US Pat. No. 10,111,420



1. A method for wetting a low energy surface with an aqueous liquid, the method comprising the steps of:adding a wetting composition to the aqueous liquid to lower the surface tension of the liquid and thereby increase the ability of the aqueous liquid to wet the low energy surface; and
contacting the low energy surface with the liquid comprising the wetting composition;
wherein the wetting composition comprises:
from about 50 wt % to 70 wt % of a C5 to C12 alcohol; and
greater than or equal to about 30 wt % of a surfactant capable of forming micelles, the surfactant being selected from one or more anionic, cationic, and non-ionic surfactants;
wherein the C5 to C12 alcohol and the surfactant together make up 90 wt % or more of the wetting composition; and
wherein the amount of wetting composition added to the aqueous liquid is from about 0.1 to 5 vol %.
US Pat. No. 10,111,932


Syracuse University, Syr...

US Pat. No. 10,112,188



1. A process for manufacturing of a zeolite based catalyst comprising the following steps:(a) adding an aluminum oxide and an acid to a zeolite powder of pentasil type, wherein the zeolite powder has an Si/Al atomic ratio of about 50 to about 250 and is of the H form,
(b) forming, drying and calcining, without treatment with steam, the mixture obtained in step (a) to obtain formed material,
(c) impregnating the formed material of step (b) with a phosphorus compound to obtain a phosphorus containing product, and
(d) calcining the phosphorus containing product from step (c) at a temperature in the range of from 150° C. to 800° C., to obtain a phosphorus containing catalyst
wherein the amounts of the aluminum oxide added in step (a), and of the phosphorus compound added in step (c) are chosen such that the AI:P atomic ratio in the phosphorus containing catalyst obtained in step (d) is 2.5 or more.
US Pat. No. 10,115,520


Mojo Mobility, Inc., San...

1. A base unit for wireless power transfer through a magnetic field, comprising:one or more components including a magnetic material or layer, that modify the magnitude and/or phase of the magnetic field and/or guide a corresponding magnetic flux generated by one or more coils in the base unit in one or multiple dimensions and/or to guide the magnetic flux in such a manner as to create a preferential path for returning flux flow in one or multiple dimensions,
wherein, when one or more power receivers each having one or more receiver coils or receivers associated therewith, is placed in proximity to a base unit, the one or more coils in the base unit are used to inductively generate a current in the one or more receiver coils or receivers associated with the one or more power receivers, and
further wherein the base unit and the one or more power receivers have a coupling coefficient therebetween of less than 0.5.
US Pat. No. 10,111,933



1. A method for treating osteoarthritis in a subject suffering from osteoarthritis, comprising administering to the subject in need of such treatment an effective amount of a peptide that is up to 50 amino acid residues in length and comprises amino acid residues 182-189 of human growth hormone or the corresponding region from any one of SEQ ID Nos: 1-41, which peptide does not include the domain of growth hormone responsible for IGF-1 production.
US Pat. No. 10,112,189


King Fahd University of P...

1. A transmetallated metal organic framework catalyst, comprising:zinc (II) ions;
second metal ions selected from the group consisting of cobalt (II) ions, iron (II) ions, copper (II) ions and mixtures thereof; and
benzene-1,3,5-tricarboxylic acid ligands;
wherein the benzene-1,3,5-tricarboxylic acid ligands comprise carboxylate groups, each carboxylate group forming a coordinative bond to the zinc (II) ions or the second metal ions to form a coordination network in the form of porous polyhedral crystals that are isostructural to an HKUST-1 metal organic framework,
wherein the metal organic framework catalyst does not comprise a coordinated solvent and a ratio of the Zn (II) ions to the second metal ions is in the range of 1.0 to 3.0.
US Pat. No. 10,111,422



1. A method of controlled release of one or more compounds, the method comprisinga. forming a controlled release composition by reacting a reactive composition comprising
i. an ether adduct having the structure X—O—Y, wherein X is the residue of a polyhydroxylated aromatic compound free of methylol moieties, O is oxygen, and Y is a group comprising from about 10 to 1000 ethylene oxide and propylene oxide repeat units arranged in a block conformation; and
ii. a phenolic aldehyde prepolymer, an aldehyde, or a combination thereof;
b. curing the reactive composition to form a cured composition;
c. loading the composition with one or more compounds, and
d. placing the loaded composition in a release environment.
US Pat. No. 10,111,934



1. A pharmaceutical composition comprising a pharmaceutically acceptable carrier and a mutant pro-IGF-I protein, wherein the mutant pro-IGF-I protein comprises an amino acid sequence set forth in SEQ ID NO: 5, wherein the amino acid sequence comprises a combination of mutation K68G, a mutation at amino acid residue R71, and a mutation at amino acid residue R77.
US Pat. No. 10,111,423


SDS BIOTECH K.K., Tokyo ...

1. A microbial pesticide composition, comprising: a bacterial cell dried product of a Bacillus sp. bacterium; and calcium chloride and/or magnesium sulfate, wherein the content of calcium chloride and/or magnesium sulfate in said composition is from 1 mass % to 5 mass %.
US Pat. No. 10,111,935


1. A method of manufacturing an agent for modulating metastatic tumor cell dissemination, the method comprising the steps of:preparing a suspended solution of a cryogenically ground ECM protein;
coating a polycarbonate polyurethane matrix by saturation within the solution of the cryogenically-ground ECM protein; and
drying the ECM protein within the polycarbonate polyurethane matrix to form the agent for modulating metastatic tumor cell dissemination.
US Pat. No. 10,113,217



1. A platinum thermocouple wire being used in a negative electrode of a platinum-based thermocouple, whereina nitrogen mass concentration is 10 to 100 ppm, and
when structure observation of a cross section of the wire in a longitudinal direction is performed, a structure is observed in which there is a plurality of crystal grains, which have an aspect ratio {(length of major axis)/(length of minor axis perpendicular to major axis)} of 5 or more and elongate in the longitudinal direction of the wire, in a wire thickness direction.
US Pat. No. 10,113,218



1. A casting Al—Si—Mg-based aluminum alloy comprising by mass 12.0-14.0% of Si, 1.5-4.0% of Mg, 0.10% or less of Mn, and 0.10% or less of Cu, the balance being Al and inevitable impurities, and having excellent specific rigidity, strength and ductility.
US Pat. No. 10,111,425


1. An aqueous disinfectant formulation consisting of:a) from about 0.05% to about 25% weight of at least one antimicrobial isolated or synthetic phenolic compound of natural origin selected from the group consisting of thymol and carvacrol;
b) from about 0.1% to about 15% weight of an anionic, a cationic, an amphoteric, an non-ionic surfactant, or combinations thereof, in an amount sufficient to form a solution or dispersion of said phenolic compound in an aqueous carrier;
c) from about 0.1% to about 40% weight of a solvent;
d) from about 0.01% to about 10% weight of a sequestering agent selected from the group consisting of ethylene diamine tetraacetic acid (EDTA) sodium salt, sodium gluconate, citric acid, trisodium NTA, trisodium ethylene disuccinate, and sodium choleate;
e) from about 0.01% to about 5% weight of a pH adjusting agent; and
f) sufficient water to make 100 weight percent.
US Pat. No. 10,111,937



1. A method of reducing accumulation of intracellular tingible body macrophages comprising:contacting a macrophage having an accumulation of tingible bodies with a human lysosomal phospholipase A2 (LPLA2) derivative having LPLA2 enzymatic activity in an amount effective to reduce the accumulation of tingible body macrophages, wherein the derivative is selected from the group consisting of a LPLA2 of SEQ ID NO:1 comprising one or more mannose residues, a LPLA2 of SEQ ID NO:1 comprising one or more mannose 6-phosphate residues, a fragment of a LPLA2 of SEQ ID NO:1 comprising a length of 50-275 residues with the catalytic active site corresponding to amino acids 196-200 of SEQ ID NO:1, a fragment of a LPLA2 of SEQ ID NO:1 comprising a length of 50-275 residues with amino acid residues Cys65 and Cys89 of SEQ ID NO:1, a LPLA2 of SEQ ID NO:1 with polyethylene glycol, a LPLA2 of SEQ ID NO:1 with polylysine, a LPLA2 of SEQ ID NO:1 with a lipid, a LPLA2 of SEQ ID NO:1 with a steroid, a LPLA2 of SEQ ID NO:1 with a carbohydrate, a LPLA2 of SEQ ID NO:1 with an oligonucleotide and a LPLA2 of SEQ ID NO:1 with an antibody Fc domain.
US Pat. No. 10,112,963


Novartis AG, Basel (CH)

1. A compound selected from the group consisting of:(3-(((R)-1-(5?-chloro-2?-fluoro-[1,1?-biphenyl]-4-yl)-4-((S)-1-(((cyclohexyloxy)carbonyl)oxy)ethoxy)-4-oxobutan-2-yl)amino)-3-oxopropyl)phosphonic acid;
(3-(((2R)-1-(5?-chloro-2?-fluoro-[1,1?-biphenyl]-4-yl)-4-(1-(((cyclohexyloxy)carbonyl)oxy)ethoxy)-4-oxobutan-2-yl)amino)-3-oxopropyl)phosphonic acid; and
(R)-(3-((1-(5?-chloro-2?-fluoro-[1,1?-biphenyl]-4-yl)-4-ethoxy-4-oxobutan-2-yl)amino)-3-oxopropyl)phosphonic acid; or a pharmaceutically acceptable salt thereof.
US Pat. No. 10,113,219


Yanshan University, Qinh...

1. A nano-pearlite rail, which is a steel rail having an internal microstructure of 100% pearlite with an average interlamellar spacing of pearlite of 55-70 nm, and containing 0.83 to 0.93 of C, 0.05 to 0.10 of Mn, a certain content of Al and Si, 1.0 to 1.5 of Cr, 0.1 to 0.3 of Co, 0.35 to 0.55 of Zr, 0.02 to 0.06 of Mg, 0.01 to 0.05 of Cu, less than 0.025 of S, less than 0.025 of P, and reminder of Fe, wherein the content of Al is 8 to 12 times the content of Mn and the collective content of Al and Si is 1, wherein all the amounts are expressed in wt. %.
US Pat. No. 10,111,426


SALVECO, Saint Die des V...

1. A biocidal composition comprising:a chelating agent, in an amount of 0.05-0.2 wt % of said composition, wherein said chelating agent is selected from the group consisting of succinic acid and sorbic acid;
a nonionic surfactant, in an amount of 0.03-0.12 wt % of said composition, wherein said nonionic surfactant contains a carbon-based chain of between 6 and 20 carbon atoms and is selected from the group consisting of alkyl polyglycoside, polyglycerol ester and sorbitan ester;
an anionic surfactant, in an amount of 0.02-0.08 wt % of said composition, wherein said anionic surfactant contains a carbon-based chain of between 6 and 20 carbon atoms and is an alkali or alkaline earth-metal carboxylic salt selected from a group consisting of alkyl polyethoxylates, propoxylates, polyols of polyglycoside, polyols of polyglycerol combined with a chemical so as to form alkyl carboxylate surfactants or alkyl sulfate surfactants;
lactic acid, in an amount of 0.025-0.1 wt % of said composition;
citric acid, in an amount of 0.025-0.1 wt % of said composition;
a natural fragrance, in an amount of 0.001-0.004 wt % of said composition, wherein the natural fragrance is selected from the group consisting of essential oils, plant essences and plant extracts; and
water, in an amount of 99.00 to 99.75 wt % of said composition;
wherein said composition has bactericidal activity after at least five minutes of contact at 20 degrees Celsius on a surface to which said composition is applied.
US Pat. No. 10,111,938


Allergan, Inc., Irvine, ...

1. A method for alleviating or reducing the occurrence of a headache in a patient with chronic migraine headaches, the method comprises:localizing one or more administration targets;
isolating the one or more administration targets; wherein the isolating step isolates the one or more administration targets from an adjacent area; thereby preventing or minimizing unwarranted adverse effects;
administering a therapeutically effective amount of a clostridial toxin to the one or more isolated administration targets;
wherein the one or more administration targets comprises the frontalis, corrugator, procerus, occipitalis, temporalis, trapezius and cervical paraspinal muscles;
wherein the administrating step is by injection and wherein the administering step comprises limiting the injection to a defined tissue depth and injection angle; and wherein the administrating to the corrugator muscle comprises targeting the belly of the corrugators and injecting superficially at a 90° angle into the belly of the corrugator muscles.
US Pat. No. 10,113,220


1. A high strength hot dipped galvanized steel sheet comprising, as ingredients of the steel, by mass %,C: 0.05 to 0.1%,
Si: 0.1 to 1.0%,
Mn: 2.0% to 2.5%,
Al: 0.02 to 0.1%,
Ti: 0.01 to 0.05%,
Cr: 0.1 to 1.0%,
Sn: 0.0010 to 0.1%, and
a balance of Fe and unavoidable impurities,
as the unavoidable impurities,
P: 0.03% or less,
S: 0.01% or less,
Nb: 0.001% or less,
V: 0.001% or less,
W: 0.001% or less,
Mo: 0.001% or less,
Zr: 0.001% or less,
B: 0.0001% or less,
having a microstructure containing, by area %, 70-90% of ferrite and the balance being comprised of a low-temperature transformation phase containing martensite,
having an average grain size of the low temperature transformed phase of 0.1 to 1 ?m,
having a ratio of average nano hardnesses of the ferrite phase and the low temperature transformed phase of 1.5 to 3.0, and
having a nano hardness of the low temperature transformed phase at 80% or more of the measurement points of 1 to 5 times the average nano hardness of the ferrite phase.
US Pat. No. 10,111,427


1. A plant growth stimulating formulation, suitable for improving fiber yield and quality of the plant, comprising a solution of Anacardic acid or its other derivatives at a concentration ranging from 2-20?M, along with Phytohormone ingredients 1-Naphthaleneacetic acid (1-NAA), and Gibberellic Acid; wherein the presence of anacardic acid or its other derivatives in the formulation in combination with the phytohormone ingredients improves the fiber yield and quality of the plant.
US Pat. No. 10,111,939


Revance Therapeutics, Inc...

1. A method for stabilizing a botulinum toxin formulation comprising a botulinum toxin, a non-reducing disaccharide or a non-reducing trisaccharide, a non-ionic surfactant, and a physiologically compatible buffer, the method comprising:combining the botulinum toxin, the non-reducing disaccharide or the non-reducing trisaccharide, the non-ionic surfactant, and the physiologically compatible buffer thereby forming a liquid botulinum toxin formulation;
wherein the concentration of the non-reducing disaccharide or non-reducing trisaccharide is in the range of 10% to 40% (w/v); and
wherein the concentration of the non-ionic surfactant is in the range of 0.005% to 0.5% (w/v).
US Pat. No. 10,111,940


Wisconsin Alumni Research...

1. A method for inducing an immune reaction to androgen receptor in a mammal having prostate cancer, comprising administering to the mammal an effective amount of a polypeptide selected from the group consisting of (i) a mammalian androgen receptor (e.g., a human androgen receptor), (ii) a fragment of the androgen receptor that comprises the ligand-binding domain, (iii) a fragment of the ligand-binding domain defined by SEQ ID NO:9, (iv) a fragment of the ligand-binding domain defined by SEQ ID NO:10, (v) a fragment of the ligand-binding domain defined by SEQ ID NO:11, and (vi) a fragment of the ligand-binding domain defined by SEQ ID NO:12, whereby the mammal develops immune reaction against androgen receptor.
US Pat. No. 10,113,222


Hydro Aluminium Rolled Pr...

1. Aluminium alloy consisting of alloy components, which have the following composition in % by weight:2.91%?Mg?4.5%,
Ti<0.20%,the balance Al and impurities individually less than 0.05% and in total a maximum of 0.15% and wherein the following applies to the alloy components Zn, Cr, Cu and Mn:(2.3* %Zn+1.25* %Cr+0.65* %Cu+0.05* %Mn) +2.4?%Mg and
(2.3* %Zn+1.25* %Cr+0.65* %Cu+0.05* %Mn) +1.4?%Mg.
US Pat. No. 10,111,942


1. An immunogenic composition comprising:an isolated polypeptide encoded by a recombinant nucleic acid molecule comprising a polynucleotide having the nucleic acid sequence of:
SEQ ID NO: 3; and,
an immuno-effective amount of an adjuvant;
wherein the composition is effective in generating an immune response against Acinetobacter baumannii in a subject in need thereof.
US Pat. No. 10,111,431


University of Florida Res...

1. A method of reducing population of microbe on an object, the method comprising: applying to the object a biofilm reducing agent, or a metal antimicrobial agent and a biofilm reducing agent, in amount and for time sufficient to reduce the microbial population, wherein the microbial population comprises Xanthomonas citri subsp. citri and the biofilm reducing agent comprises D-leucine, D-Serine, or 3-idolylacetonitrile.
US Pat. No. 10,111,687


FEMASYS, INC., Suwanee, ...

1. A method for occluding at least one fallopian tube in a mammal, comprising,a) positioning at a uterine fundus of a mammal a closed tip of an introducer shaft of a delivery device of a delivery system that delivers an effective amount of an occlusive material composition, the delivery system comprising the delivery device comprising a handle, the introducer shaft having a proximal end operatively connected to the handle and the opposed closed tip, the introducer shaft defining a catheter channel along the interior length of the introducer shaft and defining at least one catheter channel opening spaced proximally from the closed tip of the introducer shaft, wherein the catheter channel is configured for providing at least one catheter; at least one catheter having a delivery end and an end structure, wherein the at least one catheter is configured to be received therein the catheter channel of the introducer shaft; and elements for providing an occlusive material composition into and through the catheter;
wherein the closed tip of the introducer shaft is positioned at the uterine fundus by inserting the introducer shaft therethrough a cervix of the mammal until the closed tip contacts a uterine fundus of the mammal, and the at least one catheter channel opening is directed toward a uterine cornua of the mammal;
b) moving the at least one catheter therethrough the catheter channel until the delivery end of the at least one catheter exits the at least one catheter channel opening and the delivery end of the catheter is located within the uterine cornua and the end structure is at or near a tubal ostium, wherein the end structure maintains the delivery end in the uterine cornua and aids in localized delivery of the occlusive material composition; and
c) delivering an effective amount of an occlusive material composition through and out the delivery end of the catheter so that a fallopian tube is occluded, wherein the occlusive material composition comprises a material that polymerizes after delivery of the occlusive material composition.
US Pat. No. 10,111,943


ALPHAVAX, INC., Research...

1. A vaccine composition comprising (a) purified protein and (b) alphavirus replicon particles expressing said protein, wherein the protein is an influenza virus hemagglutinin protein and wherein the alphavirus is Venezuelan Equine Encephalitis (VEE) Virus.
US Pat. No. 10,111,944


wherein X1 is K, X2 is K, X3 is F, X4 is T, X5 is M, X6 is Y, X7 is I, X8 is Y, and X9 is S.
US Pat. No. 10,111,945


Hookipa Biotech GmbH, Vi...

1. A pharmaceutical composition comprising a first infectious, replication-deficient arenavirus viral vector engineered to contain a genome with the ability to amplify and express its genetic information in infected cells but unable to produce further infectious progeny particles in normal, not genetically engineered cells, wherein one arenavirus open reading frame is removed and replaced by a first nucleotide sequence selected from the group consisting of:a) a nucleotide sequence encoding a cytomegalovirus glycoprotein B (gB) or an antigenic fragment thereof;
b) a nucleotide sequence encoding a cytomegalovirus tegument protein pp65 or an antigenic fragment thereof;
c) a nucleotide sequence encoding a cytomegalovirus glycoprotein H (gH) or an antigenic fragment thereof;
d) a nucleotide sequence encoding a cytomegalovirus glycoprotein L (gL) or an antigenic fragment thereof;
e) a nucleotide sequence encoding a cytomegalovirus UL128 protein or an antigenic fragment thereof;
f) a nucleotide sequence encoding a cytomegalovirus UL130 protein or an antigenic fragment thereof; and
g) a nucleotide sequence encoding a cytomegalovirus UL131A protein or an antigenic fragment thereof,and a second infectious, replication-deficient arenavirus viral vector engineered to contain a genome with the ability to amplify and express its genetic information in infected cells but unable to produce further infectious progeny particles in normal, not genetically engineered cells, wherein one arenavirus open reading frame is removed and replaced by a second nucleotide sequence selected from the group consisting of:a) a nucleotide sequence encoding a cytomegalovirus glycoprotein B (gB) or an antigenic fragment thereof;
b) a nucleotide sequence encoding a cytomegalovirus tegument protein pp65 or an antigenic fragment thereof;
c) a nucleotide sequence encoding a cytomegalovirus glycoprotein H (gH) or an antigenic fragment thereof;
d) a nucleotide sequence encoding a cytomegalovirus glycoprotein L (gL) or an antigenic fragment thereof;
e) a nucleotide sequence encoding a cytomegalovirus UL128 protein or an antigenic fragment thereof;
f) a nucleotide sequence encoding a cytomegalovirus UL130 protein or an antigenic fragment thereof; and
g) a nucleotide sequence encoding a cytomegalovirus UL131A protein or an antigenic fragment thereof wherein the first and second nucleotide sequences are different.
US Pat. No. 10,112,971



1. A method of purifying an antibody from a preparation comprising:(a) providing the preparation comprising an antibody;
(b) adding allantoin to the preparation to a supersaturating concentration, wherein after adding the allantoin, the preparation is supersaturated with allantoin;
(c) removing solids from the preparation;
(d) contacting the preparation with polyethylene glycol (PEG) having a molecular weight of 2,000 to 12,000 Daltons and a salt, wherein (i) a concentration of the PEG is sufficient to precipitate the antibody or cause its accretion on a first surface, or maintain it in a precipitated state or accreted on the first surface, and (ii) the salt concentration is sufficient to produce a conductivity between 50 mS/cm and 150 mS/cm; and
(e) contacting the preparation with at least one electropositive surface whereby the antibody does not adsorb to the at least one electropositive surface, wherein the contacting does not prevent adsorption of acidic contaminants to the at least one electropositive surface.
US Pat. No. 10,111,946


1. An early/late hybrid promoter comprising (a) a late element driving late expression of an antigenic determinant and (b) at least two Pr7.5 early elements (Pr7.5E) driving early expression of the antigenic determinant, wherein the late element is linked to the at least two early elements, and wherein RNA levels from the late element in a recombinant modified vaccinia Ankara (MVA) virus are at least 1.5 fold greater than RNA levels produced by the SEQ ID NO: 11 promoter in a recombinant MVA virus in HeLa cells.
US Pat. No. 10,112,972



1. A process for purifying fibrinogen from a fibrinogen containing source, the process comprising precipitating fibrinogen with a precipitating agent from the fibrinogen containing source in the presence of one or more chelating agent(s) to form a fibrinogen paste, removing the supernatant from the fibrinogen paste, extracting fibrinogen from the fibrinogen paste in an aqueous medium void of the chelating agent(s) for a suitable extraction time thereby forming a liquid fraction containing fibrinogen and an undissolved residue, and separating the undissolved residue from the liquid fraction containing fibrinogen, whereinaddition of one or more protease inhibitor(s) is omitted in all steps of the process,
the fibrinogen is precipitated in a temperature range of from 4.1° C. to 40° C., and
the one or more protease inhibitor(s) is selected from the group consisting of C1-protease inhibitors, trypsin inhibitors, thrombin inhibitors, antithrombin-III (AT-III), heparin-cofactor-II, aprotinin, pepstatin, leupeptin and epsilon-aminocaproic acid.
US Pat. No. 10,111,436


SePRO Corporation, Carme...

1. A method for controlling hydrilla in a body of fresh water, comprising:providing in the body of fresh water a synergistically effective amount of a herbicidal combination including an ALS-inhibiting herbicide and endothall, so as to control the hydrilla, wherein the ALS-inhibiting herbicide is penoxsulam, imazamox, or bispyribac sodium;
wherein said providing comprises adding the endothall to the body of fresh water prior to or simultaneously with adding the ALS-inhibiting herbicide to the body of fresh water;
wherein said providing comprises providing the endothall at a level of about 0.1 to about 3.5 ppm in the body of fresh water; and
with the further proviso that:
(i) where the ALS-inhibiting herbicide is penoxsulam, the penoxsulam is applied to the body of fresh water to provide a penoxsulam level of about 2.5 to 50 ppb in the body of fresh water;
(ii) where the ALS-inhibiting herbicide is imazamox, the imazamox is applied to the body of fresh water to provide an imazamox level of about 0.02 to about 0.15 ppm in the body of fresh water; and
(iii) where the ALS-inhibiting herbicide is bispyribac sodium, the bispyribac sodium is applied to the body of fresh water to provide a bispyribac sodium level of about 0.01 to about 0.25 ppm in the body of fresh water.
US Pat. No. 10,111,948



1. A peptide monomer comprising an amphipathic ?-helical peptide comprising an amino acid sequence with at least 80% identity to SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3.
US Pat. No. 10,111,949


The Regents of the Univer...

1. An isolated protein comprising a multimerizing domain from the N-terminal fragment of Latent Membrane Protein 1 (LMP1) operatively joined to a cytoplasmic signaling domain of a heterologous receptor such that the protein assembles into a complex of three or more protein moieties; wherein the LMP1 multimerizing domain is translated from nucleic acids that do not contain introns.
US Pat. No. 10,111,438



1. A method for improving fruit production, said method comprising:(a) applying a composition comprising Methylobacterium and an agriculturally acceptable adjuvant, excipient, or combination thereof to a fruit bearing plant, wherein said Methylobacterium is NLS0037 (NRRL B-50941), NLS0038 (NRRL B-50942), NLS0042 (NRRL B-50932), NLS0062 (NRRL B-50937), and wherein said fruit bearing plant is an apple, pear, grape, citrus, melon, pepper, berry, kiwi, mango, or banana plant, and,
(b) harvesting fruit from said plant, wherein said plant exhibits faster fruit set, increased fruit set, earlier fruit maturation, and/or more uniform fruit maturation compared to an untreated control plant, thereby obtaining improved fruit production.
US Pat. No. 10,111,950


Vaccinex, Inc., Rocheste...

1. A method of treating a disease in a subject, comprising administering to a subject in need of said treatment a modified glycolipid/protein complex comprising:a) a CD1d protein;
b) a ?2-microglobulin physically associated with said CD1d protein; and
c) a modified ?-glycosyl ceramide;
wherein the disease is a viral disease; wherein the modified ?-glycosyl ceramide is covalently linked to the CD1d protein via activation of a benzophenone group attached to the terminus of an acyl chain of the N-acyl lipophilic moiety of the modified ?-glycosyl ceramide, wherein the modified glycolipid/protein complex enhances the activity of natural killer T (NKT) cells, and wherein the modified glycolipid/protein complex is administered in an amount sufficient to alter the progression of the disease.
US Pat. No. 10,111,439



1. A non-aqueous, non-oil liquid composition comprising live Bacillus amyloliquefaciens, a liquid carrier selected from the group consisting of a polyethylene glycol, glycerol, ethylene glycol, dipropylene glycol, propylene carbonate and mixtures thereof, a vinylpyrrolidone polymer and a nonionic block copolymer.
US Pat. No. 10,111,440



1. A non-aqueous, non-oil liquid composition comprising live microbial organisms, a liquid carrier selected from the group consisting of a polyethylene glycol, glycerol, ethylene glycol, dipropylene glycol, propylene carbonate and mixtures thereof, a vinylpyrrolidone polymer and a nonionic block copolymer.
US Pat. No. 10,111,952



1. A method for providing an adjuvant immune response, comprising administering nanoparticles of silicon dioxide to a patient in need thereof, wherein the nanoparticles have a size of at least 5 nm up to 150 nm.
US Pat. No. 10,112,208


1. A glass article, comprising:a glass substrate having a first surface, a second surface, and an edge;
a first nanoparticle region located within the substrate comprising first nanoparticles which are completely surrounded by the substrate; and
a second nanoparticle region located adjacent at least one of the first surface and the second surface, wherein the second nanoparticle region comprises second nanoparticles, wherein at least some of the second nanoparticles are completely surrounded by the substrate.
US Pat. No. 10,112,978


Osaka University, Suita ...

1. A composition containing (a) a peptide of 20 or less amino acids comprising the amino acid sequence LHRLKRLRKRLK (SEQ ID NO: 9) and (b) at least one antigen that is different from the peptide.
US Pat. No. 10,114,004


The Board of Trustees of ...

1. A method of analyzing a cell, comprising:obtaining a cell on a substrate, wherein the cell is labeled with a plurality of mass tags; measuring, using mass spectrometry, an abundance of each of the plurality of mass tags at a plurality of sites for each of a plurality of depths within the cell, thereby generating a set of data, wherein the abundance of each of the plurality of mass tags at a plurality of sites for each of a plurality of depths within the cell is measured using secondary ion mass spectrometry (SIMS).
US Pat. No. 10,111,441



1. A method for synthesis of a silver-PMMA nanocomposite film, comprising the steps of:dissolving silver nitrate in water to obtain an aqueous solution of silver ions;
extracting buds of Aristolochia bracteolate in water to obtain an aqueous Aristolochia extract;
mixing the aqueous solution of silver ions with the aqueous Aristolochia extract to obtain silver nanoparticles in water;
mixing the silver nanoparticles in water with poly (methyl methacrylate) [PMMA] in an organic solvent at 80° C. to obtain a colloidal solution of a nanocomposite of silver nanoparticles and PMMA;
casting the colloidal solution on a support; and
evaporating the organic solvent at room temperature to obtain a silver-PMMA nanocomposite film;
wherein the step of dissolving silver nitrate in water comprises the step of dissolving silver nitrate in distilled water at 60° C. under continuous stirring.
US Pat. No. 10,111,953


Regeneron Pharmaceuticals...

1. A method for reducing in a patient the serum concentration of IDL-C; the method comprising selecting a patient with elevated serum IDL-C, and administering to the patient a pharmaceutical composition comprising a PCSK9 inhibitor;wherein the patient is otherwise healthy except for exhibiting elevated serum IDL-C; and
wherein the PCSK9 inhibitor is an antibody or antigen-binding fragment of an antibody that specifically binds PCSK9 and comprises the heavy and light chain CDRs of a HCVR/LCVR amino acid sequence pair selected from the group consisting of SEQ ID Nos: 90/92 and 218/226.
US Pat. No. 10,112,979


Seqirus UK Limited, Berk...

1. A method of immunizing a patient against an influenza virus comprising steps of:(a) selecting a patient that is immunologically naïve to the influenza virus; and
(b) administering an immunological composition comprising an antigen of the influenza virus to the patient; wherein
the immunological composition is delivered to the patient's Langerhans cells by microporation using microneedles made from at least one biocompatible polymer, which open pores in the patient's stratum corneum, wherein the microneedles ranges in length from 25 ?m to 1 mm. and wherein the influenza virus antigen is in the form of an inactivated virus or a virosome or wherein the influenza virus antigen is produced by a recombinant or synthetic system that does not involve growth of influenza viruses.
US Pat. No. 10,111,954


IBC Pharmaceuticals, Inc....

1. A method of treating a Trop-2+ cancer comprising:a) administering to a human subject with a Trop-2+ cancer a trivalent T-cell redirecting complex comprising a bispecific antibody, wherein the bispecific antibody comprises (i) an anti-CD3 antibody moiety conjugated to an AD (anchoring domain) moiety from an AKAP protein, wherein the amino acid sequence of the AD moiety is SEQ ID NO:4 and (ii) an anti-Trop-2 antibody moiety conjugated to a DDD (dimerization and docking domain) moiety with an amino acid sequence of residues 1-44 of human protein kinase A (PKA) regulatory subunit RII?, wherein two copies of the DDD moiety form a dimer that binds to one copy of the AD moiety to form a complex; and
b) administering to the subject a checkpoint inhibitor antibody selected from the group consisting of pembrolizumab (MK-3475), nivolumab (BMS-936558), and pidilizumab (CT-011).
US Pat. No. 10,112,980


1. A separation matrix, comprising a plurality of polypeptides or multimers of the polypeptides coupled to a solid support, wherein the polypeptide comprises the amino acid sequence selected from the group consisting of SEQ ID NOS: 6-10, 12, 13, or a combination thereof.
US Pat. No. 10,111,443


Kellogg Company, Battle ...

1. A method of producing a filled snack product comprising the steps of:disposing a plurality of filling lines on a first flat surface of a first sheet, each of the plurality of filling lines being spaced to define a void between each of the adjacent filling lines;
placing the second sheet over the first sheet to sandwich the plurality of filling lines between the first and second sheets and form a laminate;
docking the laminate after the second sheet is placed over the first sheet to create a plurality of docking holes which each extend through the first and the second sheets of the laminate for the release of steam or gas during heating;
pinning the first and second sheets at the voids between the plurality of spaced filling lines to secure the first and second sheets to each other; and
heating the laminate to form the filled snack product;
wherein the plurality of docking holes and the plurality of spaced filling lines allow for pinning of the first and second sheets at the voids disposed between the plurality of spaced filling lines to minimize puffing of the filled snack product during heating.
US Pat. No. 10,112,981



1. A method of treating a stroke or cerebrovascular accident comprising administering multiple doses of a therapeutically effective amount of N-Succinyl-[Glu9, Ala11,15] Endothelin 1 to an individual in need thereof and further comprising administering a therapeutically effective amount of a second therapeutic agent useful in the treatment of stroke or cerebrovascular accident.
US Pat. No. 10,112,982



1. A method of detecting an autoantibody to Neurochondrin in a subject, the method comprising:contacting a bodily fluid sample isolated from a subject having cerebellar ataxia or cerebellitis with a polypeptide comprising Neurochondrin, wherein the polypeptide comprising Neurochondrin is recombinant and/or isolated, and binds specifically to autoantibodies binding to Neurochondrin, and
detecting the presence or absence of the autoantibody to Neurochondrin in a complex with the polypeptide.
US Pat. No. 10,114,264


Merck Patent GmbH, Darms...

1. A device for regulating the passage of light through a light-transmitting area, said device comprising:one or more glass layers and at least one switching layer which comprises a liquid-crystalline medium comprising at least one dichroic dye,
wherein said switching layer has a bright state ?v bright and a dark state ?v dark, and
wherein said switching layer has a degree of anisotropy R of at least 0.65 and a degree of light transmission in the bright state ?v bright in accordance with Standard EN410 of 40% to 90%,
wherein said device is a component of a window,
wherein said switching layer comprises three or more different dichroic dyes, and
wherein the liquid-crystalline medium has a clearing point in the temperature range from 70° C. to 170° C.
US Pat. No. 10,111,957


Arven Ilac Snayi ve Ticar...

1. A dry powder inhalation composition comprising,at least one corticosteroid or a pharmaceutically acceptable salt thereof,
fine particle lactose in an amount of 1-20% by weight of said composition and having d50 particle size in the range of 4-10 ?m and coarse particle anhydrous glucose in an amount of 80-99% by weight of said composition and having a d50 particle size in the range of 50-120 ?m.
US Pat. No. 10,112,983


1. A polypeptide variant of neuregulin-1 ? comprising amino acid sequence shown in SEQ ID NO:1, wherein the polypeptide variant comprises a different amino acid than that in SEQ ID NO:1, wherein the polypeptide variant has an enhanced binding affinity to ErbB3 compared to polypeptide of SEQ ID NO:1, and whereinat residue 25 said different amino acid is A, C, E, F, G, H, I, K, L, M, N, P, Q, R, S, T, V, W, or Y; or
at residue 35 said different amino acid is A, C, D, E, F, G, H, I, L, N, M, P, Q, R, S, T, V, W, or Y; or
at residue 46 said different amino acid is A, C, D, E, F, G, H, I, K, L, M, N, P, R, S, T, V, W, or Y.
US Pat. No. 10,114,009


Senomyx, Inc., San Diego...

1. An in vitro method of detecting a human or monkey cell that is potentially sensitive to sweet tastants, the method comprising: (a) detecting the expression of a T1R2 polypeptide at least 90% identical to the polypeptide of SEQ ID NO: 6 and (b) further detecting expression of a T1R3 polypeptide at least 90% identical to the polypeptide of SEQ ID NO: 7; and (c) based on the results of (a) and (b), identifying a cell that expresses said T1R2 and T1R3 polypeptides (“detected cell”) which, therefore, is potentially sensitive to sweet tastants (“detected cell”).
US Pat. No. 10,111,446


Wacker Chemie AG, Munich...

1. A method for preparing fatty acid vinyl ester copolymers by free-radical initiated polymerization ofa) one or more vinyl esters of carboxylic acids having 16 to 22 carbon atoms and
b) one or more vinyl esters of carboxylic acids having 2 to 15 carbon atoms,
wherein the one or more vinyl esters a) and the one or more vinyl esters b) are metered in during the polymerization, and
during the polymerization either a metered addition rate of vinyl ester a) or a metered addition rate of vinyl ester b) is reduced and the metered addition rate of the other of the two vinyl esters a) or b) is increased.
US Pat. No. 10,111,958


Novartis AG, Basel (CH)

1. An aqueous pharmaceutical composition, wherein the composition has a pH of 6.0 and comprises(i) an anti-CD40 antibody wherein the antibody has a concentration of 150 mg/ml, and wherein said anti-CD40 antibody includes heavy chain CDR1, CDR2 and CDR3 of SEQ ID NOs 3, 4 and 5 respectively, and light chain CDR1, CDR2 and CDR3 of SEQ ID NOs: 6, 7 and 8,
(ii) 270 mM sucrose as a stabiliser,
(iii) 30 mM histidine as a buffering agent, and
(iv) 0.06% polysorbate 20 as a surfactant.
US Pat. No. 10,112,984


Haagstreit Medtech AG, K...

1. A chimeric G-protein-coupled-receptor (GPCR) protein comprising an N-terminal domain, a C-terminal domain, transmembrane domains, extracellular loops and intracellular loops, wherein the chimeric GPCR protein includes domains from at least two different GPCR proteins and has the domains arranged to form a GPCR protein, and wherein:(a) a first portion of the chimeric GPCR protein comprises transmembrane domains contributed by a first member of the G-protein-coupled-receptor (GPCR) superfamily, wherein said first member is a bi-stable opsin, wherein said transmembrane domains mediate light activation and comprise an amino acid residue that forms a Schiff' base with a chromophore to covalently bind the chromophore to the GPCR protein; and
(b) a second portion of the chimeric GPCR protein comprises one or more intracellular domains of mGluR6 selected from the intracellular loops IL1, IL2, IL3 and the C-terminal domain (CT), said second portion of the chimeric GPCR protein binding a Galpha(o) protein of the signaling cascade of mGluR6, wherein said one or more selected intracellular loops are present in the chimeric GPCR in corresponding numerically defined positions as in the native mGluR6 structure, and wherein the second portion comprises intracellular loop 3 (IL3) of mGluR6.
US Pat. No. 10,114,010


1. A method of using a physiologically-relevant apparatus, the method comprising the steps of:providing an apparatus including at least one cassette; wherein each cassette includes a spun elastomer scaffold located within a channel separating two chambers, the spun elastomer scaffold, channel and chambers are sealed within the cassette; wherein each chamber in each cassette includes a port and nozzle configured to connect each chamber to tubing; wherein the tubing is connected to a pump; wherein the pump is configured to flow fluid in a circuit through the tubing and each cassette seeding a spun elastomer scaffold in the apparatus with a biological sample; and at least one reservoir connected to the tubing;
configuring the apparatus pump to create a specified flow rate and pressure;
adding an analyte to a reservoir;
flowing a fluid through the apparatus for a specified period of time; and
measuring the analyte;
wherein the spun elastomer scaffold is self-riveted to the chambers.
US Pat. No. 10,114,266


PPG Industries Ohio, Inc....

1. An electroactive optical device comprising:(a) an optical substrate having two opposing surfaces;
(b) at least two electrodes spaced one from the other and disposed on the surface of the substrate;
(c) at least one electroactive material layer in contact with the at least two electrodes (b) and the surface of the substrate (a) wherein the electroactive material layer comprises at least one electrochromic-dichroic material which is a single compound which is both electrochromic and dichroic in response to an applied voltage, and
wherein the electroactive optical device has variable light transmittance in response to the magnitude of an applied electrical voltage.
US Pat. No. 10,111,959


1. An antimicrobial dressing comprising an antimicrobial gel comprising at least two polysiloxanes, wherein the antimicrobial gel is formed by creating at least one covalent bond between at least one alkenyl and/or alkynyl moiety of a first polysiloxane and at least one Si—H moiety of a second polysiloxane, the antimicrobial gel further comprises at least one hydrosilylation catalyst, at least one silver salt, and at least one hydrophilic component, wherein the at least one hydrophilic component makes the antimicrobial gel swell at least 5% (wt/wt) after 24 hours in a water solution containing 8.298 g/L of sodium chloride and 0.368 g/L of calcium chloride dihydrate, as measured by the free swell absorption method, wherein the antimicrobial gel is on a substrate, wherein the substrate comprises a foam comprising polyurethane, wherein the antimicrobial gel is characterized in having an accumulated silver release of at least 0.3% of the total silver content in the initial antimicrobial composition after 24 hours.
US Pat. No. 10,112,985


Intervet Inc., Madison, ...

1. An immunostimulatory non-methylated phosphorothioate (PTO) oligodeoxynucleotide consisting of the general formula selected from the group consisting of:(i) [tcgN1]n, wherein N1=c or g and n?6 and ?100;
(ii) [N1cgt]n, wherein N1=g or c or a or t and n?6 and ?100;
(iii) [gacgtt]n, wherein n?4 and ?100;
(iv) [gacgatcgtc]n, [SEQ ID NO: 214] wherein n?3 and ?100;
(v) [tcgtcgttttcg]n, [SEQ ID NO: 215] wherein n?3 and ?100,
(vi) [tcgtcgttgtcgttttgtcgtt]n, [SEQ ID NO: 216] wherein n?2 and ?100;
(vii) (tx[ttcgtt]ty)n, wherein n?5 and ?100, x=0-5 and y=0-5;
(viii) [ttcgtN1]n, wherein N1=t or c and wherein n?5 and ?100;
(ix) [N1tcgtc]n, wherein N1=t or c and wherein n?5 and ?100;
(x) [gN1cgtt]n, wherein n?4 and ?100 and N1=a or t; and
(xi) [acga]n, and wherein n?6 and ?100.
US Pat. No. 10,114,011


1. A method, comprising:(i) contacting a first portion of a biological sample comprising antigen presenting cells (APCs) obtained from a subject in need of or having received an organ transplant from a donor, with a donor antigen from the donor in vitro under conditions sufficient to induce uptake of the donor antigen;
(ii) contacting a second portion of the biological sample comprising APCs obtained from the subject in need of or having received an organ transplant with a third-party antigen in vitro under conditions sufficient to induce uptake of the third-party antigen; and
(iii) measuring amount of uptake of the donor antigen in the first portion of the biological sample and measuring amount of uptake of the third-party antigen in the second portion of the biological sample, wherein the APCs are dendritic cells or macrophages, wherein the method determines the ratio of uptake of the donor antigen in the first sample and the uptake of the third party antigen by the APCs in the second sample.
US Pat. No. 10,111,448


Alcorn State University, ...

1. A method of reducing fat in an animal in need thereof, the method comprising:forming an oral feed composition comprising a delivery media and at least about percent by weight of Ricinodendron heudelotii (njangsa) seeds, and
feeding the animal an effective amount of the feed composition for a suitable period of time to reduce fat in the animal,
wherein the feed composition is metabolized by the animal and the body composition of the animal is improved such that fat is reduced by about 31%; and
wherein the njangsa seeds are obtained from mature njangsa tree fruit and the seeds are extracted from the seed shells by heating the seed kernels at a temperature above about 100° C.
US Pat. No. 10,112,986


University of Rochester, ...

1. A method of introducing an orthopedic implant into a patient comprising:administering to a patient in need of an orthopedic implant an effective amount of an antibody or an antigen-binding portion of an antibody that binds specifically to a Staphylococcus aureus glucosaminidase and comprises the complementarity determining region sequences of the VH domain of SEQ ID NO:2 and the VL domain of SEQ ID NO:3; and
introducing the orthopedic implant into the patient.
US Pat. No. 10,114,012



1. A method for determining a subject's susceptibility to an allergic reaction, the method comprising:(a) stimulating a whole blood sample from the subject with an allergen, wherein the whole blood sample comprises a basophil cell population;
(b) labeling the whole blood sample with anti-CD203c and a differential label for phosphatase and tensin homolog (PTEN); and
(c) measuring a level of expression of CD203c and PTEN using flow cytometry and comparing the level of expression to a control sample, wherein a higher level of expression of CD203c and PTEN in the basophil cell population compared to the control sample is indicative of increased susceptibility to an allergic reaction to the allergen in the subject.
US Pat. No. 10,111,449


BIOVET, S.A., Cambrils (...

1. An animal food product consisting essentially of an extract of Thymus vulgaris, an extract of Punica granatum and an extract of Allium sativum, wherein the Thymus vulgaris has a p-cimenol content of 15%-17% by weight, the Allium sativum has an allin content of 20%-26% and the Punica granatum has an ellagic acid from 2%-4%, wherein said animal food product was treated with methanolic hydrochloric acid and wherein said product has an inductor effect on the reproduction rate of RNA-protein in swine intestinal cells.
US Pat. No. 10,111,961



1. An inclusion complex formed by the interaction betweenat least one protein selected from the group consisting of elastin, collagen, gliadin, gelatin, keratin, legumin, vicilin, casein, fibrinonectin and fibrillin, said protein substituted by hydrophobic groups covalently bound to said protein, and
at least one ?-cyclodextrin (CD) in the form of a monomer,the protein and the cyclodextrin being non-covalently bound, wherein the hydrophobic groups by which said protein is substituted are alkyl groups, linear or branched.
US Pat. No. 10,112,987



1. A composition comprising:a polypeptide comprising the formula Vab1-L1-X-R3-Y-L2-Vab2,
wherein the Vab1 and Vab2 each independently comprises a variable antigen-binding domain from a camelid single-domain heavy chain antibody, wherein at least one of the variable antigen-binding domains comprises amino acids 1-127 of the amino acid sequence of SEQ ID NO:11 and is capable of binding to an amyloid-beta peptide;
wherein L1 and L2 each comprise a hinge region from a camelid single-domain heavy-chain only antibody;
wherein a nanoparticle comprising polybutylcyanoacrylate and dextran is covalently linked to at least one of L1 and L2; and
wherein X and Y are bifunctional linkers, selected from a maleimido-thiol conjugate and polyethylene glycol;
wherein R3 comprises at least one constant domain of human IgG CH2 or CH3 domain.
US Pat. No. 10,114,013


Berg, LLC, Framingham, M...

1. A method for determining the amount of coenzyme Q10 (CoQ10) or reduced form of coenzyme Q10 (CoQ10H2) in a sample, the method comprising analyzing the sample using LC/MS/MS using oxidized deuterated coenzyme Q10 (CoQ10-d6) and/or reduced deuterated coenzyme Q10 (CoQ10H2-d6) as an internal standard, wherein the method comprises the steps of:a1) adding a known amount of deuterated coenzyme Q10 (CoQ10-d6) to the sample,
b1) detecting CoQ10 and CoQ10-d6 by mass spectrometry, and
c1) determining the amount of detected CoQ10 by comparing it to the known amount of detected CoQ10-d6; or
a2) adding a known amount of reduced deuterated coenzyme Q10 (CoQ10H2-d6) to the sample,
b2) detecting CoQ10H2 and CoQ10H2-d6 by mass spectrometry, and
c2) determining the amount of detected CoQ10H2 by comparing it to the known amount of detected CoQ10H2-d6; or
a3) adding a known amount of CoQ10-d6 and CoQ10H2d6 to the sample,
b3) detecting CoQ10, CoQ10H2, CoQ10-d6 and CoQ10H2-d6 by mass spectrometry,
c3) determining the amount of detected CoQ10 by comparing it to the known amount of detected CoQ10H2-d6, and
d3) determining the amount of detected CoQ10H2 by comparing it to the known amount of detected CoQ10H2-d6.
US Pat. No. 10,111,450


Nestec S.A., Vevey (CH)

1. A process comprising the steps of, in order:providing a water, juice, and/or milk-based jellified product comprising at least two separate homogeneous gel masses, each of the separate homogeneous gel masses comprising carrageenan and galactomannan, wherein adjacent separate gel masses have different gel strengths between 10 and 400 g; and
manually shaking the product for a period of time sufficient to break the weakest gel mass into particles to form a jellified ready-to-drink beverage.
US Pat. No. 10,112,988



1. A method for assessing an amyloid-beta peptide in the central nervous system of a subject, the method comprising:(i) administering to the subject a polypeptide comprising the formula:
wherein Vab1 and Vab2 each independently comprises a variable antigen-binding (Vab) domain that is derived from a camelid single domain heavy chain antibody, and at least one of the variable antigen binding domains comprises amino acids 1-127 of the amino acid sequence of SEQ ID NO: 11 and is capable of binding to an amyloid-beta peptide;
wherein L1 and L2 each comprise a hinge region from a camelid single domain heavy chain antibody; and
wherein the L1, L2, or both further comprise a covalently-attached-detectable label,
wherein the detectable label comprises a nanoparticle that comprises polybutylcyanoacrylate and dextran;
wherein X and Y are bifunctional linkers, wherein X and Y are selected from the group consisting of —NHCO—(CH2CH2O)n— and wherein n=2-100, —CH(CH2SH)—NHCO, —(C4H3NO2)—S—(CH2)3-imidate-, and —NHCO—(CH2CH2O)n—(C4H3NO2)—S—(CH2)3-imidate- and wherein n=2-100;
wherein R3 comprises at least one constant domain of human IgG CH2 or CH 3 domain, and
wherein the polypeptide is capable of specifically binding to an amyloid-beta peptide within the central nervous system (CNS) of the subject;
(ii) waiting for a time sufficient for the polypeptide to permeate the blood-brain-barrier of the subject and bind to the amyloid-beta peptide; and
(iii) detecting the presence or amount of the detectable label within the CNS of the subject.
US Pat. No. 10,111,451


1. A method of treating acne or atopic dermatitis in a human in need thereof consisting essentially of administering to the human in need thereof a therapeutically effective amount of Eastern Prickly Pear which has been fermented with nuruk or Aspergillis oryzae to effectively treat the acne or atopic dermatitis in the human in need thereof.
US Pat. No. 10,112,989


Ablynx, N.V., Ghent-Zwij...

1. A method for the treatment and/or alleviation of disorders relating to platelet-mediated aggregation, comprising administering to a subject in need of such treatment an effective amount of a polypeptide construct comprising at least one single domain antibody that specifically binds vWF,wherein the at least one single domain antibody has complementarity determining regions (CDRs) and framework regions (FRs), and,
wherein the at least one single domain antibody comprises:
a sequence represented by any one of SEQ ID NOs: 1 to 7, 23 to 31, and 62 to 65, or
an homologous sequence of any one of SEQ ID NOs: 1 to 7, 23 to 31, and 62 to 65, wherein the FRs have a sequence identity of more than 85% with the FRs of the parent sequence; or
an homologous sequence of any one of SEQ ID NOs: 1 to 7, 23 to 31, and 62 to 65, wherein the FRs have up to 10 amino acid substitutions compared to the FRs of the parent sequence, and,
wherein said polypeptide or polypeptide construct is able to inhibit at least 50% of platelet aggregation at high shear (1600 s?1) at a concentration of between 0.08 and 0.3 ?g/ml.
US Pat. No. 10,112,990


Genentech, Inc., South S...

1. An isolated monoclonal antibody that binds to human Tau, wherein the antibody comprises:a) HVR-H1 comprising the amino acid sequence of SEQ ID NO: 342; HVR-H2 comprising the amino acid sequence of SEQ ID NO: 343; HVR-H3 comprising the amino acid sequence of SEQ ID NO: 344; HVR-L1 comprising an amino acid sequence selected from SEQ ID NOs: 345, 15, 468 to 478, 495 to 517, 522 to 534, 536 to 539, and 543 to 556; HVR-L2 comprising the amino acid sequence of SEQ ID NO: 346; and HVR-L3 comprising the amino acid sequence of SEQ ID NO: 347;
b) HVR-H1 comprising the amino acid sequence of SEQ ID NO: 72; HVR-H2 comprising the amino acid sequence of SEQ ID NO: 73; HVR-H3 comprising the amino acid sequence of SEQ ID NO: 74; HVR-L1 comprising the amino acid sequence of SEQ ID NO: 75; HVR-L2 comprising the amino acid sequence of SEQ ID NO: 76; and HVR-L3 comprising the amino acid sequence of SEQ ID NO: 77;
c) HVR-H1 comprising the amino acid sequence of SEQ ID NO: 42; HVR-H2 comprising the amino acid sequence of SEQ ID NO: 43; HVR-H3 comprising the amino acid sequence of SEQ ID NO: 44; HVR-L1 comprising the amino acid sequence of SEQ ID NO: 45; HVR-L2 comprising the amino acid sequence of SEQ ID NO: 46; and HVR-L3 comprising the amino acid sequence of SEQ ID NO: 47;
d) HVR-H1 comprising the amino acid sequence of SEQ ID NO: 62; HVR-H2 comprising the amino acid sequence of SEQ ID NO: 63; HVR-H3 comprising the amino acid sequence of SEQ ID NO: 64; HVR-L1 comprising the amino acid sequence of SEQ ID NO: 65; HVR-L2 comprising the amino acid sequence of SEQ ID NO: 66; and HVR-L3 comprising the amino acid sequence of SEQ ID NO: 67;
e) HVR-H1 comprising the amino acid sequence of SEQ ID NO: 212; HVR-H2 comprising the amino acid sequence of SEQ ID NO: 213; HVR-H3 comprising the amino acid sequence of SEQ ID NO: 214; HVR-L1 comprising the amino acid sequence of SEQ ID NO: 215; HVR-L2 comprising the amino acid sequence of SEQ ID NO: 216; and HVR-L3 comprising the amino acid sequence of SEQ ID NO: 217;
f) HVR-H1 comprising the amino acid sequence of SEQ ID NO: 32; HVR-H2 comprising the amino acid sequence of SEQ ID NO: 33; HVR-H3 comprising the amino acid sequence of SEQ ID NO: 34; HVR-L1 comprising the amino acid sequence of SEQ ID NO: 35; HVR-L2 comprising the amino acid sequence of SEQ ID NO: 36; and HVR-L3 comprising the amino acid sequence of SEQ ID NO: 37; or
g) HVR-H1 comprising the amino acid sequence of SEQ ID NO: 52; HVR-H2 comprising the amino acid sequence of SEQ ID NO: 53; HVR-H3 comprising the amino acid sequence of SEQ ID NO: 54; HVR-L1 comprising the amino acid sequence of SEQ ID NO: 55; HVR-L2 comprising the amino acid sequence of SEQ ID NO: 56; and HVR-L3 comprising the amino acid sequence of SEQ ID NO: 57.
US Pat. No. 10,111,965


Aadigen, LLC, Pacific Pa...

1. A complex comprising:a) a cell-penetrating peptide characterized in that it comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 1-4; and
b) a cargo selected from the group consisting of peptides, proteins, peptide analogs, uncharged oligonucleotides, PNAs and small hydrophobic molecules.
US Pat. No. 10,112,991


SANOFI, Paris (FR)

1. A polynucleotide encoding for a polypeptide having at least 95% identity with SEQ ID NO: 26; ora polynucleotide encoding for a polypeptide having at least 90% identity with SEQ ID NO: 28; or
a polynucleotide comprising at least 99% identity with SEQ ID NO: 3; or
a polynucleotide comprising at least 95% identity with SEQ ID NO: 5 or 27; or
a polynucleotide comprising at least 90% identity with SEQ ID NO: 25.
US Pat. No. 10,114,017



1. A method of measuring Factor VIII (fVIII) activity, the method comprising(a) contacting a sample in which fVIII is to be measured with a composition comprising fibrin and isolated platelets or a platelet membrane fraction comprising gpIIbIIIa,
wherein the fibrin binds to said isolated platelet or platelet membrane fraction and
wherein fVIII in said sample binds to said fibrin, and
(b) detecting activity of said fVIII with a plasma-based clotting assay, a fibrometer, a thromboelastometry device or by detecting cleavage of a chromogenic fXa substrate by fXa.
US Pat. No. 10,111,454


Nestec, S.A., Vevey (CH)...

1. A method of producing a heat processed, aseptically packaged infant food product from a plurality of ingredients, the method comprising the steps of:precooking the plurality of ingredients separately;
mixing the precooked ingredients;
subjecting the mixed, precooked ingredients to ultra-high-temperature (UHT) sterilization;
aseptically packaging the UHT-treated infant food product within a packaging container following UHT sterilization; and
wherein the heat processed, aseptically packaged infant food product has reduced levels of furan produced during processing when compared to similar products processed using conventional retorting under sterilization conditions, as indicated by less than about 5 micrograms furan per kg food product.
US Pat. No. 10,111,966


Magenta Therapeutics, Inc...

1. A method of depleting a population of CD117+ cells in a human patient, the method comprising administering an effective amount of a conjugate comprising an anti-CD117 monoclonal antibody and an amatoxin, wherein the monoclonal antibody is internalized by a CD117+ cell, wherein the patient does not have an immunodeficiency disorder, and wherein the monoclonal antibody comprises the following complementary determining regions (CDRs):a CDR-H1 having the amino acid sequence SYWIG (SEQ ID NO: 1)
a CDR-H2 having the amino acid sequence IIYPGDSDTRYSPSFQG (SEQ ID NO: 2)
a CDR-H3 having the amino acid sequence HGRGYNGYEGAFDI (SEQ ID NO: 3)
a CDR-L1 having the amino acid sequence RASQGISSALA (SEQ ID NO: 4)
a CDR-L2 having the amino acid sequence DASSLES (SEQ ID NO: 5)
a CDR-L3 having the amino acid sequence CQQFNSYPLT (SEQ ID NO: 6),wherein the monoclonal antibody is conjugated to the amatoxin by way of a cysteine residue in the Fc domain of the antibody.
US Pat. No. 10,112,992


Philogen S.P.A., Siena (...

1. A method of delivering a molecule to the neovasculature of endometriotic tissue in a human or animal, said molecule being conjugated to a specific binding member which binds the ED-A isoform of fibronectin to form a conjugate and the method comprises administering the conjugate to the human or animal, wherein the specific binding member is an anti-EDA antibody or antigen binding fragment thereof comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein(i) the heavy chain variable (VH) domain comprises heavy chain CDR1, CDR2 and CDR3 amino acid sequences in SEQ ID NO: 16; and
(ii) the light chain variable (VL) domain comprises the light chain CDR1, CDR2 and CDR3 amino acid sequences in SEQ ID NO: 78.
US Pat. No. 10,114,018


US Pat. No. 10,111,455


Cosuera Groupe Warcoing S...

1. A method for processing a composition comprising fructan and sucrose, comprising the steps of (a) providing a composition comprising fructan and sucrose, wherein said composition comprising fructan and sucrose comprises at least 30% by weight (wt %) of fructan based on the total dry matter weight of said composition; and (b) incubating said composition comprising fructan and sucrose with at least one yeast selected from the group consisting of Saccharomyces and Kluyveromyces; until a reduction of at least 10% of the initial weight of sucrose in said composition is obtained and wherein at the end of step (b) the fructan weight is at most 20% lower than the initial fructan weight.
US Pat. No. 10,111,967


1. A method of inducing or enhancing an innate immune response in a subject in need thereof, comprising administering to the subject a complexed ribonucleic acid (RNA) comprising at least one RNA molecule complexed with one or more oligopeptides, wherein the at least one RNA molecule is not covalently bound to the one or more oligopeptides, wherein the nitrogen/phosphate ratio (N/P-ratio) of the RNA to the one or more oligopeptides is in the range of 0.75-25, and wherein the oligopeptide is 8 to 15 amino acids in length and comprises the following formula:(Arg)l;(Lys)m;(His )n;(Orn)o;(Xaa)x  (formula I)whereinl+m+n+o+x=8-15, and
l, m, n or o independently of each other is any number selected from 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15, provided that the overall content of Arg, Lys, His and Orn represents at least 50% of all amino acids of the oligopeptide; and
Xaa is any amino acid selected from native or non-native amino acids except Arg, Lys, His or Orn; and
x is any number selected from 0, 1, 2, 3, 4, 5, 6, 7, or 8, provided, that the overall content of Xaa does not exceed 50% of all amino acids of the oligopeptide.
US Pat. No. 10,112,993



1. An isolated, synthetic or recombinant antibody or fragment thereof that specifically binds to complement control protein domain 18 (CCP18) of factor H (FH), the antibody or fragment comprising:(a) a heavy chain CDR1 having the sequence of SEQ ID NO:5, a heavy chain CDR2 having the sequence of SEQ ID NO:6 and a heavy chain CDR3 sequence having the sequence of SEQ ID NO:7, or
(b) a light chain CDR1 sequence having the sequence of SEQ ID NO:1, a light chain CDR2 sequence having the sequence of SEQ ID NO:2 and a light chain CDR3 having the sequence of SEQ ID NO:3.
US Pat. No. 10,114,019



1. A method of observing and evaluating bacterial infections within the lymph nodes of animals presented for harvest comprising:inoculating intradermally with a device capable of inoculating concurrently at multiple sites an animal with a known amount of a bacterial pathogen, wherein the multiple inoculation sites comprise lymph node drainage areas, wherein the bacterial pathogen that is a live bacterial pathogen selected from Salmonella, Listeria, Shigella, Fransicella, Clostridum, Staphylococcus, Streptococcus, or Bacillus; and
at one or more time points obtaining one or more lymph node biopsies are aseptically harvested to determine the extent of the bacterial pathogen in the lymph nodes.
US Pat. No. 10,111,456


22nd Century Limited, LLC...

1. A primer or probe pair capable of amplifying or detecting a nucleic acid molecule as set forth in SEQ ID NO: 3.
US Pat. No. 10,111,968


1. A method of expressing a therapeutic protein in a mammalian subject comprising administering to the subject an effective amount of mRNA comprising:a) a polypeptide coding region, encoding said therapeutic protein;
b) at least one histone stem-loop, and
c) a poly(A) sequence,wherein said mRNA does not include a histone downstream element (HDE) and the mRNA increases the expression of the therapeutic protein in said subject.
US Pat. No. 10,112,994



1. A method of producing a polypeptide comprising two chains in a prokaryotic host cell, the method comprising:(a) culturing the host cell to express the two chains of the polypeptide in a culture medium under conditions comprising:
a growth phase comprising a growth temperature and a growth agitation rate,
a temperature shift from the growth temperature to a lower production temperature, an agitation rate shift from the growth agitation rate to a lower production agitation rate, and
a production phase comprising the production temperature and the production agitation rate, whereby upon expression the two chains fold and assemble to form a biologically active polypeptide in the host cell;
wherein the host cell comprises a polynucleotide comprising
(1) a first translational unit encoding a first chain of the polypeptide;
(2) a second translational unit encoding a second chain of the polypeptide; and
(3) a third translational unit encoding at least one chaperone protein selected from the group consisting of peptidyl-prolyl isomerases, protein disulfide oxidoreductases, and combinations thereof;
wherein the growth temperature is in the range of about 30° C. to about 34° C. during the growth phase, the production temperature is in the range of about 25° C. to about 29° C. during the production phase, and the growth agitation rate is from 50 to 250 rpm above the production agitation rate; and
(b) recovering the biologically active polypeptide from the host cell.
US Pat. No. 10,112,995


ImmunoQure AG, Martinsre...

1. A human monoclonal anti-interferon-alpha (IFN-?) antibody or an IFN-? binding fragment thereof, wherein the antibody or antigen-binding fragment thereof comprises in its variable regions the complementarily determining regions (CDRs) VH CDRs: amino acids 31-35 of SEQ ID NO:18 and amino acids 50-66 of SEQ ID NO: 18 and amino acids 99-115 of SEQ ID NO: 18; and VL CDRs: amino acids 24-35 of SEQ ID NO:20 and amino acids 51-57 of SEC) ID NO:20 and amino acids 90-100 of SEC) ID NO:20 and wherein the antibody has the following properties: (i) binds to human IFN-? subtypes IFN?I/13 (IFN?Ib), IFN?2, IFN?4, IFN?5, IFN?6, IFN?7, IFN?8, IFN?10, IFN?14 IFN?16, IFN?17 and IFN?21; and (ii) does not bind to IFN-?, wherein the IFN-? antibody or IFN-? binding fragment thereof is labeled with a detectable label selected from the group consisting of an enzyme, a radioisotope, a fluorophore, a peptide and a heavy metal, or attached to a drug.
US Pat. No. 10,114,021



1. A method for determining quantity of Quiescin Q6 in a sample from a subject, wherein the subject presents with dyspnea has a medical history of heart failure, or has a prophylactic or therapeutic treatment of acute heart failure (AHF), the method comprising the steps:(i) obtaining a sample from the subject; and
(ii) determining the quantity of Quiescin Q6 by contacting the sample with one or more binding agents capable of specifically binding to Quiescin Q6.
US Pat. No. 10,111,458


R.J. Reynolds Tobacco Com...

1. A process for inhibiting formation of nitrosamines by bacteria in and/or on planted tobacco, the process comprisingtreating the planted tobacco with a substance comprising a plurality of bacteriophages capable of lysing nitrate-reducing bacteria that form nitrosamines,
wherein the substance comprising the plurality of bacteriophages includes one or more bacteriophages from order or family Caudovirales, Myoviridae, Siphoviridae, Podoviridae, Microviridae, Corticoviridae, Tectiviridae, Leviviridae, Cystoviridae, Inoviridae or Plasmaviridae,
wherein the treating comprises administering to the tobacco plant the substance comprising the plurality of bacteriophages,
wherein the nitrate-reducing bacteria are free from transduction of non-viral DNA; and
slowing the rate of conversion of nitrate to nitrite on the planted tobacco by lysing at least a portion of the nitrate-reducing bacteria.
US Pat. No. 10,111,970


Duke University, Durham,...

1. A method of enhancing a magnetic resonance imaging (MRI) image of a body or body region such as an organ or organ region in a subject, comprising:parenterally administering a composition consisting essentially of sodium ascorbate, meglumine ascorbate, or a mixture thereof to said subject in an MRI image-enhancing amount,
wherein said sodium ascorbate, meglumine ascorbate, or mixture thereof is administered in an amount of from 0.02 grams per kilogram subject body weight, up 40 grams per kilogram subject body weight; and then
generating, by MRI of the subject, an image of said body or body region,
whereby said composition enhances the MRI image.
US Pat. No. 10,112,996


UCB Biopharma SPRL, Brus...

1. An anti-Nav1.7 antibody or binding fragment thereof which after binding the Nav1.7 ion channel is functionally modifying thereto, such that the activity of the ion channel is reduced, wherein the antibody or fragment thereof binds to an E1 or E3 extracellular region of the Nav1.7 ion channel.
US Pat. No. 10,114,022



1. An in vitro method for diagnosing metastasis and/or recurrence in a subject with prostate cancer and/or an in vitro method for the prognosis of the tendency to develop metastasis and/or recurrence in a subject with prostate cancer and treating said subject to inhibit said metastasis or recurrence and/or to avoid or inhibit bone degradation, comprising:(i) quantifying the c-MAF gene expression level, copy number or amplification in a prostate tumor sample of said subject, and
(ii) comparing the expression level, copy number or amplification obtained in (i) with the expression level, copy number or amplification of the c-MAF gene in a control sample, wherein an increase in the expression level, copy number or amplification of the c-MAF gene in said tumor sample with respect to the expression level, copy number or amplification of the c-MAF gene in the control sample is indicative of a positive diagnosis for metastasis and/or recurrence or a greater tendency to develop metastasis and/or recurrence,
(iii) determining that the subject has an increase in the expression level, copy number or amplification of the c-MAF gene in the tumor sample with respect to the expression level, copy number or amplification of the c-MAF gene in the control sample, and
(iv) administering a therapeutically effective amount of a c-MAF inhibitor, a therapy aiming to inhibit and/or treat bone metastasis selected from the group consisting of an mTor inhibitor, a Src kinase inhibitor, a COX-2 inhibitor, a CCR5 antagonist and/or Radium-223, and/or an agent capable of avoiding, inhibiting and/or treating bone degradation to said subject.
US Pat. No. 10,112,997



1. An isolated antibody that specifically binds the extracellular domain of TIGIT, which comprises:(a) a heavy chain CDR1 comprising GSSLSSSYMS (SEQ II) NO:7), a heavy chain CDR2 comprising IIGSNGNTYYANWAKG (SEQ ID NO:8), and a heavy chain CDR3 comprising GGYRTSGMDP (SEQ ID NO:9), and a light chain CDR1 comprising QASQSISSYLNW (SEQ ID NO:10), a light chain CDR2 comprising DALKLAS (SEQ ID NO:11), and a light chain CDR3 comprising QQEHSVGNVDN (SEQ ID NO:12);
(b) a heavy chain CDR1 comprising GFSLSSSYMS (SEQ ID NO:13), a heavy chain CDR2 comprising IIGSNGNTYYANWAKG (SEQ ID NO:8), and a heavy chain CDR3 comprising GGYRTSGMDP (SEQ NO:9); and a light chain CDR1 comprising QASQNIYSDLAW (SEQ ID NO:81), a light chain CDR2 comprising RASTLAS (SEQ ID NO:15), and a light chain CDR3 comprising QQEHLVAWIYN (SEQ ID NO:16); or
(c) a heavy chain CDR1 comprising TSDYAWN (SEQ ID NO:57), a heavy chain CDR2 comprising YISYSGSTSYNPSLRS (SEQ ID NO:58), and a heavy chain CDR3 comprising ARRQVGLGFAY (SEQ ID NO:59), and a light chain CDR1 comprising KASQDVSTAVA (SEQ ID NO:60), a light chain CDR2 comprising SASYRYT (SEQ ID NO:61), and a light chain CDR3 comprising QQHYSTP (SEQ ID NO:62).
US Pat. No. 10,114,023


Massachusetts Institute o...

1. A method of enhancing the efficacy of an anti-hepatocyte growth factor receptor breast cancer therapy on a subject having breast cancer comprising administering to the subject an amount of an antibody, RNAi, aptamer or peptide inhibitor of MenaINV effective to enhance the efficacy of the anti-hepatocyte growth factor receptor breast cancer therapy administered to the subject.
US Pat. No. 10,112,998


National Research Council...

1. An isolated or purified single domain antibody or antigen-binding fragment thereof, comprisinga complementarity determining region (CDR) 1 sequence of GGTVSPTA (SEQ ID NO:1);
a CDR2 sequence of ITWSRGTT (SEQ ID NO:2); and
a CDR3 sequence of AASTFLRILPEESAYTY (SEQ ID NO:3),wherein the single domain antibody or antigen-binding fragment thereof is specific for Insulin-Like Growth Factor 1 Receptor (IGF1R).
US Pat. No. 10,114,280



1. A titania-doped quartz glass having a surface where EUV light is reflected, wherein an angle (?) included between a straight line connecting an origin (O) at the center of the reflecting surface and a birefringence measurement point (A) and a fast axis of birefringence at the measurement point (A) has an average value of more than 45 degrees, and wherein the fast axes of birefringence in the EUV light reflecting surface are distributed in a concentric fashion.
US Pat. No. 10,112,229


The Boeing Company, Chic...

1. A method for forming a panel comprising a first face sheet, a second face sheet and a core sheet between said first face sheet and said second face sheet, said method comprising:entrapping a precursor panel within a forming cavity of a molding tool, said precursor panel comprising said first face sheet, said core sheet welded to said first face sheet and said second face sheet welded to said core sheet, and at least one caul plate being positioned within said forming cavity adjacent to said precursor panel;
heating said precursor panel to a superplastic temperature;
pressurizing a first pressure zone located between said molding tool and said caul plate to press caul plate against said precursor panel; and
pressurizing a panel volume defined between said first face sheet and said second face sheet of said precursor panel.
US Pat. No. 10,114,025


Pathovacs, Incorporated, ...

1. A method for identifying epitopes comprising one or more amino acid molecules of at least two proteomes of an organism that are conserved or unique, the method comprising,a) generating at least one first cDNA expression library of a first recombinant proteome of a first organism by preparing fragments of the genome of said first organism of 0.3 to 1.5 kbp, size-fractionating said fragments into up to five fractions, and cloning said fragments into vectors;
b) generating at least one second cDNA expression library of at least one second recombinant proteome that is a different biotype from said first organism or is a different organism from said first organism by preparing fragments of the genome of said first organism of 0.3 to 1.5 kbp, size-fractionating said fragments into up to five fractions, and cloning said fragments into vectors;
c) expressing said at least one first expression library and said at least one second expression library en masse in a host to produce said first and said at least one second recombinant proteome;
d) harvesting said first and said at least one second recombinant proteome expressed by said first and said at least one second libraries;
e) generating enhanced anti-proteome antibodies which selectively bind to the proteins of said first recombinant proteome; and
f) binding said at least one second recombinant proteome to said anti-proteome antibodies to identify amino acid molecules comprising epitopes by (i) detecting any of said amino acid molecules conserved between said first and said at least one second recombinant proteomes, or (ii) detecting any of said amino acid molecules unique to at least one of said recombinant proteomes to identify said amino acid molecules.
US Pat. No. 10,114,281



1. A mask blank including a phase shift film on a transparent substrate, in which:the phase shift film has a function to transmit an exposure light of an ArF excimer laser at a transmittance of 2% or more and a function to generate a phase difference of 150 degrees or more and 180 degrees or less between the exposure light that transmitted through the phase shift film and the exposure light that transmitted through air for a same distance as a thickness of the phase shift film,
the phase shift film has a structure where a lower layer and an upper layer are stacked from a side of the transparent substrate,
the lower layer is formed from a material consisting of silicon, or a material consisting of silicon and one or more elements selected from nonmetallic elements other than oxygen and semimetal elements,
the upper layer, excluding a surface layer portion thereof, is formed from a material consisting of silicon and nitrogen, or a material consisting of silicon, nitrogen and one or more elements selected from nonmetallic elements excluding oxygen and semimetal elements,
the lower layer has refractive index n of less than 1.8 and extinction coefficient k of 2.0 or more,
the upper layer has refractive index n of 2.3 or more and extinction coefficient k of 1.0 or less, and
the upper layer has more thickness than the lower layer.
US Pat. No. 10,113,000


Biogen Inc., Cambridge, ...

1. A method for treating low grade or follicular non-Hodgkin's lymphoma (NHL) comprising administering to a patient 375 mg/m2 of rituximab during a cyclophosphamide, doxorubicin, vincristine, and prednisone (CHOP) chemotherapeutic regimen, wherein the CHOP chemotherapy and rituximab are administered to the patient on Day 1 of each CHOP chemotherapy cycle.
US Pat. No. 10,113,001


Xencor, Inc., Monrovia, ...

1. A nucleic acid encoding a protein, wherein said protein comprises an Fc variant of a parent IgG Fc polypeptide, said Fc variant comprising an amino acid substitution at position 243 in the Fc region of said parent IgG Fc polypeptide, wherein numbering is according to the EU index.
US Pat. No. 10,114,027


Biothera, Inc., Eagan, M...

1. A method comprising:obtaining a biological sample from a subject;
analyzing the sample for a biomarker anti-?-glucan antibody compared to a reference standard;
computing a Relative Antibody Unit (RAU) value for anti-?-glucan antibody in the sample;
identifying the subject having a RAU value greater than or equal to a predetermined RAU value for the biomarker anti-beta-glucan antibody, and therefore is biomarker positive for beta-glucan immunotherapy, wherein the predetermined RAU value is selected based on a correlation of specificity and sensitivity to at least one endpoint that stratifies biomarker-positive subjects and biomarker negative subjects; and
administering ?-glucan immunotherapy to the biomarker-positive subject.
US Pat. No. 10,113,002


Genentech, Inc., South S...

1. An isolated antibody that binds to Jagged1, the antibody comprising:(a) HVR-H1 comprising the amino acid sequence of SEQ ID NO:81;
(b) HVR-H2 comprising an amino acid sequence of SEQ ID NO:84;
(c) HVR-H3 comprising an amino acid sequence of SEQ ID NO:87;
(d) HVR-L1 comprising the amino acid sequence of SEQ ID NO:110;
(e) HVR-L2 comprising the amino acid sequence of SEQ ID NO:111; and
(f) HVR-L3 comprising an amino acid sequence of SEQ ID NO:114.
US Pat. No. 10,114,028


Upstream Medical Technolo...

1. A method of monitoring a subject having both pneumonia and acute decompensated heart failure, comprising(a) performing an immunoassay to determine a level of a ghrelin signal peptide (GHRsp) fragment by contacting a body fluid sample obtained from the subject with an antibody or antigen-binding antibody fragment thereof that binds a ghrelin signal peptide fragment that is (a) GHRsp (1-9) (SEQ ID NO:3); or (b) GHRsp (1-10) (SEQ ID NO:4) and detecting ghrelin signal peptide fragment bound to the antibody or antigen-binding antibody fragment thereof;
(b) comparing the level of the ghrelin signal peptide fragment determined by the immunoassay with a level of the ghrelin signal peptide fragment in a reference body fluid sample obtained from the same subject at an earlier time, which reference body fluid sample contained a level of ghrelin signal peptide fragment that was above a threshold level of the ghrelin signal peptide fragment that distinguishes a population of subjects having both pneumonia and acute decompensated heart failure from a population of subjects not having both pneumonia and acute decompensated heart failure, wherein a level of ghrelin signal peptide fragment that is above the threshold level indicates the subject has both pneumonia and acute decompensated heart failure; and,
(c) setting a treatment regimen or adjusting a treatment regimen for the subject based upon said comparing of the level of the ghrelin signal peptide fragment in the body fluid sample with the reference body fluid sample.
US Pat. No. 10,113,003


INNATE PHARMA, Marseille...

1. A method of promoting the specific lysis of cancer cells expressing an antigen of interest which is specifically bound by a therapeutic anti-cancer antibody or therapeutic anti-cancer antigen-binding antibody fragment in a subject in need thereof comprising contacting said cancer cells with an amount of a multispecific antigen binding protein sufficient to promote the specific lysis of said cancer cells expressing said antigen of interest, wherein said multispecific antigen binding protein comprises:(i) a first antigen binding domain (ABD) which monovalently binds to a human NKp46 polypeptide having the amino acid sequence set forth in SEQ ID NO:1,
(ii) a second ABD which comprises a therapeutic anti-cancer antibody or a therapeutic anti-cancer antigen-binding antibody fragment which binds to said antigen of interest-expressed by said cancer cells, and
(iii) a CD16A binding polypeptide,wherein:(1) said NKp46-binding ABD comprises a Fab or comprises a variable heavy (VH) domain and a variable light (VL) domain separated by a linker (“scFv”);
(2) said cancer-antigen-binding ABD, which comprises said therapeutic anti-cancer antibody or therapeutic anti-cancer antigen-binding antibody fragment, is monovalent or bivalent;
(3) said CD16A binding polypeptide comprises a dimeric human Fc domain polypeptide which binds CD16A;
(4) said multispecific antigen binding protein binds to the NKp46 polypeptide monovalently;
(5) said multispecific antigen binding protein directs NKp46-expressing natural killer (NK) cells and CD16A-expressing NK cells to lyse cancer cells expressing the cancer antigen of interest by a combination of NKp46-mediated signaling and CD16A-mediated antibody-dependent cell-mediated cytotoxicity (“ADCC”);
(6) said dimeric Fc domain interposes said first ABD and said second ABD;
(7) said first and second ABD are each connected to said dimeric Fc domain, and one or both of said first and second ABD are connected to the dimeric Fc domain via a flexible polypeptide linker.
US Pat. No. 10,114,029



1. A method which comprises:selecting a subject who suffers from kidney disease and who has not suffered a stroke;
determining and recording the level of Pro-Enkephalin or fragments thereof in a bodily fluid obtained from said subject with kidney disease using a binder to Pro-Enkephalin or a fragment thereof and
wherein said Pro-Enkephalin or fragment thereof is one or more of SEQ ID No. 1, SEQ ID No. 2, SEQ ID No. 5, SEQ ID No. 6, SEQ ID No. 8, SEQ ID No. 9, SEQ ID No. 10 or SEQ ID No. 11 and wherein said binder does not bind to SEQ ID No: 3
determining at least one additional clinical parameter of said subject which is age, BUN (blood urea nitrogen), NGAL neutrophil gelatinase-associated lipocalin, Creatinine Clearance, Creatinine, urea, or Apache Score.
US Pat. No. 10,113,004


YOUCEL CO., LTD., Iksan-...

1. A method for producing dry bio-cellulose, the method comprising the steps of:providing a bio-cellulose;
dewatering the bio-cellulose in a centrifuge for 10 minutes or more;
immersing the dewatered bio-cellulose in a solution containing a glycol-based compound; and
supporting the immersed bio-cellulose on nonwoven fabric or a mesh-type plastic plate and drying the supported bio-cellulose,
wherein the glycol-based compound is 1,3-butylene glycol, and
wherein the solution containing the glycol-based compound has an amount of 0.1-50 parts by weight of the glycol-based compound based on 100 parts by weight of the solution.
US Pat. No. 10,111,979


RedDress Ltd., Pardes Ha...

1. A method of dressing a wound of a subject, the method comprising:withdrawing a volume of whole blood by sterile withdrawal of venous blood from a subject;
mixing the volume of whole blood with a coagulation initiator;
allowing said whole blood to clot at a location physically separated from the wound to obtain a sterile whole-blood clot;
combining said whole-blood clot with a support matrix to form a sterile wound dressing comprising clotted whole blood and the support matrix; and
applying said sterile wound dressing onto the wound, and leaving said sterile wound dressing in place for at least two days.
US Pat. No. 10,113,005


Kemira Oyj, Helsinki (FI...

1. A method for producing dewatered microfibrillated cellulose (MFC) comprising:i) providing an aqueous MFC slurry,
ii) optionally dewatering said MFC slurry by mechanical means to provide a partly dewatered MFC slurry, and
iii) subjecting the MFC slurry or the partly dewatered MFC slurry to one or more drying operations by contacting the MFC slurry or the partly dewatered MFC slurry with one or more absorbing materials comprising superabsorbent polymer to produce dewatered MFC,wherein the one or more drying operations is done at ambient temperature and pressure and wherein the one or more drying operations prevents agglomeration of the MFC to obtain the dewatered MFC which is redispersible.
US Pat. No. 10,111,980


1. A method of preparing a dry composition suitable for use in haemostasis and wound healing comprising sequentiallya) providing a cross-linked biocompatible polymer in powder form, one or more polyols, an extrusion enhancer selected from albumin, phosphatidylcholine, phosphatidylserine, lecithin or soy bean oil, and an aqueous medium,
b) mixing the biocompatible polymer, the one or more polyols, the extrusion enhancer and the aqueous medium to obtain a paste, and
c) freeze-drying the paste,
wherein the dry composition comprises from about 10% w/w to about 60% w/w of one or more polyols selected from sugar alcohols and sugars, and
wherein upon addition of an aqueous medium, the dry composition reconstitutes to form a paste without mechanical mixing.
US Pat. No. 10,113,006



1. A method for obtaining a substrate layer for a release liner comprising nanofibrillar cellulose, the method comprising:providing a cellulose based support layer,
providing an organic compound comprising a first moiety and a second moiety connected by an acetal by arranging an acetalisation reaction between nanofibrillar cellulose and an organic fragment, and
applying the organic compound on a surface of the cellulose based support layer to form a release liner comprising a primer layer and the cellulose based support layer,wherein after the acetalisation reaction the first moiety comprises the nanofibrillar cellulose obtained from a primary cellulose having functional hydroxyl groups and the second moiety comprises the organic fragment, the organic fragment comprising at least one functional vinylic group.
US Pat. No. 10,111,981


DERMELLE, LLC, Columbia,...

1. An injectable acid soluble collagen composition comprising,a neutralized solution comprising the acid soluble collagen, EDTA and a polyol, and
wherein the acid soluble collagen comprises collagen selected from the group consisting of Type 1 collagen, Type III collagen and combinations thereof.
US Pat. No. 10,113,007


ICM, Inc., Colwich, KS (...

1. A method used in an alcohol production facility, the method comprising:separating a first suspended-solids stream from a first liquid stream containing fine-suspended solids of a process stream by using a first separation device in a counter-flow wash process;
sending the first liquid stream containing fine-suspended solids to a first tank;
milling a portion of the first suspended-solids stream by using a mechanical milling device;
adding water to the milled particles stream to create a lower-solids stream in a second tank;
heating the lower-solids stream in the second tank at a temperature less than about 95° C.; and
further separating a second suspended-solids stream from a second liquid stream containing fine-suspended solids of the lower-solids stream by using a second separation device in the counter-flow wash process; and
combining the second suspended-solids stream with the first liquid stream containing fine-suspended solids and mixing to homogenize;
wherein the method is performed downstream of slurry and upstream of fermentation.
US Pat. No. 10,111,982


Orthovita, Inc., Malvern...

1. A method of preparing a collagen membrane for use in tissue repair, comprising:(a) digesting collagen with pepsin, thus producing pepsinized collagen;
(b) solubilizing the pepsinized collagen in a buffer composition comprising a polyol, wherein the buffer has a substantially neutral pH and wherein the collagen is present in the buffer composition in an amount of about 2 mg to about 20 mg per ml of the buffer;
(c) drying the thus solubilized, pepsinized collagen; and
(d) reacting the collagen of (c) with a cross-linking agent, thus producing the collagen membrane, wherein the cross-linking agent is added to the solubilized, pepsinized collagen in a concentration of about 0.01% to about 6% (w/v).
US Pat. No. 10,114,290


NuFlare Technology, Inc.,...

1. A method for acquiring a parameter for correcting a dose of a charged particle beam comprising:writing, using a charged particle beam, a plurality of evaluation patterns on a substrate coated with resist;
writing, under each writing condition while varying writing condition for each of the plurality of evaluation patterns, a peripheral pattern according to a corresponding writing condition on a periphery of any different one of the plurality of evaluation patterns by using a plurality of shots of the charged particle beam, after time that can be disregarded with respect to influence of temperature increase of the resist due to writing of an evaluation pattern concerned of the plurality of evaluation patterns has passed;
measuring, under the each writing condition, a width dimension of the evaluation pattern concerned, on whose periphery the peripheral pattern has been written;
calculating, under the each writing condition, a backscatter dose reaching the evaluation pattern concerned from each shot of the plurality of shots;
calculating, under the each writing condition, a temperature increase amount of the evaluation pattern concerned, which is increased due to heat transferred from at least one shot previous to a shot concerned in the plurality of shots, at each shot time of the plurality of shots; and
calculating a correlation parameter for defining a correlation among a width dimension change amount of the evaluation pattern concerned, the temperature increase amount of the evaluation pattern concerned, and the backscatter dose reaching to the evaluation pattern concerned, by using a width dimension of the evaluation pattern concerned under the each writing condition, the temperature increase amount of the evaluation pattern concerned at the each shot time under the each writing condition, and the backscatter dose reaching the evaluation pattern concerned from the each shot under the each writing condition, and outputting the correlation parameter.
US Pat. No. 10,111,983


Warsaw Orthopedic, Inc., ...

1. A method for making a biodegradable collagen matrix, the method comprising: adding a dried mixture of a bioactive agent and bone powder, calcium phosphate, hydroxyapatite, DBM or a mixture thereof to an acidic collagen slurry to form a collagen matrix of macroscopic collagen fibers wherein the bioactive agent is bound to the macroscopic collagen fibers;raising a pH of the collagen slurry to the pH of 8-9;
adding an osteoclastogenesis inhibitor to the collagen matrix;
adding an osteoinductive additive comprising particulate demineralized bone matrix comprising bone chips to the collagen matrix; and
disposing the collagen matrix into a containment device comprising a biodegradable porous polymer mesh bag,
wherein the bioactive agent is water soluble.
US Pat. No. 10,113,009



1. A process for coupling a polysaccharide to a linker, comprising:combining the polysaccharide with an additional linker comprising a primary amine group in the presence of a reducing agent, wherein the polysaccharide comprises a carbonyl group at the reducing terminus,
reacting the carbonyl group with the primary amine group by reductive amination to form a polysaccharide-additional linker intermediate, wherein the reductive amination is carried out at a pH between 4 and 5,
coupling the polysaccharide-additional linker intermediate to the linker, to form a polysaccharide-linker compound, and
precipitating unreacted linker under aqueous conditions at a pH of less than 5.
US Pat. No. 10,114,291



1. A method comprising:forming a first layer over a substrate;
forming a patterned photoresist layer over the first layer, wherein the photoresist includes a floating additive that has an uneven distribution within the photoresist layer;
applying a solution over the patterned photoresist layer to form a conformal layer over the pattern photoresist layer, wherein the conformal layer further includes a first portion over a top surface of the patterned photoresist layer and second portion extending along sidewalls of the patterned photoresist layer;
selectively removing the first portion of the conformal layer formed over the top surface of the patterned photoresist layer; and
selectively removing the patterned photoresist layer thereby leaving the second portion of the conformal layer.
US Pat. No. 10,111,984


Allergan, Inc., Irvine, ...

1. An injectable dermal filler, comprising:a hydrogel comprising a hyaluronic acid polymer crosslinked with collagen via a zero-length crosslinking agent;
wherein said hydrogel is prepared by:
(a) reacting said hyaluronic acid polymer with said collagen via said zero-length cross-linking agent, thereby providing a crosslinked hyaluronic acid/collagen-based composition; and
(b) sterilizing the crosslinked hyaluronic acid/collagen-based composition via irradiation with ultraviolet light or a combination of ultraviolet and visible light.
US Pat. No. 10,113,010



1. A method for isolating a carbohydrate alkylcarbamate from a composition containing a solution of said alkylcarbamate dissolved in a first solvent which does not contain groups that are reactive with a carbohydrate, isocyanate or carbohydrate alkylcarbamate or for preparing a product comprising the carbohydrate alkylcarbamate, the method comprising the following steps:a) adding a second solvent to the composition containing the solution of the carbohydrate alkylcarbamate, the second solvent having the following properties:
the second solvent forms a solution with a mixture of the first solvent and carbohydrate alkylcarbamate, the second solvent forms a solution with the carbohydrate alkylcarbamate, and the second solvent has a boiling point that is at least 5° C. higher than the boiling point of the first solvent, wherein the first solvent is a polar solvent, and
b) removing the first solvent in a removing step, the removing step consisting of removing the first solvent from the composition obtained in step a) by applying a reduced pressure, the resulting composition containing less than 5% (v/v) of the first solvent.
US Pat. No. 10,114,292


FUJIFILM Corporation, To...

1. A pattern forming method comprising:a step a of coating an active-light-sensitive or radiation-sensitive resin composition onto a substrate to form a resist film;
a step b of coating a composition for forming an upper layer film onto the resist film, followed by carrying out heating to 100° C. or higher, to form the upper layer film on the resist film;
a step c of exposing the resist film having the upper layer film formed thereon; and
a step d of developing the exposed resist film using a developer including an organic solvent to form a pattern,
wherein the active-light-sensitive or radiation-sensitive resin composition contains a hydrophobic resin (D), and
the hydrophobic resin (D) has at least two of a fluorine atom, a silicon atom, and a CH3 partial structure which is contained in a side chain moiety of the hydrophobic resin (D).
US Pat. No. 10,113,011


Bridgestone Corporation, ...

1. A process for recovering rubber from an aqueous non-Hevea natural rubber latex that contains natural rubber, water, non-rubber extractables including resin, and one or more additives, and is essentially free of lignocellulosic plant material, comprising the steps of:freezing the latex, whereby at least 75% of the natural rubber coagulates and a mixture containing coagulated natural rubber, water, and extractables is formed;
thawing the mixture;
collecting the coagulated natural rubber;
contacting the coagulated natural rubber with an extraction solution comprising at least one organic polar solvent in order to preferentially solvate the extractables; and
drying the coagulated natural rubber to create a resultant natural rubber wherein the resultant natural rubber has an amount of acetone extractables of 5% by weight or less.
US Pat. No. 10,113,269


Kronoplus Technical AG, ...

1. A dispersion for manufacturing of a paper impregnated with a resin, comprising the following components in weight percent:30 to 75% water;
10 to 65% corundum particles with a particle size of F400 to F2000;
0.05 to 5% anionic dispersing agents;
0.05 to 5% of sodium polyacrylate;
0.1 to 5% nonionic tensides; and
0.01 to 2% thickening agents.
US Pat. No. 10,113,014



1. A method for producing a solid catalyst component for olefin polymerization comprising bringing a vanadium compound into contact with a solid component that comprises magnesium, a halogen, titanium, and an internal electron donor compound.
US Pat. No. 10,113,270


BASF SE, Ludwigshafen (D...

1. A process of making paper or paperboard, comprising subjecting a cellulosic thin stock to one or more shear stages and then draining through a moving screen to form a sheet which is dried,wherein the process employs a retention system which is applied to the thin stock, the retention system comprising as components
i) a blend of different cationic polymers, and
ii) a microparticulate material, which microparticulate material is selected from colloidal silica and bentonite,
in which the blend of cationic polymers comprises:
a) from 50 ppm to 3000 ppm dose rate of a cationic polymer having a charge density of from 1 to 2 mEq per gram and a molar mass of from greater than 700,000 Da to 3 million Da, which cationic polymer is selected from polymers comprising vinyl amine units, and
b) from 50 ppm to 1000 ppm dose rate of a cationic polymer haying a charge density of below 3 mEq per grain and an intrinsic viscosity of at least 10 dl/g, which cationic polymer is a cationic polyacrylamide comprising acrylamide and from 5 to 10 mole % of at least one water-soluble cationic ethylenically unsaturated monomer,
wherein i) the blend of cationic polymers is dosed into the thin stock prior to the final shearing stage and ii) the microparticulate material is dosed into the thin stock after the final shearing stage, and
wherein the ppm dose rate is based on the active weight of the cationic polymer relative to a dry weight of the cellulosic thin stock suspension,
wherein one of the components of the retention system is dosed into the thin stock after the final shearing stage and the other is dosed into the thin stock before the final shearing stage.
US Pat. No. 10,113,015


Basell Poliolefine Italia...

1. A catalyst system for the (co)polymerization of ethylene, comprising (A) a solid catalyst component comprising Ti, Mg, and a halogen, (B) an aluminum alkyl compound, and (C) a halogenated cyclic ether selected from the group consisting of 2-chloro-tetrahydrofuran, 3-chloro-tetrahydrofuran, 2,3-dichloro-tetrahydrofuran and 2,3-dichloro-tetrahydropyran,wherein the catalyst system has a molar ratio of component (C)/Ti ranging from 1 to 25, and wherein the molar amount of Ti is based on the amount of Ti present in component (A).
US Pat. No. 10,113,016


Chevron Phillips Chemical...

1. An olefin polymerization process, the process comprising contacting a catalyst composition with an olefin monomer and an optional olefin comonomer in a polymerization reactor system under polymerization conditions to produce an olefin polymer comprising a higher molecular weight component and a lower molecular weight component, wherein:the olefin polymer is characterized by a ratio of the Mp of the higher molecular weight component to the Mp of the lower molecular weight component in a range from about 5:1 to about 100:1;
the catalyst composition comprises:
catalyst component I comprising a two carbon bridged metallocene compound containing two cyclopentadienyl groups, two indenyl groups, or a cyclopentadienyl and indenyl group;
catalyst component II comprising a single atom bridged metallocene compound containing a fluorenyl group;
an activator; and
optionally, a co-catalyst; and
a weight percentage of catalyst component I is in a range from about 25 to about 98%, based on the total weight of catalyst component I and catalyst component II.
US Pat. No. 10,115,836


Heraeus Precious Metals N...

1. An electroconductive paste comprising:metallic particles;
at least one inorganic reaction system comprising a lead-bismuth-tellurium-silicate composition of Formula (I):
Pba—Bib—Tec—Sig-Md-Oe,  (I)
the sum of a, b, c, d and g is 1,
0 0.2 0?c?0.5,
0 0 a:b is between about 0.1:99.9 to about 5:95,
b:c is between about 50:50 to 99:1,
a:c is between about 1:99 to about 10:90,
b:g is between about 50:50 to about 98:2,
M is one or more elements selected from the group consisting of boron, aluminum, gallium, germanium, tin, phosphorus, antimony, niobium, tantalum, vanadium, titanium, molybdenum, tungsten, chromium, silver, halides, chalcogenides, alkaline metals, alkaline earth metals, and rare earth metals, and
e is a number sufficient to balance the charge of the Pb, Bi, Te, Si, and M components; and
an organic vehicle.
US Pat. No. 10,115,324



1. A security element for security labels or adhesive strips, the security element comprising:a carrier substrate;
a reflective layer or a layer with a high refractive index applied on the carrier substrate;
a partial separating lacquer layer applied intermittently on a surface of the reflective layer or the layer with a high refractive index;
an adhesive coating applied to the partial separating lacquer layer; and
an adhesion promoter layer situated between the partial separating lacquer layer and the reflective layer or the layer with the high refractive index,
wherein the security element is configured to cause the adhesive coating to migrate under the reflective layer or the layer with the high refractive index at portions of the surface of the reflective layer or the layer with the high refractive index on which there is no partial separating lacquer layer due to adhesion of the reflective layer or the layer with the high refractive index to the substrate being destroyed at points where the adhesive coating has migrated under the reflective layer or the layer with the high refractive index.
US Pat. No. 10,114,304



1. A toner binder comprising:a crystalline resin (A); and
an amorphous resin (B) that is a polyester resin or its modified resin, the polyester resin being obtained by reaction of an alcohol component (X) and a carboxylic acid component (Y) as raw materials,
wherein the amorphous resin (B) is a combination of two resins having different softening points (Tm's), wherein one of the two resins is a resin having a Tm of 80° C. to 110° C. and the other is a resin having a Tm of 110° C. to 170° C.,
wherein a temperature (Tp) of a top of an endothermic peak derived from the crystalline resin (A) as measured by a differential scanning calorimeter (DSC) is in the range of 40° C. to 100° C., and endothermic peak areas S1 and S2 during heating satisfy the following equation:
(S2/S1)×100?35  (1)
wherein S1 is an area of the endothermic peak derived from the crystalline resin (A) in the first heating process, and S2 is an area of the endothermic peak derived from the crystalline resin (A) in the second heating process, when the toner binder is heated, cooled, and heated.
US Pat. No. 10,112,254


Huntington Alloys Corpora...

1. A method of producing a nickel alloy clad steel pipe comprising:providing a hollow cylinder of nickel alloy cladding material and a hollow cylinder of steel;
placing the hollow cylinder of the nickel alloy cladding material concentrically inside the hollow cylinder of steel to form a composite billet;
heating the composite billet to an extrusion temperature of 1121-1260° C.; and
extruding the heated composite billet into an extrudate,
wherein the nickel alloy cladding material: comprises 6.0 to 12.0 wt. % molybdenum, 19.0 to 27.0 wt. % chromium, 1.0 wt. % maximum tungsten, 0.6 wt. % maximum aluminum, 0.6 wt. % maximum titanium, 0.001 to 0.05 wt. % carbon, 0.001 to 0.035 wt. % nitrogen, 0.001 to 0.3 wt. % silicon, 1.0 wt. % maximum niobium, 2.5 wt. % maximum iron, 0.5 wt. % maximum manganese, 0.015 wt. % maximum phosphorous, 0.015 wt. % maximum sulfur, 1.0 wt. % maximum cobalt, and the balance nickel and incidental impurities.
US Pat. No. 10,113,024


Dow Global Technologies L...

1. A polymer comprising as polymerized units one or more arylcyclobutene first monomers and one or more second monomers having two or more dienophilic moieties and one or more acid moieties chosen from carboxylic acid, protected carboxylic acid, and sulfonic acid; wherein the protected carboxylic acid is an ester having a quaternary carbon bonded directly to the alkoxy oxygen of the ester group; and wherein the one or more second monomers are free of benzocyclobutene moieties.
US Pat. No. 10,114,306



11. An image forming method for forming an image by an electrophotographic method comprising:charging an image carrier with a charging device;
light exposing the charged image carrier with a light exposing device to form an electrostatic latent image on the image carrier;
developing the electrostatic latent image with toners of plural colors to form a toner image with the toners of the plural colors;
transferring the toner image to a recording medium; and
fixing the toner image on the recording medium,
wherein each of the toners of the plural colors contains a crystalline resin,
methanol concentrations (%) at transmittance of 50% obtained for methanol wettability evaluation of the toners of the plural colors all fall in a range of 15 to 60%,
assuming that a maximum value and a minimum value of the methanol concentrations (%) at transmittance of 50% obtained for the methanol wettability evaluation of the toners of the plural colors are respectively WH (%) and WL (%), the following expression 1 is satisfied:
4?WH?WL?30  (1), and
the number of the plural colors of the toners is five or more.
US Pat. No. 10,112,769



1. A Flexible Intermediate Bulk Container (FIBC) having a body made of flexible fabric woven from polymeric tapes, and transport loops, wherein the body comprises side walls, bottom part, and top part, characterised in that the fabric of at least one of said side walls and transport loops is woven from uniaxially-drawn PET tape having a density greater than 1.333 g/cm3.
US Pat. No. 10,113,025


Evonik Degussa GmbH, Ess...

1. A process for preparing a functionalized resin, comprising:condensing a ketone selected from the group consisting of: acetone; acetophenone; ortho-, meta- or para-phenylacetophenone; methyl ethyl ketone; 3-pentanone; 2-heptanone; 3-heptanone; 4-heptanone; 2-octanone; 3-octanone; 2-undecanone; 5-methylhexan-2-one; 4-methylpentan-2-one; cyclopentanone; cyclododecanone; mixtures of 2,2,4- and 2,4,4-trimethylcyclopentanone; cycloheptanone; cyclooctanone; cyclohexanone; o-, m- or p-methoxyacetophenone; o-, m- or p-[N,N-dialkylaminophenyl]ethanone; alkyl-substituted cyclohexanones or diones or mixtures thereof
and an aldehyde in the presence of at least one amino alcohol selected from the group consisting of: N,N-dimethylaminoethanol, trimethylaminoethylethanolamine, 3-dimethylaminopropan-1-ol, butyldiethanolamine, butylethanolamine, dibutylethanolamine, diethylethanolamine, ethylethanolamine, dimethylaminoethoxyethanol, methyldiethanolamine, N,N-dimethylisopropanolamine, N-methylethanolamine, diethanolamine, diisopropanolamine, triisopropanolamine, N-(2-hydroxyethyl)piperidine, diisopropanol-p-toluidine, N,N-di(2-hydroxyethyl)aniline, N-(2-hydroxyethyl)aniline, 2-(2-aminoethoxy)ethanol, 3-amino-1-propanol, 5-amino-1-pentanol, monoethanolamine, N-(2-aminoethyl)ethanolamine, isopropanolamine, 2,2?-(phenylamino)diethanol, 1-(2-hydroxyethyl)piperazine, 4-(2-hydroxyethyl)morpholine, or derivatives or mixtures thereof,
wherein said aldehyde used is a 20% to 40% by weight aqueous formaldehyde solution, said amino alcohol is incorporated covalently into said resin and said condensation is conducted in situ.
US Pat. No. 10,112,000



1. A method for reducing ?-amyloid concentration in blood of a patient diagnosed with Alzheimer's disease or with accumulation of ?-amyloid in the brain, comprising:removing blood out of a body of the patient,
passing the removed blood through a hollow fiber membrane comprising at least one polymer to obtain a filtrate,
allowing ?-amyloid contained in the blood to adsorb directly to the at least one polymer of the hollow fiber membrane by at least one of electrostatic and hydrophobic interaction between the ?-amyloid and the at least one polymer of the hollow fiber membrane, so that the ?-amyloid concentration in blood is reduced by the direct adsorption of the ?-amyloid to the hollow fiber membrane due to the electrostatic and/or hydrophobic interaction between the ?-amyloid and the at least one polymer of the hollow fiber membrane; and
returning the blood that is passed through with or without the obtained filtrate into the body of the patient,
the at least one polymer is selected from the group consisting of polysulfone (PSf), polymethylmethacrylate (PMMA), polyethersulfone-polyarylate polymer alloy (PEPA), polyethersulfone (PES), and polyacrylonitrile (PAN),
the blood is passed through an inner cavity or an outer cavity of the hollow fiber membrane;
gas or liquid is present at an opposite side of the hollow fiber membrane to the blood side;
a removal rate of ?-amyloid from the removed blood is greater than 42.7%; and
at least 95% of the ?-amyloid removed from the patient's blood is directly adsorbed to the at least one polymer of the hollow fiber membrane.
US Pat. No. 10,113,026


Dow Global Technologies L...

1. A foam formulation comprising:a polyol composition consisting essentially of an amine-initiated polyol that is from 10 percent to 20 percent of a total weight of the polyol composition and an additional polyether polyol that is from 80 percent to 90 percent of the total weight of the polyol composition, wherein the additional polyether polyol includes a trifunctional polyol that is less than 10 percent of the total weight of the polyol composition, wherein the amine-initiated polyol has an average hydroxyl number from 200 to 850;
a polyisocyanate, wherein the foam formulation has an isocyanate index in a range from 70 to 500;
a blowing agent;
a blowing catalyst comprising pentamethyldiethylene-triamine; and optionally
a gel catalyst comprising dimethylcyclohexylamine, wherein a combination of the blowing catalyst and the gel catalyst is from 0.5 percent to 1.5 percent the total weight of the polyol composition and wherein the blowing catalyst is from 60 percent to 100 percent of a total weight of the blowing catalyst and the gel catalyst.
US Pat. No. 10,113,027


SWIMC LLC, Cleveland, OH...

1. A method of making a high molecular weight polyether polymer, comprising the step of reacting ingredients including:(i) a nitrogen-containing catalyst having at least one bridgehead Nitrogen atom;
(ii) a diepoxide compound; and
(iii) a hindered polyhydric phenol compound having an atom or group with an atomic weight of at least 15 Daltons in an ortho position relative to an oxygen atom on a phenol ring;wherein the polyether polymer: (a) includes at least 25% by weight of aryl or heteroaryl groups and (b) is substantially free of bound bisphenol A, bisphenol F, bisphenol S, polyhydric phenols having estrogenic activity greater than or equal to that of bisphenol S, and epoxides thereof.
US Pat. No. 10,113,029


1. A spherical monodispersed polyester resin aqueous dispersion, comprising a polyester resin dispersed in water,wherein the polyester resin has a particle average particle diameter in the range of from 1 to 1,000 ?m, a sphericity in the range of from 1.00 to 1.10 as an average value (aspect ratio) of the long diameter/short diameter of the particles, and a monodispersity as a coefficient of variation from the average particle diameter and a standard deviation of 8% or less,
the dispersion contains, together with the polyester resin,
(A) an anionic polymer compound having an average molecular weight of 5,000,000 or more and 25,000,000 or less, and
(B) a polyvinyl alcohol, as dispersing agents, at a ratio in the range of from 1/10 to 1/99by mass ratio (A/B), and
the dispersion has a viscosity in the range of from 0.1 to 5 Pa·s.
US Pat. No. 10,112,264


King Fahd University of P...

1. A method of treating a copper-tin alloy, comprising:ablating a metallic surface of the copper-tin alloy by directing a laser beam with a diameter of 100-400 ?m produced by a CO2 laser with a pulse frequency of 1200-1800 Hz onto the metallic surface; and
concurrently exposing the metallic surface to a N2 assist gas with a pressure of 550-650 KPa to form an ablated metallic surface comprising microgrooves with single crystal Cu3N present on a surface of the microgrooves;
wherein the N2 assist gas and the laser beam are oriented coaxially; and
wherein the ablated metallic surface has a higher surface hydrophobicity than the metallic surface prior to the ablating.
US Pat. No. 10,113,035



1. A method for producing a curable polysilsesquioxane compound comprising one structural unit or two or more structural units represented by R1SiO3/2,the curable polysilsesquioxane compound having a 29Si nuclear magnetic resonance spectrum that
has a first peak top within a range of ?60 ppm or more and less than ?54 ppm, and
has a second peak top within a range of ?70 ppm or more and less than ?61 ppm, and
a peak is not observed within the range of ?53 ppm or more and less than ?45 ppm, or, the ratio of the integral value of the peak within the range of ?53 ppm or more and less than ?45 ppm to the integral value of the peak within the range of ?60 ppm or more and less than ?54 ppm is less than 0.5% in the 29Si nuclear magnetic resonance spectrum,
the method comprising a step (I) that subjects one compound or two or more compounds represented by a formula (1) to polycondensation in the presence of an acid catalyst, and
R1Si(OR2)3  (1)
a step (II) that adds an organic solvent to a reaction mixture obtained by the step (I) to dissolve a polycondensate of the compound represented by the formula (1) to obtain a solution, adds a base to the solution in a molar equivalent equal to or larger than that of the acid catalyst, and then effects polycondensation,
wherein R1 is an alkyl group having 1 to 10 carbon atoms, and R2 is a hydrogen atom or an alkyl group having 1 to 10 carbon atoms, provided that a plurality of R2 are either identical to or different from each other.
US Pat. No. 10,113,036



1. A method of producing a crosslinked organopolysiloxane, comprising the steps of preparing a gel-like silicone by hydrosilylation of an organopolysiloxane having the structure of formula (1) below with an organohydrogenpolysiloxane having the structure of formula (2) belowM?MVi?D?DVi?T?TVi?Q?  (1)
M?MH?D?DH?T?TH?  (2)(wherein M is R3SiO1/2, MVi is R2PSiO1/2, D is R2SiO2/2, DVi is RPSiO2/2, T is RSiO3/2, TVi is PSiO3/2, MH is R2HSiO1/2, DH is RHSiO2/2, TH is HSiO3/2 and Q is SiO4/2, each R being independently an unsubstituted or substituted monovalent hydrocarbon group of 1 to 12 carbon atoms that has no aliphatic unsaturated bonds and P being an alkenyl group represented by —(CH2)a—CH?CH2 (where “a” is 0 or an integer from 1 to 6); and ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ? and ? are each independently 0 or a positive number, with the provisos that ?, ? and ? are not all 0, ?+?+??2, ?, ? and ? are not all 0, and ?+?+??2); and subsequently adding to the gel-like silicone a compound having siloxane units of formula (3) belowR12SiO2/2  (3)(wherein each R1 is the same or a different group selected from among monovalent hydrocarbon groups of 1 to 20 carbon atoms that have no aliphatic unsaturated bonds and alkenyl groups represented by —(CH2)a—CH?CH2 (where “a” is 0 or an integer from 1 to 6; and an average degree of polymerization of the siloxane of formula (3) is from 3 to 2,000 in the compound having siloxane units of formula (3)) and carrying out equilibration so as to obtain an organopolysiloxane which contains 0.1 to 50 moles of silethylene linkages per 1,000 moles of siloxane units.
US Pat. No. 10,113,038


Lotte Advanced Materials ...

1. A thermoplastic resin composition for an exterior material, comprising:a thermoplastic resin and at least two cellulose fibers,
wherein the cellulose fibers are present in an amount of 0.1 parts by weight to 5 parts by weight relative to 100 parts by weight of the thermoplastic resin, and
wherein the cellulose fibers comprise first cellulose fibers having an average diameter of 5 ?m to 20 ?m and second cellulose fibers having an average diameter of 40 ?m to 400 ?m.
US Pat. No. 10,113,039



1. A process for producing shaped articles comprising the steps of:(a) forming polymer pellets (A) of a polymer composition (A) by compounding in a first kneader a polyamide, a halogen-free melamine based flame retardant and at most 15 wt. % of glass fibers,
(b) forming polymer pellets (B) of a polymer composition (B) by compounding in a second kneader a polyamide and more than 15 wt. % of glass fibers in the absence of a halogen-free melamine based flame retardant,
(c) producing a mixture of pellets comprising the polymer pellets (A) of polymer composition (A) and the polymer pellets (B) of polymer composition (B), and
(d) injection molding into articles the mixture of pellets comprising the polymer pellets (A) of polymer composition (A) and the polymer pellets (B) of polymer composition (B).
US Pat. No. 10,113,041



1. A film comprising:an aromatic polyether ketone resin (I); and
a fluororesin (II),
the aromatic polyether ketone resin (I) having a crystallinity of 15% or higher.
US Pat. No. 10,113,042



1. A method for curing and surface functionalization to produce surface-functionalized molded parts, comprising:processing at least one material of
a fiber reinforced polymer material,
a sheet molding compound (SMC),
a bulk molding compound (BMC), and
a fiber-polymer-matrix part to form a molded part; wherein the material is an unsaturated radically curable reactive resin system and further substances; and
during or after the processing of the at least one material to form the molded part,
partially curing the material of the molded part to dimensional stability by cross-linking, which is thermally initiated, to form a partially-cured molded part; and then
subjecting the partially-cured molded part to energetic electrons in an oxygen-containing atmosphere and with a dose application in at least two treatments to essentially completely cure at least a surface region of the partially-cured molded part, to generate oxygen-containing functional groups from the atmosphere on the surface and/or in regions close to the surface of the partially-cured molded part, and to increase hydrophilicity of the surface of the partially-cured molded part, thereby producing a surface-functionalized molded part;
after subjecting the partially-cured molded part to the energetic electrons in the oxygen-containing atmosphere to form the surface-functionalized molded part, gas emission from the surface of the surface-functionalized molded part, of any residual monomers, residual oligomers, or residual reactive thinning agents that remain, is virtually completely prevented, and
no residual reactivity is detectable in the surface-functionalized molded part surface via differential scanning calorimetry (DSC) measurements.
US Pat. No. 10,111,505


1. A clear aerosol composition for hypoallergic metal surface sealant, the composition comprises:a resin material, and wherein a concentration of the resin material present in the composition is in a predetermined range;
an ethyl acetate, and wherein a concentration of the ethyl acetate present in the composition is in a predetermined range;
an butyl acetate, and wherein a concentration of the butyl acetate present in the composition is in a predetermined range;
a Plasticizer comprising trimethyl pentanyl diisobutyrate, and wherein the plasticizer comprising trimethyl pentanyl diisobutyrate is added in the composition in a predetermined amount;
a Propylene Glycol Monomethyl Ether Acetate (PM) Acetate, a concentration of the propylene glycol monomethyl ether acetate present in the composition is in a predetermined range;
a herbal fragrance, and wherein the herbal fragrance is added in the composition in a predetermined amount; and
a propellent, and wherein the propellant is added in the composition in a predetermined range.
US Pat. No. 10,113,043



1. A composition comprising a combination of latex foam and polyurethane gel particles produced by the method comprising:a. reacting one or more polyols with hydroxyl values from 10-170 and with functionality greater than or equal to 3; one or more polyols with hydroxyl values from 170-1400 and with functionality of 2; and one or more polyisocyanates with NCO functionality of 2 to 8 to make a polyurethane gel elastomer, where the polyurethane gel elastomer has a polyisocyanate index between 0.62 to 0.90, and where the polyurethane gel polymer is prepared in the presence of at least one gelation catalyst;
b. reducing the polyurethane gel elastomer into polyurethane gel particles having an average particle size between the range of about 0.01 to about 12 millimeters;
c. introducing the polyurethane gel particles into a mixture of latex foam-forming components; and
d. polymerizing the latex foam-forming components to form an open cell flexible latex foam;where said polyurethane gel particles are added in the range of about 0.1 to about 200 parts per hundred of the latex foam-forming components.
US Pat. No. 10,111,508


1. A cosmetic product comprising:a) a cosmetic preparation comprising, relative to the total weight thereof:
a1) 50 to 90 wt. % polar solvent, and
a2) 0.001 to 10 wt. % direct dye; and
b) a device for flash evaporation of the cosmetic preparation a).
US Pat. No. 10,113,046


ARKEMA INC, King of Prus...

1. A process of foaming a polyurethane foam comprising mixing polyurethane foam forming components comprising one or more polyols, one or more surfactants, one or more catalysts and one or more flame retardants with a foam blowing agent comprising 2,4,4,4-tetrafluorobutene-1 wherein said polyurethane foam exhibits a k-factor at 50° F. when tested in accordance with ASTM C518 ranging from an initial, k-factor of 0.1347 Btu·in./ft2·h·° F. to a k-factor of 0.1526 Btu·in./ft2·h·° F. upon aging said foam for 120 days.
US Pat. No. 10,112,021


OptiNose AS, Oslo (NO)

1. A method of delivering a protein formulation to the upper posterior region of a nasal cavity of a subject for uptake into the central nervous system (CNS) of the subject, the method comprising the steps of:delivering the formulation through a nozzle of a nosepiece of a delivery device into the nasal cavity of the subject to provide for uptake of the protein to the CNS without triggering an immune response; and
the subject exhaling through a mouthpiece unit to cause closure of the oropharyngeal velum of the subject;
wherein air exhaled from an exhalation breath is delivered through the nosepiece to entrain the protein formulation as delivered from the nozzle; and
wherein the nosepiece includes a coating which prevents the accumulation of endotoxins thereon.
US Pat. No. 10,113,048


1. An element for electronics comprising a polymer-ceramic composite comprising grains of titanium suboxides of general formulation TiOx in which x is between 1.00 and 1.99, limits included, and/or grains of barium and/or strontium titanate suboxides of general formulation Ba(1-m)SrmTiOy in which y is greater than or equal to 1.50 and less than 2.90, and m is between 0 and 1, limits included, wherein said element is a passive element for electronics that is a shield for attenuation of electromagnetic waves.
US Pat. No. 10,113,050


Evonik Roehm GmbH, Darms...

1. A powdery or granulated composition, comprising at least 30% by weight of a mixture comprising:(a) a copolymer comprising, in polymerized form, a C1- to C4-alkyl ester of acrylic or methacrylic acid and an alkyl(meth)acrylate monomer comprising a tertiary amino group in an alkyl radical;
(b) 0.5 to 10% by weight based on (a) of a dicarboxylic acid comprising 4 to 10carbon atoms; and
(c) 5 to 20% by weight based on (a) of a linear, saturated fatty monocarboxylic acid comprising 8 to 18 carbon atoms;
a molar ratio of the dicarboxylic acid to the tertiary amino groups of copolymer (a) is from 0.8/100 to 17/100,
a molar ratio of the fatty monocarboxylic acid to the tertiary amino groups of copolymer (a) is from 5/100 to 45/100, and
a dispersion or solution preparation time of the composition is less than 3 hours.
US Pat. No. 10,111,770


Ethicon Endo-Surgery, Inc...

1. A medical device, comprising:a pump configured to be applied to an exterior skin surface of a patient at a depot of brown adipose tissue and in communication with a receptor in communication with at least a portion of the depot of brown adipose tissue,
wherein the pump has an on-board supply of a chemical, and the pump applied to the exterior skin surface delivers the chemical to the patient to activate the brown adipose tissue and increase energy expenditure of the brown adipose tissue, wherein the delivered chemical is configured to chemically interact with cellular surface receptors of the brown adipose tissue, and the chemical comprises one of a depolarization agent, a hormone-related chemical, an odiferous agent, a Melanocortin receptor 4 (MCR4) protein agonist, a TRPA1 agonist, and a TRPV1 agonist.
US Pat. No. 10,113,054



1. A molded article comprising a polyamide resin composition comprising a polyamide resin and at least one alkali metal and/or alkaline earth metal element mixed therein, wherein(the average concentration of alkali metal and/or alkaline earth metal elements in a region within a depth of 3 ?m from the surface of the polyamide resin composition of the molded article)/(the average concentration of alkali metal and/or alkaline earth metal elements in a region of the polyamide resin composition of the molded article except for the region within a depth of 3 ?m from the surface of the polyamide resin composition of the molded article)>2.
US Pat. No. 10,113,055



1. An article comprising a composition,wherein the article is selected from the group consisting of fan blades, battery parts for hybrid and electric vehicles, parts for automotive kinetic energy recovery systems, and electric vehicle junction boxes;
wherein the composition comprises
40 to 75 weight percent of a poly(phenylene ether)-polysiloxane block copolymer reaction product comprising a poly(phenylene ether)-polysiloxane block copolymer and a first poly(phenylene ether);
10 to 25 weight percent of a flame retardant comprising an organophosphate ester; and
15 to 30 weight percent of a reinforcing filler;wherein all weight percent values are based on the total weight of the composition; andwherein the composition comprises less than 1 weight percent of a polyamide.
US Pat. No. 10,113,056


LG CHEM, LTD., Seoul (KR...

1. A composite obtained by processing a resin composition comprising a thermoplastic resin, multi-walled carbon nanotubes, and a reinforcing material,wherein the average diameter of the multi-walled carbon nanotubes is 10 nm-30 nm, walls of the multi-walled carbon nanotubes have 10-50 layers of graphene, an Id/Ig of the multi-walled carbon nanotubes is 0.6-1.0, and
the rate of residual length of the multi-walled carbon nanotubes present in the composite is 40%-99%, the rate of residual length being defined by Equation 1:
Rate of residual length (%)=(Content of ?500 nm long multi-walled carbon nanotubes in the composite)/(Content of all multi-walled carbon nanotubes in the composite)×100.
US Pat. No. 10,111,776


1. A method of providing intraocular delivery of an active agent in an eye, comprising:providing an implantable scaffold, wherein the scaffold comprises an interior reservoir and is formed from a flexible material, wherein the scaffold comprises a mechanical scaffold in the shape of a closed ring;
associating the active agent with the scaffold;
performing an intraocular implantation of the scaffold and the active agent;
positioning an external reservoir configured to be positioned outside of the eye when the scaffold is intraocularly implanted, wherein the external reservoir is separate from the scaffold and comprises an injection port;
fluidly connecting the external reservoir to the interior reservoir via a tube;
delivering the active agent from the scaffold following the intraocular implantation; and
refilling the interior reservoir with the active agent via the injection port of the external reservoir after the intraocular implantation.
US Pat. No. 10,113,058


Braskem America, Inc., P...

1. A polymer composition, comprising:from about 50 weight percent (wt. %) to about 95 wt. % of a matrix phase comprising a polypropylene polymer comprising from 0 to 7 mole percent (mol. %) of units derived from ethylene, a C4-C10 alpha olefin or combinations thereof;
from about 5 wt. % to about 50 wt. % of a dispersed phase being a propylene/alpha olefin copolymer having from 10 mol. % to 70 mol. % of units derived from ethylene or a C4-C10 alpha olefin or combinations thereof,
wherein the weight percentages of the matrix phase and the dispersed phase are based on the total weight of the matrix phase and the dispersed phase, and
the polymer composition satisfies the following inequality:
y?55x ?8, wherein x is a ratio of Mw solubles/Mw insolubles and is less than or equal to 0.85, Mw solubles is weight average molecular weight of a soluble fraction of the polymer composition in xylene at 25° C. following ASTM D5492, Mw insoluble is weight average molecular weight of an insoluble fraction of the polymer composition in xylene at 25° C. following ASTM D5492, and y is the haze value being measured on a 0.508 millimeter (20 mil) thick injection molded plaque according to ASTM D1003; and
wherein the matrix phase has a melt flow rate of from about 0.1 dg/min. to about 10 dg/min.; and the dispersed phase has a melt flow rate of from about 1 dg/min. to about 200 dg/min., being measured using a load of 2.16 kg at 230 ° C. following ASTM D 1238.
US Pat. No. 10,113,059



1. A composite powder comprising:a core particle comprising a styrene/acrylate polymer resin and optionally a first metal ion acrylate monomer; and
a shell comprising a styrene/acrylate ionomer resin, wherein the styrene/acrylate ionomer resin comprises a second metal ion acrylate monomer;
wherein the total amount of metal presented in the composite powder ranges in a concentration of from about 0.5 ppm to about 50,000 ppm; and further wherein the composite powder has a particle size of from about 10 microns to about 300 microns.
US Pat. No. 10,113,060


CJ Cheiljedang Corporatio...

1. A composition, comprising a biodegradable branched polymer blend formed by reactive blending of:a. polylactic acid (PLA); and
b. a biodegradable polyhydroxyalkanoate (PHA) polymer having a glass transition temperature (Tg) of between ?5° C. and ?50° C. and a weight average molecular weight from 500,000 Daltons to 2,000,000 Daltons, wherein the PHA polymer is a copolymer of:
3-hydroxybutyrate and 4-hydroxybutyrate, wherein the content of 4-hydroxybutyrate in the PHA polymer is from about 25% to about 85% by weight of the PHA polymer;
wherein the copolymer of 3-hydroxybutyrate and 4-hydroxybutyrate is the sole PHA polymer in the polymer blend,
wherein the content of the PHA polymer in the biodegradable branched polymer blend is between about 3% and about 40% by weight of the blend, and
wherein the renewable carbon content of the biodegradable branched polymer blend is at least 95% by weight of the blend,
wherein the biodegradable branched polymer blend was formed by reactive blending of the PLA and the PHA polymer with a branching agent.
US Pat. No. 10,113,061


Sumitomo Seika Chemicals ...

1. A polyester resin composition comprising:a polyester resin; and
a polyrotaxane that has a cyclic molecule, a linear molecule threading through a cavity of the cyclic molecule in a skewered manner, and capping groups capping both ends of the linear molecule,
wherein a polycaprolactone chain is introduced to the cyclic molecule,
the polycaprolactone chain has a carboxyl group as a substituent at its terminal, and
the polyrotaxane contains polyethylene glycol as the linear molecule and a molecule derived from ?-cyclodextrin as the cyclic molecule.
US Pat. No. 10,113,062



1. A process for forming a polymeric composition comprising:contacting a polylactic acid with a reactive modifier selected from epoxy-functionalized polybutadiene, ionic monomer, and combinations thereof; and
contacting the polylactic acid and the reactive modifier with a polyolefin to produce a polyolefin-polylactic acid blend, wherein the polyolefin exhibits a melt flow rate of less than about 6 dg/min.
US Pat. No. 10,114,344



1. An electronic device, comprising:an electronic storage medium;
a display configured to display at least a state of the electronic storage medium;
a communication circuit; and
a control circuit configured to
keep time in the electronic device,
establish first wireless communication with an external device via the communication circuit;
provide, through the first wireless communication via the communication circuit, parameters for second wireless communication via the communication circuit;
establish the second wireless communication with the external device via the communication circuit based on the parameters,
receive time information, via the second wireless communication, from the external device, and
update the time kept in the electronic device in accordance with the time information received from the external device,
wherein the time kept in the electronic device is settable via a time setting manipulation.
US Pat. No. 10,113,063



1. A composition comprising:A) 50 to 95 parts by weight of at least one polymer selected from the group consisting of aromatic polycarbonate and aromatic polyestercarbonate,
B) 5 to 50 parts by weight of at least one branched polyester, the polyester being derived from succinic acid and butanediol,
C) 0 to 20 parts by weight of graft polymer,
D) 0 to 20 parts by weight of vinyl (co)polymer and/or polyalkylene terephthalate,
E) 0 to 30 parts by weight of additives, the parts by weight being standardized to the total weight of the composition;
wherein the weight-average molecular weights Mw of component B are between 80 and 500 kg/mol, determined by gel permeation chromatography against polystyrene as reference.
US Pat. No. 10,113,064


STRATASYS LTD., Rehovot ...

1. A material composition for three-dimensional inkjet printing comprising:polyethylene glycol (PEG) having a molecular weight between about 1000 and about 6000; and
dimethyl hexanediol, wherein the composition has a melting point between 70° C.-85° C. and solidifies upon cooling.
US Pat. No. 10,113,066



1. A curable composition, comprising:a photobase generator;
an epoxy group-containing (meth)acrylate compound;
a photopolymerization initiator; and
a thermosetting component other than the epoxy group-containing (meth)acrylate compound,
wherein the epoxy group-containing (meth)acrylate compound is a low-molecular-weight material that is a monomer or an oligomer and having a molecular weight in a range of 100 to 1,000, the photobase generator is in an amount of from 0.1 to 40 parts by mass with respect to 100 parts by mass of the thermosetting component and generates a catalyst for addition reaction between the epoxy group-containing (meth)acrylate compound and the thermosetting component by photoirradiation, and the thermosetting component is in an amount of 1 to 30 parts by mass with respect to 100 parts by mass of the curable composition.
US Pat. No. 10,113,067



1. A hydrophobic coating material which comprises an acid catalyzed condensation reaction product comprised of:an organic polymeric silane selected from the group consisting of polycaprolactone polyols having 2 to 4 hydroxyl groups reacted with an isocyanate-terminated silane and polyurea silanes;
an inorganic metal alkoxide; and
a fluorinated silane.
US Pat. No. 10,113,068


AGC INC., Chiyoda-ku (JP...

1. A powder primer composition comprising:a powder made of a reactive ethylene/tetrafluoroethylene copolymer containing repeating units (A) based on tetrafluoroethylene, repeating units (B) based on ethylene, and repeating units (C) based on a monomer having an acid anhydride residue and a polymerizable unsaturated bond, wherein a ratio (C)/((A)+(B)) is from 1/10,000 to 5/100 by molar ratio; and
a powder made of an epoxy resin having an epoxy equivalent of from 500 to 2,700 and a softening point of at least 70° C.;
wherein a mass ratio of the powder made of a reactive ethylene/tetrafluoroethylene copolymer to the powder made of an epoxy resin is from 99/1 to 80/20,
wherein an average particle size of the powder made of a reactive ethylene/tetrafluoroethylene copolymer is from 1 to 1,000 ?m, an average particle size of the powder made of the an epoxy resin is from 1 to 1,000 ?m, and a ratio of the average particle size of the powder made of the epoxy resin to the average particle size of the reactive ethylene/tetrafluoroethylene copolymer is from 0.575 to 2.30,
wherein the powder primer composition is prepared by dry blending component powders, and
wherein no formation of nodules is observed in the powder primer composition.
US Pat. No. 10,113,069


AGC INC., Chiyoda-ku (JP...

1. A coated article comprising:a substrate: and
a cured film of a powder coating material formed on the substrate, the powder coating material comprising a fluorinated polymer (A), a polyester polymer (B), an ultraviolet absorber (D) and titanium oxide (E), wherein
the thickness of the cured film is from 20 to 1,000 ?m,
the atom number concentration of Ti element in region (I) within 5 ?m in depth from a surface of the cured film is from 0 to 7.5% as obtained by method (1), with respect to 100% of the total of the atom number concentrations of C element, O element, F element and Ti element present in region (I),
the atom number concentration of Ti element in region (II) beyond 10 ?m in depth from the surface of the cured film is from 8.5 to 15% as obtained by method (2), with respect to 100% of the total of the atom number concentrations of C element, O element, F element and Ti element present in region (II), and
the proportion of the ultraviolet absorber (D) contained in region (I) (100 mass %) as obtained by method (3) is from 0.5 to 10 mass %:
method (1):
by observing a cross section of the cured film by a scanning electron microscope equipped with an energy dispersive X-ray analyzer, the respective atom number concentrations of C element, O element, F element and Ti element present in region (I) are analyzed by the energy dispersive X-ray analyzer, to determine the atom number concentration of Ti element, when the total of the respective atom number concentrations of C element, O element, F element and Ti element is set to be 100%,
method (2):
by observing a cross section of the cured film by a scanning electron microscope equipped with an energy dispersive X-ray analyzer, with respect to region (II-1) in a case where the thickness of the cured film is at least 20 ?m and less than 30 ?m, regions (II-1) to (II-2) in a case where the thickness of the cured film is at least 30 ?m and less than 40 ?m, regions (II-1) to (II-3) in a case where the thickness of the cured film is at least 40 ?m and less than 50 ?m, regions (II-1) to (II-4) in a case where the thickness of the cured film is at least 50 ?m and less than 60 ?m, regions (II-1) to (II-5) in a case where the thickness of the cured film is at least 60 ?m, the respective atom number concentrations of C element, O element, F element and Ti element present in the respective regions are analyzed by the energy dispersive X-ray analyzer, to determine the atom number concentration of Ti element, when the total of the respective atom number concentrations of C element, O element, F element and Ti element is set to be 100%, in each region, whereupon the atom number concentrations of Ti element in the respective regions are summed up and divided by the number of regions to obtain an average value,
region (II-1): a region beyond 10 ?m and at most 20 ?m in depth from the surface of the cured film,
region (II-2 ): a region beyond 20 ?m and at most 30 ?m in depth from the surface of the cured film,
region (II-3): a region beyond 30 ?m and at most 40 ?m in depth from the surface of the cured film,
region (II-4): a region beyond 40 ?m and at most 50 ?m in depth from the surface of the cured film,
region (II-5): a region beyond 50 ?m and at most 60 ?m in depth from the surface of the cured film,
method (3):
a powder obtained by scraping off region (I) with a cutter is subjected to high performance liquid chromatography analysis, whereby the amount of the ultraviolet absorber (D) per unit mass in the powder is obtained from a peak derived from the ultraviolet absorber (D) by using a calibration curve prepared beforehand.
US Pat. No. 10,113,071



1. A liquid intumescent coating composition comprising:(a) 25.0-75.0 volume % of one or more organic thermosetting polymer(s) and one or more curing agent(s) for the organic thermosetting polymer(s), and
(b) 5.0-25.0 volume % of a source of phosphoric or sulphonic acid selected from one or more of sodium, potassium or ammonium phosphate or sulphate salts, and para-toluene sulphonic acid,
(c) 10.0-50.0 volume % of a source of boric acid selected from one or more of boric acid, borate salts, and borosilicates,
(d) 0 volume % of melamine or melamine derivatives, and
(e) 0 volume % of one or more isocyanurate derivatives,
wherein the organic thermosetting polymers do not comprise a polysiloxane, and wherein volume % is calculated on the total volume of the non-volatile components in the coating composition.
US Pat. No. 10,113,076



1. An ink composition useful for variable data digital lithographic printing, comprising:an acrylate ink base formulation comprising:
a) a color pigment component,
b) at least one of an acrylate monomer, oligomer or polymer, or a mixture thereof, forming a continuous acrylate phase, and
c) a free radical photoinitiator component comprising at least one of a type I photoinitiator and a type II photoinitiator; and
an aqueous solution consisting of water and a single surfactant in an amount of from about 1.0 ppm to about 2.0 ppm, wherein the aqueous solution is dispersed in the continuous acrylate phase of the acrylate ink base to provide an inverse emulsion ink composition having a viscosity in the range of from about 1E+05 centipoise to about 1E+06 centipoise at a temperature of from about 20 degrees Celsius to about 50 degrees Celsius,
wherein the surfactant lowers a surface tension of the water to below a surface tension of the acrylate ink base formulation, and
wherein the at least one of the acrylate monomer, oligomer or polymer, or a mixture thereof comprises a high-viscosity, di-functional acrylated polyester oligomer.