen, having serum relaxivity values r2* greater than 90 s?1 mM?1, characterized in that:
i) the inorganic core is composed of magnetite —Fe3O4—; and
ii) the water-soluble polymer coating is polyacrylic acid that is directly and covalently bound to the core by the use of carbodiimide; and
(b) performing perfusion imaging by T2*-weighted magnetic resonance imaging (MRI) between 0 and 6 hours after operation (a).
US Pat. No. 10,988,718

TUNGSTEN POST-CMP CLEANING COMPOSITION

ENTEGRIS, INC., Billeric...

1. A composition comprising: at least one organic additive; at least one metal chelating agent; and at least one polyelectrolyte;wherein the at least one organic additive comprises a species selected from the group consisting of aminoethylethanolamine, N-methylaminoethanol, aminoethoxyethanol, dimethylaminoethoxyethanol, diethanolamine, N-methyldiethanolamine, monoethanolamine, triethanolamine, 1-amino-2-propanol, 2-amino-1-butanol, isobutanolamine, triethylenediamine, isopropanolamine, diisopropanolamine, 2-amino-1-butanol, 2-amino-2-ethyl-1,3-propanediol, 2-amino-2-methyl-1,3-propanediol, 1-methoxy-2-aminoethane, 2-(2-aminoethoxy)ethanol, morpholine, N-methylmorpholine, 4-(2-hydroxyethyl)morpholine (HEM), aminomethylpiperazine, and N-aminoethylpiperazine (N-AEP), and
wherein when the composition is brought into contact with a microelectronic comprising tungsten containing layers and having metal particles and contaminants present on a surface of the microelectronic device that are a result of a chemical mechanical polishing process step, the composition at least partially removes metal particles and contaminants present on the surface of the microelectronic device without substantially corroding any tungsten containing layers.
US Pat. No. 10,988,463

SUBSTITUTED 3-AZABICYCLO[3.1.0]HEXANES AS KETOHEXOKINASE INHIBITORS

Pfizer Inc., New York, N...

1. A method of treating a disease for which an inhibitor of KHK is indicated, the method comprising the administration to a human in need thereof a therapeutically effective amount of a compound, wherein the compound is [(1R,5S,6R)-3-{2-[(2S)-2-methylazetidin-1-yl]-6-(trifluoromethyl)pyrimidin-4-yl}-3-azabicyclo[3.1.0]hex-6-yl]acetic acid, or pharmaceutically acceptable salt thereof, and wherein the disease is selected from any one or a combination of obesity, visceral adipose dysfunction, eating disorders, and excessive sugar craving.
US Pat. No. 10,988,719

METHOD FOR PRODUCING BEERS STORED, OFFERED, SERVED OR CONSUMED IN UV-VIS-TRANSMITTANT BOTTLES WITH REDUCED SENSITIVITY, IN PARTICULAR NO SENSITIVITY, TO SKUNKY THIOL FLAVOR DEGRADATION UPON EXPOSURE TO SUNLIGHT OR OTHER SOURCES OF UV AND/OR VIS LIGHT, AND

IFAST NV, Roosdaal (BE)

1. A bottled lager or ale beer, wherein said bottled lager or ale beer is in a UV-VIS-transmittant bottle, said bottled lager or ale beer comprising:(reduced) hulupones at a concentration of 4-150 ppm,
wherein the bottled lager or ale beer either:
does not further comprise isohumulones or
has an isohulumones concentration does not exceed 2 ppm,
wherein the fraction of (reduced) hulupones in the total of isohumulones and (reduced) hulupones is at least 75 mol %, and
wherein said UV-VIS-transmittant bottle is a UV-VIS-transmittant clear glass bottle, a UV-VIS-transmittant green glass bottle, a UV-VIS-transmittant clear plastic bottle, a UV-VIS-transmittant green plastic bottle or combinations thereof.
US Pat. No. 10,989,999

HALFTONE PHASE SHIFT MASK BLANK AND HALFTONE PHASE SHIFT MASK

SHIN-ETSU CHEMICAL CO., L...

1. A halftone phase shift mask blank comprising a transparent substrate and a halftone phase shift film thereon having a phase shift of 150° to 200° and a transmittance of 3% to 30% with respect to light of wavelength up to 200 nm, whereinsaid halftone phase shift film is a single layer or a multilayer film, and is composed of a silicon base material comprising essentially a transition metal, silicon and nitrogen and optionally oxygen,
said halftone phase shift film includes at least one layer (A) composed of a silicon base material having a transition metal content of up to 3 at %, a total content of silicon, nitrogen and oxygen of at least 90 at %, a silicon content of 30 to 70 at %, a total content of nitrogen and oxygen of 30 to 60 at %, and an oxygen content of up to 30 at %, and having a sheet resistance of up to 1013?/?, wherein the layer (A) is compositionally graded such that the concentration of some or all constituent elements continuously varies in thickness direction, and
the content of nitrogen continuously decreases and the content of silicon continuously increases in thickness direction in the layer (A).
US Pat. No. 10,987,697

MULTI-LAYER CURABLE COMPOSITIONS CONTAINING 1,1-DI-ACTIVATED VINYL COMPOUND PRODUCTS AND RELATED PROCESSES

PPG Industries Ohio, Inc....

18. A process for applying a curable composition to a substrate comprising:applying a first curable composition layer over at least a portion of a substrate;
applying a second curable composition layer over at least a portion of the first curable composition layer; and
curing the first curable composition layer and/or the second curable composition layer;
wherein the first curable composition layer and the second coating layer both independently comprise a polymeric resin; and
wherein the first curable composition layer and/or the second curable composition layer, when cured, comprise a polymerization reaction product of a dialkyl methylene malonate, a diaryl methylene malonate, a multifunctional form of a dialkyl methylene malonate, or a multifunctional form of a diaryl methylene malonate, or a combination of any thereof.
US Pat. No. 10,987,442

INFORMATION MEDIUM HAVING ANTIVIRAL PROPERTIES, AND METHOD FOR MAKING SAME

OBERTHUR FIDUCIAIRE SAS, ...

1. A method for producing an information medium having antiviral activity, the method comprising:in the presence of a catalyst, depositing on a surface of a substrate medium an aqueous composition comprising at least lauric acid and glycerol, the substrate medium comprising paper, and the catalyst selected from the group consisting of a zeolite catalyst and a lipase catalyst; and
subsequent to depositing the aqueous composition and in the presence of the catalyst, heating the substrate medium with the aqueous composition deposited thereon, wherein the heating:
comprises subjecting the substrate medium to a temperature of approximately 80° C. to approximately 100° C.,
synthesizes monolaurin, in situ on the substrate medium, from the lauric acid and glycerol, and
dries the substrate medium and the monolaurin synthesized thereon.
US Pat. No. 10,987,445

METHODS, COMPOSITIONS AND ARTICLES FOR OLFACTORY-ACTIVE SUBSTANCES

ENVIROSCENT, INC., Atlan...

1. A scented article, comprising:a rod comprising an absorbent matrix material comprising multiple types of paper or pulp composition;
wherein the multiple types of paper or pulp composition comprises:
a first type of paper or pulp composition disposed at an interior of the absorbent matrix material, the first type of paper or pulp composition having a first porosity;
a second type of paper or pulp composition disposed at an exterior of the absorbent matrix material, the second type of paper or pulp composition having a second porosity different from the first porosity;
at least one olfactory-active composition releasably retained in the absorbent matrix material;
wherein at least a portion of an outermost surface of the exterior of the absorbent matrix material is treated with a porosity-altering material;
wherein the porosity-altering material comprises a dye, pigment, a wax, soy wax, paraffin, bees wax, polyethylene wax, microcrystalline wax, waxes that soften or melt at a temperature greater than about 150 F, acrylates, polylactide, polyglycolide or polycaprolactone, or a polyester copolymer comprising poly(lactide/glycolide) acid (PLGA) or poly(lactid-co-epsilon-caprolactone) (PLCL), alkyl- or alkoxyalkyl-2-cyanoacrylates, n-butyl-2-cyanoacrylate, 2-methoxybutyl-2-cyanoacrylate, crosslinked cyanoacrylate, polylactic acid, polyglycolic acid, lactic-glycolic acid copolymers, polycaprolactone, lactic acid-caprolactone copolymers, poly-3-hydroxybutyric acid, polyorthoesters, polyalkyl acrylates, copolymers of alkylacrylate and vinyl acetate, polyalkyl methacrylates, copolymers of alkyl methacrylates and butadiene; dioctyl phthalate, dimethyl sebacate, trethyl phosphate, tri(2-ethylhexy)phosphate, tri(p-cresyl)phosphate, glyceryl triacetate, glyceryl tributyrate, diethyl sebacate, dioctyl adipate, isopropyl myristate, butyl stearate, lauric acid, dibutyl phthalate, trioctyl trimellitate, dioctyl glutarate, or a starch; and
wherein the rod comprises an attachment element.
US Pat. No. 10,988,727

FERMENTATION SYSTEMS

FRAUNHOFER-GESELLSCHAFT Z...

1. A cell-density regulated cell cultivation process for the production of eukaryotic cells and/or a eukaryotic cell-derived product, the process comprising the steps of:a) growing cells in a cell culture having a variable cell culture volume in a first cultivation vessel, wherein the culture volume is not regulated to be constant over the entire cell cultivation process,
b) monitoring cell density in the cell culture over time by repeatedly performing cell density measurements with a density sensor,
c) varying the cell culture volume to maintain the cells in growth phase by feeding nutrient medium into the cell culture in response to the monitored cell density,
d) harvesting a fraction of the cell culture while maintaining remaining cells within the cell culture in growth phase, wherein feed rate and harvest rate are not coupled to one another, and wherein the harvested fraction comprises cells and/or a cell-derived product, and wherein the cell culture volume in the vessel is not kept constant continuously by adding nutrient medium into the vessel after harvesting said fraction and/or wherein the volume of the harvested fraction is not immediately replenished by adding nutrient medium into the vessel,
e) repeating one or all of the aforementioned steps in the order set forth to allow a repeated harvest of cell culture fractions, and
f) optionally processing the harvested cells and/or cell-derived products.
US Pat. No. 10,987,447

ANTIBACTERIAL DRESSING MATERIAL AND PREPARING METHOD THEREFOR

Genewel Co., Ltd., Gyeon...

1. An antibacterial dressing comprising: an external infectious agent-blocking film layer; a bacterial growth-inhibiting polyurethane foam layer; and a wound infection agent-removing polyurethane foam layer,wherein the bacterial growth-inhibiting polyurethane foam layer contains a rapid cell membrane-penetrating component and has a pore size of 100 to 350 ?m together with a cell size of 100 to 350 ?m, and the wound infection agent-removing polyurethane foam layer contains a rapid cell membrane-penetrating component and has a pore size of 25 to 75 ?m together with a cell size of 100 to 350 ?m to prevent reinfection by absorbing and destroying bacteria in the bacterial growth-inhibiting polyurethane foam layer, and then to prevent bacteria from returning to the wound infection agent-removing polyurethane foam layer.
US Pat. No. 10,987,448

OSTEOCONDUCTIVE AND OSTEOINDUCTIVE IMPLANT FOR AUGMENTATION, STABILIZATION, OR DEFECT RECONSTRUCTION

UNIVERSITY OF SOUTH FLORI...

1. An implant for augmentation, stabilisation, or defect reconstruction of bone tissue, comprising:a malleable scaffold portion having a same composition throughout and structured to provide shape to the implant, the malleable scaffold portion comprising:
one or more polymers selected from polylactic acid isomer and/or polyglycolic acid polymer; and allogenic bone material, and
an autologous cancellous bone graft and bone morphogenic protein embedded within the malleable scaffold portion,
wherein the scaffold portion is in the form of a mesh or a lattice structure of customizable density.
US Pat. No. 10,988,730

SAND WORM LYOPHILISATE AND USES THEREOF

Hemarina, Morlaix (FR)

1. A method for improving the yield of fermentation carried out by microorganisms, comprising providing to the microorganisms in a culture medium, a pathogen-free lyophilisate or a powder obtained from whole annelids which have been milled beforehand, wherein the pathogen-free lyophilisate or powder comprises i) at least one extracellular hemoglobin, globin or globin protomer from annelids, wherein said hemoglobin, globin or globin protomer comprises iron, and ii) at least one biological material from annelids that is different from said globin, from said protomer and from said hemoglobin, wherein the annelid is chosen from the Arenicolidae family or the Nereididae family and wherein the pathogen-free lyophilisate or powder is provided in an amount sufficient to improve the yield of fermentation carried out by the microorganisms, andwherein the microorganisms are lactic acid bacteria and the fermentation is lactic acid fermentation.
US Pat. No. 10,990,010

PHOTOSENSITIVE RESIN COMPOSITION AND ETCHING PROCESS

MITSUBISHI PAPER MILLS LI...

4. An etching process comprising the sequential steps of:first, forming a photosensitive resin layer comprising a photosensitive resin composition comprising at least (A) an acid-modified epoxy acrylate, (B) a photopolymerization initiator, (C) a blocked 1,6-hexamethylene diisocyanate, and (D) talc, on at least one surface of a substrate;
second, exposing and then developing the photosensitive resin layer to form a cured photosensitive resin layer having a resist pattern on the at least one surface of the substrate;
third, baking the photosensitive resin layer, thereby crosslinking the cured photosensitive resin layer having the resist pattern, to form a crosslinked photosensitive resin layer having the resist pattern on the at least one surface of the substrate; and
fourth, conducting an etching treatment on the at least one surface of the substrate having the crosslinked photosensitive resin layer having the resist pattern on the at least one surface of the substrate with an etching solution containing hydrofluoric acid in an amount of more than 0% mass and not more than 20% mass,
wherein the acid-modified epoxy acrylate (A) is a compound produced by reacting
(a1) at least a bisphenol A epoxy resin,
(a2) at least one compound selected from the group consisting of acrylic acid and methacrylic acid, and
(a3) at least one compound selected from the group consisting of succinic acid and succinic anhydride.
US Pat. No. 10,988,731

FORMULATION FOR STORAGE, TRANSPORTATION, AND DELIVERY OF PROTEIN RICH CONDITIONED MEDIUM

HOPE BIOSCIENCES, LLC, S...

1. A storage, transportation, and delivery formulation comprising a protein rich conditioned medium comprising:a) a conditioned medium comprising at least:
i) 0.3 pg/ml fibroblast growth factor (FGF);
ii) 6 pg/ml transforming growth factor (TGF);
iii) 6 pg/ml epidermal growth factor (EGF), wherein the epidermal growth factor (EGF) is present in at least twenty times the concentration of fibroblast growth factor (FGF); and
iv) 300 pg/ml stromal-derived factor (SDF);
b) water;
c) disodium ethylenediaminetetraacetic acid;
d) propanediol;
e) phenoxyethanol;
f) C12-15 alkyl benzoate; and
g) polyacrylate Crosspolymer-6; and
wherein the conditioned medium is not concentrated.
US Pat. No. 10,990,011

CURABLE COMPOSITION FOR IMPRINTING, CURED PRODUCT, PATTERN FORMING METHOD, AND LITHOGRAPHY METHOD

FUJIFILM Corporation, To...

1. A curable composition for imprinting comprising:a monofunctional polymerizable compound;
a bifunctional polymerizable compound; and
a photopolymerization initiator,
wherein the content of the monofunctional polymerizable compound is 5 to 30 mass % with respect to the content of all the polymerizable compounds included in the curable composition for imprinting,
the content of the bifunctional polymerizable compound is 70 mass % or higher with respect to the content of all the polymerizable compounds included in the curable composition for imprinting,
at least one bifunctional polymerizable compound is a bifunctional polymerizable compound in which the number of atoms linking two polymerizable groups to each other is 2 or less,
at least one bifunctional polymerizable compound is a bifunctional polymerizable compound that includes two polymerizable groups having an ethylenically unsaturated bond and in which the number of atoms linking the ethylenically unsaturated bonds to each other is 6 or less,
the content of a bifunctional polymerizable compound that does not include an alicyclic structure and an aromatic ring structure and in which the number of atoms linking two polymerizable groups to each other is 3 or more is 30 mass % or lower with respect to the content of all the polymerizable compounds included in the curable composition for imprinting, and
the bifunctional polymerizable compound in which the number of atoms linking two polymerizable groups to each other is 2 or less and the bifunctional polymerizable compound that includes two polymerizable groups having an ethylenically unsaturated bond and in which the number of atoms linking the ethylenically unsaturated bonds to each other is 6 or less have a boiling point of 230° C. or higher at 101325 Pa.
US Pat. No. 10,988,732

GRAPHENE OXIDE-BASED POROUS 3D MESH

University of North Dakot...

1. A method of making a porous three-dimensional graphene mesh, the method comprising:combining graphene oxide (GO) and poly(ethylene)(glycol) (PEG) in an alcohol solvent to form a mixture;
adding a selected amount of sodium chloride (NaCl) to the mixture, wherein the amount of NaCl added to the mixture is selected to generate a ratio of GO to NaCl of 1:12 or greater and a porosity of a resulting gel of less than 90%;
heating the mixture to form the resulting gel; and
washing the resulting gel with water to remove the NaCl from the resulting leaving behind a three-dimensional graphene scaffold mesh having stable pores.
US Pat. No. 10,988,733

METHODS FOR OBTAINING PLURIPOTENT ADULT OLFACTORY STEM CELLS FROM AN OLFACTORY MUCOSA TISSUE

China Medical University,...

1. A method for obtaining a plurality of pluripotent adult olfactory stem cells (APOSCs), the method comprising:i. isolating the APOSCs, comprising:
(a) obtaining an olfactory tissue of a mammal;
(b) culturing the olfactory mucosa tissue obtained from step (a) in a medium containing Dulbecco's Modified Eagle Medium/F12 (DMEM/F12 medium), heparin, bFGF, EGF and an antibiotic for 5-7 days to allow for migration of the cells from the cultured tissue; and
(c) isolating adherent cells from step (b);
ii. culturing the isolated APOSCs in a sphere culture medium comprising DMEM/F12 medium, B27 supplement, bFGF, EGF and an antibiotic; and
iii. collecting the cultured APOSCs that express Bmi-1 (B-lymphoma moloney murine leukemia virus insertion region-1), Oct-4 (Octamer-binding transcription factor 4), Sox-2 (Sex-determining region Y (SRY)-box 2), Nanog, SSEA-4 (Stage-specific embryonic antigen-4), ki67, c-Myc, KLF-4 (Kruppel Like Factor 4), K14 (Cytokeratin 14) and ICAM-1 (Intercellular Adhesion Molecule 1).
US Pat. No. 10,988,735

CARDIAC TISSUES CONTAINING SEMICONDUCTOR NANOMATERIALS AND METHODS OF PREPARING AND USING THE SAME

Clemson University Resear...

1. A tissue comprising cardiac cells, a semiconductor nanomaterial, and an electrically conductive microenvironment,wherein the electrically conductive microenvironment consists of an electrically conductive network within the tissue, wherein the electrically conductive network comprises the cardiac cells and the semiconductor nanomaterial;
wherein the semiconductor nanomaterial is incorporated within the tissue and the semiconductor nanomaterial is present in the tissue in an amount of about 0.00001% to about 1% by weight of the semiconductor nanomaterial per volume of the tissue;
wherein the tissue is scaffold-free and is a three-dimensional tissue; and
wherein the tissue is a spheroid or an aggregate.
US Pat. No. 10,988,736

METHOD OF ISOLATING MESENCHYMAL STEM CELLS FROM THE AMNIOTIC MEMBRANE OF THE UMBILICAL CORD, A MESENCHYMAL STEM CELL POPULATION ISOLATED FROM THE AMNIOTIC MEMBRANE OF THE UMBILICAL CORD AND A CELL CULTURE MEDIUM FOR ISOLATING MESENCHYMAL STEM CELLS FROM T

Cellresearch Corporation ...

1. An isolated mesenchymal stem population of the amniotic membrane of the umbilical cord, wherein cells of the stem cell population express the POU5f1 gene, and wherein at least about 97% or more cells of the stem cell population express each of the following markers: CD73, CD90 and CD105 and lack expression of the following markers: CD34, CD45 and HLA-DR.
US Pat. No. 10,991,809

COMPOSITION AND PROCESS FOR SELECTIVELY ETCHING P-DOPED POLYSILICON RELATIVE TO SILICON NITRIDE

ENTEGRIS, INC., Billeric...

1. A method of selectively removing p-doped polysilicon relative to silicon nitride, said method comprising contacting a substrate comprising p-doped polysilicon and silicon nitride with a removal composition, wherein the removal composition selectively removes the p-doped polysilicon relative to silicon nitride and comprises about 0.1 wt % to about 1 wt % of at least one nitrate, about 0.1 wt % to about 3 wt % of at least one fluoride, about 50 wt % to about 85 wt % of at least one strong acid, about 0.00001 wt % to about 0.5 wt % of at least one silicon source and at least one reducing agent, and about 10.5 wt % to about 49.8 wt % of at least one solvent, wherein the removal composition has a ratio of at least one nitrate to at least one fluoride in a range of from about 0.2:1 to about 2:1 and a pH of from 2 to about ?8, and wherein the at least one reducing agent comprises a species selected from the group consisting of a sulfur dioxide solution, a sulfite salt, a thiosulfate salt, sulfurous acid, elemental sulfur, dimethyl sulfoxide, formic acid, formaldehyde, glyoxylic acid, glyoxal, hydrazine sulfate, hydroxylamine sulfate, boroxine, borane-amine complexes, borane-ammonia complexes, tetramethylammonium borohydride, potassium borohydride, and combinations thereof.
US Pat. No. 10,988,738

COENZYME-BINDING GLUCOSE DEHYDROGENASE

Ikeda Food Research Co., ...

1. A method for producing a biosensor for measuring glucose in a sample liquid comprising:(i) obtaining a soluble flavin adenine dinucleotide-binding glucose dehydrogenase (FAD-GDH) secreted from an Aspergillus fungal body, which has enzymatic activity to glucose comprising catalyzing a reaction for oxidizing glucose in the presence of an electron acceptor, and
(ii) forming a biosensor comprising an electrode system and an enzymatic reaction layer on an electrode of the electrode system, the enzymatic reaction layer comprising the soluble flavin adenine dinucleotide-binding glucose dehydrogenase and an electron acceptor,
wherein:
(a) enzymatic activity of the FAD-GDH to maltose is 5% or less relative to the enzymatic activity of the FAD-GDH to glucose, and
(b) enzymatic activity of the FAD-GDH to D-fructose is not more than enzymatic activity of the FAD-GDH to D-mannose.
US Pat. No. 10,988,739

KETOREDUCTASE POLYPEPTIDES

Codexis, Inc., Redwood C...

1. An engineered polynucleotide encoding an engineered polypeptide having ketoreductase activity, wherein said engineered polypeptide comprises a region with an amino acid sequence having at least 95% sequence identity to residues 90 to 211 of SEQ ID NO: 130, comprising a substitution at position X117 with glycine and at position X190 with cysteine, and further comprising one or more of the following features selected from:residue corresponding to X94 is asparagine, glycine, serine, or a polar residue;
residue corresponding to X95 is an aliphatic residue;
residue corresponding to X96 is glutamine, asparagine, or threonine;
residue corresponding to X101 is an acidic, non-polar, or a polar residue;
residue corresponding to X105 is an acidic or non-polar residue;
residue corresponding to X108 is a hydrophilic, polar or constrained residue;
residue corresponding to X111 is a non-polar or aliphatic residue;
residue corresponding to X112 is an acidic or polar residue;
residue corresponding to X113 is a non-polar or aliphatic residue;
residue corresponding to X127 is a basic residue;
residue corresponding to X147 is a non-polar, aliphatic, aromatic, or hydrophobic residue;
residue corresponding to X152 is a non-polar, basic, or hydrophilic residue;
residue corresponding to X157 is a polar residue;
residue corresponding to X163 is a non-polar or aliphatic residue;
residue corresponding to X176 is a non-polar or aliphatic residue;
residue corresponding to X176 is a non-polar or aliphatic residue;
residue corresponding to X194 is a constrained, basic, or polar residue;
residue corresponding to X197 is a hydrophilic, acidic, basic, aliphatic or a non-polar residue;
residue corresponding to X198 is an acidic, basic, hydrophilic, or non-polar residue;
residue corresponding to X199 is an acidic, aliphatic, or non-polar residue;
residue corresponding to X200 is an acidic or constrained residue;
residue corresponding to X202 is a non-polar residue;
residue corresponding to X206 is a non-polar, aromatic, or hydrophobic residue; and
wherein the amino acid sequence can optionally have one or more differences at other amino acid residues in the domain as compared to the reference sequence.
US Pat. No. 10,988,740

DEVELOPMENT OF MICROORGANISMS FOR HYDROGEN PRODUCTION

Svetlana Oard, Baton Rou...

1. A microorganism, comprising a modified gene encoding a H2-forming H2ase and one or more genes encoding maturation proteins that mediate the maturation of said H2ase; wherein a nucleic acid molecule encoding said H2ase is genetically engineered for high expression at more than 2% O2 by silent substitutions of nucleotides, wherein said H2ase gene is expressed at an O2 concentration of about 0% to more than 2%; wherein at least one of said genes encoding a maturation protein is expressed under less than 0.1% O2; wherein said microorganism is selected from the group consisting of algae, bacteria, and cyanobacteria; exhibiting an increased level of H2 production when compared to an otherwise identical microorganism, but lacking said H2ase gene and the engineered genes encoding maturation proteins.
US Pat. No. 10,988,741

MUTATED GENES FOR THE CATALYTIC PROTEIN OF OPLOPHORUS LUCIFERASE AND USE THEREOF

JNC CORPORATION, Tokyo (...

1. A method for producing a recombinant luciferase mutant, which comprises the steps of culturing a transformant transformed with a recombinant vector comprising a polynucleotide comprising a nucleotide sequence encoding the recombinant luciferase mutant and separating/purifying the recombinant luciferase mutant, wherein the recombinant luciferase mutant is selected from the group consisting of:(a) a recombinant luciferase mutant comprising the amino acid sequence of SEQ ID NO: 2 substituted at the amino acid positions consisting of:
glutamic acid at position 4;
arginine at position 11;
leucine at position 18; and
valine at position 27; and,
(b) a recombinant luciferase mutant comprising the amino acid sequence of SEQ ID NO: 2 substituted at the positions consisting of:
glutamic acid at position 4;
arginine at position 11;
leucine at position 18;
valine at position 27; and
one or more amino acid(s) at position(s) other than positions 4, 11, 18, 27, 33, 43, 44, 54, 68, 72, 75, 90, 115, 124, 138 and 166 of the amino acid sequence of SEQ ID NO: 2, wherein the recombinant luciferase mutant has luciferase activity.
US Pat. No. 10,988,742

PENICILLIN EXPANDASE MUTANTS, DNA CODING THE MUTANTS, REAGENT KIT CONTAINING THE MUTANTS AND THE APPLICATION

BioRight Worldwide Co., L...

1. A penicillin expandase mutant of wild-type penicillin expandase of SEQ ID NO: 2, wherein the mutation of the mutant is as follows: the amino acid at position 126 is substituted by phenylalanine and, optionally, the amino acid at position 42 is substituted by cysteine, aspartic acid, glutamic acid, methionine, proline, glutamine, or arginine.
US Pat. No. 10,988,744

METHOD OF PRODUCING ALKALINE PHOSPHATASE

Alexion Pharmaceuticals, ...

1. A method of improving enzymatic activity of a recombinant alkaline phosphatase during production comprising:(i) culturing a recombinant cell culture that expresses an alkaline phosphatase;
(ii) obtaining a preparation comprising recombinant alkaline phosphatase from the cell culture; and
(iii) (a) decreasing in the preparation at least one of:
(1) a concentration of Nickel (Ni) to less than about 2.33 ppm;
(2) a concentration of Cobalt (Co) to less than about 0.30 ppm;
(3) a concentration of Copper (Cu) to less than about 24.82 ppm;
(4) a concentration of Manganese (Mn) to less than about 9.13 ppm;
(5) a molar ratio of Nickel/Zinc to less than about 1.90;
(6) a molar ratio of Cobalt/Zinc to less than about 0.09; and
(7) a molar ratio of Copper/Zinc to less than about 0.16;
and
(b) increasing in the preparation a concentration of Zinc to at least about 550 ppm,
wherein the method improves the enzymatic activity of the recombinant alkaline phosphatase.
US Pat. No. 10,988,745

THERAPEUTIC NUCLEASE-ALBUMIN FUSIONS AND METHODS

RESOLVE THERAPEUTICS, LLC...

1. A fusion protein comprising:a mutant human DNase comprising one or more mutations selected from the group consisting of E13R, N74K, A114F and T205K, wherein the mutation numbering corresponds to SEQ ID NO: 66, operably coupled, with or without a linker, to
a human serum albumin or a human serum albumin variant, wherein the human serum albumin variant has greater than 90% sequence identity to the amino acid sequence of human serum albumin set forth in SEQ ID NO: 1, and wherein the human serum albumin or human serum albumin variant is operably coupled, with or without a linker, to
a human RNase; and
wherein the fusion protein has increased serum half-life relative to a fusion protein comprising the human mutant DNase and the human RNase without the human serum albumin or human serum albumin variant.
US Pat. No. 10,988,490

TRIIODOSILYLAMINE PRECURSOR COMPOUNDS

ENTEGRIS, INC., Billeric...

1. A compound of Formula (I)(R2N)SiI3,  (I)
wherein each R is taken together with the nitrogen atom to which they are bonded to form a substituted or unsubstituted 3 or 4-membered N-heterocyclic ring.
US Pat. No. 10,988,746

MANUFACTURING AND ENGINEERING OF DNASE ENZYMES FOR THERAPY

NEUTROLIS, INC., Cambrid...

1. A fusion protein comprising:(i) a DNASEI-LIKE 3 (D1L3) protein having chromatin-degrading activity, wherein said DIL3 protein has an amino acid sequence that is at least 95% identical to amino acids 21 to 282 of SEQ ID NO: 4, and wherein the C-terminus of the D1L3 amino acid sequence lacks the amino acid sequence of amino acids 301-305 of SEQ ID NO: 4,
(ii) an albumin located at the N-terminal side of the D1L3 protein, wherein the albumin has an amino acid sequence at least 95% identical to SEQ ID NO: 39, and
(iii) a flexible amino acid linker of from 5 to 50 amino acids between the albumin and the D1L3 protein, wherein the flexible linker has at least 15 amino acids and is composed predominately of serine and glycine residues.
US Pat. No. 10,988,747

DETERGENT COMPOSITION COMPRISING GH9 ENDOGLUCANASE VARIANTS I

1. A detergent composition comprising an endoglucanase variant, comprising an alteration at one or more positions in one or more chelator-induced instability region selected from the group of:i) region 7 corresponding to amino acids 612 to 660 of SEQ ID NO: 2
ii) region 1 corresponding to amino acids 95 to 105 of SEQ ID NO: 2,
iii) region 2 corresponding to amino acids 115 to 138 of SEQ ID NO: 2,
iv) region 3 corresponding to amino acids 210 to 251 of SEQ ID NO: 2,
v) region 4 corresponding to amino acids 267 to 301 of SEQ ID NO: 2,
vi) region 5 corresponding to amino acids 339 to 361 of SEQ ID NO: 2,
vii) region 6 corresponding to amino acids 547 to 595 of SEQ ID NO: 2,
viii) region 8 corresponding to amino acids 806 to 828 of SEQ ID NO: 2, and
ix) region 9 corresponding to amino acids 839 to 1042 of SEQ ID NO: 2,
wherein said variant has at least 86% sequence identity to SEQ ID NO: 2.
US Pat. No. 10,988,748

COMPOSITIONS AND METHODS FOR TREATING CELIAC SPRUE DISEASE

University of Washington,...

1. A polypeptide comprising the amino acid sequence set forth in SEQ ID NO:129.
US Pat. No. 10,988,749

BETA-LACTAMASE VARIANTS

DA VOLTERRA, Paris (FR) ...

1. An isolated polypeptide having beta-lactamase activity, which comprises an amino acid sequence having at least 90% sequence identity to SEQ ID NO:1, said amino acid sequence further comprising a substitution at a position corresponding to residue 34 in SEQ ID NO: 1 and a C-terminal truncation of residues 237-240 of SEQ ID NO:1.
US Pat. No. 10,988,750

PHOSPHOKETOLASES FOR IMPROVED PRODUCTION OF ACETYL COENZYME A-DERIVED METABOLITES, ISOPRENE, ISOPRENOID PRECURSORS, AND ISOPRENOIDS

Danisco US Inc., Palo Al...

1. A microorganism capable of increased carbon flux through the phosphoketolase pathway compared to a control microorganism not expressing a heterologous phosphoketolase, wherein the microorganism comprises: (i) a heterologous nucleic acid sequence encoding a polypeptide having phosphoketolase activity, wherein the polypeptide comprises at least 65% sequence identity to SEQ ID NO:8 or SEQ ID NO: 11; and (ii) one or more nucleic acids encoding one or more polypeptides of the complete mevalonate (MVA) pathway, wherein(1) the microorganism comprising the polypeptide having phosphoketolase activity of (i) has a Performance Index value of greater than 1.0 in one or more of the following parameters: (a) cell growth on glucose, (b) cell growth on xylose, (c) production of intracellular acetyl-phosphate or (d) cell growth on glucose-6-phosphate, wherein the Performance Index value is calculated as activity per unit relative to a corresponding cell expressing a phosphoketolase from E. gallinarum; or
(2) the polypeptide having phosphoketolase activity of (i) has a Performance Index value of greater than 1.0 in one or more of the following parameters: (e) protein solubility, (f) protein expression, or (g) fructose-6-phosphate (F6P) Specific Activity, wherein the Performance Index value is calculated as activity per unit relative to a phosphoketolase from E. gallinarum.
US Pat. No. 10,988,751

DIPHOSPHOMEVALONATE DECARBOXYLASE VARIANT AND METHOD FOR MANUFACTURING OLEFIN COMPOUND USING SAME

RIKEN, Wako (JP) ZEON CO...

1. A method for producing isoprene or isobutene, the method comprising:reacting ATP and a substrate compound in the presence of a diphosphomevalonate decarboxylase to produce isoprene or isobutene,
wherein:
the diphosphomevalonate decarboxylase is a protein in which:
serine at position 153 of SEQ ID NO: 2 or serine corresponding to the position is mutated to aspartic acid or glutamic acid,
threonine at position 209 of SEQ ID NO: 2 or threonine corresponding to the position is mutated to aspartic acid, and
the amino acid sequence consists of the amino acid sequence of SEQ ID NO: 2 or an amino acid sequence in which no more than 40 amino acid residues of the amino acid sequence of SEQ ID NO: 2 are substituted, deleted, added, and/or inserted other than at positions 153 and 209,
and
when the method produces isoprene, the substrate compound is 3-hydroxy-3-methylpent-4-enoate and
when the method produces isobutene, the substrate compound is (?-hydroxyisovaleric acid.
US Pat. No. 10,988,752

3-METHYLCROTONIC ACID DECARBOXYLASE (MDC) VARIANTS

Global Bioenergies, Evry...

1. A variant of a 3-methylcrotonic acid decarboxylase (MDC) showing an improved activity in converting 3-methylcrotonic acid into isobutene relative to a parent MDC having the amino acid sequence as set forth in SEQ ID NO: 14, wherein said variant comprises an amino acid sequence having at least 63% sequence identity to SEQ ID NO: 14 with a substitution, a deletion or an insertion at a position corresponding to amino acid residue 404 of SEQ ID NO: 14, and wherein said variant optionally further comprises a substitution, a deletion or an insertion at one or more amino acid residues corresponding to position(s) 2, 3, 5, 6, 24, 25, 35, 36, 64, 74, 80, 85, 86, 126, 129, 154, 166, 175, 195, 196, 197, 198, 204, 208, 214, 236, 237, 238, 240, 277, 298, 302, 339, 343, 347, 350, 359, 366, 368, 390, 391, 394, 395, 396, 398, 401, 402, 403, 405, 406, 407, 408, 426, 439, 440, 441, 442, 444, 446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457, 458, 459, 460, 461, 462 and 473 of SEQ ID NO: 14.
US Pat. No. 10,988,499

HYDRATED AND ANHYDROUS POLYMORPHS OF 2'-O-FUCOSYLLACTOSE AND THEIR PRODUCTION METHODS

BASF SE, Ludwigshafen (D...

1. A method for obtaining crystalline 2?-O-Fucosyllactose (2?FL)hydrate in form of polymorph A with molecular formula C18H32O15.nH2O wherein n is 3/2, the method comprising:drying a 2?FL hydrate in form of polymorph B with molecular formula C18H32O15.nH2O wherein n is 5/2, thereby transforming the 2?FL hydrate polymorph B into polymorph A.
US Pat. No. 10,988,500

LIPID A MIMICS, METHODS OF PREPARATION, AND USES THEREOF

Immunovaccine Technologie...

1. A compound of formula:A-L1-D-L2-E
wherein:
one of A or E is a cyclic monosaccharide residue with one or more of the hydroxyl groups optionally substituted or absent, and one of A or E is a substituted or unsubstituted aromatic group;
L1 and L2 independently are present or absent, and if present is independently a substituted or unsubstituted, branched or linear, saturated or unsaturated, carbon chain optionally comprising one or more of O, S or N; and
D is —O—, —S— or —NH—;
wherein at least one of A or L1 comprises one or more lipid chain substituents, and at least one of E or L2 comprises one or more lipid chain substituents;
wherein each lipid chain substituent comprises at least one major carbon chain; and
wherein when L1 or L2 comprise a lipid chain substituent, the lipid chain substituent is a substituent group of L1 or L2;
or a pharmaceutically acceptable salt thereof.
US Pat. No. 10,988,758

MAGNETIC NANOPARTICLES FOR NUCLEIC ACID PURIFICATION

Roche Molecular Systems, ...

1. A composition comprising monodisperse silanized ferrimagnetic iron oxide particles for independent generic nucleic acid binding wherein said particles comprise:(a) a core wherein the core consists of an inner layer consisting of Fe3O4 and an outer layer consisting of Fe2O3,
(b) a coating wherein the coating comprises silica and silicates from sodium silicate precipitation,
wherein said particles display a sedimentation speed in pure water of less than 60 ?m/s, and no significant iron bleeding in 1M HCl for at least 60 minutes.
US Pat. No. 10,988,759

HIGH THROUGHPUT PROTEIN-PROTEIN INTERACTION SCREENING IN YEAST LIQUID CULTURE

UNIVERSITY OF WASHINGTON,...

1. A method of detecting a protein-protein interaction between cell surface proteins, the method comprising:(a) providing a first plurality of haploid yeast cells of a first mating type, the first plurality of cells comprising a library of first gene expression cassettes, wherein each gene expression cassette in the library comprises:
a nucleic acid sequence encoding a first selectable marker, a first unique oligonucleotide molecular barcode sequence operatively linked to a first recombination site, and a nucleic acid sequence encoding one protein of a first library of cell surface proteins, such that each unique oligonucleotide molecular barcode is operably linked to the nucleic acid sequence encoding one protein of the first library of cell surface proteins;
(b) providing a second plurality of haploid yeast cells of a second mating type, the second plurality of cells comprising a library of second gene expression cassettes, wherein each gene expression cassette in the library comprises:
a nucleic acid sequence encoding a second selectable marker, a second unique oligonucleotide molecular barcode sequence operatively linked to a second recombination site, and a nucleic acid sequence encoding one protein of a second library of cell surface proteins, such that each unique oligonucleotide molecular barcode is operably linked to the nucleic acid sequence encoding one protein of the second library of cell surface proteins,
wherein the first library of cell surface proteins encoded by the library of first gene expression cassettes and the second library of cell surface proteins encoded by the library of second gene expression cassettes comprise potential binding pairs between the first library of cell surface proteins and the second library of cell surface proteins;
(c) contacting the first plurality of haploid yeast cells with the second plurality of haploid yeast cells under liquid culture conditions that promote contact between the first plurality of haploid yeast cells and the second plurality of haploid yeast cells when a specific binding interaction between one protein of the first library of cell surface proteins encoded by the library of first gene expression cassettes and one protein of the second library of cell surface proteins encoded by the library of second gene expression cassettes occurs, wherein the specific binding interaction promotes mating of the first and second plurality of haploid yeast cells to produce diploid yeast cells;
(d) recombining within the diploid cells one or more nucleotides of the gene expression cassettes to generate a recombined molecular barcode sequence comprising at least one or more nucleotides of the first unique oligonucleotide barcode operably linked to the nucleic acid sequence encoding one protein of the first library of cell surface proteins and one or more nucleotides of the second unique oligonucleotide molecular barcode operably linked to the nucleic acid sequence encoding one protein of the second library of cell surface proteins; and
(e) sequencing the recombined molecular barcode sequence from the diploid cells to identify a surface protein from the library of first gene expression cassettes and a cell surface protein from the library of second gene expression cassettes that interact, thus detecting a protein-protein interaction between the cell surface proteins.
US Pat. No. 10,990,551

HIGH SPEED, PARALLEL CONFIGURATION OF MULTIPLE FIELD PROGRAMMABLE GATE ARRAYS

Micron Technology, Inc., ...

20. A system comprising:a PCIe switch;
a plurality of PCIe communication lines coupled to the PCIe switch;
a host computing system comprising:
a host memory storing a first configuration bit image for an application; and
a host processor adapted to transmit a message comprising a memory address of the first configuration bit image in the host memory;
one or more nonvolatile memories, each nonvolatile memory storing a second configuration bit image for a communication functionality;
a plurality of JTAG communication lines;
at least one first field programmable gate array coupled to a PCIe communication line of the plurality of PCIe communication lines and to one or more JTAG communication lines of the plurality of JTAG communication lines; the at least one first field programmable gate array coupled to a nonvolatile memory of the one or more nonvolatile memories, the at least one first field programmable gate array configured for the communication functionality using the second configuration bit image, the at least one first field programmable gate array having a DMA engine and, in response to the message, configured to use the DMA engine to access the host memory, obtain the first configuration bit image, and self-configure for the application using the first configuration bit image; the at least one first field programmable gate array further configured to transmit the first configuration bit image over the one or more JTAG communication lines; and
at least one second field programmable gate array, the at least one second field programmable gate array coupled to a JTAG communication line of the plurality of JTAG communication lines, the at least one second field programmable gate array configured for the application using the first configuration bit image transmitted over the plurality of JTAG communication lines.
US Pat. No. 10,988,504

SOLID PHASE PEPTIDE SYNTHESIS PROCESSES AND ASSOCIATED SYSTEMS

Massachusetts Institute o...

1. A process for adding amino acid residues to peptides, comprising:providing a plurality of peptides comprising protection groups, each peptide immobilized on a solid support;
exposing a deprotection reagent to the immobilized peptides to remove the protection groups from at least a portion of the immobilized peptides;
removing at least a portion of the deprotection reagent;
exposing a heated stream comprising activated amino acids to the immobilized peptides such that at least a portion of the activated amino acids are bonded to the immobilized peptides to form newly-bonded amino acid residues; and
removing at least a portion of activated amino acids that do not bond to the immobilized peptides;
wherein an amino acid residue is added to at least about 99% of the immobilized peptides during the amino acids exposing step; and
wherein the total amount of time taken to perform the combination of all of the deprotection reagent exposing step, the deprotection reagent removal step, the activated amino acid exposing step, and the activated amino acid removal step is from about 10 seconds to about 5 minutes.
US Pat. No. 10,988,761

HTP PLATFORM FOR THE GENETIC ENGINEERING OF CHINESE HAMSTER OVARY CELLS

Zymergen Inc., Emeryvill...

1. A high-throughput (HTP) method for immunoglobulin expression, comprising:(a) selecting at least one cellular pathway target gene that is endogenous to a host cell, wherein the target gene encodes a molecule selected from the group consisting of: signaling receptor protein 14 (SRP14), signaling receptor protein 9 (SRP9), signaling recognition particle 54 (SRP54), X-box binding protein 1 (XBP-1), b-cell lymphoma 2 (bcl-2), insulin-like growth factor 1 (IGF1), C1GALT1-specific chaperone (COSMC), alpha-1,6-fucosyltransferase 8 (FUT8), BCL2 antagonist/killer (BAK), activating transcription factor 6 (ATF6), eukaryotic translation initiation factor 2 alpha kinase 3 (PERK), inositol requiring enzyme 1 ? (IRE1?), heat shock 70 kDa protein 5 (BiP/GRP78), DNA heat shock protein family member B9 (Dnajb9), and lactate dehydrogenase A (LDHA);
(b) providing a promoter ladder comprising a plurality of promoters exhibiting different expression profiles;
(c) engineering the genome of the host cell by operably linking a promoter from the promoter ladder to the target gene in the genome of the host cell;
(d) repeating step (c) with additional host cells to create an initial promoter swap host cell library comprising a plurality of host cells, wherein the plurality of host cells comprises individual host cells comprising a different promoter from the promoter ladder operably linked to the target gene in the genome of each host cell; and
(e) screening cells of the initial promoter swap host cell library for phenotypic characteristics of an expressed immunoglobulin of interest and/or the host cell.
US Pat. No. 10,987,738

SURFACE-COATED CUTTING TOOL

Sumitomo Electric Hardmet...

1. A surface-coated cutting tool comprising a substrate and a coating that is disposed on the substrate and formed so as to cover at least a portion of a flank face,wherein
the coating includes an inner layer and an outer layer formed on the inner layer,
the inner layer is formed of at least one layer and includes an aluminum oxide layer as a layer in contact with the outer layer,
the outer layer has a multilayer structure that includes three or more layers stacked on top of one another,
each of the layers that constitute the multilayer structure is composed of a compound containing titanium and has an average thickness of greater than or equal to 0.05 ?m and less than or equal to 1 ?m,
the coating includes a plurality of voids in an interface between the inner layer and the outer layer,
the voids have an average diameter of greater than or equal to 10 nm and less than or equal to 80 nm and have a density of 1.1 to 2 pieces/?m on a cross-sectional surface of the coating obtained by cutting the coating along a plane in parallel with a normal to the flank face,
the inner layer has an average thickness of greater than or equal to 0.5 ?m and less than or equal to 20 ?m, and
the aluminum oxide layer being the layer that is included in the inner layer and is in contact with the outer layer has an average thickness of 0.5 to 4 ?m.
US Pat. No. 10,988,763

SINGLE-STRANDED RNA-EDITING OLIGONUCLEOTIDES

PROQR THERAPEUTICS II B.V...

1. An antisense oligonucleotide (AON) capable of forming a double stranded complex with a target RNA in a cell for the deamination of a target adenosine present in the target RNA by an ADAR enzyme present in the cell, wherein:(a) the AON is complementary to a target RNA region comprising the target adenosine, and the AON comprises one or more mismatches, wobbles and/or bulges with the complementary target RNA region;
(b) the AON comprises one or more nucleotides with one or more sugar modifications, provided that the nucleotide opposite the target adenosine comprises a ribose with a 2?-OH group, or a deoxyribose with a 2?-H group;
(c) the AON does not comprise a portion that is capable of forming an intramolecular stem-loop structure capable of binding an ADAR enzyme;
(d) the AON does not include a 5?-terminal O6-benzylguanine modification;
(e) the AON does not include a 5?-terminal amino modification; and
(f) the AON is not covalently linked to a SNAP-tag domain.
US Pat. No. 10,988,764

COMPOSITIONS AND METHODS FOR REGULATING GENE EXPRESSION VIA RNA INTERFERENCE

Monsanto Technology LLC, ...

1. A double stranded RNA (dsRNA) molecule comprising:a. a first strand comprising in the 5? to 3? direction
i. a first sequence that is essentially identical to at least 18 consecutive nucleotides of a first target nucleotide sequence; and
ii. a second sequence that is essentially identical to at least 18 consecutive nucleotides of a second target nucleotide sequence; and
b. a second strand comprising in the 5? to 3? direction, a 5?-overhang, a nucleotide sequence that is essentially complementary to the first strand, and a 2 nucleotide 3?-overhang, wherein the 5?-overhang is 5 nucleotides in length and has a high GC content,
wherein the first strand and the second strand are not linked by phosphodiester bonds,
wherein the dsRNA molecule is processed to produce 21, 22, 23, and/or 24 nucleotide siRNAs, and
wherein the production of the 21-24 nucleotide siRNAs is directionally biased towards the 3? end of the second strand of the dsRNA molecule.
US Pat. No. 10,988,509

METHOD OF CULTURING AKKERMANSIA

WAGENINGEN UNIVERSITEIT, ...

1. A method of culturing bacteria of the species Akkermansia muciniphila, said method comprising:inoculating a composition with bacteria of the species Akkermansia muciniphila, said composition comprising glucose, a nitrogen-containing derivative of a monosaccharide, threonine, and an amino acid source,
said nitrogen-containing derivative of a monosaccharide selected from the group consisting of N-acteyl-glucosamine (Glc-NAc) and N-acteyl-galactosamine (Gal-NAc).
US Pat. No. 10,988,765

METHODS AND COMPOSITIONS FOR INHIBITING DETOXIFICATION RESPONSE

THE GENERAL HOSPITAL CORP...

1. A method of attenuating a detoxification response and/or treating related symptoms in a subject in need of such treatment, the method comprising administering an inhibitor of expression of a daf-22 gene or its human homolog, SCPx.
US Pat. No. 10,988,510

SECRETAGOGUES DERIVED FROM OXALOBACTER FORMIGENES

OXTHERA INTELLECTUAL PROP...

1. A pharmaceutical composition comprising an effective amount of a secretagogue isolated from Oxalobacter formigenes oxalate-degrading bacteria, the secretagogue having the amino acid sequence of any one of SEQ ID NOs. 3, 4, 6, 13 and 19, wherein the secretagogue promotes secretion of oxalate, and wherein the pharmaceutical composition is provided with an enteric coating.
US Pat. No. 10,988,766

COMPOSITIONS AND METHODS USED IN DIAGNOSING AND TREATING COLORECTAL CANCER

1. A method of sensitizing colorectal cancer cells in a subject to ionizing radiation, the method comprising administering to a subject in need thereof an effective amount of miR-451a (SEQ ID NO: 1).
US Pat. No. 10,988,511

CONSERVED ESCHERICHIA BACTERIAL IG-LIKE DOMAIN (GROUP 1) PROTEIN (ORF405) IMMUNOGENS

GLAXOSMITHKLINE BIOLOGICA...

1. A composition comprising an immunologically effective amount of an adjuvant in admixture with an isolated or recombinant polypeptide fragment comprising amino acids of any one of the polypeptides of SEQ ID NOs: 3-18 and lacking amino acid residues 21-593 and 1009 to 1416, 1417, or 1418 of the applicable polypeptide of SEQ ID NO:3, 4, 5, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17 or 18 or lacking amino acid residues 21-593 and 1009 to 1415 of SEQ ID NO: 6 or 7.
US Pat. No. 10,988,512

METHODS OF PRODUCING AGGREGATE-FREE MONOMERIC DIPHTHERIA TOXIN FUSION PROTEINS AND THERAPEUTIC USES

The Johns Hopkins Univers...

1. A fusion protein having an amino acid sequence selected from the group consisting of SEQ ID NOs: 12, 14, 15, and 43.
US Pat. No. 10,988,768

TMPRSS6 IRNA COMPOSITIONS AND METHODS OF USE THEREOF

Alnylam Pharmaceuticals, ...

1. A double stranded RNAi agent for inhibiting expression of TMPRSS6 in a cell, comprising a sense strand and an antisense strand forming a double-stranded region,wherein the antisense strand comprises at least 15 contiguous nucleotides which differ by no more than three nucleotides from the nucleotide sequence AGAAUGAACCAGAAGAAGCAGGU (SEQ ID NO:187),
wherein each strand is independently 15 to 30 nucleotides in length,
wherein all of the nucleotides of the sense strand and all of the nucleotides of the antisense strand are modified nucleotides,
wherein the double stranded RNAi agent comprises 6-8 phosphorothioate internucleotide linkages, and
wherein at least one strand is conjugated to an N-acetylgalactosamine (GalNAc) derivative ligand attached at the 3?-terminus, the 5?-terminus or both termini.
US Pat. No. 10,988,513

MALTOSE DEPENDENT DEGRONS, MALTOSE-RESPONSIVE PROMOTERS, STABILIZATION CONSTRUCTS, AND THEIR USE IN PRODUCTION OF NON-CATABOLIC COMPOUNDS

AMYRIS, INC., Emeryville...

1. A method for producing a heterologous non-catabolic compound, the method comprising:(a) culturing a population of genetically modified host cell in a culture medium comprising an essential compound, wherein the genetically modified host cell comprises:
i. a heterologous nucleic acid for producing the heterologous non-catabolic compound, wherein the heterologous nucleic acid is operably linked to a first promoter;
ii. a nucleic acid encoding a conditional essential gene product of a biosynthetic pathway for producing the essential compound, wherein the nucleic acid is operably linked to a second promoter; and
iii. a nucleic acid encoding a transcriptional regulator,
wherein the first promoter and the second promoter are both regulated by the transcriptional regulator, and wherein expression of the heterologous nucleic acid encoding the enzyme of the biosynthetic pathway and expression of the nucleic acid encoding the conditional essential gene product are limited, and wherein the nucleic acid encoding a transcriptional regulator is operably linked to an inducible promoter, and wherein the inducible promoter is a maltose-responsive promoter; and
(b) culturing the population or a subpopulation thereof in a culture medium comprising a sufficiently low amount of or no essential compound under a culture condition which promotes expression of the nucleic acid encoding the conditional essential gene product resulting in production of the essential compound necessary for cell growth, and which culture condition promotes expression of the heterologous nucleic acid operably linked to the first promoter, resulting in increased production of the heterologous non-catabolic compound compared to step (a).
US Pat. No. 10,988,769

PAENIBACILLUS-BASED ENDOSPORE DISPLAY PLATFORM, PRODUCTS AND METHODS

Bayer CropScience LP, St...

1. A nucleic acid molecule encoding a fusion protein, comprising (a) a first polynucleotide sequence encoding an N-terminal signal peptide, operably linked to (b) a second polynucleotide sequence encoding a polypeptide heterologous to the N-terminal signal peptide, wherein the first polynucleotide sequence comprises:(i) a polynucleotide sequence comprising SEQ ID NO: 1; or
(ii) a polynucleotide sequence that encodes a polypeptide comprising SEQ ID NO: 2;
wherein the N-terminal signal peptide is capable of targeting the fusion protein to a spore surface of a Paenibacillus endospore.
US Pat. No. 10,988,514

POLYPEPTDES CAPABLE OF FORMING HOMO-OLIGOMERS WITH MODULAR HYDROGEN BOND NETWORK-MEDIATED SPECIFICITY AND THEIR DESIGN

University of Washington,...


Z2 is selected from the group consisting of general formulae BX1BX2, X1BBX2, X1BX2B, X1X2BB, BX1X2B, and BBX1X2, wherein:
B is xx-S-L-xx-xx-Q-xx;
X1 and X2 independently have the amino acid sequence of Formula 5:
O1O2O3O4O5O6O7 wherein:
O1, O4, O5, and O7 are xx;
O2 and O3 are independently selected from the group consisting of I, L, and A; and
O6 is L; and
Z4 is selected from the group consisting of general formulae B2X3B2X4, X3B2B2X4, X3B2X4B2, X3X4B2B2, B2X3X4B2, and B2B2X3X4, wherein
B2 is xx-L-A-xx-xx-Q-xx; and
X3 and X4 independently have the amino acid sequence of Formula 6:
O10O11O12O13O14O15O16 wherein
O10, O13, O14, and O16 are xx;
O11 is L; and
O12 and O15 are independently selected from e group consisting of I, L, V, and A;
wherein xx is any amino acid; and
wherein:
(i) when Z2 is BX1BX2 then Z4 is X3B2X4B2;
(ii) when Z2 is X1BBX2 then Z4 is X3B2B2X4;
(iii) when Z2 is X1BX2B then Z4 is BX3B2X4;
(iv) when Z2 is X1X2BB then Z4 is B2B2X3X4;
(v) when Z2 is BX1X2B then Z4 is B2X3X4B2;
(vi) when Z2 is BBX1X2 then Z4 is X3X4B2B2; and
(vii) “and” is not used interchangeably with “or”.
US Pat. No. 10,988,515

ELASTOMERIC PROTEINS

Bolt Threads, Inc., Emer...

1. A method for producing a composition comprising a recombinant resilin protein, comprising:culturing a population of recombinant host cells in a fermentation, wherein said recombinant host cells comprise a vector comprising a secreted resilin coding sequence, and wherein said recombinant host cells secrete a recombinant resilin protein encoded by said secreted resilin coding sequence, and wherein said recombinant host cells are yeast cells; and
purifying said recombinant resilin protein from said fermentation.
US Pat. No. 10,988,771

ENDOSPERM-SPECIFIC PROMOTER FROM THE LIPID TRANSFER PROTEIN 1 GENE OF COFFEA ARABICA

1. A nucleic acid molecule, wherein said nucleic acid molecule comprises a polynucleotide sequence having promoter activity which has at least 95% sequence identity to the nucleotide sequence of SEQ ID NO: 1, wherein the polynucleotide sequence is linked to a nucleotide sequence that is heterologous with respect to SEQ ID NO: 1.
US Pat. No. 10,988,516

METHODS AND COMPOSITIONS FOR TREATING INFLAMMATION

UTI Limited Partnership, ...

1. A method for treating inflammation in the gastrointestinal (GI) tract of a patient in need thereof comprising parenterally administering to the patient an effective amount of a nanoparticle composition, wherein the composition does not comprise an adjuvant, wherein the composition comprises a plurality of nanoparticle cores, each nanoparticle core coupled to a plurality of peptide antigen-MHC complexes, wherein:a) the peptide antigen comprises a peptide having at least 80% identity to a peptide sequence SEQ ID NO. 1;
b) the nanoparticle core has a diameter from about 1 nm to about 100 nm; and
c) the ratio of peptide antigen-MHC complexes per nanoparticle core is from about 10:1 to about 1000:1; and
d) the peptide antigen is a T cell epitope.
US Pat. No. 10,988,772

LOW GLUCOSINOLATE PENNYCRESS MEAL AND METHODS OF MAKING

CoverCress Inc., St. Lou...

1. A pennycress seed comprising less than 30 micromoles sinigrin per gram by dry weight, wherein the seed comprises: (i) at least one loss-of-function mutation in an endogenous pennycress gene encoding the polypeptide of SEQ ID NO: 3 or an allelic variant thereof and said loss-of-function mutation reduces expression of said polypeptide or reduces 2-oxoglutarate-dependent dioxygenase activity of said polypeptide; or (ii) at least one transgene or genome rearrangement that suppresses expression of at least one endogenous pennycress gene that encodes the polypeptide of SEQ ID NO: 3 or an allelic variant thereof; and wherein said allelic variants of SEQ ID NO: 3 have at least 95% sequence identity to SEQ ID NO: 3.
US Pat. No. 10,988,517

HETERODIMERIC PROTEINS FOR MODULATING GAMMA DELTA T CELLS

Shattuck Labs, Inc., Aus...

1. A heterodimeric protein comprising:(a) a first domain comprising one or more butyrophilin family proteins selected from BTN3A1, BTN3A2, BTN2A1, BTNL3, and BTNL8, or fragments thereof that comprise the extracellular domain of the butyrophilin family proteins;
(b) a second domain comprising a targeting domain, wherein the targeting domain is capable of binding to CD19 and selected from an antibody and a single-chain antibody (scFv); and
(c) a linker that adjoins the first and second domain, the linker comprises:
a peptide comprising negatively charged amino acid residues comprising the sequence DEGGED (SEQ ID NO: 13) or GSGSDEGGEDGS (SEQ ID NO: 14), and/or
a peptide comprising positively charged amino acid residues comprising the sequence RKGGKR (SEQ ID NO: 11) or GSGSRKGGKRGS (SEQ ID NO: 12).
US Pat. No. 10,988,773

ENGINEERED MICROALGAE WITH ENHANCED LIPID PRODUCTION

J. Craig Venter Institute...

1. An engineered diatom that produces lipid during exponential growth, and has been stably engineered with an exogenous nucleic acid to enhance the expression level or activity of a protein that facilitates carbon assimilation comprising pyrenoid decarboxylase having a nucleotide sequence set forth in SEQ ID NO: 6 or 8, relative to the wild-type diatom, wherein said nucleotide sequence is fused to a fucoxanthin binding protein promoter, and wherein the diatom is Phaeodactylum triconutum or Thalassiosira pseudonana.
US Pat. No. 10,988,518

METHOD FOR EFFICIENTLY PRODUCING ? MYOSIN HEAVY CHAIN IN CARDIAC MUSCLE CELLS DIFFERENTIATED FROM INDUCED PLURIPOTENT STEM CELLS DERIVED FROM HOMO SAPIENS

PANASONIC CORPORATION, O...

1. A method for producing a ? myosin heavy chain in cardiac muscle cells differentiated from human induced pluripotent stem cells, the method comprising:(a) supplying a liquid culture medium containing the cardiac muscle cells onto a substrate comprising a first electrode, a second electrode and insulative fibers on the surface thereof to coat a surface of the first electrode, a surface of the second electrode, and a region between the first electrode and the second electrode with the cardiac muscle cells;
wherein
at least a part of the insulative fibers is located between the first electrode and the second electrode in a top view of the substrate; and
an angle formed between each of not less than 90% of the insulative fibers and an imaginary straight line which passes through both the first electrode and the second electrode is not more than ±20 degrees in the top view;
(b) leaving the substrate at rest;
(c) cultivating the cardiac muscle cells, while a pulse electric current is applied to the cardiac muscle cells through the first electrode and the second electrode; and
(d) obtaining the ? myosin heavy chain produced in the cultivated cardiac muscle cells.
US Pat. No. 10,988,774

SYSTEM FOR SITE-SPECIFIC MODIFICATION OF ALS GENE USING CRISPR-CAS9 SYSTEM FOR PRODUCTION OF HERBICIDE-RESISTANT RICE AND USE OF SAME

INSTITUTE OF CROP SCIENCE...

1. A composition for site-specific modification in a plant genome, comprising a vector for site-specific modification in the plant genome and a donor DNA A;wherein the vector for site-specific modification in the plant genome comprises a Cas9 protein expression cassette, a gRNA expression cassette, and a donor DNA B;
wherein the gRNA expression cassette encodes two gRNAs targeting two target sites in a target DNA of a plant of interest;
wherein the target DNA of the plant of interest comprises a fragment to be site-specifically modified which is positioned between the two target sites in the target DNA of the plant of interest;
wherein of the two target sites, one positioned upstream is an upstream target site,
wherein the other one positioned downstream is a downstream target site;
wherein the donor DNA B comprises the upstream target site, the downstream target site, and a fragment for site-specific modification positioned between the upstream target site and the downstream target site;
wherein the fragment for site-specific modification is a DNA fragment to replace the fragment to be site-specifically modified in the target DNA;
wherein the donor DNA A is other than the vector and has a same nucleotide sequence as the donor DNA B, and
wherein: the upstream target site consists of nucleotides at positions 7590-7609 from 5?-end of SEQ ID NO: 1; the downstream target site consists of nucleotides at positions 8032-8051 from 5?-end of SEQ ID NO: 1; and the fragment for site-specific modification is set forth by the nucleotides at positions 7716-7979 from 5?-end of SEQ ID NO: 1.
US Pat. No. 10,989,030

SYNTHETIC SWEET SPOTS IN TIGHT FORMATIONS BY INJECTION OF NANO ENCAPSULATED REACTANTS

SAUDI ARABIAN OIL COMPANY...

1. A method for stimulating production of gas in a tight-gas formation, the method comprising the steps of:injecting into the formation an aqueous solution comprising at least one encapsulated nano particle reactant, the at least one encapsulated nano particle reactant comprising a reactant and a coating, the reactant being capable of reacting exothermically to produce a volume of gas, wherein the reactant is a component of a redox reaction and is selected from the group consisting of an oxidizing agent and a reducing agent;
allowing the at least one encapsulated nano particle reactant to migrate into fractures in the formation;
allowing a delayed erosion of the coating, wherein erosion of the coating releases the reactant;
allowing the reactant to react exothermically to produce the volume of gas;
creating an area of localized pressure within the formation due to the volume of gas; and
producing fractures and microfractures due to the localized pressure, thereby improving production therefrom.
US Pat. No. 10,988,519

COMPOSITION AND METHOD FOR TREATING COMPLEMENT-MEDIATED DISEASE

The Trustees of the Unive...

1. A recombinant viral vector having packaged therein an expression cassette comprising a nucleic acid sequence that encodes SEQ ID NO: 48 operably linked to expression control sequences which direct expression thereof.
US Pat. No. 10,988,520

LYSIN-ANTIMICROBIAL PEPTIDE (AMP) POLYPEPTIDE CONSTRUCTS, LYSINS, ISOLATED POLYNUCLEOTIDES ENCODING SAME AND USES THEREOF

CONTRAFECT CORPORATION, ...

1. A lysin-antimicrobial peptide (AMP) polypeptide construct comprising:(a) a first component comprising the polypeptide sequence of:
(i) SEQ ID NO: 118; or
(ii) a polypeptide having lytic activity and having at least 80% sequence identity with the polypeptide sequence of SEQ ID NO: 118; or
(iii) an active fragment of SEQ. ID NO: 118; and
(b) a second component comprising the polypeptide sequence of SEQ ID NO: 114,
wherein the polypeptide having lytic activity and having at least 80% sequence identity with the polypeptide sequence of SEQ ID NO: 118 and the active fragment of SEQ ID NO: 118 retain an ?-helix domain of the polypeptide of SEQ ID NO: 118.
US Pat. No. 10,988,776

METHODS OF MODIFYING GENES IN EUKARYOTIC CELLS

REGENERON PHARMACEUTICALS...

1. A method of creating a conditional allele in the genome of a mouse embryonic stem (ES) cell, comprising:modifying a genomic exon of the mouse ES cell by introducing an artificial intron into the genomic exon by homologous recombination, the artificial intron comprising:
a splice donor;
a DNA cassette comprising a first transcription termination sequence and a marker gene and a first splice acceptor, wherein the first transcription termination sequence, marker gene, and first splice acceptor are oriented in the antisense direction with respect to the genomic exon into which the DNA cassette is to be introduced, wherein the DNA cassette is flanked by first and second site-specific recombination sites oriented in the opposite direction with respect to one another, such that inversion of the DNA cassette occurs as a result of site-specific recombination by a recombinase that recognizes the first and second site-specific recombination sites,
a second splice acceptor; and
a drug selection cassette, wherein the drug selection cassette comprises a second transcription termination sequence followed by a drug resistance gene operably linked to a promoter, wherein the drug selection cassette is flanked by third and fourth site-specific recombination sites oriented in the same direction with respect to one another; such that excision of the drug resistance gene and second transcription termination sequences occurs as a result of site-specific recombination by a recombinase that recognizes the third and fourth site-specific recombination sites;
wherein the artificial intron comprises from 5? to 3? with respect to the direction of transcription:
the splice donor, the first site-specific recombination site, the first transcription termination sequence in antisense orientation, the marker gene in antisense orientation, the first splice acceptor in antisense orientation, the second site-specific recombination site, wherein the second site-specific recombination site is oriented with respect to the first site-specific recombination site to direct an inversion of sequence between the first and second site-specific recombination sites; the third site-specific recombination site, the second transcription termination sequence in antisense orientation, the drug resistance gene in antisense orientation, the promoter operably linked to the drug resistance gene, the fourth site-specific recombination site, wherein the fourth site-specific recombination site is oriented with respect to the third site-specific recombination site to direct an excision of sequence between the third and fourth site-specific recombination sites, and the second splice acceptor;
whereby in the absence of exposure to a recombinase that recognizes the first and second site-specific recombination sites, a normal mRNA transcript is produced from a genomic region of the genome comprising the modified genomic exon; and
whereby in the presence of exposure to a recombinase that recognizes the first and second site-specific recombination sites, an mRNA transcript produced from a genomic region of the genome comprising the modified genomic exon is terminated at the position of the first termination sequence.
US Pat. No. 10,988,521

RECOMBINANT MILK PROTEINS

Alpine Roads, Inc., Sout...

1. A recombinant fusion protein, comprising:a) ?-casein; and
b) ?-lactoglobulin.
US Pat. No. 10,988,777

METHOD FOR INDUCING CCR5?32 DELETION BY USING CRISPR-CAS9 GENOME EDITING TECHNIQUE

Nankai University, Tianj...

1. A method for treating HIV/AIDS by inducing CCR5?32 deletion by using CRISPR-Cas9 genome editing technique, wherein the method comprises:i) designing a pair of guide RNAs (gRNA) for target sequences at both sides of CCR5?32, to obtain CCR5?32/?32 homozygous cells,
wherein the DNA corresponding to the gRNA at the left side of CCR5?32 deletion sequence is selected from any one sequence of SEQ ID Nos. 3-19;
wherein the DNA corresponding to the gRNA at the right side of CCR5?32 deletion sequence is selected from any one sequence of SEQ ID Nos. 20-36;
wherein the DNA corresponding to the gRNA at the left side of CCR5?32 deletion sequence has the seed DNA sequence “5? gactgta 3?” and the DNA corresponding to the gRNA at the right side of CCR5?32 deletion sequence has the seed DNA sequence “5? taatgtc 3?”;
ii) constructing a functional plasmid by inserting the DNA sequences corresponding to the gRNAs designed in i) into a CRISPR-Cas9 plasmid vector,
wherein the functional plasmid comprises:
a. a Cas9 nuclease expression reading frame, other associated gene sequences of CRISPR, and lentiviral packaging signals; and
b. the DNA sequences corresponding to the gRNAs at both sides of CCR5?32 locus, as described in i);
iii) preparing lentiviral particles encapsulating the functional plasmid by co-transfecting the functional plasmid constructed in ii) and the packaging plasmids PMD2.G and psPAX2 into HEK293T cells, and collecting cell supernatant after a period of time, wherein the supernatant contains the lentiviral particles; and
iv) infecting target cells with the lentiviral particles obtained in iii) to obtain CCR5?32/?32 homozygous deletion cells which are used as a treatment for HIV/AIDS.
US Pat. No. 10,988,522

PROTEOLICALLY RESISTANT CYCLOTIDES WITH ANGIOTENSIN 1-7 LIKE ACTIVITY

UNIVERSITY OF SOUTHERN CA...

1. A cyclotide comprising:a) a cyclotide backbone selected from the group consisting of SEQ ID NOs: 2, 4, and 5 and
b) an angiotensin polypeptide consisting of the sequence of SEQ ID NO: 14,
wherein the cyclotide maintains a biological activity of an angiotensin polypeptide.
US Pat. No. 10,988,778

CODON-OPTIMIZED REDUCED-SIZE ATP7A CDNA AND USES FOR TREATMENT OF COPPER TRANSPORT DISORDERS

The United States of Amer...

1. A method of treating a subject with Menkes disease, comprising:(a) intracerebroventricularly administering to the subject an effective amount of a composition comprising: about 1×109 to about 1×1010 viral genome of an adeno-associated virus serotype 9 (AAV9) vector comprising a nucleic acid molecule consisting of the nucleic acid sequence as set forth in SEQ ID NO: 1 operably linked to a promoter, wherein the nucleic acid molecule encodes a reduced-size P-type ATPase copper-transporting ATPase 1 (ATP7A) protein; and a pharmaceutically acceptable carrier; and
(b) administering an effective amount of copper to the subject,
thereby treating the subject with Menkes disease.
US Pat. No. 10,988,779

VIRAL DELIVERY OF RNA UTILIZING SELF-CLEAVING RIBOZYMES AND CRISPR-BASED APPLICATIONS THEREOF

Icahn School of Medicine ...

1. A nucleic acid comprising a genome sequence of a single-stranded RNA (ssRNA) virus or antigenome sequence that is complementary to the genome sequence, the antigenome sequence comprising a first region comprising(i) a target segment,
(ii) a first segment encoding a first self-cleaving ribozyme, and
(iii) a second segment encoding a second self-cleaving ribozyme,wherein the target segment is adjacent to the first segment and wherein the target segment is flanked by the first segment and the second segment.
US Pat. No. 10,988,524

MODIFIED RELAXIN B CHAIN PEPTIDES AND THEIR THERAPEUTIC USE

SANOFI, Paris (FR)

1. The peptide having the following formula (I)Nter-X-(E)a-X10-E-G-R-E-X15-V-R-X18-X19-I-X21-X22-E-G-X25-S-X27-X28-X29-X30-R-(X32)b-(X33)c-(X34)d-NH2-Cter wherein:Nter represents the N-terminal end of the peptide;
Cter represents the C-terminal end of the peptide;
a, b, c and d independently represent 0 or 1;
X represents hydrogen atom or acetyl group;
E represents glutamic acid;
X10 represents an amino acid selected from the group consisting of leucine, 2-amino-isobutyric acid, ?-methyl-leucine and N?-acetyl-lysine;
G represents glycine;
R represents arginine;
X15 represents an amino acid selected from the group consisting of lysine, homolysine, arginine, homoarginine and ornithine;
V represents valine;
X18 represents an amino acid selected from the group consisting of alanine, 2-amino-isobutyric acid, N?-acetyl-lysine, arginine, leucine and glutamine;
X19 represents an amino acid selected from the group consisting of glutamine, N?-acetyl-lysine, alanine and 2-amino-isobutyric acid;
I represents isoleucine;
X21 represents an amino acid selected from the group consisting of alanine and 2-amino-isobutyric acid;
X22 represents an amino acid selected from the group consisting of isoleucine and 2-amino-isobutyric acid;
X25 represents an amino acid selected from the group consisting of methionine, norleucine, glutamine, glutamic acid and N?-acetyl-lysine;
S represents serine;
X27 represents an amino acid selected from the group consisting of threonine, lysine, ?-methyl-serine, glutamine and arginine;
X28 represents an amino acid selected from the group consisting of tryptophan, 5-chlorotryptophan, 5-Fluorotryptophan, 5-MethoxyTryptophan, phenylalanine, homophenylalanine, tyrosine, 4-fluoro-phenylalanine, 1-naphtylalanine and 2-naphtylalanine;
X29 represents an amino acid selected from the group consisting of serine, alanine, threonine, ?-methyl-serine, N?-acetyl-lysine and valine;
X30 represents an amino acid selected from the group consisting of lysine, 2-amino-isobutyric acid, ?-methyl-lysine, N?-acetyl-lysine and arginine;
X32 represents an amino acid selected from the group consisting of lysine, arginine and N?-acetyl-lysine;
X33 represents an amino acid selected from the group consisting of leucine, lysine, N?-acetyl-lysine, glutamine, arginine and alanine; and
X34 represents an amino acid selected from the group consisting of lysine and N?-acetyl-lysine;or a salt or a solvate thereof.
US Pat. No. 10,988,780

METHODS AND COMPOSITIONS FOR RNA-DIRECTED TARGET DNA MODIFICATION AND FOR RNA-DIRECTED MODULATION OF TRANSCRIPTION

The Regents of the Univer...

1. A method of producing genetically modified prokaryotic cells, the method comprising:(1) contacting a target DNA inside of a prokaryotic cell with:
(a) a Cas9 protein; and
(b) a single molecule DNA-targeting RNA comprising, in 5? to 3? order:
(i) a targeter-RNA comprising a nucleotide sequence that is complement to, and hybridizes with, a target sequence of the target DNA, and
(ii) an activator-RNA that hybridizes with the targeter-RNA to form a double-stranded RNA duplex,
wherein the targeter-RNA and the activator-RNA are covalently linked by intervening nucleotides,
wherein said contacting results in modification of the target DNA thereby producing a genetically modified prokaryotic cell; and then
(2) culturing said genetically modified prokaryotic cell to produce a population of genetically modified prokaryotic cells.
US Pat. No. 10,988,525

MODIFIED MONOCYTES/MACROPHAGE EXPRESSING CHIMERIC ANTIGEN RECEPTORS AND USES THEREOF

The Trustees of the Unive...

1. A modified cell comprising a chimeric antigen receptor (CAR), wherein the CAR comprisesan anti-HER2 antigen binding domain, an anti-PSMA binding domain, or an anti-mesothelin antigen binding domain,
a transmembrane domain, and
an intracellular domain of a stimulatory and/or co-stimulatory molecule, and wherein the modified cell is a macrophage or a monocyte.
US Pat. No. 10,988,781

METHOD OF TARGET CLEAVING USING CRISPR HYBRID DNA/RNA POLYNUCLEOTIDES

Caribou Biosciences, Inc....

1. A method of site specific cleaving of a target deoxyribonucleic acid (DNA) molecule in vitro or in an isolated cell, the method comprising:contacting the target DNA molecule having a target sequence with
a single polynucleotide comprising a targeting region that comprises a mixture of DNA and ribonucleic acid (RNA) and an activating region that comprises a mixture of DNA and RNA, wherein the activating region is adjacent to the targeting region, wherein the targeting region is configured to hybridize with the target sequence, and wherein the activating region comprises a stem loop structure; and
a Cpf1 protein,
wherein the Cpf1 protein binds to the activating region of the single polynucleotide, thereby cleaving the target DNA molecule.
US Pat. No. 10,987,501

CELL IMPREGNATED SLEEVE FOR PARACRINE AND OTHER FACTOR PRODUCTION

The Johns Hopkins Univers...

1. A method of treating a subject in need thereof, comprising:(a) preparing a therapeutic sleeve device comprising:
i. a nonwoven fiber fabric assembly defining a plurality of pores, wherein said nonwoven fiber fabric assembly comprises a nanofiber fabric assembly comprising at least one of poly(lactic acid), poly(L-lactic acid), poly(lactic-co-glycolic acid) copolymer, polycaprolactone, or polyethylene terephthalate; and
ii. a plurality of stem cells, each stem cell of the plurality of stem cells embedded in one of the plurality of pores of the nonwoven fiber fabric assembly, wherein each stem cell of the plurality of stem cells is configured to emit paracrine factors, the paracrine factors being configured to promote healing of a tissue, organ, or wound of the subject,
each stem cell of the plurality of stem cells has a cell diameter, wherein each pore of the plurality of pores has a maximal pore size of less than 10 microns in diameter,
the maximal pore size of each pore is less than the cell diameter to form a cage inside which any of the plurality of stem cells is embedded and retained thereby configuring the cage to prevent interaction between cells of the subject and the plurality of stem cells in response to the therapeutic sleeve device being inserted into the subject, and
the maximal pore size is larger than a diameter of the paracrine factors emitted by each stem cell of the plurality of stem cells to allow for the paracrine factors to be emitted through the cage while the cage prevents washout and dilution of the plurality of stem cells from the therapeutic sleeve;
(b) wrapping the therapeutic sleeve device around an object, wherein the object comprises a medical instrument, a tissue, an organ or a portion of an organ, a blood vessel, or a bypass graft, and
(c) implanting the wrapped object into the subject,
wherein the therapeutic sleeve device prevents embedded stem cells from dilution and washout, and protects them from the immune system of the subject.
US Pat. No. 10,988,526

DNA MOLECULE ENCODING A P75NTR(NBP)-FC FUSION PROTEIN

Levicept Limited, Sandwi...

1. A nucleic acid molecule encoding the amino acid sequence set forth by SEQ ID NO:3.
US Pat. No. 10,988,782

METHODS AND COMPOSITIONS FOR RNA-DIRECTED TARGET DNA MODIFICATION AND FOR RNA-DIRECTED MODULATION OF TRANSCRIPTION

The Regents of the Univer...

1. A composition comprising:(1) a Cas9 protein or a nucleic acid encoding the Cas9 protein, and
(2) a non-naturally occurring DNA-targeting RNA that comprises:
(i) a targeter-RNA comprising a nucleotide sequence that is complementary to a target sequence of a target DNA; and
(ii) an activator-RNA that hybridizes with the targeter-RNA to form a double-stranded RNA duplex, wherein the activator-RNA hybridizes with the targeter-RNA to form a total of 8 to 15 base pairs,
wherein the non-naturally occurring DNA-targeting RNA comprises one or more of: a non-natural internucleoside linkage, a nucleic acid mimetic, a modified sugar moiety, and a modified nucleobase,
wherein the non-naturally occurring DNA-targeting RNA is capable of forming a complex with the Cas9 protein and hybridization of the targeter-RNA to the target sequence is capable of targeting the complex to the target DNA.
US Pat. No. 10,988,527

METHOD FOR PREPARING TNFR-FC FUSION PROTEIN CONTAINING TARGET CONTENT OF IMPURITIES

LG CHEM, LTD., Seoul (KR...

1. A method for preparing a TNFR-Fc fusion protein mixture comprising a target content of hydrophobic chromatogram peak 3 impurities, wherein the TNFR-Fc fusion protein mixture is a biosimilar to an originator product and the target content of hydrophobic chromatogram peak 3 impurities is adjusted to that of the originator product TNFR-Fc fusion protein mixture, comprising:(a) injecting a sample comprising a TNFR-Fc fusion protein mixture liquid produced from mammalian cells into a column filled with hydrophobic interaction chromatography (HIC) medium comprising an aromatic functional group, which is pre-equilibrated with an equilibration (EQ) buffer comprising sodium chloride at a concentration of 1 M to 1.4 M or ammonium sulfate at a concentration of 0.45 M to 0.55 M; and
(b) adjusting the content of hydrophobic chromatogram peak 3 impurities by eluting the protein mixture with an elution buffer comprising sodium chloride or ammonium sulfate at the same concentration as that of the equilibration buffer, wherein the concentration of sodium chloride or ammonium sulfate is adjusted to produce the target content of hydrophobic chromatogram peak 3 impurities,
wherein the content of the hydrophobic chromatogram peak 3 impurities of the sample comprising said TNFR-Fc fusion protein mixture of step (a) exceeds 20%, and
wherein the target content of hydrophobic chromatogram peak 3 impurities is 9% to 18%.
US Pat. No. 10,988,783

METHODS AND MATERIALS FOR PRODUCING 7-CARBON MONOMERS

INV NYLON CHEMICALS AMERI...

1. A method of producing 5-amino-3-oxopentanoyl-[ACP] or 5-amino-3-oxopentanoyl-CoA or corresponding salts thereof, said method comprising enzymatically converting ?-alanyl-[ACP] or ?-alanyl-CoA respectively to 5-amino-3-oxopentanoyl-[ACP] or 5-amino-3-oxopentanoyl-CoA or corresponding salts thereof, using a polypeptide having the activity of a ?-ketoacyl synthase or a ?-ketothiolase classified under EC. 2.3.1.- and/or a CoA transferase classified under EC 2.8.3-.
US Pat. No. 10,988,528

ANTIBODY-BASED MOLECULES SPECIFIC FOR THE TRUNCATED ASP421 EPITOPE OF TAU AND THEIR USES IN THE DIAGNOSIS AND TREATMENT OF TAUOPATHY

New York University, New...

1. An antibody-based molecule that is capable of immunospecifically binding to the Truncated Asp421 Epitope of Tau, wherein said epitope is present on a peptide having the sequence of Tau 407-421 (SEQ ID NO:7): HLSNVSSTGSIDMVD,wherein:
(A) said aspartate residue of SEQ ID NO:7 is the C-terminal Tau residue of said polypeptide;
(B) relative to said immunospecific binding, said antibody-based molecule exhibits substantially diminished binding to a polypeptide that contains additional Tau sequence residues C-terminal to said aspartate residue of SEQ ID NO:7; and
(C) said antibody-based molecule comprises:
(i) a Variable Light Chain CDR1, CDR2, CDR3 having the amino acid sequence of SEQ ID NOs:37, 38 and 39, respectively; and
(ii) a Variable Heavy Chain CDR1, CDR2, CDR3 respectively having the amino acid sequence of SEQ ID NOs:41, 42 and 43, respectively.
US Pat. No. 10,989,040

METHOD OF USING CONTROLLED RELEASE TRACERS

Baker Hughes, LLC, Houst...

1. A sand control method for a wellbore penetrating a subterranean formation, comprising(a) introducing into the wellbore a slurry comprising a composite having an immobilized solid tracer onto a substrate or within a matrix which is either hydrocarbon soluble, water soluble or both water soluble and hydrocarbon soluble and further wherein the solid tracer is capable of being slowly solubilized into fluids produced from the well and wherein the composite either comprises:
(i) the tracer adsorbed onto a water-insoluble adsorbent substrate, the water-insoluble adsorbent having a surface area between from about 1 m2/g to about 100 m2/g;
(ii) the tracer absorbed into the pores within a porous particulate;
(iii) the tracer adsorbed onto a calcined porous metal oxide substrate, the surface area of the calcined porous metal oxide substrate being between from about 1 m2/g to about 10 m2/g and the diameter of the calcined porous metal oxide substrate being between from about 0.1 to about 3 mm; or
(iv) a microemulsion comprising the tracer and an emulsified solvent-surfactant blend wherein the particle size of the tracer in the microemulsion is between from about 0.001 microns to about 100 microns;
(b) placing the slurry adjacent the subterranean formation to form a fluid-permeable pack capable of reducing or substantially preventing the passage of formation particles from the subterranean formation into the wellbore while allowing passage of formation fluids from the subterranean formation into the wellbore; and
(c) solubilizing the solid tracer into hydrocarbons or water in the formation or well over a period between 6 months and five years; and
(d) monitoring the solubilized immobilized tracer in fluids removed from the well.
US Pat. No. 10,988,529

COMBINATION THERAPY

Eli Lilly and Company, I...

1. A pharmaceutical composition, comprising an anti-N3pGlu Abeta antibody, with one or more pharmaceutically acceptable carriers, diluents, or excipients, in combination with a pharmaceutical composition of anti-Tau antibody, with one or more pharmaceutically acceptable carriers, diluents, or excipients, wherein the anti-Tau antibody comprises a light chain variable region (LCVR) and a heavy chain variable region (HCVR), wherein the LCVR comprises complementarity determining regions (CDRs) LCDR1, LCDR2, and LCDR3 and the HCVR comprises CDRs HCDR1, HCDR2, and HCDR3, wherein the amino acid sequence of LCDR1 is given by SEQ ID NO.69, the amino acid sequence of LCDR2 is given by SEQ ID NO.70, the amino acid sequence of LCDR3 is given by SEQ ID NO.71, the amino acid sequence of HCDR1 is given by SEQ ID NO. 72, the amino acid sequence of HCDR2 is given by SEQ ID NO.73, and the amino acid sequence of HCDR3 is given by SEQ ID NO.74.
US Pat. No. 10,988,785

ISOLATED CODON SEQUENCE

CB THERAPEUTICS, INC., C...

1. An isolated nucleic acid molecule comprising a nucleotide sequence that is at least 95% identical to the nucleic acid sequence set forth in SEQ ID NO: 36, wherein the isolated nucleic acid molecule: (i) is non-naturally occurring; (ii) has a nucleotide sequence that is codon-optimized for expression in a host organism; and (iii) produces at least one cannabinoid precursor selected from the group consisting of isopentenyl pyrophosphate (IPP), geranyl diphosphate (GPP) and farnesyl pyrophosphate (FPP) in the host organism when inserted and expressed in the host organism, and wherein the host organism is Escherichia coli, Saccharomyces cerevisiae or Pichia pastoris.
US Pat. No. 10,988,786

MUTANT 4-HYDROXYPHENYLACETATE 3-HYDROXYLASES AND USES THEREOF

SYMRISE AG, Holzminden (...

1. A method for catalyzing the biotechnological conversion of at least one 4-hydroxyphenyl compound for producing at least one 3,4-dihydroxyphenol compound comprising:(i) providing a mutant 4-hydroxyphenylacetate 3-hydroxylase or a catalytically active fragment thereof, comprising at least one mutation in an active site; wherein the sequence of wild-type 4-hydroxyphenylacetate 3-hydroxylase is set forth in SEQ ID NO: 98, in which the active site comprises residues I157, M293, Y301, and S462; wherein the sequence of the mutant 4-hydroxyphenylacetate 3-hydroxylase is at least 90% identical to SEQ ID NO: 98, and wherein the at least one mutation in the mutant active site comprises Y301F relative to the wild-type active site;
(ii) providing at least one 4-hydroxyphenyl compound;
(iii) reacting the at least one 4-hydroxyphenyl compound and the mutant 4-hydroxyphenylacetate 3-hydroxylase or the catalytically active fragment thereof under suitable reaction conditions for allowing the hydroxylation of the at least one 4-hydroxyphenyl compound by the mutant 4-hydroxyphenylacetate-3-hydroxylase or the catalytically active fragment thereof to yield at least one 3,4-dihydroxyphenol compound; and
(iv) optionally isolating and/or purifying the resulting at least one 3,4-dihydroxyphenol compound.
US Pat. No. 10,987,250

SAFETY HANDLE

Try This First, Inc., Be...

1. A device for promoting drainage of fluid from a Eustachian tube of an individual, comprising:a handle portion configured to be held by the individual;
a mouthpiece portion comprising a concave surface and a convex surface; and
a hard candy composition affixed to the mouthpiece portion and configured to promote a negative pressure within an oral cavity of the individual when used by the individual, the hard candy composition comprising:
a flat first surface; and
a convex second surface, opposite the flat first surface,
wherein the flat first surface of the mouthpiece portion and the convex second surface of the mouthpiece portion are arranged such that the hard candy composition fits within the oral cavity of the individual with the flat first surface in contact with the individual's tongue, with the convex second surface in contact with a roof of the individual's mouth, and with the handle portion projecting out from the individual's mouth, and
wherein the hard candy composition is dissolvable and antibiotic-free, and comprises:
a sweetening agent;
an extract; and
a natural flavoring agent.
US Pat. No. 10,988,532

ANTI P2X7 RECEPTOR ANTIBODIES AND FRAGMENTS THEREOF

BIOSCEPTRE (AUST) PTY LTD...


US Pat. No. 10,988,788

PLANTS EXPRESSING CELL WALL DEGRADING ENZYMES AND EXPRESSION VECTORS

AGRIVIDA, INC., Woburn, ...

1. A transgenic plant comprising a nucleic acid that encodes a xylanase, wherein the transgenic plant is switchgrass, and the xylanase comprises consists of the amino acid of SEQ ID NO: 44.
US Pat. No. 10,988,789

GLUCOSYLTRANSFERASE ENZYMES FOR PRODUCTION OF GLUCAN POLYMERS

1. A composition comprising (i) an insoluble poly alpha-1,3-glucan having at least 90% alpha-1,3 glycosidic linkages, and (ii) a genetically engineered cell that expresses an isolated glucosyltransferase enzyme comprising an amino acid sequence that is at least 90% identical to SEQ ID NO:4.
US Pat. No. 10,988,534

MULTI-SPECIFIC ANTIBODIES WITH AFFINITY FOR HUMAN A33 ANTIGEN AND DOTA METAL COMPLEX AND USES THEREOF

Memorial Sloan Kettering ...

1. An antibody or an antigen-binding fragment thereof comprising a heavy chain variable region (HCVR) sequence that is identical to the HCVR sequence present in SEQ ID NO: 6 or SEQ ID NO:7, and a light chain variable region (LCVR) sequence that is identical to the LCVR present in any one of SEQ ID NOs: 2-4.
US Pat. No. 10,988,790

METHOD FOR PRODUCING STEVIOL AND STEVIOL GLYCOSIDE BY USING AOBGL11 HOMOLOG

SUNTORY HOLDINGS LIMITED,...

1. A method comprising reacting a protein comprising the amino acid sequence of SEQ ID NO: 2 with a first steviol glycoside.
US Pat. No. 10,988,535

HUMAN ANTIBODIES THAT BIND LYMPHOCYTE ACTIVATION GENE-3 (LAG-3), AND USES THEREOF

1. A method for treating cancer in a subject comprising administering to the subject an anti-LAG-3 antibody and an anti-PD-L1 antibody.
US Pat. No. 10,988,536

HUMAN ANTIBODIES THAT BIND LYMPHOCYTE ACTIVATION GENE-3 (LAG-3), AND USES THEREOF

1. A method for treating a metastatic cancer in a human subject comprising administering to the subject an anti-LAG-3 antibody and an anti-PD-1 antibody.
US Pat. No. 10,988,537

ANTIBODIES COMPRISING CHIMERIC CONSTANT DOMAINS

Regeneren Pharmaceuticals...

1. An antibody comprising a heavy chain constant (CH) region comprising, from N-terminus to C-terminus, a CH1 domain, a hinge, a CH2 domain, and a CH3 domain wherein:(a) the CH1 domain comprises a human IgG1 CH1 domain or a human IgG4 CH1 domain having the amino acid sequence DKKV or DKRV from positions 212 to 215 (EU numbering),
(b) the hinge comprises a human IgG1 or a human IgG4 upper hinge amino acid sequence from positions 216 to 227 (EU numbering) and a human IgG2 lower hinge amino acid sequence PCPAPPVA (SEQ ID NO: 3) from positions 228 to 236 (EU numbering),
(c) the CH2 domain comprises a human IgG4 CH2 domain amino acid sequence from positions 237 to 340 (EU numbering), and
(d) the CH3 domain comprises a human IgG1 or a human IgG4 CH3 domain sequence from positions 341 to 447 (EU numbering), and
wherein the antibody is capable of binding to an Fc?R with lower affinity than a corresponding antibody comprising a wild-type IgG1 or wild-type IgG4 heavy chain constant region, the antibody is capable of binding Fc?RIIA and optionally Fc?RIIB, and the antibody is capable of binding Fc?RIIA with higher affinity compared to its binding affinity to Fc?RIIB.
US Pat. No. 10,988,538

BISPECIFIC SIGNALING AGENTS AND USES THEREOF

Orionis Biosciences BV, ...

1. A chimeric protein comprising:(a) a modified signaling agent, wherein the modified signaling agent consists of a single mutant human interferon alpha 2 (IFN?2), the single mutant human IFN?2 having at least 95% identity with SEQ ID NO: 336 and having a mutation at position R149;
(b) a first targeting moiety comprising a first recombinant heavy chain-only (VHH) antibody or single-chain variable fragment (scFv), wherein the first targeting moiety specifically binds to a first antigen or receptor of interest; and
(c) a second targeting moiety comprising a second recombinant heavy chain-only (VHH) antibody or single-chain variable fragment (scFv), wherein the second targeting moiety specifically binds to a second antigen or receptor of interest;
wherein the mutant human IFN?2 has a reduced affinity or activity for its receptor relative to the wild type human IFN?2; and
wherein the reduced affinity or activity of the mutant human IFN?2 for its receptor is restorable by one or more of the targeting moieties,
wherein the first targeting moiety is attached to the second targeting moiety and the second targeting moiety is attached to the modified signaling agent.
US Pat. No. 10,988,794

METHODS OF TARGETED ANTIBIOTIC SUSCEPTIBILITY TESTING

QVELLA CORPORATION, Rich...

1. A method of performing rapid antibiotic susceptibility testing, comprising:obtaining a first sample and a second sample, wherein the first sample and the second sample are derived from a common subject in the absence of an initial microbial growth step;
adding growth media to the second sample and pre-incubating the second sample under conditions suitable for promoting microbial growth;
while pre-incubating the second sample, performing a multiplexed identification test panel on the first sample and identifying a presence of one or more microbial cells with the first sample, wherein the multiplexed identification test panel is performed on the first sample in the absence of culturing the first sample; and
performing an antimicrobial susceptibility test on the second sample to determine a measure of the effectiveness of an antibiotic on microbial cells within the second sample, wherein the antibiotic is selected based on the results from the multiplexed identification test panel.
US Pat. No. 10,988,539

COMBINATION THERAPY WITH ANTI-HLA-DR ANTIBODIES AND KINASE INHIBITORS IN HEMATOPOIETIC CANCERS

Immunomedics, Inc., Morr...

1. A method of treating a hematopoietic cancer, comprising:a) administering to a subject with a hematopoietic cancer an IMMU-140 antibody-drug conjugate (ADC) that binds to HLA-DR; and
b) administering to the subject a PI3K (phosphoinositide 3-kinase) inhibitor.
US Pat. No. 10,988,795

SYNTHESIS OF DOUBLE-STRANDED NUCLEIC ACIDS

RUPRECHT-KARLS-UNIVERSITA...

1. A method for the synthesis of double stranded nucleic acid with a defined 3? and 5? terminal nucleotide sequence from a sample comprising single stranded nucleic acid comprising the steps of:a) providing a sample comprising single stranded or double stranded nucleic acid,
b) performing a polynucleotide tailing reaction by adding at least 5 consecutive nucleotides to the 3?-terminus of the single stranded or double stranded nucleic acid,
c) hybridizing a priming oligonucleotide complementary to the added nucleotide sequence and synthesizing a cDNA or a cRNA with a template dependent DNA or RNA polymerase to generate a double stranded nucleic acid,
d) hybridizing a template switching oligonucleotide to said double stranded nucleic acid, and
e) extending the 3? end of the cDNA or the cRNA strand to synthesize a double stranded nucleic acid, wherein one strand of the nucleic acid comprises the priming oligonucleotide, and a cDNA or a cRNA that is complementary to the single stranded nucleic acid and to the template switching oligonucleotide;
wherein said priming oligonucleotide comprises the following nucleotide sequence elements:
3?-Wm-X-Y-Z1o-Qt-Z2s-5?,
wherein:
W at each instance is independently selected from dA, dG, dC, dT and dU;
X is selected from dA, dG, dC, dT, dU, rA, rG, rC, rT and rU;
Y is a polynucleotide of between 15 and 100 nucleotides length, wherein between 80% and 99% of the sequence is composed of dT or rT, wherein the other 1% to 20% of the sequence is composed of nucleotides or dinucleotides that are different from dT or rT, and are selected from dA, dG, dC, dT, dU, rA, rG, rC, rT, rU, AC, AG, AT, AU, CA, CG, CT, CU, GA, GC, GT, GU, TA, TC, TG, TU, AA, CC, GG, UU, UA, UC, UG, and UT, with the proviso that at least one of the nucleotides in the sequence is different from dT or rT, and with the proviso that X is different from the nucleotide or dinucleotide that constitutes the majority of Y;
Q is a sequence of consecutive degenerate (wobble) DNA bases;
Z1 is a polynucleotide of at least 5 nucleotides length of defined sequence, wherein the sequence is different from Wm-X-Y;
Z2 is a polynucleotide of at least 5 nucleotides length of defined sequence, wherein the sequence is different from Wm-X-Y-Z1o-Qt;
m is an integer of 0 to 6, i.e. 0, 1, 2, 3, 4, 5 or 6;
o is 0 or 1;
s is 0 or 1; and
t is an integer of 0 to 6, i.e. 0, 1, 2, 3, 4, 5 or 6.
US Pat. No. 10,988,540

ANTIBODY

OSAKA UNIVERSITY, Osaka ...

1. An anti-integrin beta 7 antibody comprising:a heavy chain variable region including
heavy-chain CDR1 having the amino acid sequence of SEQ ID NO: 1,
heavy-chain CDR2 having the amino acid sequence of SEQ ID NO: 2, and
heavy-chain CDR3 having the amino acid sequence of SEQ ID NO: 3; and
a light chain variable region including
light-chain CDR1 having the amino acid sequence of SEQ ID NO: 6,
light-chain CDR2 having the amino acid sequence of SEQ ID NO: 7, and
light-chain CDR3 having the amino acid sequence of SEQ ID NO: 8.
US Pat. No. 10,988,796

METHODS OF DEPLETING A TARGET MOLECULE FROM AN INITIAL COLLECTION OF NUCLEIC ACIDS, AND COMPOSITIONS AND KITS FOR PRACTICING THE SAME

Takara Bio USA, Inc., Mo...

1. A method of selectively depleting target cDNAs from a sample, the method comprising:obtaining a sample comprising both target cDNAs and non-target cDNAs, wherein the target cDNAs comprise cDNAs transcribed from ribosomal RNAs,
contacting the sample with a nucleic acid guided nuclease and a guide nucleic acid that guides the nucleic acid guided nuclease to the target cDNAs, wherein the nucleic acid guided nuclease, the guide nucleic acid, and the target cDNAs form a complex in which the guide nucleic acid specifically hybridizes with the target cDNAs, and
selectively depleting the target cDNAs from the sample by cleaving the target cDNAs with the nucleic acid guided nuclease in the complex.
US Pat. No. 10,988,541

CD123 SPECIFIC CHIMERIC ANTIGEN RECEPTORS FOR CANCER IMMUNOTHERAPY

CELLECTIS, Paris (FR)

1. A chimeric antigen receptor (CAR) comprising:an extracellular ligand binding domain comprising a heavy chain variable region (VH) and a light chain variable region (VL) from a monoclonal anti-CD123 antibody, wherein the VH region comprises CDR sequences SEQ ID NO. 67, SEQ ID NO. 68, and SEQ ID NO. 69, and wherein the VL region comprises CDR sequences SEQ ID NO. 70, SEQ ID NO. 71, and SEQ ID NO. 72;
an Fc?RIII?, CD8?, or IgG1 hinge;
a CD8? transmembrane domain; and
a cytoplasmic domain comprising a CD3-? signaling domain and a co-stimulatory domain from 4-1BB.
US Pat. No. 10,988,797

METHODS AND COMPOSITIONS FOR PREPARING NUCLEIC ACID LIBRARIES

Illumina, Inc., San Dieg...

1. A method for preparing a nucleic acid library from a low quality nucleic acid sample comprising:(a) providing a plurality of nucleic acids obtained from the low quality nucleic acid sample by a method comprising:
(i) separating the plurality of nucleic acids into a first fraction of nucleic acids having an average length longer than 550 base pairs, and a second fraction of nucleic acids having an average length shorter than 550 base pairs,
(ii) shearing the nucleic acids of the first fraction, and
(iii) combining the sheared first fraction and the second fraction to form the sheared nucleic acids;
(b) removing single-stranded nucleic acids from the plurality of nucleic acids; and
(c) repairing the nucleic acids of the plurality of nucleic acids with an enzyme selected from the group consisting of uracil N-glycosylase (UNG), uracil DNA glycosylase (UDG), endonuclease IV, endonuclease VIII, formamidopyrimidine-DNA glycosylase (FPG), thereby preparing a nucleic acid library.
US Pat. No. 10,988,542

CHIMERIC ANTIGEN RECEPTORS WITH INTEGRATED CONTROLLABLE FUNCTIONS

CELLECTIS, Paris (FR)

1. A single chain chimeric antigen receptor (CAR) characterized in that it comprises:a) at least one ectodomain which comprises:
i) an extracellular antigen binding domain; and
ii) a switch domain comprising at least a first multimerizing ligand-binding domain and a second multimerizing ligand-binding domain which are capable of binding to a predetermined multivalent ligand to form a multimer comprising said two binding domains and the multivalent ligand to which they are capable of binding;
b) at least one transmembrane domain; and
c) at least one endodomain comprising a signal transducing domain and optionally a co-stimulatory domain;
wherein the switch domain is located between the extracellular antigen binding domain and the transmembrane domain.
US Pat. No. 10,988,543

HUMANIZED ANTI-TUMOR NECROSIS FACTOR ALPHA RECEPTOR 2 (ANTI-TNFR2) ANTIBODIES AND METHODS OF USE THEREOF TO ELICIT AN IMMUNE RESPONSE AGAINST A TUMOR

1. A pharmacological composition comprising a humanized anti-TNF? Receptor 2 (anti-TNFR2) antibody that blocks TNF? binding to TNFR2, and a pharmaceutically acceptable carrier, wherein the anti-TNFR2 antibody comprises a set of three heavy chain complementary determining regions (HCDRs) and three light chain complementary determining regions (LCDRs), wherein the set of three HCDRs and three LCDRs are selected from the group consisting of:(a) SEQ ID NOs: 22-24 (HCDRs) and SEQ ID NOs: 25-27 (LCDRs); and
(b) SEQ ID NOs: 28-30 (HCDRs) and SEQ ID NOs: 31-33 (LCDRs).
US Pat. No. 10,988,799

ANALYSIS SYSTEM AND METHOD FOR TESTING A SAMPLE

BOEHRINGER INGELHEIM VETM...

1. An analysis system for testing a biological sample, comprising:a fluid system having a plurality of channels and
a sensor apparatus comprising a plurality of electrodes, each electrode being provided with capture molecules for bonding analytes of a sample,
wherein the capture molecules of each electrode are at least one of:
selected from at least two types from a group consisting of capture proteins, capture aptamers or capture nucleic-acid sequences, or
comprised of a first group of capture molecules and a second group of capture molecules, the first group of capture molecules being able to be at least one of thermally activated in order to bond analytes or thermally deactivated/denatured in order to prevent bonding of analytes, by means of a temperature-control apparatus.
US Pat. No. 10,988,544

FUSION PROTEINS COMPRISING AN ANTI-CD40 ANTIBODY AND HIV ANTIGENIC PEPTIDES

Baylor Research Institute...

1. An antibody-antigen fusion protein comprising an anti-CD40 antibody comprising:a heavy chain variable domain (VH) which comprises in sequence hypervariable regions CDR1H, CDR2H and CDR3H, the CDR1H having the amino acid sequence GFTFSDYYMY (SEQ ID NO.:45), the CDR2H having the amino acid sequence YINSGGGSTYYPDTVKG (SEQ ID NO.:46), and the CDR3H having the amino acid sequence RGLPFHAMDY (SEQ ID NO.:47); and
a light chain variable domain (VL) which comprises in sequence hypervariable regions CDR1L, CDR2L and CDR3L, the CDR1L having the amino acid sequence SASQGISNYLN (SEQ ID NO.:41), the CDR2L having the amino acid sequence YTSILHS (SEQ ID NO.:42), and the CDR3L having the amino acid sequence QQFNKLPPT (SEQ ID NO.:43); and
one or more HIV antigenic peptides, wherein at least one of the viral antigenic peptide(s) comprises an antigenic peptide of the pol HIV antigen.
US Pat. No. 10,988,800

PCR REACTION VESSEL, PCR DEVICE, AND PCR METHOD

Nippon Sheet Glass Compan...

1. A PCR method comprising:preparing a PCR reaction vessel including:
a substrate;
a channel formed on the substrate;
a pair of filters provided at respective ends of the channel;
a pair of air communication ports that communicate with the channel through the respective filters;
a thermal cycle region formed between the pair of filters in the channel;
a branch point formed between the pair of filters in the channel;
a branched channel whose one end is connected to the branch point; and
a sample introduction port formed at the other end of the branched channel;
introducing a sample into the PCR reaction vessel via the sample introduction port;
setting the PCR reaction vessel in a PCR device provided with a pump;
connecting a nozzle of the pump to the air communication ports;
detecting fluorescence from a sample inside the thermal cycle region of the channel; and
moving a sample in the thermal cycle region by controlling the pressure inside the channel by the pump based on a change in the amount of detected fluorescence, while a sample not subjected to PCR stays in the branched channel.
US Pat. No. 10,988,545

ANTI-GITR ANTIGEN-BINDING PROTEINS AND METHODS OF USE THEREOF

Potenza Therapeutics, Inc...

1. An isolated antigen binding protein (ABP) that specifically binds human GITR (hGITR; SEQ ID NO: 1), comprising the following six CDR sequences:(a) a CDR-H3 having the sequence X1X2X3X4X5RGYGDYGGHHAFDI, wherein X1 is A or V, X2 is H, D, L, or R, X3 is E or D, X4 is R, N, S, or A, and X5 is V, D or G (SEQ ID NO:141);
(b) a CDR-H2 having the sequence X1IX2X3SGX4TYYNPSLKS, wherein X1 is G, L, or S, X2 is Y, A, or V, X3 is E, Y or H, and X4 is S or K (SEQ ID NO:142);
(c) a CDR-H1 having the sequence X1SISSX2X3X4X5WX6, wherein X1 is Y or G, X2 is G, S, or E, X3 is L, G, S, Y, or A, X4 is G, A, Y, M, or G, X5 is V, A, or is absent, and X6 is S or G (SEQ ID NO:143);
(d) a CDR-L3 having the sequence QQEYX1TPPX2, wherein X1 is A or N and X2 is T or S (SEQ ID NO:144);
(e) a CDR-L2 having the sequence X1AX2SLX3X4, wherein X1 is A or S, X2 is D or S, X3 is Q, D, K, or E, and X4 is S or Y (SEQ ID NO:145); and
(f) a CDR-L1 having the sequence X1AS X2SI X3X4YLN, wherein X1 is G or R, X2 is Q or K, X3 is S, D, or N, and X4 is S or T (SEQ ID NO:146),
wherein the ABP agonizes GITR expressed on the surface of a target cell.
US Pat. No. 10,988,801

ENUMERATION OF NUCLEIC ACIDS

Esoterix Genetic Laborato...

1. A method of determining the relative amount of a target nucleic acid in a biological sample, the method comprising:amplifying polynucleotides immobilized at the individual sites to generate amplified products,
wherein the polynucleotides are obtained from a biological sample,
wherein the polynucleotides comprise heterogeneous nucleic acids comprising a target nucleic acid and a reference nucleic acid, and
wherein the each individual site contains on average one of the polynucleotides;hybridizing the amplified products with nucleic acid probes specific for (i) a target nucleic acid, or a portion thereof, and (ii) a reference nucleic acid, or a portion thereof, at respective individual sites on the solid support;determining (i) a first number of individual sites containing probes hybridized to a target nucleic acid, or a portion thereof, and (ii) a second number of individual sites containing probes hybridized to a reference nucleic acid, or a portion thereof; andcomparing the first number to the second number to determine the relative amount of the target nucleic acid in the biological sample.
US Pat. No. 10,988,546

BCMA MONOCLONAL ANTIBODY-DRUG CONJUGATE

MedImmune, LLC, Gaithers...

1. An antibody-drug conjugate (ADC) comprising a monoclonal antibody or an antigen-binding fragment thereof, conjugated to a cytotoxin, wherein the monoclonal antibody or antigen-binding fragment thereof is capable of binding to human B-cell maturation antigen (BCMA) and comprises (a) a heavy chain variable region comprising a complementarity determining region 1 (HCDR1) amino acid sequence of SEQ ID NO: 1, an HCDR2 amino acid sequence of SEQ ID NO: 2, and an HCDR3 amino acid sequence of SEQ ID NO: 3 and (b) a light chain variable region comprising a complementarity determining region 1 (LCDR1) amino acid sequence of SEQ ID NO: 4, an LCDR2 amino acid sequence of SEQ ID NO: 5, and an LCDR3 amino acid sequence of SEQ ID NO: 6.
US Pat. No. 10,987,778

METHOD OF FORMING FINE DIMPLES IN A HARD-BRITTLE MATERIAL SURFACE

FUJI MANUFACTURING CO., L...

1. A method of forming fine dimples on a surface of a hard-brittle material, comprising:ejecting non-angular shape ejection particles having a median diameter d50 of from 1 ?m to 18 ?m together with a compressed gas at an ejection pressure of from 0.01 MPa to 0.7 MPa against a dimple formation region which is a region where the dimples are to be formed on the surface of the hard-brittle material of an article to be treated; and
forming the dimples with liquid retention on the surface of the hard-brittle material by plastic deformation.
US Pat. No. 10,988,547

BI-SPECIFIC FUSION PROTEINS

Silver Creek Pharmaceutic...

1. A bi-specific fusion protein comprising:(a) Annexin V comprising an amino acid sequence having at least 99% identity with SEQ ID NO: 31, and
(b) IGF-1 comprising an amino acid sequence having at least 98.5% identity with SEQ ID NO: 3.
US Pat. No. 10,988,803

MULTIPLEXED ASSAY FOR QUANTITATING AND ASSESSING INTEGRITY OF CELL-FREE DNA IN BIOLOGICAL FLUIDS FOR CANCER DIAGNOSIS, PROGNOSIS AND SURVEILLANCE

Life Genetics Lab, LLC, ...

1. A multiplexed method to quantitate the integrity of cell free human DNA, comprising:providing a sample of serum, plasma, or urine, the sample comprising cell free human DNA, the cell free human DNA originating from circulating cell free human DNA and comprising a short nucleic acid target sequence including less than 180 bp and a long nucleic acid target sequence including more than 180 bp, the short nucleic acid target sequence and the long nucleic acid target sequence being retrotransposable element genomic targets that are independent of each other and that do not have any substantial portion of their sequences in common;
preparing a standard curve plot for each of the short nucleic acid target sequence and the long nucleic acid target sequence;
using a quantitative polymerase chain reaction (qPCR) method to separately and simultaneously quantitate the short nucleic acid target sequence and the long nucleic acid target sequence, wherein the short nucleic acid target sequence is a fragment of an ALU element and the long nucleic acid target sequence is a fragment of a SVA element, obtaining for each quantitated nucleic acid target sequence a threshold cycle number;
comparing each threshold cycle number with the respective standard curve to determine for each quantitated nucleic acid target sequence a quantity of the DNA fragment that was present in the cell free DNA found in the sample;
calculating a ratio of the quantity of DNA based on the long nucleic acid target sequence to the quantity of DNA based on the short nucleic acid target sequence; and
accepting the ratio as a measure of an integrity of the cell free human DNA in the sample.
US Pat. No. 10,988,548

NON-HUMAN ANIMALS THAT SELECT FOR LIGHT CHAIN VARIABLE REGIONS THAT BIND ANTIGEN

Regeneron Pharmaceuticals...

1. A mouse comprising in its germline genome:(i) at an endogenous immunoglobulin (Ig) heavy chain locus, an unrearranged human Ig light chain variable kappa (V?) gene segment and an unrearranged human Ig light chain joining kappa (J?) gene segment operably linked to an endogenous Ig heavy chain constant region nucleic acid sequence comprising at least one intact Ig heavy chain constant region gene encoding a functional CH1 domain, wherein the intact Ig heavy chain constant region gene is an Ig? gene, Ig? gene, Ig? gene, Ig? gene or an Ig? gene, wherein the unrearranged human Ig V? gene segment and the unrearranged human Ig J? gene segment rearrange in a B cell to form a hybrid sequence comprising a rearranged human Ig V?/J? gene sequence operably linked to the Ig heavy chain constant region nucleic acid sequence;
(ii) at an endogenous Ig light chain ? locus, a human universal Ig light chain variable region nucleotide sequence comprising a single human Ig V? gene segment rearranged with a single human Ig J? gene segment operably linked to an endogenous Ig light chain ? constant region nucleic acid sequence;
wherein the mouse expresses an antigen-binding protein that comprises a human Ig hybrid chain derived from the rearranged human Ig V?/J? gene sequence operably linked to the Ig heavy chain constant region nucleic acid sequence and a cognate light chain derived from the human universal Ig light chain variable region nucleotide sequence at the endogenous Ig light chain locus, wherein the human Ig hybrid chain comprises a human Ig light chain variable ? (hV?/CHxULC) domain fused to an endogenous heavy chain constant IgM, IgD, IgG, IgE or IgA region comprising a functional CH1 domain, and wherein the cognate light chain comprises a human Ig light variable ? domain chain fused to an endogenous light chain ? constant domain.
US Pat. No. 10,988,804

NUCLEIC ACID SEQUENCING APPARATUS FOR MONITORING STATUS OF A TRANSPLANT RECIPIENT

The Board of Trustees of ...

1. A nucleic acid sequencing apparatus for monitoring status of a transplant in a transplant recipient by quantifying transplant-derived cell-free nucleic acids in a biological sample obtained from said transplant recipient , wherein the transplant-derived cell-free nucleic acids make up between 0.03% to 8.0% of total cell free nucleic acids in said biological sample, said nucleic acid sequencing apparatus comprising (a) a high-throughput sequencing device, and (b) a computing device that comprises a computer executable logic that is recorded on a computer readable medium causing a processor to perform a set of instructions to:i. receive at least 1000 nucleic acid sequence reads from said high-throughput sequencing device, wherein said at least 1000 nucleic acid sequence reads are obtained from cell-free nucleic acids from said biological sample,
ii. determine a base call error rate for said at least 1000 nucleic acid sequence reads;
iii. identify nucleic acid sequence reads with a base call error rate below 0.5% of said at least 1000 nucleic acid sequence reads thereby providing identified nucleic acid sequence reads with a base call error rate below 0.5% and increasing sensitivity of distinguishing nucleic acids between said transplant and said transplant recipient;
iv determine at least 100 single nucleotide polymorphisms that are distinguishable between said transplant recipient and said transplant from said identified nucleic acid sequence reads with a base call error rate below 0.5%, wherein said at least 100 single nucleotide polymorphisms that are distinguishable between said transplant recipient and said transplant from said identified nucleic acid sequence reads with a base call error rate below 0.5% are selected from the group consisting of heterozygous single nucleotide polymorphisms, homozygous single nucleotide polymorphisms, and both heterozygous and homozygous single nucleotide polymorphisms; and
v. provide a quantified amount of transplant-derived cell-free nucleic acids in said biological sample based on the determination of said at least 100 single nucleotide polymorphisms that are distinguishable between said transplant recipient and said transplant from said identified nucleic acid sequence reads with a base call error rate below 0.5%, wherein said transplant derived cell-free nucleic acids in said biological sample make up between about 0.03% to 8.0% of said total cell-free nucleic acids in said biological sample.
US Pat. No. 10,988,549

METHOD FOR PRODUCING CELLULOSE NANOFIBER DRY SOLID

NIPPON PAPER INDUSTRIES C...

1. A method for producing a dry solid of cellulose nanofiber, the method comprising:step (A) of defibrating a cellulose material in water to obtain an aqueous dispersion of cellulose nanofiber, and mixing the aqueous dispersion of cellulose nanofiber with a water-soluble organic solvent to obtain a mixture comprising the cellulose nanofiber, water, and the water-soluble organic solvent, wherein the cellulose nanofiber has an average fiber diameter of 2 to 500 nm, wherein a weight ratio of the water to the water-soluble organic solvent in the mixture is 1:100 to 10:1, and wherein the water-soluble organic solvent is a lower alcohol having 1 to 4 carbons; and
step (B) of drying the mixture under temperature ranging from 50 to 160° C.
US Pat. No. 10,988,550

METHOD FOR PREPARING RESISTANT DEXTRIN BY USING A STARCH BRANCHING ENZYME AND A CYCLODEXTRIN GLYCOSYLTRANSFERASE

Jiangnan University, Wux...

1. A method for preparing a resistant dextrin product, comprising adding a starch branching enzyme and a cyclodextrin glycosyltransferase (CGTase) to a pyrodextrin simultaneously or successively, wherein the starch branching enzyme is obtained from Thermobifida fusca, having the amino acid sequence of SEQ ID NO: 2, and the CGTase has the amino acid sequence of SEQ ID NO:5, wherein 1000-1500 U/g pyrodextrin of the starch branching enzyme and 5-10 U/g pyrodextrin of the CGTase is added to the pyrodextrin simultaneously or successively.
US Pat. No. 10,988,806

METHODS FOR INDEXING SAMPLES AND SEQUENCING MULTIPLE POLYNUCLEOTIDE TEMPLATES

Illumina Cambridge Limite...

1. A method for sequencing nucleic acid sequences and identifying subsets of nucleic acid sequences, each subset of nucleic acid sequences isolated from a different source, the method comprising the steps of:(a) providing at least two different samples of randomly fragmented double stranded nucleic acid targets, wherein each of the randomly fragmented double stranded nucleic acid targets is isolated from a different source;
(b) ligating a tagged adaptor to each end of the fragmented double stranded nucleic acid targets to generate adaptor-target-adaptors, wherein the tagged adaptor comprises at least one region of double stranded nucleic acid and a region of single stranded nucleic acid comprising a sample specific tag sequence that differentiates adaptor-target-adaptors from different samples;
(c) amplifying the adaptor-target-adaptors of each sample with a pair of amplification primers complementary to the sample specific tag sequence to generate amplified adaptor-target-adaptors from each sample;
(d) pooling the amplified adaptor-target-adaptors of the at least two different samples;
(e) immobilizing the pooled adaptor-target-adaptors on a surface;
(f) sequencing the immobilized adaptor-target-adaptors on the surface to determine a sequence read of each immobilised adaptor-target-adaptor and identify the sample specific tag sequence of each immobilised adaptor-target-adaptor, thereby determining nucleic acid sequences of the immobilized adaptor-target-adaptors and identifying each of the immobilized adaptor-target-adaptors as a member of a subset of nucleic acid sequences.
US Pat. No. 10,988,551

PROCESSES FOR MAKING CHITOSAN SALTS AND PRODUCTS FORMED THEREBY

PRIMEX EHF., Siglufjordu...

1. A method for making a chitosan salt, comprising:providing a chitosan composition, which comprises chitosan;
combining the chitosan composition, water, and one or more acids to form a paste comprising a chitosan salt hydrate; and
removing at least a portion of the water from the paste to form a dried composition comprising a chitosan salt.
US Pat. No. 10,988,807

SEQUENCE BASED GENOTYPING BASED ON OLIGONUCLEOTIDE LIGATION ASSAYS

KEYGENE N.V., Wageningen...

1. A kit of parts for detecting one or more polymorphisms in a plurality of target nucleotide sequences in a plurality of samples, wherein the kit of parts comprisesi) a first probe and a second probe,
wherein the first probe comprises a first target specific section and a first tag section that is non-complementary to the target nucleotide sequence and that comprises a first universal primer binding site;
wherein the second probe comprises a second target specific section and a second tag section that is non-complementary to the target nucleotide sequence; and
ii) a first primer and optionally a second primer, wherein the first primer comprises a sample-specific identifier sequence and wherein the first primer can hybridize to the first universal primer binding site.
US Pat. No. 10,988,552

ANTIBODIES TARGETED TO FUNGAL CELL WALL POLYSACCHARIDES

Wellstat Vaccines, LLC, ...

1. An isolated and purified antibody specific to a compound, wherein the compound comprises:one or more polysaccharide moieties, each independently represented by the formula ?(1?4)-[GlcNH-R]n-2,5-anhydromannose, wherein n is a positive integer from 3 to 500, R is H or an acetyl group, and the one or more polysaccharide moieties are chitin/chitosan mixed polymers.
US Pat. No. 10,988,808

SYNTHESIZING BARCODING SEQUENCES UTILIZING PHASE-SHIFT BLOCKS AND USES THEREOF

Bio-Rad Laboratories, Inc...

1. A method for analyzing nucleic acid of a population of cells comprising:providing:
(i) a library of barcode oligonucleotides, each barcode oligonucleotide comprising in the 5? to 3? direction, a phase-shift region, a universal region, a variable region, and a capture region, wherein a first nucleotide of the universal region of a first barcode oligonucleotide is staggered by 1 to 50 nucleotides from the first nucleotide of the universal region of a second barcode oligonucleotide; or
(ii) a library of barcode beads comprising a plurality of beads, wherein each bead is conjugated to a plurality of barcode oligonucleotides and wherein each bead in the library is conjugated to a unique barcode oligonucleotide, each barcode oligonucleotide comprising in the 5? to 3? direction, a phase-shift region, a universal region, a variable region, and a capture region, wherein the first nucleotide of the universal region of a first barcode oligonucleotide is staggered by 1 to 50 nucleotides from the first nucleotide of the universal region of a second barcode oligonucleotide, and wherein for each bead, at least two identical copies of a barcode oligonucleotide is conjugated to the bead;
providing a population of cells;
partitioning the library of barcode oligonucleotides or the library of barcode oligonucleotide beads, and the population of cells to generate a plurality of partitions, wherein individual partitions of the plurality have copies of a single barcode oligonucleotide and nucleic acid from a single cell;
in the partitions lysing the cells to generate nucleic acid from a single cell in individual partitions;
hybridizing the copies of the barcode oligonucleotide to the nucleic acid from the single cell in the partitions;
performing template directed nucleic acid polymerization to covalently attach oligonucleotide primers to the nucleic acid of the single cell in the partitions;
combining the partitions; and
performing high-throughput sequencing.
US Pat. No. 10,988,809

GENETIC POLYMORPHISMS ASSOCIATED WITH CORONARY EVENTS AND DRUG RESPONSE, METHODS OF DETECTION AND USES THEREOF

Celera Corporation, San ...

1. A method for identifying a human as being responsive to HMG-CoA reductase inhibitor treatment for reducing their risk for myocardial infarction (MI), the method comprising:a) testing nucleic acid from said human for a KIF6 polymorphism rs9462535 as represented by position 101 of SEQ ID NO:16 or its complement by contacting said nucleic acid with an oligonucleotide comprising SEQ ID NO:166;
b) detecting the presence of A at said position 101 of SEQ ID NO:16 or T at said complement; and
c) identifying said human as being responsive to HMG-CoA reductase inhibitor treatment for reducing their risk for MI due to the presence of said A or said T.
US Pat. No. 10,988,810

METHODS AND MATERIALS FOR DETECTION OF MUTATIONS

PentaBase ApS, Odense C ...

1. A method for detecting the presence of a more than one of a number of variant sequences in a target nucleic acid sequence comprising nucleotide(s) of interest (NOI), wherein said NOI may consist of said variant sequences, of other variant sequences or of a reference NOI sequence, said method comprising the steps ofa) providing a sample comprising nucleic acids
b) providing one blocking oligonucleotide comprising a sequence of in the range of 10 to 50 nucleotides (referred to as “blocking sequence”) into which in the range of 2 to 10 hydrophobic nucleotides have been inserted
wherein
at least one hydrophobic nucleotide is positioned at the 5? end of said sequence or within 4 nucleotides from the 5? end; and
at least one hydrophobic nucleotide is positioned at the 3? end of said sequence or within 4 nucleotides from the 3? end; and
wherein the hydrophobic nucleotide has the structure
X—Y-Q
wherein
X is a nucleotide or nucleotide analogue or a backbone monomer unit,
Q is a intercalator which is not taking part in Watson-Crick hydrogen bonding; and
Y is a linker moiety linking said nucleotide or nucleotide analogue or backbone monomer unit and said intercalator; and
wherein the blocking sequence is identical to a consecutive stretch of the target nucleic acid sequence comprising the reference NOI sequence,
c) providing sets of primers comprising at least two different primers including a first primer 1 and a primer 2, wherein the first primer 1 together with the primer 2 is capable of amplification of the target nucleic acid sequence comprising a first variant sequence, and wherein first primer 1 comprises a sequence of at least 15 nucleotides positioned at the 3? end of said primer, which is identical to a consecutive stretch of the target nucleic acid sequence comprising said first variant sequence except for up to one mismatch, and a second primer 1 together with the primer 2 is capable of amplification of a target nucleic acid sequence comprising a second variant sequence, wherein said second primer 1 comprises a sequence of at least 15 nucleotides positioned at the 3? end of said primer, which is identical to a consecutive stretch of the target nucleic acid sequence comprising said second variant sequence except for up to one mismatch; and wherein the sets of primers optionally comprise one or more further primer 1, which together with the primer 2 are capable of amplification of a target nucleic acid sequence comprising one or more further variant sequence(s), wherein said further primer 1(s) comprise a sequence of at least 15 nucleotides positioned at the 3? end of said primer, which is identical to a consecutive stretch of the target nucleic acid sequence comprising said further variant sequence(s) except for up to one mismatch;
d) performing a polymerase chain reaction in the presence of said sample, said blocking oligonucleotide; and said set of primers;
e) detecting a product of said polymerase chain reaction, wherein the presence of a product of said polymerase chain reaction indicates the presence of a target nucleic acid sequence comprising the variant sequence in said sample.
US Pat. No. 10,989,066

ABRADABLE COATING MADE OF A MATERIAL HAVING A LOW SURFACE ROUGHNESS

SAFRAN AIRCRAFT ENGINES, ...

1. A method of manufacturing a stator part of a turbine engine, the stator part configured to be outside a rotor part or facing a rotor part, the stator part comprising an internal face that comprises a layer of a MCrAlY abradable coating wherein M is selected from the group consisting of Ni, Co, NiCo, and CoNi, the layer of the MCrAlY alloy being intended to form a seal between the stator part and the rotor part, the method comprising:filling surface irregularities of the layer of the abradable coating with ceramic grains, the ceramic grains being alumina, and
heating the layer of the abradable coating to bind the ceramic grains by partial sintering, a free surface of the layer of the abradable coating comprising portions of the MCrAlY alloy and the alumina.
US Pat. No. 10,988,811

MARKER GENES FOR COLORECTAL CANCER CLASSIFICATION, METHOD FOR JUDGING LYMPH NODE METASTASIS FOR PROGNOSIS OF COLORECTAL CANCER AND KIT THEREFOR

1. A kit, the kit comprising: nucleic acid primers and nucleic probes for determination of gene expression levels of genes SLC35D3 and POSTN to determine metastatic potential and/or tumor aggressiveness in a subject diagnosed with colorectal cancer wherein the primers and probes comprise (a) SEQ ID NO: 1-2 and 3, (b) SEQ ID NO: 4-5 and 6, or (c) a combination of (a) and (b) and wherein the probes contain a dye.
US Pat. No. 10,987,531

METHOD FOR STABILIZING METALLIC MERCURY

SARP INDUSTRIES, Limay (...

1. Process for stabilizing metallic mercury in the form of mercury sulphide, the process comprising the following steps:a) dispersion of metallic mercury in an aqueous polysulphide solution so as to convert metallic mercury into mercury sulphide;
b) separation of the mercury sulphide,
wherein step a) is performed at a temperature of at least 60° C.
US Pat. No. 10,988,812

FUSION GENES ASSOCIATED WITH PROGRESSIVE PROSTATE CANCER

UNIVERSITY OF PITTSBURGH ...

1. A method of treating a subject in need thereof, comprising (i) determining whether a subject is at increased risk of manifesting progressive prostate cancer comprising determining whether a prostate cancer cell of the subject contains a PTEN-NOLC1 or CCNH-C5orf30 fusion gene; and (ii) where the prostate cancer cell contains the PTEN-NOLC1 or CCNH-C5orf30 fusion gene so that the subject is at increased risk, then performing one or more of cryotherapy, radiation therapy, chemotherapy, hormone therapy, and radical prostatectomy to treat the subject.
US Pat. No. 10,988,557

METHODS OF PREPARING A CATALYST UTILIZING HYDRATED REAGENTS

Chevron Phillips Chemical...

1. A method of preparing a pre-catalyst comprising:a) contacting (i) a titanium-containing compound, (ii) ascorbic acid or a derivative thereof and (iii) a solvent to form a solution;
b) contacting the solution with a chromium-containing compound to form a mixture; and
c) spray-drying a silica support with the mixture to form the pre-catalyst.
US Pat. No. 10,988,813

DETECTION OF GENE FUSIONS BY INTRAGENIC DIFFERENTIAL EXPRESSION (IDE) USING AVERAGE CYCLE THRESHOLDS

Quest Diagnostics Investm...

1. A composition comprising:(a) two or more 5? target primer pairs that are complementary to a 5? region of a ALK target gene transcript and are suitable for amplifying a 5? region of the target gene transcript, wherein at least one primer of each of the ALK 5? target primer pairs is detectably labeled; and
(b) two or more 3? target primer pairs that are complementary to the 3? region of the ALK target gene transcript and are suitable for amplifying a 3? region of the target gene transcript, wherein at least one primer of each of the ALK 3? target primer pairs is detectably labeled;
and/or
(c) two or more 5? target primer pairs that are complementary to a 5? region of a ROS1 target gene transcript and are suitable for amplifying a 5? region of the target gene transcript, wherein at least one primer of each of the ROS1 5? target primer pairs is detectably labeled; and
(d) two or more 3? target primer pairs that are complementary to the 3? region of the ROS1 target gene transcript and are suitable for amplifying a 3? region of the target gene transcript, wherein at least one primer of each of the ROS1 3? target primer pairs is detectably labeled;
and/or
(e) two or more 5? target primer pairs that are complementary to a 5? region of a RET target gene transcript and are suitable for amplifying a 5? region of the target gene transcript, wherein at least one primer of each of the RET 5? target primer pairs is detectably labeled; and
(f) two or more 3? target primer pairs that are complementary to the 3? region of the RET target gene transcript and are suitable for amplifying a 3? region of the target gene transcript, wherein at least one primer of each of the RET 3? target primer pairs is detectably labeled; and
(g) a biological sample.
US Pat. No. 10,988,558

CONTROLLED PARTICLE SIZE DISTRIBUTION

DDP SPECIALTY ELECTRONIC ...

1. A method of making a collection of polymer beads comprising(a1) forming a first collection of monomer droplets in an aqueous medium in a container, wherein the first collection of monomer droplets has volume-average diameter DAV1 and has uniformity coefficient less than 1.3;
(a2) forming a second collection of monomer droplets in the aqueous medium in the container, wherein the second collection of monomer droplets has volume-average diameter DAV2 and has uniformity coefficient less than 1.3, wherein DAV1 and DAV2 differ by 10 ?m or more;
wherein either step (a1) and step (a2) are performed simultaneously; or step (a2) is performed after step (a1), while the first collection of monomer droplets remains in the container; or a combination thereof; and
(b) after steps (a1) and (a2), polymerizing the monomer droplets by suspension polymerization to form the polymer beads.
US Pat. No. 10,988,814

SINIPERCA CHUATSI IL-6 GENE AND DETECTION METHOD OF DISEASE-RESISTANT SNP MARKER THEREOF

SOOCHOW UNIVERSITY, Suzh...

1. A Siniperca chuatsi IL-6 cDNA comprising the cDNA sequence shown in SEQ ID NO: 1.
US Pat. No. 10,988,559

FLUOROPOLYMER POWDER AND METHOD FOR PRODUCING SAME

DAIKIN INDUSTRIES, LTD., ...

1. A powder comprising a fluoropolymer and having an aspect ratio of 3 or lower,the fluoropolymer containing at least one group A selected from the group consisting of —SO2Y, —COOR, —SO3X, —SO2NR12, and —COOX,
wherein Y is a halogen atom; R is a C1-C4 alkyl group; X is M1/L or NR14, where M is a hydrogen atom or an L-valent metal, the L-valent metal being a metal in group 1, group 2, group 4, group 8, group 11, group 12, or group 13 of the periodic table; and R1s are each individually a hydrogen atom or a C1-C4 alkyl group,
the powder exhibiting a dispersion of 50% or higher, the dispersion being calculated by filtering a composition obtained by mixing the powder with water through a mesh having an opening of 20 ?m,
wherein the powder has an average primary particle size of greater than 30 nm to 300 nm.
US Pat. No. 10,988,815

DETECTIVE MOLECULE, KIT AND METHOD FOR PREDICTING FRAGRANCE PRODUCTION IN AN ORCHID

NATIONAL CHENG KUNG UNIVE...

1. A method for predicting fragrance production in an orchid, comprising detecting if a target molecule exists in genome of the orchid, wherein the target molecule is selected from the group consisting of:(i) a nucleic acid molecule comprising SEQ ID NO: 1;
(ii) a nucleic acid molecule comprising SEQ ID NO: 2; and wherein the existence of the target molecule in genome of the orchid predicts fragrance production in the orchid;
wherein the detecting comprises amplifying the target molecule using a primer;
wherein the primer is selected from a forward primer comprising SEQ ID NO: 3 and a reverse primer comprising SEQ ID NO: 4.
US Pat. No. 10,988,560

METHOD FOR PRODUCING CARBOXYL-GROUP-CONTAINING POLYMER COMPOSITION

Sumitomo Seika Chemicals ...

1. A method for producing a carboxyl group-containing polymer composition, the carboxyl group-containing polymer composition comprising:a carboxyl group-containing polymer that is a copolymer of monomers comprising an ?,?-unsaturated carboxylic acid and a compound having at least two ethylenically unsaturated groups per molecule; and
a nonionic surfactant,wherein the method comprises copolymerizing the monomers in an inert solvent in a polymerization reaction, wherein the nonionic surfactant is added into the polymerization reaction only when a polymerization degree of the ?,?-unsaturated carboxylic acid has reached 70 to 98%, and an amount of the nonionic surfactant added is 3 to 7 parts by mass per 100 parts by mass of the ?,?-unsaturated carboxylic acid.
US Pat. No. 10,988,816

COMPOSITIONS AND METHODS FOR DETECTING HUMAN PAPILLOMAVIRUS NUCLEIC ACID

GEN-PROBE INCORPORATED, ...

1. A target capture reaction mixture for selectively separating a human papillomavirus type 33 (HPV33) and/or type 31 (HPV31) target nucleic acid from other components in a sample, wherein the target capture reaction mixture comprises(a) an HPV33-specific capture probe oligomer comprising a target-hybridizing sequence consisting of SEQ ID NO:50; and
(b) an HPV31-specific capture probe oligomer comprising a target-hybridizing sequence consisting of SEQ ID NO:52;
wherein each of the HPV33-specific and HPV31-specific capture probe oligomers further comprises an immobilized probe-binding region that is not complementary to the HPV33 or HPV31 target nucleic acid.
US Pat. No. 10,987,281

SELF-ADHESIVE DENTAL COMPOSITE RESIN

KURARAY NORITAKE DENTAL I...

1. A one-part self-adhesive dental composite resin, comprising:an acid group-containing (meth)acrylic polymerizable monomer (a);
a polyfunctional (meth)acrylic polymerizable monomer (b) containing no acid group;
a photopolymerization initiator (c); and
a filler (d), wherein the filler (d) is treated with a surface treatment agent and has an average particle diameter of 0.01 to 50.0 ?m,
the surface treatment agent comprises a silane coupling agent (A) of formula (1):
CH2?C(R1)—COO—(CH2)p—Si—R2qR3(3-q)  (1),
wherein R1is a hydrogen atom or a methyl group, R2 is an optionally substituted hydrolyzable group, R3 is an optionally substituted C1 to C3 alkyl group, p is an integer of 1 to 13, and q is 2 or 3, and
an organosilazane (B) of formula (2):
R4R5R6—Si—NH—Si—R7R8R9  (2),
wherein R4, R5, and R6 are each independently a hydrogen atom or an optionally substituted C1 to C3 alkyl group, at least one of R4, R5, and R6 is an optionally substituted C1 to C3 alkyl group, R7, R8, and R9 are each independently a hydrogen atom or an optionally substituted C1 to C3 alkyl group, and at least one of R7, R8, and R9 is an optionally substituted C1 to C3 alkyl group,
wherein the total content of the filler is 50 mass % or more based on the total weight of the one-part self-adhesive dental composite resin, and
wherein the one-part self-adhesive dental composite resin does not comprise a solvent.
US Pat. No. 10,988,562

FLAME RETARDANT POLYOLEFIN-TYPE RESIN AND PREPARATION METHOD AS WELL AS OPTIC FIBER CABLE USING THE SAME

CORNING INCORPORATED, Co...

1. A method of preparing a flame retardant grafted polyolefin resin, the method comprising the steps of:reacting in an extrusion barrel a reactive polyolefin and a monomeric flame retardant agent to form the flame retardant grafted polyolefin resin, wherein the reactive polyolefin has a functional group including a moiety selected from the group consisting of anhydrides, epoxies, carboxylic acids, ketones, and isocyanates and wherein the monomeric flame retardant agent has an amine functional group and contains at least one element selected from the group consisting of phosphorus, nitrogen, silicon, and sulfur, the at least one element comprising more than 10% by weight of the monomeric flame retardant agent; and
extruding the flame retardant grafted polyolefin resin.
US Pat. No. 10,986,769

LOW DUST POWDERED SEED TREATMENT

1. A composition for minimizing fugitive dust during seed treatment comprising (a) mica coated with titanium dioxide and (b) oil powder comprising oil and maltodextrin, wherein said mica coated with titanium dioxide is about 75% by weight and said oil powder is about 25% by weight of said composition.
US Pat. No. 10,987,282

CURABLE COMPOSITION

TOKUYAMA DENTAL CORPORATI...

1. A curable composition comprising a polymerizable monomer (A); spherical particles (B) having an average primary-particle diameter in a range of 230 nm to 1,000 nm; a polymerization initiator (C), and inorganic particles (D) having an average primary-particle diameter of less than 100 nm, wherein90% or more of individual particles constituting the spherical particles (B) lies in a range of ±5% based on the average primary-particle diameter,
the polymerizable monomer (A) and the spherical particles (B) satisfy requirement (X1) represented by the following formula (1):
nP in formula (1), nP represents a refractive index at 25° C. of a polymer obtained by polymerizing the polymerizable monomer (A); and nF represents a refractive index at 25° C. of the spherical particles (B), and
when a 1 mm-thick cured product is formed from the curable composition and the Y value (Yb) of the colorimetric value according to the Munsell Color System of the colored light of the cured product on a black background and the Y value (Yw) of the colorimetric value according to the Munsell Color System of the colored light of the cured product on a white background are each measured using a color difference meter, the ratio therebetween, Yb/Yw, being within a range of 0.2 to 0.5.
US Pat. No. 10,987,283

DENTAL GLASS IONOMER CEMENT COMPOSITION FOR LUTING EXCELLENT IN REMOVABILITY

SHOFU INC., Kyoto (JP)

1. A dental glass ionomer cement composition for luting comprising at least;a component (a) acid reactive glass powder having an average particle diameter within a range of 4.5 to 7.0 ?m,
a component (b) polymer of an acid group-containing polymerizable monomer having a weight average molecular weight within a range of 30000 to 100000,
a component (c) chelating agent and
a component (d) water, wherein
a plastic flow distance of a kneaded material before setting is 2 mm or less, and
a removal possible time of an excess cement is 2 minutes or less.
US Pat. No. 10,987,284

VOLUME BOOSTING MOLDING HAIR COLORING CREME FORMULATION

1. A hair styling formulation consisting of:a. a natural color agent consisting of coffee, present in an amount ranging from 0.001-0.5 wt. % of the composition, said coffee containing caffeine that provides anti-dihydrotestosterone (D.H.T.) effects and providing a hair color treatment that stains the hair brown, dark brown or black;
b. a viscosity building agent selected from the group consisting of 1-4% by weight vinylpyrrolidone (PVP), 1-6% by weight vinylpyrrolidone, 1-8% by weight vinyl acetate copolymer, 1-6% by weight sodium polyacrylate or combinations thereof;
c. a thickening agent from 2-14% by weight of the composition selected from the group consisting of sunflower seed wax, cetyl alcohol and combinations thereof;
d. said hair styling formulation being a leave-in hair product for molding and volumizing the hair
e.
f.
g.
US Pat. No. 10,988,565

PROCESS FOR PRODUCING ELASTIC AND TEAR-RESISTANT POLYURETHANE FOAMS AND USES

Covestro Deutschland AG, ...

1. A process for producing polyurethane foams, in which compositions comprisingA) isocyanate-functional prepolymers obtainable by the reaction of
A1) low molecular weight diisocyanates of molar mass from 140 to 278 g/mol with
A2) polyalkylene oxides having an OH functionality of two or more,
A3) optionally further isocyanate-reactive components not covered by A2);
B) water in an amount of at least 2% by weight, based on the total weight of the composition;
C) optionally heterocyclic 4-membered or 6-membered ring oligomers of low molecular weight diisocyanates having a molar mass of 140 to 278 g/mol,
D) optionally catalysts;
E) optionally salts of weak acids, the corresponding free acids of which have a pKA in water at 25° C. of ?3.0 and ?14.0;
F) optionally surfactants; and
G) optionally mono- or polyhydric alcohols or polyols;
H) optionally hydrophilic polyisocyanates obtainable by reaction of
H1) low molecular weight diisocyanates of molar mass from 140 to 278 g/mol and/or polyisocyanates preparable therefrom and having an isocyanate functionality of 2 to 6 with
H2) monofunctional polyalkylene oxides of OH number from 10 to 250 and of ethylene oxide content from 50 to 100 mol %, based on the total amount of the oxyalkylene groups present,
are provided, foamed and cured,
wherein the isocyanate-containing components have a total isocyanate content within a range from 2% to 8% by weight and a content of urethane groups of 1.0 to 3.5 mol/kg, based in each case on the total amount of the isocyanate-containing components, and
wherein the polyurethane foam has an F20 value (F20 corresponds to the tension at 20% elongation in the stress strain test according to DIN EN ISO 527-2) of ?50 kPa and a quotient of break strength determined according to DIN EN ISO 527-2 to F20 of at least 3.5.
US Pat. No. 10,988,821

WIRE ROD HAVING EXCELLENT COLD FORGEABILITY AND MANUFACTURING METHOD THEREFOR

POSCO, Pohang-si (KR)

1. A wire rod, comprising:carbon (C): 0.02 wt % to 0.14 wt %, silicon (Si): 0.05 wt % to 0.3 wt %, manganese (Mn): 0.5 wt % to 1.2 wt %, chrome (Cr): 0.3 wt % to 0.9 wt %, phosphorus (P): 0.02 wt % or less, sulfur (S): 0.02 wt % or less, soluble aluminum (sol. Al): 0.01 wt % to 0.05 wt %, nitrogen (N): 0.008 wt % or less, iron (Fe) as a remainder, and unavoidable impurities,
wherein, the wire rod satisfies Formula 1 and Formula 2, when the hardness of the wire rod, measured in a 1/2d position and in a 1/4d position in the diameter direction of the wire rod, are Hv, 1/2(HV) and Hv, 1/4(HV), respectively,
(Hv1/2d+Hv,1/4d)/2?150  [Formula 1]
Hv,1/2d/Hv1/4d?1.2  [Formula 2]
where d is the diameter of the wire.
US Pat. No. 10,987,285

METHOD OF RECLAIMING FORMULA COMPONENTS OF ANTIPERSPIRANT COMPOSITIONS

Colgate-Palmolive Company...

1. A method comprising:(1) melting a solid or semi-solid antiperspirant composition within a package;
(2) removing the molten antiperspirant composition from the package;
(3) settling the molten antiperspirant composition directly from steps (1) and (2) for a period of 6 to 72 hours so as to settle the molten composition into a liquid phase having an oil/wax phase, and a solid phase having an antiperspirant active;
(4) separating the solid phase from the oil/wax phase by washing the melted antiperspirant composition with water to form an aqueous phase in the liquid phase, wherein washing the melted antiperspirant composition distributes the antiperspirant active in the aqueous phase, and washing separates the solid phase from the oil/wax phase within 3 hours; and
(5) treating the liquid phase to reclaim one or more components thereof, which comprises removing the aqueous phase for reclaiming of the antiperspirant active; and saponifying the oil/wax phase.
US Pat. No. 10,988,566

DELAYED ACTION GELLING CATALYST COMPOSITIONS AND METHODS FOR MAKING POLYURETHANE POLYMERS

Evonik Operations GmbH, ...

1. A polyurethane polymer premix composition comprising at least one polyol and a catalyst composition comprising a combination of: i) at least one dimethyltin di-carboxylate salt, ii) at least one dimethyltin mercaptide salt, iii) at least one gelling tertiary amine catalyst, and iv) at least one organic carboxylic acid; wherein the at least one dimethyltin di-carboxylate salt is selected from the group consisting of dimethyltin dipropionate, dimethyltin dibutanoate, dimethyltin dipentanoate, dimethyltin dihexanoate, dimethyltin diheptanoate, dimethyltin dioctanoate, dimethyltin dinonanoate, dimethyltin didecanoate, dimethyltin diundecanoate, dimethyltin dimyristate, dimethyltin dipalmitate, dimethyltin distearate, the corresponding neo-acid derivatives including dimethyltin dineopentanoate, dimehtyltin dineohexanoate, dimethyltin dineoheptanoate, dimethyltin dineooctanoate, dimethyltin dineononanoate, dimethyltin dineoundecanoate, dimethyltin dineododecanoate, dimethyltin dineotetradecanoate, dimethyltin dineohexadecanoate, and dimethyltin dineooctadecanoate; wherein the at least one dimethyltin mercaptide salt is selected from the group consisting of dimethyltin bis(2-ethylhexylmercaptoacetate), dimethyltin bis(butylmercaptoacetate), dimethyltin bis(propylmercaptoacetate), dimethyltin bis(ethylmercaptoacetate), dimethyltin bis(methylmercaptoacetate), dimethyltin bis(pentylmercaptoacetate), dimethyltin bis(hexylmercaptoacetate), dimethyltin bis(heptylmercaptoacetate), dimethyltin bis(nonylmercaptoacetate), dimethyltin bis(decylmercaptoacetate), dimethyltin bis(undecylmercaptoacetate), dimethyltin bis(dodecylmercaptoacetate), dimethyltin bis(palmitoleylmercaptoacetate), dimethyltin bis(oleylmercaptoacetate), dimethyltin bis(linoleylmercaptoacetate), dimethyltin bis(docosahexanoylmercaptoacetate), dimethyltin bis(caprylicmercaptoacetate), dimethyltin bis(capricmercaptoacetate), dimethyltin bis(myristicmercaptoacetate), dimethyltin bis(palmiticmercaptoacetate), dimethyltin bis(stearicmercaptoacetate); wherein the at least one dimethyltin di-carboxylate salt is present in an amount between 0.01 pphp to 10 pphp, and wherein the at least one dimethyltin mercaptide salt is present in an amount between 0.01 pphp to 10 pphp.
US Pat. No. 10,988,822

GRAIN-ORIENTED ELECTRICAL STEEL SHEET AND METHOD FOR MANUFACTURING SAME

JFE STEEL CORPORATION, T...

1. A grain-oriented electrical steel sheet comprising:a steel substrate;
a forsterite base film; and
an insulating coating,
wherein critical damage shear stress ? between the forsterite base film and the steel substrate is 50 MPa or more and 200 MPa or less, the critical damage shear stress ? being measured in accordance with JIS R 3255,
wherein the grain-oriented electrical steel sheet has a non-heat resistant magnetic domain refining region,
wherein a heat-affected width w is 50 ?m or more and (2?+150) ?m or less, the heat-affected width w being a width of a thermal strain portion in the non-heat resistant magnetic domain refining region and the ? is a value expressed in MPa, and
wherein the grain-oriented electrical steel sheet has a coating damaged part area ratio of 10% or less.
US Pat. No. 10,989,846

NEAR INFRARED ABSORBING COMPOSITION, NEAR INFRARED CUT FILTER, METHOD OF MANUFACTURING NEAR INFRARED CUT FILTER, SOLID IMAGE PICKUP ELEMENT, CAMERA MODULE, AND IMAGE DISPLAY DEVICE

FUJIFILM Corporation, To...

1. A near infrared absorbing composition comprising:a resin A that satisfies the following condition a1;
an infrared absorber B; and
a solvent D,
wherein the resin A comprises a repeating unit having a crosslinking group, and the content of the repeating unit having a crosslinking group in the resin A is 10 to 90 mass % with respect to the total mass of all the repeating units of the resin A,
condition a1: a glass transition temperature of a resin having a structure in which a portion which forms a crosslinking bond in the crosslinking group of the resin A is substituted with a hydrogen atom is 0° C. to 100° C., the glass transition temperature being measured by differential scanning calorimetry.
US Pat. No. 10,988,567

AQUEOUS DISPERSIONS CONTAINING POLYMERIZATES PRODUCED IN MULTIPLE STAGES AND COATING AGENT COMPOSITIONS CONTAINING SAME

1. A method of preparing an aqueous dispersion comprising at least one polymer, the method comprising:i. polymerizing a mixture of olefinically unsaturated monomers A by emulsion polymerization in water, using at least one emulsifier and at least one water-soluble initiator, wherein
a polymer prepared from the monomers A has a glass transition temperature of 10 to 55° C.,
ii. separately polymerizing a mixture of olefinically unsaturated monomers B by emulsion polymerization in water, using at least one emulsifier and at least one water-soluble initiator, and adding the polymerized mixture of olefinically unsaturated monomers B to the polymer obtained under i.,
wherein
a monomers concentration of 6.0 wt % in the reaction solution is not exceeded throughout the reaction period, and
the mixture of olefinically unsaturated monomers B comprises at least one polyolefinically unsaturated monomer,
iii. separately polymerizing a mixture of olefinically unsaturated monomers C by emulsion polymerization in water, using at least one emulsifier and at least one water-soluble initiator, and adding the polymerized mixture of olefinically unsaturated monomers C to the polymer obtained under ii.,
wherein
a monomers concentration of 6.0 wt % in the reaction solution is not exceeded throughout the reaction period, and
iv. adjusting the pH of the reaction solution to a pH of 6.5 to 9.0,
wherein
a. the mixture of olefinically unsaturated monomers A comprises from 0 wt % to less than 50.0 wt % of one or more monomers having a solubility in water of <0.5 g/l at 25° C.,
a monomers A concentration of 6.0 wt % in the reaction solution from stage i. is not exceeded,
and the resulting polymer after stage i. has a particle size of 20 to 110 nm,
b. a polymer prepared from the monomers B has a glass transition temperature of ?35 to 12° C., and
the resulting polymer after stage ii. has a particle size of 130 to 200 nm,
c. a polymer prepared from the monomers C has a glass transition temperature of ?50 to 15° C., and
the resulting polymer after stage iii. has a particle size of 150 to 280 nm.
US Pat. No. 10,987,287

POWDERED HAIR COLOUR WITH PERCARBONATE IN A WATER-SOLUBLE FILM

1. A cosmetic product for changing the natural colour of keratinous fibres, comprising(i) at least one package (VP) comprising a water-soluble film (F), wherein the water-soluble film comprises a first polyvinyl alcohol polymer and a second polyvinyl alcohol polymer, wherein the first polyvinyl alcohol polymer has a lower average molecular weight Mw than the second polyvinyl alcohol polymer and/or wherein the first PVOH polymer has a lower degree of hydrolysis than the second PVOH polymer,
(ii) at least one cosmetic composition (KM) which is packaged in the package (VP) and comprises at least one oxidizing compound,
(iii) at least one cosmetic colour composition (FZ) which is packaged in the package (VP),
wherein the oxidizing compound is a solid oxidizing agent and is selected from the group consisting of a percarbonate salt, a perborate salt and a percarbamide salt.