US Pat. No. 10,190,116

MODULATION OF EXON RECOGNITION IN PRE-MRNA BY INTERFERING WITH THE SECONDARY RNA STRUCTURE

ACADEMISCH ZIEKENHUIS LEI...

1. A method for inducing the skipping of exon 51 of the human dystrophin pre-mRNA in a patient or cell derived from the patient, said method comprising providing to said patient or said cell, an oligonucleotide of 15 to 24 nucleotides in length comprising at least 15 consecutive bases of a base sequence of the sequence UCAAGGAAGAUGGCAUUUCU (SEQ ID NO: 27), wherein said oligonucleotide induces exon 51 skipping in the human dystrophin pre-mRNA in the patient or a cell derived from the patient.
US Pat. No. 10,188,066

MAIZE HYBRID X03M280

PIONEER HI-BRED INTERNATI...

1. A seed of hybrid maize variety X03M280, representative seed produced by crossing a first plant of variety PH42YG with a second plant of variety PH2DPY, wherein representative seed of the varieties PH42YG and PH2DPY have been deposited under ATCC Accession Numbers PTA-124780 and PTA-124001, respectively.
US Pat. No. 10,188,067

MAIZE HYBRID X08M611

PIONEER HI-BRED INTERNATI...

1. A seed of hybrid maize variety X08M611, representative seed produced by crossing a first plant of variety PH41R5 with a second plant of variety PH4257, wherein representative seed of the varieties PH41R5 and PH4257 have been deposited under ATCC Accession Numbers PTA-124793 and PTA-124803, respectively.
US Pat. No. 10,189,606

DRINKING OR EATING VESSEL

AT Promotions LTD, Kings...

1. A drinking or eating vessel comprising an inner surface that defines a volume for receiving liquid or solid food and an outer surface that supports a polymeric coating and a decorative layer,wherein the polymeric coating comprises a polymer formed by curing a coating mixture on the outer surface of the drinking or eating vessel, said coating mixture comprising a matting agent,
the polymeric coating has an inner surface in contact with the drinking or eating vessel and an outer surface in contact with the decorative layer, and
the decorative layer comprises a dry toner image applied to the outer surface of the polymeric coating.
US Pat. No. 10,188,072

SOYBEAN VARIETY 01064694

Monsanto Technology LLc, ...

1. A plant of soybean variety 01064694, wherein representative seed of said soybean variety have been deposited under ATCC Accession No. PTA-124971.
US Pat. No. 10,188,074

SOYBEAN VARIETY 5PKCF87

PIONEER HI-BRED INTERNATI...

1. A plant or a seed of soybean variety 5PKCF87, representative seed of the variety having been deposited under ATCC Accession Number PTA-125527.
US Pat. No. 10,188,075

SOYBEAN VARIETY 5PKDS07

PIONEER HI-BRED INTERNATI...

1. A plant or a seed of soybean variety 5PKDS07, representative seed of the variety having been deposited under ATCC Accession Number PTA-125528.
US Pat. No. 10,190,126

TRANSGENIC PLANTS WITH MODIFIED SUGAR CONTENT AND METHODS OF GENERATING SAME

A.B. Seeds Ltd., (IL)

1. A method of increasing the sucrose level or increasing the sucrose to glucose ratio in a tomato plant comprising expressing in said tomato planta DNA encoding a miR397-, miR528-, or miR1110-resistant target gene, wherein said miR397-, miR528-, or miR1110-resistant target gene comprises an introduced silent mutation in a nucleotide sequence that is otherwise substantially identical to the nucleotide sequence of an endogenous gene that is natively regulated by miR397, miR528, or miR1110, and wherein said silent mutation prevents binding by a mature miR397, miR528, or miR1110 to a transcript of said miR397-, miR528-, or miR1110-resistant target gene,
wherein the sucrose level or the sucrose-to-glucose ratio is increased in said tomato plant.
US Pat. No. 10,189,871

TRANSITION METAL COMPLEXES FOR ENANTIOSELECTIVE CATALYSIS OF CARBON-CARBON, CARBON-HETEROATOM, AND CARBON-HYDROGEN BOND FORMING REACTIONS

1. A compound, comprising a transition metal complex having the formula ?-[M ((x,y)-L1)3?b?c((w,v)-L2)b((t,u)-L3)c]p+An?m,Z?p?m, wherein ? is ? or ?, wherein M is a transition metal, wherein p is an integer corresponding to the oxidation state of M, wherein each of x, y, w, v, t, and u independently comprises one of R and S, wherein each of L1 and L2 independently is a ligand comprising ethylene diamine, wherein L3 is EN(CH2)nNR1R2, wherein EN represents ethylene diamine, wherein n is from 2 to 4, and wherein R1 and R2 are independently H or alkyl groups, wherein c is from 1 to 3, wherein b is from 0 to 2, wherein An? comprises a lipophilic anion, wherein m is from 1 to 3, and wherein Z? comprises a second anion.
US Pat. No. 10,190,129

INCREASING LEVELS OF NICOTINIC ALKALOIDS IN PLANTS

22nd Century Limited, LLC...

1. A method for increasing nicotine and yield in a Nicotiana plant, comprising:(a) crossing an increased nicotine Nicotiana plant that expresses heterologous NBB1 having the amino acid sequence set forth in SEQ ID NO: 2 and A622 having the amino acid sequence set forth in SEQ ID NO: 4 with a high yielding Nicotiana plant; and
(b) selecting progeny plant with increased nicotine and high yield, wherein the plant has an increased nicotine content and yield relative to a non-transformed control plant.
US Pat. No. 10,190,132

RECOMBINANT INFLUENZA VIRUS-LIKE PARTICLES (VLPS) PRODUCED IN TRANSGENIC PLANTS EXPRESSING HEMAGGLUTININ

MEDICAGO INC., Quebec (C...

1. A method of producing an influenza virus like particle (VLP) in a plant comprising:a) introducing a nucleic acid comprising a nucleotide sequence encoding an influenza hemagglutinin (HA) into a plant, or portion of a plant, the HA being operatively linked to a regulatory element that is operative in a plant and wherein the regulatory element comprises a Cowpea Mosaic Virus (CPMV) regulatory region, and
b) incubating the plant or portion of the plant under conditions that permit the expression of the nucleic acid, thereby producing the VLP.
US Pat. No. 10,190,133

COMPOSITIONS AND METHODS FOR IMPROVING ABIOTIC STRESS TOLERANCE

China Agricultural Univer...

1. A recombinant nucleic acid, comprising:(a) the nucleotide sequence SEQ ID NO:1; or
(b) a nucleotide sequence that encodes a polypeptide comprising the amino acid sequence SEQ ID NO:28,
wherein each of the nucleotide sequences of (a) and (b) is operably linked to a heterologous promoter.
US Pat. No. 10,190,649

FRICTION MATERIAL

AKEBONO BRAKE INDUSTRY CO...

1. A friction material comprising:a fiber base material;
a friction modifier; and
a binder,
wherein a content of copper is 0.5% by mass or less in terms of copper element,
wherein a content of the binder is 10% by mass or more,
wherein the friction material contains calcium hydroxide and zinc,
wherein the friction material has pH of 113 or more,
wherein a content of the zinc is from 1% by mass to 5% by mass,
wherein the zinc comprises a powder having an average particle diameter in a range of 1 ?m to 10 ?m,
wherein the calcium hydroxide comprises powder having an average particle diameter in a range of 5 ?m to 50 ?m,
wherein the fiber base material comprises a bio-soluble inorganic fiber, and
wherein the binder consists of at least one selected from the group consisting of an acrylic rubber-modified phenol resin, a silicone rubber-modified phenol resin, an NBR rubber-modified phenol resin, a cashew-modified phenol resin, an epoxy-modified phenol resin and an alkylbenzene-modified phenol resin.
US Pat. No. 10,189,881

MPS PEPTIDES AND USE THEREOF

The Regents of the Univer...

1. A method for one or more of: reducing, delaying, inhibiting or suppressing solid tumor cell growth or metastasis; promoting apoptosis; inhibiting cancer stem cell growth; inhibiting the PIP3 level in a tumor cell; or suppressing tumor cell mobility, the method comprising contacting the cell or tissue to be treated in vivo with an effective amount of an isolated polypeptide comprising no more than 51 amino acids, wherein the amino acid sequence comprises:XXXRYSYXXSYX (SEQ ID NO: 1) and optionally, wherein one or more serines has been substituted with a neutral or positively charged amino acid, wherein each X is a lysine and wherein each Y is a phenylalanine; or
XXXXXRYSYXXSYXLSGYSYXXNXX (SEQ ID NO: 5), and optionally a polypeptide comprising any contiguous 12 amino acid fragment thereof, and/or optionally, wherein one or more serines has been substituted with a neutral or positively charged amino acid and wherein each X is a lysine and wherein each Y is a phenylalanine.
US Pat. No. 10,190,139

METHOD FOR LACTIC ACID PRODUCTION USING MONASCUS STRAINS MODIFIED FOR LACTIC ACID PRODUCTION

1. A method of producing a composition comprising lactic acid, the method comprising:(i) providing a Monascus micro-organism that is tolerant to organic acid at a concentration of at least 50 g/L and a pH of less than 5.0 and has been genetically modified for increased production of a lactic acid by the introduction of an exogenous lactate dehydrogenase (LDH) gene; and
(ii) culturing the micro-organism in a medium having a pH less than 1.5 units above the pKa value of lactic acid in the presence of hexose, pentose, or a combination thereof, as the sole carbon source.
US Pat. No. 10,188,607

PHARMACEUTICAL FORMULATION OF RACECADOTRIL

Rivopharm SA, Manno, Lug...

1. A method of dry granulating racecadotril in the presence of a diluent and a disintegrant, the diluent being lactose monohydrate, said method being carried out by means of a dry granulation technique by operatinga compaction step with a compaction strength of less than 30 kN and equal to or greater than 4 kN, and
a step of grinding and calibration of the slugs and/or ribbon so as to obtain a granulate in which not more than 50% by weight of the product has a particle size of less than 90 microns.
US Pat. No. 10,190,402

CONTROLLING A BOTTOM-HOLE ASSEMBLY IN A WELLBORE

Halliburton Energy Servic...

1. A computer-implemented method of controlling a bottom hole assembly (BHA), the method comprising:determining, by a wellbore controller, a first candidate BHA control signal;
generating, by the wellbore controller, an input to a BHA control, the input comprising a perturbation signal superimposed on the first candidate BHA control signal;
controlling, by the wellbore controller, the BHA using the input to the BHA control;
determining, by the wellbore controller, a change in an objective value as a function of the perturbation signal, based on a received downhole sensor measurement; and
generating, by the wellbore controller and based on the change in the objective value, a second candidate BHA control signal.
US Pat. No. 10,188,115

PROTEINS TOXIC TO HEMIPTERAN INSECT SPECIES

Monsanto Technology LLC, ...

1. An insect inhibitory recombinant polypeptide comprising the amino acid sequence as set forth in SEQ ID NO: 36.
US Pat. No. 10,189,911

INNOVATIVE DISCOVERY OF THERAPEUTIC, DIAGNOSTIC, AND ANTIBODY COMPOSITIONS RELATED TO PROTEIN FRAGMENTS OF VALYL-TRNA SYNTHETASES

aTyr Pharma, Inc., San D...

1. A therapeutic composition for detecting or modulating a biological activity of a splice variant polypeptide, comprising a pharmaceutically-acceptable carrier and an antibody or antigen-binding fragment thereof that exhibits binding specificity for an isolated aminoacyl-tRNA synthetase (AARS) splice variant polypeptide that consists of SEQ ID NO: 14, 74, 76, or 78 or an epitope comprising at least 5 amino acids selected from SEQ ID NOs: 55, 57, 69, 182, 194, and 196, wherein the composition has a purity of at least about 90% on a protein basis and less than about 10 EU endotoxin/mg protein.
US Pat. No. 10,189,912

CARRIER IMMUNOGLOBULINS

AMGEN INC., Thousand Oak...

1. An isolated antigen binding protein comprising an immunoglobulin heavy chain variable region and an immunoglobulin light chain variable region, wherein the heavy chain variable region comprises three complementarity determining regions (CDRs) designated CDRH1, CDRH2 and CDRH3, and the light chain variable region comprises three CDRs designated CDRL1, CDRL2 and CDRL3, wherein:(a) CDRH1 comprises the amino acid sequence of SEQ ID NO: 190;
(b) CDRH2 comprises the amino acid sequence of SEQ ID NO: 194;
(c) CDRH3 comprises the amino acid sequence of SEQ ID NO: 200;
(d) CDRL1 comprises the amino acid sequence of SEQ ID NO:204;
(e) CDRL2 comprises the amino acid sequence of SEQ ID NO:206; and
(f) CDRL3 comprises the amino acid sequence of SEQ ID NO:210.
US Pat. No. 10,190,168

METHOD FOR PREDICTING A TREATMENT RESPONSE TO A CRHR1 ANTAGONIST AND/OR A V1B ANTAGONIST IN A PATIENT WITH DEPRESSIVE AND/OR ANXIETY SYMPTOMS

1. A method of treating a human patient with unipolar or bipolar depression comprisingadministering an effective amount of a V1B receptor antagonist and/or CRHR1 antagonist to the patient in need thereof,
wherein the patient's genome has a polymorphic variant in the AVPR1B gene, the polymorphic variant is SNP rs28373064 which is represented by a single polymorphic change at position 27 of SEQ ID NO: 1, wherein in one or two alleles of the wild-type nucleotide A is replaced by indicator nucleotide G, and
wherein the patient's genome excluding the AVPR1B gene has at least one polymorphic variant selected from the group of biomarkers consisting of:
SNP rs9880583 which is represented by a single polymorphic change at position 27 of SEQ ID NO: 2, wherein in one or two alleles the wild-type nucleotide C is replaced by indicator nucleotide G,
SNP rs13099050 which is represented by a single polymorphic change at position 27 of SEQ ID NO: 3, wherein in one or two alleles the wild-type nucleotide A is replaced by indicator nucleotide C,
SNP rs7441352 which is represented by a single polymorphic change at position 27 of SEQ ID NO: 4, wherein in one or two alleles the wild-type nucleotide A is replaced by indicator nucleotide G,
SNP rs730258 which is represented by a single polymorphic change at position 27 of SEQ ID NO: 5, wherein in one or two alleles the wild-type nucleotide C is replaced by indicator nucleotide T,
SNP rs12654236 which is represented by a single polymorphic change at position 27 of SEQ ID NO: 6, wherein in one or two alleles the wild-type nucleotide A is replaced by indicator nucleotide G,
SNP rs17091872 which is represented by a single polymorphic change at position 27 of SEQ ID NO: 7, wherein in one or two alleles the wild-type nucleotide A is replaced by indicator nucleotide G,
SNP rs12254219 which is represented by a single polymorphic change at position 27 of SEQ ID NO: 8, wherein in one or two alleles the wild-type nucleotide C is replaced by indicator nucleotide T,
SNP rs11575663 which is represented by a single polymorphic change at position 27 of SEQ ID NO: 9, wherein in one or two alleles the wild-type nucleotide A is replaced by indicator nucleotide G,
SNP rs7080276 which is represented by a single polymorphic change at position 27 of SEQ ID NO: 10, wherein in one or two alleles the wild-type nucleotide A is replaced by indicator nucleotide G,
SNP rs7416 which is represented by a single polymorphic change at position 27 of SEQ ID NO: 11, wherein in one or two alleles the wild-type nucleotide A is replaced by indicator nucleotide G,
SNP rs12424513 which is represented by a single polymorphic change at position 27 of SEQ ID NO: 12, wherein in one or two alleles the wild-type nucleotide C is replaced by indicator nucleotide T,
SNP rs1035050 which is represented by a single polymorphic change at position 27 of SEQ ID NO: 13, wherein in one or two alleles the wild-type nucleotide C is replaced by indicator nucleotide T,
SNP rs9959162 which is represented by a single polymorphic change at position 27 of SEQ ID NO: 14, wherein in one or two alleles the wild-type nucleotide A is replaced by indicator nucleotide C, and
SNP rs8088242 which is represented by a single polymorphic change at position 27 of SEQ ID NO: 15, wherein in one or two alleles the wild-type nucleotide A is replaced by indicator nucleotide G.
US Pat. No. 10,189,914

COUPLED DIENE ELASTOMER HAVING A SILANOL FUNCTION IN THE MIDDLE OF THE CHAIN AND HAVING AN AMINE FUNCTION AT THE CHAIN END, AND RUBBER COMPOSITION COMPRISING SAME

COMPAGNIE GENERALE DES ET...

1. A modified diene elastomer comprising: from 80% to 100% by weight, with respect to the modified diene elastomer, of an entity functionalized in the middle of the chain by a silanol group, the silicon atom of which bonds the two pieces of the chain, the chain ends of the modified diene elastomer being functionalized to at least 70 mol %, with respect to the number of moles of chain end, by an amine functional group, and an overall content of Si functional group T, which is the ratio Ns/Np, in which Ns represents the number of moles of silicon bonded to the coupled polymer, determined by 1H nuclear magnetic resonance NMR and expressed in mmol/kg, and Np represents the number of mmoles of polymer before coupling per kilogram of polymer, ranging from 0.36 to 0.60, a content of silanol (SiOH) functional group in the middle of the chain T1 which is the ratio corresponding to the number of moles of SiOH functional groups to the number of moles of silicon (Si), determined by 1H-29Si 2D nuclear magnetic resonance NMR, ranging from 80 to 100% and a monomodal distribution of the number-average molecular weights of the coupled polymer chains.
US Pat. No. 10,188,123

METHODS OF MAKING REDUCED SODIUM FOOD PRODUCTS FORMED OF POTASSIUM-CONTAINING EMULSIFYING SALT MIXTURES

1. A method of preparing a dairy product comprising:combining a dairy ingredient with an emulsifying salt mixture of one or more of liquid sodium potassium hydrogen phosphate or liquid sodium dipotassium phosphate to form the dairy product,
wherein the liquid sodium potassium hydrogen phosphate, the liquid sodium dipotassium phosphate or a combination thereof accounts for at least 50 percent of the emulsifying salt mixture, and
wherein any sodium hydroxide in the emulsifying salt mixture is less than 0.05 percent by weight of the emulsifying salt mixture.
US Pat. No. 10,188,125

COFFEE CONCENTRATE COMPOSITION

KAO CORPORATION, Tokyo (...

1. A concentrated coffee composition, comprising:components (A), (B) and (C);
(A) at least one chlorogenic acid,
(B) total sugar, and
(C) caffeine,
wherein a mass ratio of the component (A) and the component (B), [(B)/(A)], is from 2.9 to 5,
wherein a mass ratio of the component (A) and the component (C), [(C)/(A)], is 0.17 or less, and
wherein a (F) Brix value of the concentrated coffee composition is 5% or more.

US Pat. No. 10,194,429

MOBILE STATION APPARATUS THAT CONTROLS AN UPLINK TRANSMISSION, AND A METHOD FOR CONTROLLING AN UPLINK TRANSMISSION

SHARP KABUSHIKI KAISHA, ...

1. A mobile station apparatus comprising:a memory and a processor in electrical communication with the memory, the processor executing instructions stored in the memory to:
configure a first timer related to a first group and a second timer related to a second group, wherein a first group of one or more cells uses a first uplink transmission timing, the one or more cells includes a primary cell, and a second group of one or more secondary cells uses a second uplink transmission timing,
in a case where the first timer for the first group is expired, consider the second timer is expired, and stop an uplink transmission on any cells except random access preamble transmission on the primary cell; and
in a case where the second timer for the second group expired, stop uplink transmission on any cells in the second group except random access preamble transmission on the any cells in the second group.

US Pat. No. 10,194,428

TERMINAL, BASE STATION, TRANSMISSION METHOD, AND RECEPTION METHOD

Panasonic Intellectual Pr...

1. A terminal comprising:a receiver, which, in operation, receives repetitions of a control signal across a plurality of first subframes and a data signal allocated to a resource indicated by the control signal;
a generator, which, in operation, performs repetition of a response signal for the data signal across a plurality of second subframes and generates a transmission signal by multiplying the response signals in the plurality of second subframes by respective components of an inter-subframe orthogonal code sequence which is associated with one of the plurality of first subframes, the inter-subframe orthogonal code sequence being one of a plurality of sequences which are orthogonal to one another; and
a transmitter, which, in operation, transmits the transmission signal.

US Pat. No. 10,194,397

POWER SUPPLY CONTROL METHOD AND WIRELESS TERMINAL

HUAWEI DEVICE CO., LTD., ...

1. A power supply control method, comprising:simultaneously performing discontinuous transmission (DTX) and discontinuous reception (DRX) by a wireless terminal, the DTX comprising a DTX dormant time period and a DTX awake time period, and the DRX comprising a DRX dormant time period and a DRX awake time period;
stop supplying power to at least some circuits of a radio frequency circuit in the wireless terminal in only a part of a time period during which the wireless terminal is in a dormant state, the dormant state comprising the wireless terminal being in both the DTX dormant time period and the DRX dormant time period, the DTX dormant time period comprising an entire DTX period, and the DRX dormant time period comprising a fraction of a DRX period; and
resume supplying power to the at least some circuits of the radio frequency circuit in the wireless terminal when the wireless terminal is in the DTX awake time period or the DRX awake time period.

US Pat. No. 10,194,393

MOBILE RADIO COMMUNICATIONS DEVICE, NETWORK DEVICE AND METHOD FOR EMPLOYING POWER SAVING MODE

NEC Corporation, Tokyo (...

1. A mobile radio communications device for communication with a mobile radio communications network, the mobile radio communications device comprising:a transmission and reception unit configured to send non-access stratum or access stratum signalling to the network, the non-access stratum or access stratum including a preference indication of a preference of the mobile radio communications device to use a plurality of possible power saving modes, and to receive a confirmation, returned by the network, of a selected power-saving mode of the plurality of power saving modes indicated by the preference indication, the confirmed selected power saving mode to be employed by the mobile radio communications device; and
a controller configured to initiate operation of the confirmed selected power saving mode.

US Pat. No. 10,194,385

DETERMINING MULTI-USER OR SINGLE USER TRANSMISSION FOR ACCESS POINT ACKNOWLEDGEMENT IN A MULTI-USER ENVIRONMENT

Marvell International Ltd...

1. An access point implemented for wireless communication, the access point comprising:a transmitter component configured to communicate transmissions to a plurality of station devices;
a receiver component configured to receive association requests from the plurality of station devices;
a management entity configured to:
communicate, via the transmitter component, a downlink multi-user transmission to a first station device and a second station device, the downlink multi-user transmission soliciting acknowledgement from the first station device and second station device;
receive, via the receiver component and in response to the downlink multi-user transmission, a first association request from the first station device and a second association request from the second station device;
determine a single user transmission mode for the first station device based on the first association request;
determine a multi-user transmission mode for the second station device based on the second association request;
communicate, in the single user transmission mode using a polled uplink single user sequential transmission mode, to the first station device; and
communicate, in the multi-user transmission mode using a polled uplink single user transmission mode with a multi-user block acknowledgment request, to the second station device, the multi-user block acknowledgement request being used to solicit acknowledgment in a form of an uplink orthogonal frequency-division multiple access message from the second station device.

US Pat. No. 10,194,371

COMMUNICATION APPARATUS AND CONTROL METHOD OF COMMUNICATION APPARATUS

CANON KABUSHIKI KAISHA, ...

1. A communication apparatus comprising:one or more processors; and
one or more memories including instructions that, when executed by the one or more processors, cause the apparatus to:
obtain, by a communication that conforms to a first communication scheme, execution information representing whether or not a first apparatus is executing a relay function that enables the communication apparatus to communicate with a second apparatus via the first apparatus;
request, by the communication that conforms to the first communication scheme, the first apparatus to start the relay function, in a case where the execution information represents that the first apparatus is not executing the relay function;
communicate with the second apparatus via the first apparatus, by performing a communication that conforms to a second communication scheme that is different from the first communication scheme with the first apparatus that is executing the relay function;
determine whether the first apparatus has been requested to start the relay function in a case where the communication with the second apparatus is terminated; and
request the first apparatus to stop the relay function in a case where it is determined that the first apparatus has been requested to start the relay function, and not request the first apparatus to stop the relay function in a case where it is determined that the first apparatus has not been requested to start the relay function.

US Pat. No. 10,194,365

SYSTEM AND METHOD FOR INTERFERENCE MANAGEMENT IN CELLULAR NETWORKS

Futurewei Technologies, I...

1. A method for operating a first network controller, the method comprising:transmitting, by the first network controller, at least one indicator to a served user equipment (UE), wherein the at least one indicator specifies a cell-specific reference signal (CRS) port count associated with CRS symbols transmitted by a second network controller and a CRS frequency shift of the CRS symbols transmitted by the second network controller.

US Pat. No. 10,194,363

DYNAMIC RADIO COVERAGE AREA TRANSITION MANAGEMENT

Kyocera Corporation, Kyo...

18. A method comprising:transmitting a cell state change request message from an energy saving communication station to a compensation communication station, the cell state change request message at least requesting deactivation of an energy saving service area provided by the energy saving communication station;
transmitting a cell state change response message from the compensation communication station to the energy saving communication station, the cell state change response message indicating that the energy saving service area should be deactivated;
transferring a user equipment device (UE device from the energy saving communication station to a transition radio head, the transferring comprising assigning to the UE device an uplink/downlink frequency pair for communication with the transition radio head and not used by the energy saving communication station, the transition radio head and the energy saving communication station operating in accordance with a same communication specification;
deactivating the energy saving service area such that the energy saving communication station does not provide wireless service within the energy saving service area;
transmitting a cell state change update message from the energy saving communication station to the compensation communication station, the cell state change update message at least indicating that no UE devices are receiving wireless service from the energy saving communication station;
expanding, at least partially in response to receiving the cell state change update message at the compensation communication station, a compensation service area of the compensation communication station to cover at least a portion of the energy saving service area of the energy saving communication station; and
transferring the UE device from the transition radio head to a compensation radio head of the compensation communication station that provides the compensation service area.

US Pat. No. 10,194,357

METHOD AND APPARATUS FOR APPLYING ASSISTANCE INFORMATION FOR TRAFFIC STEERING IN WIRELESS COMMUNICATION SYSTEM

LG ELECTRONICS INC., Seo...

1. A Method for applying assistance information for traffic steering between a 3rd generation partnership project (3GPP) access network and a non-3GPP access network by a user equipment (UE) in a wireless communication system, the method comprising:while in a radio resource control (RRC) connected mode:
receiving first assistance information for traffic steering via a dedicated signaling from an eNodeB (eNB);
applying the first assistance information for traffic steering;
transiting from the RRC connected mode to a RRC idle mode;
while in the RRC idle mode:
keeping applying the first assistance information for traffic steering;
performing a cell reselection while the first assistance information is valid; and
clearing the first assistance information,
wherein the first assistance information includes thresholds regarding the 3GPP access network and thresholds regarding the non-3GPP access network.

US Pat. No. 10,194,347

METHOD FOR MANAGING OVERLOAD IN A MOBILE COMMUNICATION NETWORK

NEC CORPORATION, Tokyo (...

1. A method for managing overload in a mobile communication network including a radio access network and a core network connected to the radio access network, wherein a plurality of non-MTC user devices and/or MTC user devices is connected to one or more base stations of the radio access network, the method comprising:a) detecting a presence of a network overload in the mobile communication network;
b) generating an overload report according to the detected network overload having one or more resource identifiers of the resources of the mobile communication network on which the network overload was detected;
c) identifying one or more user devices and/or applications affected by the network overload based on the overload report; and
d) informing one or more serving entities serving identified user devices for temporarily suppressing communication requests.

US Pat. No. 10,194,342

COLLECTING CHARACTERISTICS FOR A PATH BETWEEN IP END-POINTS ASSOCIATED WITH A RADIO ACCESS TRANSPORT NETWORK

Telefonaktiebolaget LM Er...

1. A method, performed in a first radio base station in a radio access network, of collecting characteristics for a path between two IP end-points associated with a radio access transport network, the method comprising:receiving an IP address of at least one IP end-point associated with the radio access transport network to which the first radio base station is connected;
sending a query to a node in the radio access transport network for at least one characteristic for a path between the two IP end-points, wherein the two IP end-points comprise the at least one IP end-point, and the node routes traffic between the two IP end-points;
receiving the at least one characteristic for the path between the two IP end-points;
comparing the at least one characteristic for a path between the two IP end points with at least one characteristic for a path between a second radio base station and an IP end point that is one of the two IP end points; and
determining, based on the comparison, which of the first radio base station and the second radio base station should serve as a master base station that decides whether radio coordination features should be used.

US Pat. No. 10,194,339

DETECTION OF BASE STATION SYNCHRONIZATION FAILURE

Sprint Communications Com...

10. One or more non-transitory computer-readable media having computer-executable instructions embodied thereon that, when executed, perform a method for detecting synchronization failures between base stations in a wireless communications network, the method comprising:at each of a plurality of base stations:
generating a cancellation signal that is in-phase relative to signals output over a downlink band by a first base station and that has an inverse amplitude relative to the signals output over the downlink band by the first base station;
internally cancelling receipt, in near real time at the first base station, of the signals output over the downlink band by the first base station using the cancellation signal;
listening for synchronization information output by a neighboring base station over the downlink band as enabled by the signal receipt cancellation;
when synchronization information output over the downlink band by the neighboring base station is received at the first base station, communicating the synchronization information of the neighboring base station and synchronization information of the first base station to a server for detection of synchronization failures.

US Pat. No. 10,194,336

ACTIVATION OF CELLS

Telefonaktiebolaget LM Er...

1. A method performed in a wireless device served by a network node of a radio communications system, the wireless device being capable of carrier aggregation and being configured by the network node with a primary cell, PCell, and a first secondary cell, SCell, the method comprising:receiving an activation command for activating the first SCell, the first SCell operating on a carrier for contention-based transmission; and
activating the first SCell in response to the activation command within a variable time period, the variable timer period increasing with a number of times that a discovery reference signal occasion of the first SCell is not available at the wireless device during the activation, the discovery reference signal occasion of the first SCell is not available when at least one of a quality and a strength of a signal received in the discovery reference signal occasion is below a respective threshold.

US Pat. No. 10,194,334

METHODS AND NODES IN A WIRELESS COMMUNICATION NETWORK

Huawei Technologies Co., ...

1. A Base Transceiver Station (BTS), wherein the BTS comprises:a Multiple Input Multiple Output (MIMO) antenna array configured for beamforming and MIMO transmission, wherein the BTS is configured for wireless communication with a User Equipment (UE) in a wireless communication system;
a processing circuit, configured to implement a plurality of downlink pre-coders, wherein the plurality of downlink pre-coders are configurable to provide a remotely configurable downlink cell pattern, at least one of the plurality of downlink pre-coders is configured to provide downlink pre-coding for a UE dedicated channel corresponding to the UE, and at least one of the plurality of downlink pre-coders is configured to provide downlink pre-coding for a control plane, and wherein the downlink pre-coding that is provided by the plurality of downlink pre-coders is used to modify phase excitation of the MIMO antenna array, to cause a transceiver to create an antenna beam by providing a different phase for each antenna element of the MIMO antenna array; and
the transceiver, configured to transmit a signal in the antenna beam via the MIMO antenna array to the UE.

US Pat. No. 10,194,333

TERMINAL APPARATUS, BASE STATION, AND PROGRAM

SONY CORPORATION, Tokyo ...

1. A terminal apparatus comprising:a wireless communication transceiver configured to perform wireless communication with a base station; and
controller circuitry configured to receive a transmitted reference signal from the base station and perform measurement of the transmitted reference signal, a plurality of transmission weights being applied by the base station to the transmitted reference signal for beamforming, the plurality of transmission weights stored at the base station, wherein the base station applies the plurality of transmission weights to the transmitted reference signal by multiplying the transmitted reference signal with the plurality of transmission weights,
wherein the controller circuitry performs the measurement by calculating the sum of the plurality of transmission weights for beamforming, and multiplying a channel for the reference signal before application by the sum of the plurality of transmission weights for beamforming, and thereby calculating received power which occurs when the reference signal after application of the plurality of transmission weights for beamforming is received by the wireless communication transceiver,
wherein the terminal apparatus communicates with a base station which has been selected based on the measurement of the transmitted reference signal.

US Pat. No. 10,194,323

WIRELESS BASE STATION, CORE NETWORK DEVICE, WIRELESS COMMUNICATION SYSTEM, AND WIRELESS COMMUNICATION METHOD

NEC CORPORATION, Tokyo (...

1. A wireless base station comprising:a communication unit; and
a control unit that transmits, to an adjacent wireless base station adjacent to the wireless base station, through the communication unit, an instruction signal that gives an instruction to expand a cell range of the adjacent wireless base station in a direction of the wireless base station before the wireless base station narrows a cell range or reduces transmission power, wherein
the control unit narrows the cell range or reduces the transmission power of the wireless base station after receiving, from the adjacent wireless base station, a notification signal that gives a notification that the adjacent wireless base station has expanded the cell range of the adjacent wireless base station in the direction of the wireless base station.

US Pat. No. 10,194,318

SYSTEMS AND METHODS FOR NFC ACCESS CONTROL IN A SECURE ELEMENT CENTRIC NFC ARCHITECTURE

Intel IP Corporation, Sa...

1. A non-transitory computer-readable medium storing computer-executable instructions which, when executed by a secure element, cause the secure to perform operations comprising:receiving, using a full duplex interface protocol, a request for information from an application processor on a full duplex interface, wherein:
the full duplex interface connects the application processor to the secure element, and wherein the application processor and the secure element are part of a device, and
the request for information is a near field communication (NFC) controller interface (NCI) packet in an application protocol data unit (APDU);
receiving one or more access control policies from a trusted service manager, wherein the one or more access control policies are encrypted by the trusted service manager based at least in part on a first secure key;
decoding the one or more access control policies, from the trusted service manager, based at least in part on a second locally stored secure key;
processing the received request, based at least in part on the one or more access control policies, to identify a first access level associated with the request and a second access level associated with an originator of the request;
determining if the first access level matches the second access level;
in response to determining the first access level matches the second access level, transmitting the request to a NFC controller through the secure element using a single wire protocol interface without a direct connection between the application processor and the NFC controller;
receiving information from the NFC controller; and
transmitting the information from the NFC controller to the originator of the request.

US Pat. No. 10,194,314

METHOD AND SYSTEM FOR IDENTIFYING AN ENTITY IN A MOBILE DEVICE ECOSYSTEM

BlackBerry Limited, Wate...

1. A method of assigning an identifier to a first entity operating within a mobile device ecosystem the method comprising:obtaining an identifier of a first entity which uniquely identifies the first entity within a first domain in a plurality of domains in the mobile device ecosystem, each domain including a plurality of entities, each entity having an identifier that is unique within its respective domain but which may not be unique across the plurality of domains, wherein the identifier of the first entity comprises a number of octets and represents a personal identification number (PIN) that uniquely identifies a device within a domain that consists of all devices of a particular make or a universally unique identifier (UUID);
determining a length of the identifier of the first entity, wherein the length of the identifier of the first entity is represented by a single octet;
determining an identifier of the first domain which uniquely identifies the first domain within the mobile device ecosystem based on a combination of an entity type of the first entity and a protocol used to identify the first entity within the first domain, wherein the protocol is one of a PIN protocol, UUID protocol or Internet Protocol version 6 (IPv6) protocol, wherein the identifier of the first domain comprises a variable length integer, wherein the variable length integer includes one or more octets which encode an unsigned integer of a variable length, wherein a most significant bit of each octet indicates whether that octet is the last octet in the variable length integer;
concatenating the identifier of the first entity with the length of the identifier of the first entity and the identifier of the first domain to create a globally unique identifier of the first entity which is globally unique in the mobile device ecosystem, wherein the globally unique identifier is represented as an array of octets;
storing the globally unique identifier in a memory associated with an identity management system module; and
exchanging communications between the first entity and a second entity, wherein the communications specify the first entity using the globally unique identifier of the first entity stored in the identity management system module and specify the second entity using a globally unique identifier of the second entity stored in the identity management system module.

US Pat. No. 10,194,313

ESIM PROFILE PROVISIONING BETWEEN PROXIMATE DEVICES

T-Mobile USA, Inc., Bell...

1. A first device comprising:one or more processors; and
a non-transitory storage medium storing one or more instructions, the one or more instructions executable on the one or more processors to cause the first device to:
detect, as a detected presence, a presence of a second device within a configurable threshold distance of the first device, wherein the configurable threshold distance corresponds to a distance within which a device-to-device connection between the first device and the second device can be established;
send an indication to the second device, the indication indicating that the second device is within the configurable threshold distance of the first device; and
provision, based at least in part on the detected presence and via a device-to-device connection, a profile associated with a service provider and associated with an embedded subscriber identity module (eSIM) of the first device to the second device to enable the second device to utilize the profile associated with the eSIM for at least one service of a service provider, wherein the profile is embedded in the eSIM of the first device.

US Pat. No. 10,194,299

MULTIPLE APPLICATION MODULE OR UNIT

Corning Optical Communica...

1. A communication system, comprising:a wireless distribution system (WDS) configured for transmitting a downlink signal or for receiving an uplink signal; and
a computing device configured to serve as a client device to the WDS, the computing device comprising:
a memory;
a multi applications processor in communication with the memory, the multi applications processor configured to execute one or more applications; and
a wireless service processor in communication with the multi applications processor for communicating via a corresponding wireless service with the WDS;
the multi applications processor configured to execute an instance of a data service to establish a connection with the WDS for a specified application process utilizing the wireless service to provide at least one datum on the WDS.

US Pat. No. 10,194,294

METHOD FOR COLLECTIVELY COLLECTING DATA IN A MOBILE NETWORK, DATA ACQUISITION COMPUTER, AND MOBILE NETWORK MANAGEMENT UNIT FOR USE IN THE METHOD

Volkswagen AG, (DE)

1. A method for the collective acquisition of data, the method comprising:acquiring data by mobile devices each equipped with a radio communication module, wherein the data are transmitted via mobile radio network to at least one data acquisition computer with the aid of the radio communication modules; and
selecting the mobile devices whose acquired data are to be transmitted to the at least one data acquisition computer based on at least the connection status of the mobile devices in the mobile radio network,
wherein the connection status of a mobile device depends on at least one of the level of utilization of the mobile radio cell in which the mobile device moves, the measured connection quality, how far away the mobile device is from the cell boundary of the mobile radio cell, the handover status of the mobile device, the required accuracy of the data to be acquired, and the spectral efficiency with which the data is transmitted or the energy efficiency with which the data is transmitted.

US Pat. No. 10,194,293

SYSTEM AND METHOD FOR VITAL SIGNS ALERTING PRIVILEGED RECIPIENTS

16. A multi-user centralized service data processing system, comprising:one or more processors; and
memory coupled to the one or more processors and storing instructions, wherein the one or more processors, based on the instructions, perform operations comprising:
storing an alert delivery configuration for delivery of an alert to a first user that is feasibly physically located in a proximity range of a second user at a time associated with a recording data processing system detecting a health vital sign condition of the second user;
storing an interoperability configuration enabling the alert to the first user that is feasibly physically located in the proximity range of the second user at the time associated with the recording data processing system detecting the health vital sign condition of the second user;
receiving communications of the recording data processing system detecting the health vital sign condition of the second user, and determining the proximity range with a physical location of the recording data processing system at the time associated with the recording data processing system detecting the health vital sign condition of the second user;
receiving by radio wave transmission a physical location of a first data processing system associated with the first user, and determining with the physical location of the first data processing system and the proximity range that the first data processing system is physically located in the proximity range of the recording data processing system at the time associated with the recording data processing system detecting the health vital sign condition of the second user;
determining with the interoperability configuration the first user is privileged for receipt of the alert to the first user that is feasibly physically located in the proximity range of the second user at the time associated with the recording data processing system detecting the health vital sign condition of the second user; and
communicating the alert in accordance with the alert delivery configuration.

US Pat. No. 10,194,290

ENERGY-EFFICIENT PUSH/POLL NOTIFICATION SERVICE

T-Mobile USA, Inc., Bell...

18. A telecommunications device comprising:at least a first transceiver having a first communications interface and a second transceiver having second communications interface that is different from the first communications interface;
a processor; and
a memory having instructions stored thereon, the instructions, when executed by the processor, direct the telecommunications device to perform acts comprising:
for both the first and the second transceivers, determining a respective energy efficiency indicator for each of multiple, different communications channels between the telecommunications device and a corresponding plurality of sources of multimedia/notification service data, wherein determining an energy efficiency indicator for multiple communications channels between the telecommunications device and sources of multimedia/notification service data comprises:
determining a first energy efficiency indicator for a communications channel, over the first transceiver, between the telecommunications device and a first source of multimedia/notification service data;
determining a second energy efficiency indicator for a communications channel, over the second transceiver, between the telecommunications device and the first source of multimedia/notification service data;
determining a third energy efficiency indicator for a communications channel, over the first transceiver, between the telecommunications device and a second source of multimedia/notification service data; and
determining a fourth energy efficiency indicator for a communications channel, over the second transceiver, between the telecommunications device and the second source of multimedia/notification service data;
comparing the energy efficiency indicators;
selecting one communications channel of the multiple, different communications channels as a notification session channel based at least in part on the comparison of the energy efficiency indicators; and
acquiring, via the notification session channel, multimedia/notification service data.

US Pat. No. 10,194,285

SERVER-SIDE RATE-LIMITING ALGORITHMS FOR PIGGYBACKING SOCIAL UPDATES FOR MOBILE DEVICES

Facebook, Inc., Menlo Pa...

1. A method comprising:by one or more computing devices, receiving, from a mobile device of a first user, a notification mode indicating an interaction level of the first user with respect to the mobile device, wherein the notification mode is one of a trickle notification mode indicating the first user is actively interacting with the mobile device, a napping notification mode indicating the user is not actively interacting with the mobile device and the mobile device is in motion, or a sleep notification mode indicating the first user is not actively interacting with the mobile device and the mobile device is stationary for a pre-determined time duration;
by the one or more computing devices, identifying a set of outgoing messages to be sent to the first user;
by the one or more computing devices, computing an affinity score for each of the outgoing messages with respect to an originator of the message and the first user; and
by the one or more computing devices, sending one or more messages from the set of outgoing messages to the mobile device, wherein the sending is based on at least the notification mode received from the mobile device of the first user and the affinity scores associated with the one or more messages, wherein:
if the notification mode is the trickle notification mode, then sending messages whose affinity scores are above a first pre-determined threshold score; or
if the notification mode is the napping notification mode, then sending messages whose affinity scores are above a second pre-determined threshold score, wherein the second pre-determined threshold score is greater than the first pre-determined threshold score.

US Pat. No. 10,194,281

MBMS CONTROL METHOD, USER TERMINAL, AND BASE STATION

KYOCERA Corporation, Kyo...

1. A Multimedia Broadcast/Multicast Service (MBMS) control method for determining a demand status for an MBMS service that is provided from a network of a mobile communication system, by multicast or broadcast, in the network, comprising the steps of:transmitting, by a base station included in the network, an MBMS counting request for counting user terminals that either receive or have an interest in receiving the MBMS service, by using a predetermined signal that can be received by a user terminal in an RRC idle state;
receiving, by a first user terminal that supports MBMS reception, the MBMS counting request transmitted by using the predetermined signal, when the first user terminal is in the RRC idle state;
transmitting, by the first user terminal in the RRC idle state, an MBMS counting response to the MBMS counting request, through direct communication with a second user terminal, to the second user terminal;
receiving, by the second user terminal in an RRC connected state, the MBMS counting response through the direct communication; and
transferring, by the second user terminal in the RRC connected state, to the network, the received MBMS counting response.

US Pat. No. 10,194,273

POSITIONING INFORMATION PROCESSING METHOD AND APPARATUS

HUAWEI TECHNOLOGIES CO., ...

1. A positioning information processing method, comprising:obtaining, by a terminal device, location information of at least two to-be-positioned targets;
selecting, by the terminal device, a first to-be-positioned target from the at least two to-be-positioned targets according to the location information of the at least two to-be-positioned targets;
displaying, by the terminal device, location information of the first to-be-positioned target; and
indicating, by the terminal device, an orientation and a quantity of other to-be-positioned targets, different from the first to-be-positioned target, in the at least two to-be-positioned targets according to the location information of the at least two to-be-positioned targets.

US Pat. No. 10,194,270

SERVER FOR CONTROLLING AN INFORMATION SHARING STATE BETWEEN A FIRST MOBILE PHONE AND A SECOND MOBILE PHONE VIA A NETWORK

SONY CORPORATION, Tokyo ...

1. A server for controlling an information sharing state between a first mobile phone and a second mobile phone via a network, the server comprising:a network interface configured to communicate, via the network, with the first mobile phone and the second mobile phone;
a memory configured to store predetermined distance data indicating a predetermined distance; and
circuitry configured to
receive, via the network interface, a first Global Positioning System (GPS) signal indicating a current location of the first mobile phone, first user information indicating user information of a first user, and first restriction information indicating restriction information of the first user from the first mobile phone, the first GPS signal being obtained by the first mobile phone using a GPS receiver in the first mobile phone;
receive, via the network interface, a second GPS signal indicating a current location of the second mobile phone, second user information indicating user information of a second user, and second restriction information indicating restriction information of the second user from the second mobile phone, the second GPS signal being obtained by the second mobile phone using a GPS receiver in the second mobile phone;
calculate a distance between the current location of the first mobile phone and the current location of the second mobile phone based on the received first GPS signal and the received second GPS signal;
compare the calculated distance with the predetermined distance indicated by the predetermined distance data stored in the memory to determine whether the first mobile phone and the second mobile phone satisfy a predetermined condition;
change an information sharing state between the first mobile phone and the second mobile phone via the network from a first state in which the server disables information exchange via the network between the first mobile phone and the second mobile phone to a second state in which the server enables the information exchange via the network between the first mobile phone and the second mobile phone based on a comparison result obtained by the comparison such that upon a determination that the first mobile phone and the second mobile phone satisfy the predetermined condition, the information sharing state is automatically changed to the second state; and
restrict the change of the information sharing state from the first state to the second state based on the first restriction information of the first mobile phone and the second user information of the second mobile phone.

US Pat. No. 10,194,268

METHODS AND APPARATUS FOR RANGE MEASUREMENT

Marvell International Ltd...

1. A method, comprising:determining, at a first communication device, scheduling information for a plurality of range measurement signal exchange sessions that will occur in the future between the first communication device and one or more second communication devices, wherein the plurality of range measurement signal exchange sessions involve using i) different channel bandwidths, and ii) different physical layer data unit (PPDU) formats for the plurality of range measurement signal exchange sessions, and wherein the scheduling information includes, for each session, i) a respective indication of when the session will occur in the future, ii) a respective indication of a respective channel bandwidth, selected from a set of multiple different channel bandwidths, that will be used during the session in the future, and iii) a respective indication of a respective PPDU format, selected from a set of multiple different PPDU formats defined by different communication protocols, that will be used during the session in the future;
generating, at the first communication device, a single packet that includes the scheduling information, the single packet including, for each second communication device with which the first communication device will exchange signals during one or more range measurement signal exchange sessions in the future, a respective field specifying parameters for the one or more range measurement signal exchange sessions between the first communication device and the respective second communication device; and
transmitting, with the first communication device, the single packet so that a third communication device can use the scheduling information to observe, in the future, one or more of the range measurement signal exchange sessions in the plurality of range measurement signal exchange sessions between the first communication device and one or more second communication devices, to determine range measurements.

US Pat. No. 10,194,265

SYSTEMS AND METHODS FOR SUPPORTING POSITIONING BEACONS COMPATIBLE WITH LEGACY WIRELESS DEVICES

QUALCOMM Incorporated, S...

1. A method at a wireless node for supporting positioning of one or more wireless devices comprising:transmitting, by the wireless node configured as a positioning beacon, a first downlink signal for supporting positioning of the one or more wireless devices; and
transmitting a second downlink signal that inhibits a receiving wireless device, from the one or more wireless devices, from sending uplink signals to the wireless node configured as the positioning beacon.

US Pat. No. 10,194,262

PROXIMITY-BASED ITEM DATA COMMUNICATION

1. A method comprising:receiving an audio signal at a mobile computing device from a speaker device;
determining whether the audio signal is within a particular frequency range using an application executing at the mobile computing device;
based on a determination that the audio signal is within the particular frequency range, processing the audio signal to determine speaker location data, wherein the speaker location data is encoded within the audio signal and indicates a location of the speaker device;
sending a message including information associated with the speaker location data from the mobile computing device via a network to a server;
receiving item data at the mobile computing device responsive to the message, wherein the item data identifies items located proximate to the speaker device; and
in response to a particular item included in a shopping list of the application matching an item identified in the item data, generating an alert at the mobile computing device and causing a first display device associated with the speaker device to display a product location of the particular item.

US Pat. No. 10,194,260

SOUND VOLUME CONTROL DEVICE, SOUND VOLUME CONTROL METHOD AND SOUND VOLUME CONTROL PROGRAM

PIONEER CORPORATION, Tok...

1. A sound volume control device connected to a pair of speakers arranged on left and right sides of two listening positions in a vehicle interior, comprising:an analyzer configured to derive a first frequency characteristic and a second frequency characteristic, each of which is a frequency characteristic at one of the two listening positions, of sound outputted from at least one of the pair of speakers; and
a controller configured to control a sound signal of at least one of peak frequency bands of the sound common to the first frequency characteristic and the second frequency characteristic.

US Pat. No. 10,194,254

ISOLATED ACTUATOR FOR BONE CONDUCTION DEVICE

COCHLEAR LIMITED, Macqua...

1. An apparatus comprising:an auditory prosthesis housing;
a sound processor disposed in the auditory prosthesis housing;
a vibration actuator mechanically disposed within the auditory prosthesis housing and separate from the auditory prosthesis housing;
a housing retention element fixed to the auditory prosthesis housing; and
an actuator retention element discrete from the housing retention element and fixed relative to the vibration actuator.

US Pat. No. 10,194,253

ANTENNAS FOR HEARING AIDS

Starkey Laboratories, Inc...

1. A hearing aid comprising:a hybrid circuit including a first substrate and a second substrate;
an antenna having metallic traces disposed in the hybrid circuit, wherein the antenna includes at least one turn on the first substrate and at least one turn on the second substrate;
an electronic device in the hybrid circuit coupled to the metallic traces of the antenna; and
a signal processing unit to process information received and transmitted by the antenna, wherein the antenna is configured with a first turn to act as a transmitting antenna and a second turn outside the first turn to act as a receiving antenna, the second turn configured to inductively receive signals from the first turn for measurement of power in the first turn.

US Pat. No. 10,194,250

SENSOR WITH MOVABLE PARTS AND BIASING

Infineon Technologies AG,...

1. An apparatus, comprising:a sensor comprising a first electrode, a movable part, and a second electrode,
a first capacitance being defined between the first electrode and the movable part,
a second capacitance being defined between the movable part and the second electrode,
the first electrode being directly coupled to an amplifier, and
the second electrode being directly coupled to the amplifier;
a first switch coupling a first voltage source with:
the movable part, or
the first electrode and the second electrode;
a second switch coupling a second voltage source with:
the movable part, or
the first electrode and the second electrode; and
a clock, coupled to the first switch and the second switch, to alternately close the first switch and the second switch.

US Pat. No. 10,194,239

MULTI-RESOLUTION AUDIO SIGNALS

Nokia Technologies Oy, E...

1. An apparatus comprising:at least one microphone;
audio circuitry connected to the at least one microphone, where the audio circuitry is configured to output a first audio track and at least one second audio track, where the audio circuitry is configured to form the first audio track from at least one output signal, provided by the at least one microphone, by processing the at least one output signal with a first audio configuring and form the first audio track with a first audio resolution, and where the audio circuitry is configured to form the at least one second audio track from the same at least one output signal, provided by the same at least one microphone, by processing the at least one output signal with a different second audio configuring and form the at least one second audio track with a second different audio resolution;
a memory connected to the audio circuitry which is configured to store the first audio track and the at least one second audio track; and
a selector configured to automatically select the first audio track or the at least one second audio track to be played after the first and second audio tracks have been stored in the memory, where a plurality of the audio tracks has a different audio resolution of a same sound received at the at least one microphone, where the apparatus is:
configured to be able to play at least one of the respective audio resolutions, and
configured to not be able to play at least one other one of the respective audio resolutions, and
where the selector is configured to automatically select the first audio track to be played or the at least one second audio track to be played based at least partially upon an audio resolution playing capability of the apparatus to play the at least one of the respective audio resolutions and an audio resolution playing incapability of the apparatus to play the at least one other one of the respective audio resolutions.

US Pat. No. 10,194,234

CANCELATION OF INDUCED GROUND NOISE IN A HEADPHONE OUTPUT

QUALCOMM Incorporated, S...

1. An apparatus for reducing an impact of ground noise on an auxiliary device power input, comprising:an output jack including a ground pole and a power output pole;
a power supply circuit configured to generate a power signal;
a coupler circuit operably coupled to the ground pole and the power output pole of the output jack, the coupler circuit configured to couple the power signal with a noise signal on the ground pole to generate a combined output signal on the power output pole.

US Pat. No. 10,194,233

EARPHONES AND EARBUDS WITH PHYSIOLOGIC SENSORS

Harman International Indu...

1. An earphone, comprising:a housing;
a speaker in the housing;
an enhancer comprising a body mounted on the housing and adapted to be secured in a user's ear to acoustically couple the speaker to the user's ear, the body having a front outer wall and adjoining side walls, the front outer wall spaced from the housing and the side walls contacting the housing;
a sound tube projecting from and above the front outer wall of the body and adapted to fit in a user's ear canal; and
an optical physiologic sensor disposed inside the enhancer beneath the front outer wall of the body adjacent the sound tube, and at least one aperture in the front outer wall of the body adjacent the sound tube and aligned with the optical physiologic sensor, so that the optical physiologic sensor can optically couple with the user's ear external to the front outer wall when the enhancer is secured in the user's ear.

US Pat. No. 10,194,232

RESPONSIVE PACKAGING SYSTEM FOR MANAGING DISPLAY ACTIONS

1. A packaging system for wireless earpieces, comprising:wireless earpieces including one or more sensors and a near field communication chip, wherein the near field communication chip communicates with a plurality of packaging systems if present adjacent to the packaging system; and
packaging defining a window for displaying the wireless earpieces, wherein the packing prevents damage to the wireless earpieces, and wherein the packaging performs a display action in response to a display criteria being met.

US Pat. No. 10,194,231

CIRCUIT FOR DETECTING BUTTON ACTION ON EARPHONE, TERMINAL, AND EARPHONE

Huawei Technologies Co., ...

6. A terminal, comprising:an earphone jack configured to connect the terminal to an earphone;
a first resistor, having a first end and a second end;
a comparator, having with a first input end, a second input end, and an output end, wherein the first input end of the comparator is connected to the first end of the first resistor, wherein the second input end of the comparator is connected to the second end of the first resistor, and wherein the comparator is configured to output a control signal at the output end of the comparator when a voltage difference between the first input end and the second input end is greater than a first threshold; and
a power supply, connected to the first end of the first resistor;
a first analog to digital converter (ADC), wherein an input end of the first ADC is connected to the first end of the first resistor, and wherein an output end of the first ADC is connected to a processor; and
a second ADC, wherein an input end of the second ADC is connected to the second end of the first resistor, and an output end of the second ADC is connected to the processor;
wherein the earphone comprises:
a second resistor, having a first end and a second end, wherein when the earphone is connected to the terminal through the earphone jack, the first end of the second resistor is connected to the second end of the first resistor;
a microphone (MIC), having a first end and a second end, wherein the first end of the MIC is connected to the first end of the second resistor, and the second end of the MIC is grounded; and
a button, having two ends that are respectively connected to the second end of the MIC and the second end of the second resistor, wherein, when the button is pressed, the two ends of the button are electrically connected; and
wherein the terminal further comprises the processor configured to receive the control signal, and to execute a function corresponding to the control signal.

US Pat. No. 10,194,222

PACKET-BASED OPTICAL SIGNAL SWITCHING CONTROL METHOD AND APPARATUS

ELECTRONICS AND TELECOMMU...

1. An optical switching control method performed by a data plane of a packet-based optical signal network, the optical switching control method comprising:generating optical switching paths to a destination node of service traffic flowing from an external service network to an entrance node;
generating optical frames corresponding to the optical switching paths;
transmitting, from the entrance node to a control server, each of request messages for requesting allocation of one of time slots and use of one of the optical switching paths to transmit each of the optical frames;
generating each of optical signals having a predetermined one of wavelengths corresponding to each of the optical frames to transmit each of the optical frames in response to each of admission messages being received as a result of admission with respect to each of the request messages;
setting one of the optical switching paths for transmitting each of the optical signals by designating one of a plurality of output (input) ports included in the entrance (destination) node for switching each of the optical signals; and
transferring each of the optical frames to the destination node based on the set one of the optical switching paths and the allocated one of the time slots.

US Pat. No. 10,194,218

METHOD AND APPARATUS FOR PRESENTING DYNAMIC MEDIA CONTENT

1. A device comprising:a processing system including a processor; and
a memory that stores executable instructions that, when executed by the processing system, facilitate performance of operations comprising:
analyzing media content provided by a media content provider system;
enabling selection of a portion of the media content and a recipient device to receive the portion of the media content, wherein the selection of the portion of the media content is based on the analyzing;
transmitting the portion of the media content to a media processor, wherein the media processor stores the portion of the media content; and
generating a metadata pointer and transmitting the metadata pointer to a server, wherein the metadata pointer indicates a storage location at the media processor for the portion of the media content, wherein the transmitting of the metadata pointer causes the server to provide a request to accept the portion of the media content, and wherein the metadata pointer is configured to enable the server to retrieve the portion of the media content from the media processor responsive to the recipient device accepting the request,
wherein the server stores the metadata pointer responsive to the recipient device accepting the request.

US Pat. No. 10,194,216

VIDEO RECEPTION DEVICE, VIDEO RECOGNITION METHOD, AND ADDITIONAL INFORMATION DISPLAY SYSTEM

Panasonic Intellectual Pr...

1. A video reception device configured to transmit and receive data through a communication network, the video reception device comprising:an input unit configured to receive an input of a video signal of a stereoscopic video, the video signal of a stereoscopic video being transmitted using a first stereoscopic video transmission method that is one of a plurality of stereoscopic video transmission methods;
a video extraction unit configured to extract a partial video for video recognition processing, from the video signal, the partial video having a predetermined time duration or a predetermined number of frames;
a video signal generator configured to generate, from the partial video, another partial video using at least one stereoscopic video transmission method different from the first stereoscopic video transmission method of the stereoscopic video; and
a control unit configured to perform control of:
generating a plurality of pieces of content recognition information from all of the partial video and the another partial video,
transmitting the content recognition information to a video recognition device connected to the communication network so as to request the video recognition device to perform video recognition processing,
obtaining a result of the video recognition processing from the video recognition device, and
obtaining additional information based on the result of the video recognition processing from an additional information distribution device connected to the communication network.

US Pat. No. 10,194,215

METHOD AND SYSTEM FOR BROADCASTING AN ADVERTISEMENT TO A POTENTIAL CUSTOMER

MASTERCARD INTERNATIONAL ...

1. A computer-implemented method for broadcasting an advertisement for a merchant of a product over a network comprising the steps of:receiving transaction data relating to a plurality of customers from a financial service provider system, wherein said transaction data comprises, for each transaction, a hashed reference generated by said financial service provider system to anonymously reference the related customer, payment information, location, purchase information and amount of transaction;
receiving a first set of rules defined by the merchant based on the product, the first set of rules defining parameters for identifying customers from said plurality of customers as potential customers of the product based on the transaction data;
processing said transaction data of said plurality of customers based on at least one rule from the first set of rules to obtain a potential customer base;
receiving viewership data of said plurality of customers from a network service provider system, wherein said viewership data comprises a listing of communications channels along with timestamp starts and timestamp ends associated with respective said communications channels and payment information of said plurality of customers, said payment information being taken from stored subscription records and having associated therewith said hashed references;
mapping said viewership data with said potential customer base, utilizing said hashed references, to obtain an user database, wherein said user database comprises at least one entry of said communications channel associated with respective said timestamp start, said timestamp end, and said location;
for each said communications channel, determining optimal timestamps based on the timestamp starts and the timestamp ends, each of the the optimal timestamps representing a range of time;
aggregating, based on the optimal timestamps, user counts for each said communications channel for each said location;
selecting, based on said aggregated user counts, at least one associated grouping of said communications channels, said optimal timestamps, and said locations in accordance with at least one rule from a second set of rules;
broadcasting said advertisement for the product through said network in said at least one selected communications channel for said at least one selected location within the range of time of said at least one selected optimal timestamp;
monitoring transaction data relating to said plurality of customers generated after the broadcasting of the advertisement of the product to identify sales of the product to said plurality of customers; and,
determining further broadcasting of the advertisement of the product based on the identified sales of the product.

US Pat. No. 10,194,212

SYSTEMS AND METHODS FOR PROVIDING FLEXIBLE ACCESS TO SCENES CONTAINED WITHIN A VIDEO CONTENT ITEM

Comigo Ltd., Yarkona (IL...

1. In a system comprising a central server and at least one client terminal, wherein the central server provides linear TV channels that include video content items to each one of the at least one client terminal, a method for providing to a user of a first client terminal of the at least one client terminal flexible access to video scenes contained within video content items included in linear TV channels provided by the central server to the first client terminal, the method comprising:a. receiving, by the first client terminal and from the central server, a first linear TV channel including at least a portion of a first video content item;
b. playing, by the first client terminal, the first linear TV channel, thereby playing the at least a portion of the first video content item;
c. switching, by the first client terminal, from playing the first linear TV channel to playing a second linear TV channel including a second video content item, thereby playing the second video content item;
d. at the first client terminal, receiving from the central server a scene information collection of the second video content item, wherein the scene information collection of the second video content item comprises scene information about at least a first video scene contained in the second video content item, the scene information collection of the second video content item being generated by the central server while the first client terminal is playing the second video content item;
e. providing, by the first client terminal and before the first client terminal finishes to play the second video content item, a user interface enabling the user of the first client terminal to select a single video scene from multiple video scenes contained in the second video content item, wherein the providing is subsequent to the receiving the scene information collection and wherein the multiple video scenes which may be selected using the user interface are based on the scene information collection;
f. receiving, by the first client terminal, a selection of one video scene contained in the second video content item, wherein the one video scene contained in the second video content item was not played by the first client terminal following the switching, the selection provided by the user using the user interface; and
g. subsequent to and in response to the receiving of the selection, playing the one video scene by the first client terminal.

US Pat. No. 10,194,210

DYNAMIC CONTENT DELIVERY NETWORK ALLOCATION SYSTEM

HULU, LLC, Santa Monica,...

1. A method comprising:determining, by a computing device of a content delivery service, an allocation percentage in an overall percentage for video traffic for each of a plurality of content delivery networks (CDNs), wherein each CDN is configured to select servers from each independent network for each CDN to deliver media programs for the content delivery service to client devices;
associating, by the computing device, metrics for each CDN together based on information regarding playback of the media programs for each CDN;
analyzing, by the computing device, the metrics for each CDN together based on information regarding the playback of the media programs for each CDN to determine when to change one or more allocation percentages in the overall percentage, wherein the metrics are associated with a time period, and wherein allocation percentages are per CDN based on a platform type, and each allocation percentage is used to allocate requests for playback of media programs to a CDN;
reducing, by the computing device, a first allocation percentage for a platform type in the overall percentage for a first CDN in the plurality of CDNs based on the analyzing of the metrics to reduce future allocations to the first CDN, wherein the first allocation percentage is used to allocate a first set of requests for playback of media programs to the first CDN, and wherein the first CDN selects servers from a first CDN network for the first CDN to respond to the first set of requests;
increasing, by the computing device, a second allocation percentage for a platform type in the overall percentage for a second CDN in the plurality of CDNs based on the analyzing of the metrics to increase future allocations to the second CDN, wherein the second allocation percentage is used to allocate a second set of requests for playback of media programs to the second CDN, and wherein the second CDN selects servers from a second CDN network for the second CDN to respond to the second set of requests; and
allocating, by the computing device, requests for playback of media programs to the plurality of CDNs based on the allocation percentages in the overall percentage, wherein the reduced first allocation percentage and the increased second allocation percentage are used in allocating the requests.

US Pat. No. 10,194,203

MULTIMODAL AND REAL-TIME METHOD FOR FILTERING SENSITIVE MEDIA

1. A method comprising:performing, by at least one processor, operations including:
segmenting a digital video stream into video fragments along a video timeline;
extracting low-level features containing significant information on sensitive media from the video fragments;
reducing a semantic difference between the extracted low-level features, and a high-level concept;
classifying the video fragments, and generating a high-level label as either positive or negative and a confidence score for each classified video fragment;
performing high-level fusion to correlate the generated high-level labels and the confidence scores for each classified video fragment; and
identifying a particular content of the digital video stream by combining the generated high-level labels of the classified video fragments along the video timeline,
wherein the performing the high-level fusion comprises:
temporally aligning N classified video fragments along the video timeline;
representing an N-dimensional vector, which builds an N-dimensional vector for each instant of interest of the digital video stream, and within the N-dimensional vector, every i-th component holds a classification confidence score of the i-th classified video fragment, in relation to a video fragment having a reference moment which coincides with a reference instant of interest, wherein i belongs to the natural interval [1 . . . N]);
in an offline operation, generating a late fusion model from a training dataset, employing a supervised machine learning method on the generated late fusion model to generate a good late fusion model, and storing the good late fusion model; and
in an online operation, retrieving the stored good late fusion model and using the retrieved good late fusion model, a de-noising function, and a predetermined threshold to correlate the generated high-level labels and the confidence scores for each classified video fragment.

US Pat. No. 10,194,197

BROADCASTING SIGNAL TRANSMISSION DEVICE, BROADCASTING SIGNAL RECEPTION DEVICE, AND METHOD FOR TRANSMITTING/RECEIVING BROADCASTING SIGNAL USING SAME

LG ELECTRONICS INC., Seo...

1. A method for transmitting broadcast signals by a broadcast signal transmitter, the method comprising:encoding Physical Layer Pipe (PLP) data carried in each of a plurality of Physical Layer Pipes (PLPs), wherein one of the PLPs carries at least one broadcast service component of a service;
interleaving the encoded PLP data;
building a signal frame including the interleaved PLP data;
modulating data of the built signal frame by an Orthogonal Frequency Division Multiplex (OFDM) scheme; and
transmitting the broadcast signals including the modulated data of the signal frame,
wherein the broadcast signals further include first signaling information including service identification (ID) information and service name information, and
wherein the broadcast signals further include second signaling information including mapping information between ID information for the PLPs and internet protocol (IP) addresses of the service described in the first signaling information.

US Pat. No. 10,194,190

ADAPTING USER INTERFACE OF DISPLAY APPARATUS ACCORDING TO REMOTE CONTROL DEVICE

SAMSUNG ELECTRONICS CO., ...

1. A method of controlling a display apparatus, the method comprising:displaying a plurality of content items on a screen of the display apparatus;
receiving data from a connected remote control device;
identifying a device type of the connected remote control device based on the received data; and
displaying on the screen of the display apparatus a list of content items controllable by the connected remote control device based on the identified device type of the connected remote control device,
wherein the displaying the list of content items comprises displaying at least one of the plurality of content items corresponding to the identified device type of the connected remote control device among the plurality of content items distinguishably from remaining content items of the plurality of content items.

US Pat. No. 10,194,175

VIDEO CODING WITH EMBEDDED MOTION

Xylon LLC, Las Vegas, NV...

1. A method, comprising:receiving image data comprising a sequence of one or more frames, wherein the one or more image frames include a first image frame and a second image frame;
identifying a first basis function that represents at least, in part, a first portion of the first image frame;
identifying a second portion of the second image frame that is represented at least by the first basis function;
determining a displacement between the first portion of the first image frame and the second portion of the second image frame; and
associating motion data with the first basis function, wherein the motion data indicates the displacement;
wherein the first portion includes two or more pixels of the first image frame,
wherein the second portion includes two or more pixels of the second image frame, and
wherein the first basis function is selected from a dictionary of basis functions.

US Pat. No. 10,194,161

IMAGE DECODING DEVICE AND IMAGE CODING DEVICE

Dolby International AB, ...

1. An image encoding method comprising:identifying, at an encoder, a target picture and a reference picture set (RPS);
generating RPS information usable for generating the RPS at a decoder;
generating, based on the target picture and the RPS, a reference picture list (RPL);
generating RPL modification information usable for generating the RPL, the RPL modification information including information regarding list sorting associated with the RPL;
generating, based on the RPS information, RPL modification information, and the target picture, one or more coding parameters and a slice header, wherein the one or more coding parameter includes a first flag that indicates whether the information regarding the list sorting is included within the slice header and a parameter that represents a number of current-picture referable pictures;
encoding the target picture based in part on the RPL to generate encoded picture data; and
generating a bitstream representing the target picture, the bitstream including the slice header, the encoded picture data, and the one or more coding parameters, wherein generating the bitstream comprises:
including a reference picture sorting presence or absence flag and a reference list sorting order in the RPL modification information if the first flag and the parameter representing the number of current-picture referable pictures have predetermined values, and
omitting inclusion of the reference picture sorting presence or absence flag and the reference list sorting order in the RPL modification information if the first flag and the parameter representing the number of current-picture referable pictures do not have predetermined values.

US Pat. No. 10,194,160

SIGNALING CHANGE IN OUTPUT LAYER SETS

Dolby International AB, ...

1. A method for video decoding, comprising:receiving a bitstream comprising a video parameter set and bits representing a current picture;
parsing at least a portion of a slice header of the current picture;
performing a first determination, based on one or more syntax elements in the video parameter set, whether a removal operation from a decoded picture buffer (DPB) is to be performed on a per-picture basis or per-access unit (AU) basis, wherein an access unit comprises at least a base layer and an enhanced layer, and each layer represents a picture;
performing a second determination, separate from the first determination, based on one or more syntax elements in the video parameter set, whether a picture output operation from the DPB is to be performed on a per-picture basis or per-AU basis;
performing the removal operation from the DPB in accordance with the first determination whether the removal operation is to be performed on a per-picture basis or per-AU basis;
performing the picture output operation from the DPB in accordance with the second determination whether the picture output operation is to be performed on a per-picture basis or per-AU basis;
performing a decoding and storing of a current decoded picture in the DPB;
performing a third determination, based on the one or more syntax elements in the video parameter set, whether marking the current decoded picture is to be performed on a per-picture basis or per-AU basis;
marking the current decoded picture in the DPB in accordance with the third determination whether marking the current decoded picture is to be performed on a per-picture basis or per-AU basis; and
performing an additional picture output from the DPB in accordance with a fourth determination whether the additional picture output is to be performed on a per-picture basis or per-AU basis.

US Pat. No. 10,194,159

METHOD AND APPARATUS FOR IMAGE AND VIDEO CODING USING HIERARCHICAL SAMPLE ADAPTIVE BAND OFFSET

Texas Instruments Incorpo...

1. A system comprising:a receiver component configured for receiving encoded video data representing a sequence of pictures, each picture represented by an array of component pixel values for one or more components, each component pixel value comprising binary word;
a video decoder component coupled to the receiver component, the video decoder component configured for:
reconstructing an array of component pixel values of at least one component in a coding unit of a first picture of the sequence of pictures represented by the video data;
determining a starting band for band offset sample adaptive filtering for the coding unit, the starting band identified by five most significant bits of each component pixel value associated with the starting band;
determining offset values for four contiguous bands including the starting band and three adjacent bands; and
performing sample adaptive offset filtering on the component pixel values in the four contiguous bands of the coding unit; and
a display coupled to the video decoder component configured for displaying the sample adaptive offset filtered pixel values.

US Pat. No. 10,194,156

METHOD OF AND APPARATUS FOR GENERATING AN OUTPUT FRAME

ARM Limited, Cambridge (...

1. A method of generating output frames from input frames, in which input frames are processed when generating output frames, the method comprising:when generating a region of a first output frame from a region of a first input frame:
processing the region of the first input frame;
generating information relating to the processing performed on the region of the first input frame; and
storing the information relating to the processing performed on the region of the first input frame; and
when generating a region of a second output frame from a region of a second input frame:
comparing the region of the second input frame with the region of the first input frame to determine if the region of the second input frame is similar to the region of the first input frame; and when the region of the second input frame is determined to be similar to the region of the first input frame:
reading the stored information relating to the processing performed on the region of the first input frame when generating the region of the first output frame;
determining whether the read information relating to the processing performed on the region of the first input frame when generating the region of the first output frame indicates that a part or all of the processing of the region of the second input frame is not required; and
when it is not determined that the read information relating to the processing performed on the region of the first input frame when generating the region of the first output frame indicates that a part or all of the processing of the region of the second input frame is not required:
processing the region of the second input frame; and
when it is determined that the read information relating to the processing performed on the region of the first input frame when generating the region of the first output frame indicates that a part or all of the processing of the region of the second input frame is not required: omitting the part or all of the processing of the region of the second input frame.

US Pat. No. 10,194,152

IMAGE PROCESSING APPARATUS AND METHOD

SONY CORPORATION, Tokyo ...

1. An image processing apparatus for encoding image data, the image processing apparatus comprising:circuitry including at least a processor and a memory, the circuitry configured to:
with a variable-sized coding unit as a processing unit, according to a position of a current coding unit within a current maximum coding unit, when all adjacent coding units, which are adjacent to the current coding unit, are located outside the current maximum coding unit and the all adjacent coding units are unusable, set as a predicted quantization parameter, a quantization parameter which is set for a surrounding coding unit located around but not adjacent to the current coding unit, wherein the variable-sized coding unit is obtained by recursively dividing a fixed-sized maximum coding unit according to a quad tree structure in a sequencing unit;
set a difference quantization parameter indicating a difference value between a current quantization parameter which is set for the current coding unit and the predicted quantization parameter set; and
generate a bit stream comprising the difference quantization parameter set by encoding the image data with the coding unit as the processing unit.

US Pat. No. 10,194,145

3D DISPLAY DEVICE FOR REDUCING MOVING FLICKER

LG DISPLAY CO., LTD., Se...

1. A display device, comprising:a display panel configured to display a left-eye image and a right-eye image;
a parallax barrier panel configured to block and transmit the left-eye image and the right-eye image so that the left-eye image and the right-eye image reaching a user's left-eye and right-eye, respectively, produces a 3D image;
a camera configured to sense the user's movement; and
a controller configured to calculate the user's moving speed by sensing a past position and a current position of the user sensed by the camera and implement the 3D image by estimating the user's future position based on the calculated user's moving speed when the calculated user's moving speed is faster than a frame per second (FPS) of the camera, and by applying a driving voltage to a barrier electrode according to the estimated future position,
wherein the controller is further configured to implement the 3D image by applying the driving voltage to the barrier electrode in correspondence to the current position of the user sensed by the camera when the calculated user's moving speed is slower than the frame per second (FPS) of the camera.

US Pat. No. 10,194,141

IMAGING DEVICE AND IMAGING METHOD

SONY CORPORATION, Tokyo ...

1. A video imaging device comprising:an image sensor containing pixels and having an electronic shutter function, the image sensor exhibiting an adjustable sensor exposure period and configured to convert an image light into an image signal including frames of a frame frequency;
an input terminal that inputs synchronizing data from an external device, the synchronizing data representing an image exposure period from a timing at which imaging each frame is started by the image sensor to a timing at which the image sensor reads out the image signal; and
an imaging control section configured to control an imaging operation of the image sensor based on the synchronizing data,
wherein the sensor exposure period represents a period in which the pixels in the image sensor receive the image light for each frame imaged by the image sensor, and wherein the image exposure period is a function of the frame frequency of each frame of the image signal, with the frame frequency being adjustable so as to increase with an increase in the sensor exposure period and to decrease with a decrease in the sensor exposure period, such that the image exposure period of each frame is the same.

US Pat. No. 10,194,140

BINOCULAR STEREO VISION DEVICE, ADJUSTING METHOD AND APPARATUS THEREOF AND DISPLAY DEVICE

BOE TECHNOLOGY GROUP CO.,...

1. A binocular stereo vision device, comprising:an acquisition system including two acquisition units arranged at intervals and being configured to acquire a depth distance from a measured object to the acquisition system;
an adjuster configured to adjust a distance between the two acquisition units;
a sensor configured to acquire an initial distance between the two acquisition units; and
a processing unit configured to obtain a standard distance between the two acquisition units according to the acquired depth distance from the measured object to the acquisition system and output a control signal according to a difference between the standard distance and the initial distance, wherein the adjuster adjusts the distance between the two acquisition units to be equal to the standard distance according to the control signal outputted by the processing unit, the processing unit includes: a calculator configured to obtain the standard distance according to a formula Dbest=(L*F)/RZ and obtain an initial control signal according to the difference between the standard distance and the initial distance, in which Dbest refers to the acquired depth distance from the measured object to the acquisition system; L refers to the standard distance between the two acquisition units; F refers to a focal length of the acquisition units; RZ refers to a depth resolution.

US Pat. No. 10,194,136

APPARATUS FOR RECORDING AN IMAGE OF AN OBJECT FIELD ON A HUMAN OR ANIMAL BODY

1. An apparatus for recording an image of an object field on a body from outside of the body, the apparatus comprising:a shank; and
an optical unit arranged at a distal end of the shank, the optical unit comprising an observation optical unit for recording the image of the object field and being rotatable about an axis of rotation that is at least substantially parallel to a viewing direction of the observation optical unit,
wherein the observation optical unit has a first stereo channel and a second stereo channel, the first and second stereo channels having an objective and at least one electronic image recorder,
wherein the observation optical unit comprises at least one filter that is swivelable into a beam path of the observation optical unit and swivelable therefrom, and
wherein the at least one filter is swivelable about a swivel axis formed substantially perpendicular to the axis of rotation.

US Pat. No. 10,194,130

IMAGE PROCESSING APPARATUS, IMAGE PROCESSING METHOD, AND PROGRAM

Canon Kabushiki Kaisha, ...

1. An image processing apparatus comprising:an image obtaining unit configured to obtain image data representing an image including an object;
a distance obtaining unit configured to obtain distance information indicating an object distance from an imaging apparatus capturing the image data to the object for each pixel of the image;
a determination unit configured to determine a correction target pixel having an abnormal combination of the object distance and a pixel value based on a frequency of combinations of the distance value and the pixel value; and
a correction unit configured to correct the distance information of the correction target pixel determined by the determination unit.

US Pat. No. 10,194,110

SOLID-STATE IMAGING DEVICE, IMAGING DEVICE, AND SIGNAL READING METHOD

OLYMPUS CORPORATION, Tok...

1. A solid-state imaging device comprising:a first substrate and a second substrate which have circuit elements disposed therein are electrically connected to each other, the circuit elements constituting pixels, wherein
the pixels comprise:
a photoelectric conversion element disposed in the first substrate;
an amplifier circuit that amplifies a signal generated in the photoelectric conversion element to output an amplified signal;
a signal accumulation circuit which is disposed in the second substrate and accumulates the amplified signal which is output from the amplifier circuit; and
an output circuit that outputs the amplified signal accumulated in the signal accumulation circuit from the pixel;
a noise reduction circuit that reduces noise in the amplified signal which is output from the amplifier circuit;
a first reset circuit that resets the photoelectric conversion element;
a second reset circuit that resets an input section of the amplifier circuit;
a transfer circuit that transfers the signal generated in the photoelectric conversion element to the input section of the amplifier circuit;
a second amplifier circuit that amplifies the amplified signal accumulated in the signal accumulation circuit to output a second amplified signal;
a third reset circuit that resets an input section of the second amplifier circuit; and
a switching circuit that connects the signal accumulation circuit and the input section of the second amplifier circuit and is capable of switching an on-state and an off-state,
wherein the noise reduction circuit removes noise generated in the input section of the amplifier circuit resulting from an operation of a circuit connected to the amplifier circuit or noise resulting from an operating characteristics of the amplifier circuit,
the noise reduction circuit includes:
a clamp section that clamps the amplified signal which is output from the amplifier circuit; and
a sample-and-hold section that samples and holds a signal corresponding the amplified signal clamped in the clamp section and accumulates in the signal accumulation circuit,
wherein the second reset circuits reset the input sections of the amplifier circuits of all the pixels collectively after the first reset circuits reset the photoelectric conversion elements of all the pixels collectively,
the clamp section clamps the amplified signal which is output from the amplifier circuit after the input section of the amplifier circuit is reset,
the transfer circuit transfers signals generated in the photoelectric conversion elements of all the pixels collectively to the input section of the amplifier circuit after elapsing a predetermined period until the first reset circuits reset the photoelectric conversion element of all the pixels collectively,
the sample-and-hold section samples and holds a signal corresponding to a fluctuation in the amplified signal generated by transferring the signal by the transfer circuit and accumulates a sampled and held signal in the signal accumulation circuit, and then, the output circuit outputs the second amplified signal after the third reset circuit reset the input section of the second amplifier circuit when the switching circuit is turned off and the second amplified signal after the sample-and-hold section samples and holds the signal corresponding to the fluctuation in the amplified signal generated by transferring the signal by the transfer circuit and accumulates the sampled and held signal in the signal accumulation circuit and when the switching circuit is turned on are output from the pixel in a time-division manner.

US Pat. No. 10,194,107

SOLID-STATE IMAGING APPARATUS AND DRIVING METHOD OF SOLID-STATE IMAGING APPARATUS

Sony Corporation, Tokyo ...

1. A solid-state imaging apparatus comprising:a pixel that operates based on a first ground potential applied to a first ground line and that outputs an analog image signal according to emitted light;
an analog-digital converter that operates based on a second ground potential applied to a second ground line, the second ground potential higher than the first ground potential, and that converts the analog image signal into a digital image signal based on a reference voltage as a standard for the conversion;
a reference voltage generation unit that operates based on the second ground potential and that generates the reference voltage; and
a reference voltage correction unit that corrects the generated reference voltage according to a change in the first ground potential and that supplies the reference voltage to the analog-digital converter.

US Pat. No. 10,194,103

SOLID-STATE IMAGING DEVICE AND METHOD OF DRIVING SOLID-STATE IMAGING DEVICE WITH CLIPPING LEVEL SET ACCORDING TO TRANSFER OPERATION FREQUENCY

CANON KABUSHIKI KAISHA, ...

1. A solid-state imaging device comprising:a plurality of pixels each including
a photoelectric converter configured to generate charges through photoelectric conversion,
a holding portion configured to hold charges generated in the photoelectric converter, and
a transfer unit configured to transfer charges from the photoelectric converter to the holding portion,
the plurality of pixels each being configured to output a signal based on charges held in the holding portion;
an output line, which is connected to the plurality of pixels, and to which the signal is output from each of the plurality of pixels;
a clipping unit configured to limit a signal level of the signal so that the signal level falls within a range having an upper limit and a lower limit, one of which is determined by a clipping level;
a transfer control unit configured to control the transfer unit so that the charges generated in the photoelectric converter during one exposure period are transferred to the holding portion through transfer operation performed at a frequency that is variable but at least once; and
a clipping level control unit configured to control the clipping level so that the clipping level is set to a first clipping level when the transfer operation is performed at a first frequency, and the clipping level is set to a second clipping level that is different from the first clipping level when the transfer operation is performed at a second frequency that is different from the first frequency.

US Pat. No. 10,194,098

IMAGING APPARATUS AND METHOD OF CONTROLLING IMAGING APPARATUS IN WHICH CORRESPONDING LINES IN PARTIALLY OVERLAPPING IMAGES ARE SEQUENTIALLY EXPOSED

SONY CORPORATION, Tokyo ...

1. An imaging apparatus, comprising:a light receiving surface;
a plurality of lines on the light receiving surface,
wherein each line of the plurality of lines comprises a plurality of pixels arranged in a direction, and
wherein the plurality of pixels are configured to generate a plurality of pixel signals based on an exposure start signal;
a first lens configured to form a first image on the light receiving surface;
a second lens configured to form a second image on the light receiving surface,
wherein the first image and the second image partially overlap each other at an overlapping portion; and
circuitry configured to:
sequentially select a first line from the plurality of lines, wherein the first line is in the overlapping portion of the first image;
supply the exposure start signal to the selected first line and a corresponding line in the overlapping portion of the second image,
wherein the corresponding line corresponds to the selected first line; and
combine a plurality of images formed from the plurality of pixel signals into one image.

US Pat. No. 10,194,085

IMAGE PICKUP APPARATUS AND ITS CONTROL METHOD

Canon Kabushiki Kaisha, ...

1. An image pickup apparatus comprising:an image processing unit configured to process an image;
a display unit configured to provide a live-view display in which images processed by the image processing unit are sequentially displayed; and
a control unit configured to make, when determining that the image pickup apparatus is panning, the image processing unit produce a synthesized image by synthesizing a plurality of images arranged in a time series, and the display unit display the synthesized image produced by the image processing unit as a frame image in the live-view display,
wherein the image processing unit synthesizes the plurality of frame images with one another within a synthesis number obtained from a shutter speed for still image pickup, and
wherein at least one processor or circuit is configured to perform a function of at least one of the units.

US Pat. No. 10,194,084

IMAGE PROCESSING DEVICE AND COMPUTER-READABLE STORAGE DEVICE FOR SELECTIVELY OUTPUTTING REFERENCE IMAGE AND SYNTHESIZED IMAGE

OLYMPUS CORPORATION, Tok...

1. An image processing device comprising:one or more processors comprising hardware, wherein the one or more processors are configured to:
calculate an estimated movement amount of a subject in each image of a plurality of images;
perform, based on the estimated movement amounts of the plurality of images, one of:
select and output an image that is most recently captured among the plurality of images; and
select a reference image from the plurality of images based on the estimated movement amounts of the subject in the plurality of images;
in response to selecting the reference image, determine a gain of the reference image; and
perform, based on the gain of the reference image, one of:
select and output the reference image; and
a synthesis process comprising:
select a synthesis target image from the plurality of images, the synthesis target image being different from the reference image; and
generate and output a synthesized image by synthesizing the synthesis target image and the reference image,
wherein the one or more processors are configured to:
determine whether the estimated movement amounts of the plurality of images is larger than a predetermined motion value; and
in response to a determination that the estimated movement amounts of the plurality of images is larger than the predetermined motion value, select and output the image that is most recently captured among the plurality of images.

US Pat. No. 10,194,083

WOBBLE DETECTION DEVICE

MITSUBISHI ELECTRIC CORPO...

1. A wobble detection device comprising:a sensor unit that includes a first one-dimensional image sensor and a second one-dimensional image sensor arranged side by side in an auxiliary scanning direction so that corresponding pixels of the first one-dimensional image sensor and the second one-dimensional image sensor coincide with each other in a main scanning direction, and acquires an image of an object moving in the auxiliary scanning direction as one-dimensional data,
the wobble detection device making a comparison of data corresponding to a same image region of the image by using first one-dimensional data acquired by the first one-dimensional image sensor and second one-dimensional data acquired by the second one-dimensional image sensor and thereby detecting a movement amount of the image in the main scanning direction between a time when the first one-dimensional data used for the comparison was acquired and a time when the second one-dimensional data used for the comparison was acquired.

US Pat. No. 10,194,082

IMAGE PICKUP APPARATUS THAT SHOOTS MOVING IMAGE FOR PREDETERMINED TIME PERIOD AT THE TIME OF SHOOTING STILL IMAGE, CONTROL METHOD FOR THE IMAGE PICKUP APPARATUS, AND STORAGE MEDIUM

CANON KABUSHIKI KAISHA, ...

1. An image pickup apparatus comprising:an image pickup unit;
one or more processors; and
at least one memory storing instructions which, when executed by the one or more processors, cause the image pickup apparatus to:
receive a first still image shooting instruction,
control to record, in a recording medium, a still image picked up by the image pickup unit in response to receiving the first still image shooting instruction, and a moving image picked up by the image pickup unit since a predetermined time period before receiving the first still image shooting instruction, and
when a second still image shooting instruction is received within a predetermined time period since receiving the first still image shooting instruction, control to record, in the recording medium, a moving image, picked up since the predetermined time period before receiving the first still image shooting instruction until a moving image shooting ending time corresponding to the second still image shooting instruction being received, as a sequence of moving images.

US Pat. No. 10,194,069

CREDENTIAL TRANSFER MANAGEMENT CAMERA SYSTEM

GoPro, Inc., San Mateo, ...

1. A camera comprising a processor and a non-transitory computer-readable storage medium containing instructions that, when executed by the processor, cause the camera to:configure the camera to operate as a wireless access point;
connect to a smart device configured to operate as a wireless station, wherein the smart device is a separate device from the camera;
request from the smart device a wireless credential to connect to a communication device configured to operate as a wireless access point;
receive from the smart device the wireless credential for the communication device; and
in response to reception of the wireless credential from the smart device:
switch the operation of the camera as a wireless access point to a wireless station; and
connect the camera to the communication device using the received wireless credential.

US Pat. No. 10,194,067

LIFELOG CAMERA AND METHOD OF CONTROLLING IN ASSOCIATION WITH AN INTRAPERSONAL AREA NETWORK

SONY MOBILE COMMUNICATION...

1. A method of controlling a lifelog camera associated with a first user, the method comprising:determining that a second intrapersonal area network (IAN) associated with a second user is in range of a first IAN associated with the first user based on the first user and the second user being in touching contact with each other;
determining if the second user is a target to be captured by the lifelog camera by communication between the first IAN and the second IAN; and
capturing an image of the second user with the lifelog camera based on determining that the second IAN is in range of the first IAN and that the second user is a target to be captured by the lifelog camera,
wherein at least one of the first IAN and the second IAN comprises a plurality of nodes adapted to be worn on or near the body of the user associated with the IAN and to be in communication with one another, and
wherein determining that the second IAN is in range of the first IAN includes detecting a signal strength of the second IAN and determining whether the detected signal strength meets a minimum threshold level.

US Pat. No. 10,194,057

METHOD FOR LIMITING AMOUNT OF INK DISCHARGED, METHOD FOR CREATING COLOR CONVERSION TABLE, GLOSS DETERMINATION DEVICE, RECORDING MEDIUM HAVING RECORDED THEREIN GLOSS DETERMINATION PROGRAM, AND GLOSS DETERMINATION METHOD

Screen Holdings Co., Ltd....

1. A method for limiting an amount of ink discharged in a photocurable inkjet printing apparatus that performs printing using inks of four CMYK colors, the method comprising:a conversion step of converting, for each ink color, an input grayscale value to an amount of ink; and
a limit value setting step of setting a limit value limiting a total amount for inks to be discharged, the total amount for inks being, obtained in the conversion step, the limit value including a first limit value limiting a total amount for all inks of a secondary color not including a K color component, a second limit value limiting a total amount for all inks of a tertiary color not including a K color component, and a third limit value limiting a total amount for all inks of a color including a K color component, wherein the second limit value is smaller than the first limit value, and the third limit value is smaller than the first limit value,
the limit value itself differs among the color including the K color component, the secondary color not including the K color component, and the tertiary color not including the K color component.

US Pat. No. 10,194,052

POST PROCESSING HALFTONE IMAGES

Hewlett-Packard Developme...

1. A method for post-processing halftone images, the method comprising:parsing a halftone image into a set of image cells, the halftone image generated by halftoning an original image;
determining an estimated colorimetric value for each of the image cells; and
selectively replacing at least one of the image cells of the halftone image with a replacement cell,
wherein the replacement cell has an area coverage representation with a replacement colorimetric value,
wherein the replacing is based on comparing the replacement colorimetric value to the estimated colorimetric value of the at least one of the image cells,
wherein the replacing is further based on comparing a value of a pre-determined metric for the replacement cell to a value of the pre-determined metric for the at least one of the image cells,
and wherein the halftone image is printed as the original image after the at least one image cell of the halftone image has been replaced with the replacement cell.

US Pat. No. 10,194,051

DEVICE FOR DETECTING AMOUNT OF SKEW IN DOCUMENT AND IMAGE PROCESSING APPARATUS

KONICA MINOLTA, INC., Ch...

11. An image processing apparatus comprising:a light source configured to apply light to a sheet-like document, the document being placed on a surface of a background plate or passing over the surface of the background plate;
a scan portion configured to scan an area including at least one edge of the document with light, by the light source, reflected from the document to obtain an input image;
a boundary point detector configured to detect, for each position in a main scanning direction, a boundary point between the document and the background plate in the input image;
a boundary point group of interest setting portion configured to set a boundary point group of interest from among the boundary points detected, the boundary point group of interest including two boundary points spaced away from each other in the main scanning direction and boundary points located between the two boundary points;
an oblique line setting portion configured to set a line which slants to the main scanning direction based on positions of the boundary point group of interest in the main scanning direction and in a sub-scanning direction;
a skew modifying portion configured to modify an amount of skew of the oblique line so that an error between the boundary point group of interest and the oblique line is reduced;
an amount of skew determination portion configured to determine that an amount of skew in the document is an amount of skew of the oblique line having the error equal to or smaller than a threshold; and
a skew correction portion configured to apply, to the input image, correction processing in accordance with an amount of skew in the document determined by the amount of skew determination portion.

US Pat. No. 10,194,050

IMAGE PROCESSING APPARATUS, IMAGE PROCESSING METHOD, AND STORAGE MEDIUM IN WHICH BACKGROUND REMOVAL IS PERFORMED TO REMOVE A BACKGROUND INCLUDED IN AN INPUT IMAGE BASED ON PIXEL VALUES

Canon Kabushiki Kaisha, ...

1. An image processing apparatus comprising:(a) a first determination unit configured to determine an attribute of an area included in an input image obtained by reading a document;
(b) a second determination unit configured to determine saturation of an area determined to be a halftone dot area by the first determination unit; and
(c) a background removal unit configured to remove a background included in the input image, wherein the background removal unit converts:
(i) for an area determined to be a halftone dot area by the first determination unit and whose value indicating saturation is determined to be less than a predetermined value by the second determination unit, a color of a pixel of pixels making up the area, which has a pixel value greater than a first level, into white, and
(ii) for an area determined to be a halftone dot area by the first determination unit and whose value indicating saturation is determined to be greater than or equal to the predetermined value by the second determination unit, a color of a pixel of pixels making up the area, which has a pixel value greater than a second level, into white, and
wherein a pixel value specified by the first level is less than a pixel value specified by the second level, and
wherein the first determination unit, the second determination unit, and the background removal unit are implemented by at least one processor or at least one circuit.

US Pat. No. 10,194,048

IMAGE COMMUNICATION APPARATUS, METHOD OF CONTROLLING SAME, AND STORAGE MEDIUM FOR DISPLAYING ADDRESSES FROM ADDRESS BOOK

Canon Kabushiki Kaisha, ...

1. A data processing apparatus which is able to communicate with an external apparatus, comprising:a storage configured to store a first address book for an administrator and a second address book for a user other than the administrator;
a display configured to display at least one address included in an address book; and
a controller configured to set a transfer destination of received data from the at least one address displayed by the display,
wherein the received data is transferred to the set transfer destination;
wherein the display initially displays, in a case where the display displays at least one address included in an address book stored in the storage in accordance with a display request of the transfer destination, at least one address included in the first address book without initially displaying an address included in the second address book, and
wherein the display initially displays, in a case where the display displays at least one address included in an address book stored in the external apparatus in accordance with a display request of the transfer destination, at least one address in all address books that the external apparatus has.

US Pat. No. 10,194,047

INFORMATION PROCESSING DEVICE AND NON-TRANSITORY RECORDING MEDIUM

KONICA MINOLTA, INC., Ch...

1. An information processing device includes a first wireless communication device that establishes a short-range wireless communication with a first image forming device in a local network and a second wireless communication device that establishes a wireless communication with a wireless communication device connected to said local network, comprising a hardware processor that:enables said first wireless communication device to establish the short-range wireless communication with said first image forming device, thereby obtaining an IP address of said first image forming device in said local network; and
enables said second wireless communication device to send a search command for searching for a second image forming device in said local network to each of a multiple IP addresses in said local network except for the IP address of said first image forming device using unicast transmission via said wireless communication device based on the IP address of said first image forming device.

US Pat. No. 10,194,045

PRINTER POWER MANAGEMENT

Hewlett-Packard Developme...

1. A system for printer power management, comprising:a processing resource;
a memory resource having instructions stored thereon that when executed by the processing resource are to form a system power control engine and a state machine engine;
the system power control engine to:
receive a power usage estimate from each of a plurality of components of a printing device; and
schedule a deferred service routine to identify a level of real-time performance of the plurality of components; and
the state machine engine to:
estimate how close a power supply coupled to the printing device is to an over-power failure (OPF) based on the real-time performance;
identify an imminent OPF based on the estimated closeness of the OPF of the power supply, wherein the imminent OPF is identified when the real-time usage exceeds a particular threshold corresponding to the state machine engine; and
provide information about the imminent OPF to the plurality of components to reduce power usage within a threshold period of time.

US Pat. No. 10,194,043

APPARATUS AND METHOD OF DETECTING DECOLORATION INK IMAGE

KABUSHIKI KAISHA TOSHIBA,...

1. A detection apparatus for detecting a decolorable ink image, comprising:an image reading unit that generates image data by reading a sheet;
a decoloration unit that performs a decoloration processing on the sheet so that a decolorable image formed with decolorable ink on the sheet is partially decolored forming a mixed pattern of decolored sections of the decolorable image and non-decolored sections of the decolorable image, the decoloration unit including a heat roller having a plurality of heating sections and non-heating sections alternately arranged on an outer surface of the heat roller, and a pressure roller that applies pressure to the sheet conveyed between the outer surface of the heat roller and the pressure roller;
a sheet transfer unit that transfers the sheet to the image reading unit before the decoloration processing by the decoloration unit and returns the sheet to the image reading unit after the decoloration processing by the decoloration unit;
a plurality of sheet ejection trays;
a sheet ejection unit that ejects the sheet after the decoloration processing is executed to any of a plurality of the sheet ejection trays; and
a controller that
acquires a first image data generated by the image reading unit reading the sheet before the decoloration processing is executed by the decoloration unit,
acquires a second image data generated by the image reading unit reading the sheet after the decoloration processing is executed by the decoloration unit,
determines a difference between the first image data and the second image data,
determines whether or not the decolorable ink is used on the sheet based on the determined difference between the first image data and the second image data, and
controls the sheet ejection unit such that the sheet is ejected to one of the sheet ejection trays if there is a difference between the first image data and the second image data and the sheet is ejected to a different sheet ejection tray if there is no difference between the first image data and the second image data.

US Pat. No. 10,194,041

IMAGE FORMING APPARATUS, MOBILE DEVICE, METHOD FOR CLASSIFYING DOCUMENT, AND COMPUTER READABLE RECORDING MEDIUM

S-Printing Solution Co., ...

1. An image forming apparatus comprising:a scanner to scan a plurality of manuscripts;
a touch screen; and
at least one processor to:
control the touch screen to display a first user interface (UI) for selecting one of a plurality of displayed classification standards,
control the touch screen to display a second UI for selecting one of a plurality of classification output types, the second UI being displayed after receipt of the selection on the first UI,
generate classification information of the plurality of manuscripts using a scanning result of the plurality of manuscripts, and
control the scanner to output the plurality of manuscripts according to the selected classification output type,
wherein the plurality of displayed classification standards comprise two or more of a reusable paper classification, a document keyword classification, a document form classification, or a document security classification, and
wherein the classification information corresponds to the selected classification standard and comprises information related to each of the plurality of manuscripts.

US Pat. No. 10,194,040

APPARATUS, METHOD AND STORAGE MEDIUM THAT STORES PROGRAM

Canon Kabushiki Kaisha, ...

1. An apparatus which is able to perform a single area mode in which a single display area occupies a screen and a multi-area mode in which a plurality of display areas share the screen, the apparatus comprising:at least one processor operating to:
cause a display unit to display a predetermined notification indicating an error state; and
change a state of the predetermined notification in response to a user operation on a specified button provided in an external apparatus,
wherein the specified button is set to be able to change, in response to the user operation on the specified button, the state from a non-display state in which the predetermined notification is not displayed even in the error state, to a display state in which the predetermined notification is displayed in the error state, and
wherein, in a case where the state is changed from the non-display state to the display state in response to the user operation on the specified button while the single area mode in which a display target is displayed in the single display area is being performed, the predetermined notification is displayed within the single display area in which the display target is being displayed.

US Pat. No. 10,194,039

PRINTING RESULT ESTIMATION APPARATUS AND COMPUTER PROGRAM

Kabushiki Kaisha Toshiba,...

1. A printing result estimation apparatus comprising:a print condition obtaining unit configured to obtain condition information indicating a selected print condition set by a user;
a status obtaining unit configured to periodically obtain status information of an image forming apparatus;
a print result estimation unit configured to estimate an execution result of a printing process based on the condition information and the status information when a status of the image forming apparatus is determined to have changed based on the periodically obtained status information, wherein the estimated execution result includes an effect of printing on cost factors, environmental factors, and a time required to execute printing;
a print condition estimation unit configured to obtain a selected print result set by the user and estimate an allowable print condition required for obtaining the selected print result, the selected print result including at least one of an allowable cost of printing, an allowable environmental impact of printing, and a time allowed to execute printing; and
a display device controlled to display a print result estimate of the print result estimation unit and to display the allowable print condition estimated by the print condition estimation unit.

US Pat. No. 10,194,024

NUMBER PORTABILITY DETERMINATION IN VARIABLE NUMBERING PLAN

TELEFONAKTIEBOLAGET LM ER...

1. A system configured for determining if a telephony network number is ported, comprising:a first network node configured to receive a number message comprising at least a first part of a dialed number identifying a called party; and
a number portability database, containing routing numbers associated with entries in the database;
the first network node being configured to compare the number message with entries in the database, and the first network node being configured such that:
if the number message or a first part of the number message uniquely matches with the whole of an entry in the database and does not match with part of another entry in the database, the first network node determines that a best match has been found and routes a call to a second network node identified by the routing number associated with said entry,
if the number message matches with at least part of at least one entry in the database, the first network node determines that at least one partial match has been found, retrieves a further part of the dialed number and repeats said comparison based on a new number message comprising said first part of the dialed number and said further part of the dialed number, and
if at least a first part of the number message cannot be matched to the whole of any entry in the database, the first network node determines that no match has been found and routes a call to a second network node identified by the dialed number.

US Pat. No. 10,194,023

VOICE USER INTERFACE FOR WIRED COMMUNICATIONS SYSTEM

Amazon Technologies, Inc....

1. A computer-implemented method comprising:receiving, via a data network and from an adapter connected to a public switched telephone network (PSTN) via at least one port, a first notification indicating an incoming telephone call from the PSTN, the first notification corresponding to a first ringing signal received by the adapter from the PSTN;
generating first text data that indicates the incoming telephone call;
generating, using text-to-speech processing, first audio data using the first text data;
receiving, via the data network and from the adapter, a second notification corresponding to the incoming telephone call, the second notification corresponding to a second ringing signal received by the adapter from the PSTN, the second notification including caller identification associated with the incoming telephone call that is received from the PSTN, the caller identification indicating at least one of a phone number or a name;
determining contact information associated with the caller identification, the contact information associated with at least one of the phone number or the name;
generating second text data corresponding to the contact information;
generating, using text-to-speech processing, second audio data using the second text data;
generating combined audio data by combining the first audio data and the second audio data; and
sending, to a device via the data network, the combined audio data.

US Pat. No. 10,194,019

METHODS AND SYSTEMS FOR INITIATING A PHONE CALL FROM A WIRELESS COMMUNICATION DEVICE

QUALCOMM Incorporated, S...

1. A method for initiating a call from a wireless communication device, comprising:receiving sensor data from a first sensor in the wireless communication device during a user interaction time interval;
detecting a plurality of user interactions on the wireless communication device during the user interaction time interval based on the sensor data;
for each respective user interaction of the plurality of user interactions:
determining a magnitude of the respective user interaction; and
incrementing a number of user interactions if the magnitude of the respective user interaction is greater than a threshold;
determining a contact number associated with the number of user interactions by:
querying a contact repository based on at least the number of user interactions; and
receiving the contact number associated with the number of user interactions; and
causing the wireless communication device to dial the contact number at an end of the user interaction time interval.

US Pat. No. 10,194,014

SWITCHING BETWEEN WATCHES

Apple Inc., Cupertino, C...

1. A non-transitory machine-readable medium storing executable program instructions which when executed by a data processing system cause the data processing system to perform operations comprising:receiving, at a companion device, data from a first paired device that is paired with the companion device, the first paired device being an active paired device when the data is received;
storing received data in a first store of the companion device, wherein once the data is stored in the first store, the data cannot be accessed when the companion device is locked; and
storing the received data in a second store of the companion device, the received data in the second store for use in synchronizing a second paired device with the companion device when the second paired device becomes the active paired device and the first paired device is no longer the active paired device.

US Pat. No. 10,194,008

COMMUNICATION DEVICE, NETWORK MONITORING DEVICE SYSTEM, AND INFORMATION NOTIFICATION METHOD

NEC Corporation, Tokyo (...

1. A communication device connected to a network monitoring device, together with another communication device, wherein the communication device constitutes a redundant configuration together with the another communication device, the communication device comprising:a memory storing information, and
a processor configured to output predetermined information it has measured while performing a predetermined operation as the active device of the redundant configuration, to the network monitoring device, upon occurrence of a predetermined event;
wherein upon occurrence of the predetermined event, the processor increments a predetermined number by a predetermined value and then outputs the incremented predetermined number along with the predetermined information, and stores the predetermined number and the predetermined information in the memory in a manner to correlate them with each other; and wherein
if receiving a request for resending of the predetermined information, the processor outputs the predetermined information stored in the memory in a manner to be correlated with the predetermined number included in the request, to the network monitoring device.

US Pat. No. 10,194,006

PHYSICAL LAYER FRAME FORMAT FOR WLAN

Marvell World Trade Ltd.,...

1. A method for generating a physical layer (PHY) data unit for transmission via a communication channel, the PHY data unit conforming to a first communication protocol, the method comprising:generating, at a first communication device, a PHY preamble for the PHY data unit, including:
generating a signal field,
including the signal field and a duplicate of the signal field in the PHY preamble, wherein presence of the duplicate of the signal field indicates to second communication devices that conform to the first communication protocol that the PHY data unit conforms to the first communication protocol, and
formatting the PHY preamble such that a first portion of the PHY preamble is decodable by a third communication device that conforms to a second communication protocol, but does not conform to the first communication protocol, to determine a duration of the PHY data unit based on the first portion of the PHY preamble; and
generating, at the first communication device, the PHY data unit to include the PHY preamble and a PHY payload.

US Pat. No. 10,194,003

INFORMATION PROCESSING APPARATUS, SERVER-CLIENT SYSTEM, CONTROL METHOD OF INFORMATION PROCESSING APPARATUS, AND STORAGE MEDIUM

CANON KABUSHIKI KAISHA, ...

4. A control method for an information processing apparatus including an embedded client and server for managing, by a database, setting information of each of a plurality of clients including the embedded client and a network client, the control method comprising:performing, if an input for changing a value of address information as a network setting of the information processing apparatus is performed on the information processing apparatus, update processing for updating a connection destination address managed by the database for each client with the value corresponding to the changing, wherein the changing is not reflected as the network setting of the information processing apparatus until the value used for the update processing is transmitted to all of the plurality of clients; and
transmitting the value of the connection destination address managed by the database for each client to each client in response to a request from each client,
wherein, in the network client, setting information which is used by the network client to access the server is updated with the transmitted value, and
wherein the changing is reflected as the network setting of the information processing apparatus after the value used for the update processing has been transmitted to all of the plurality of clients.

US Pat. No. 10,193,985

METHOD AND DEVICE FOR PERFORMING SERVICE DISCOVERY IN WIRELESS COMMUNICATION SYSTEM

LG Electronics Inc., Seo...

1. A method of performing service discovery performed by a first NAN (neighbor awareness networking) device in a wireless communication system, the method comprising:exchanging a subscribe message with a second NAN device; and
transmitting a first service discovery frame (SDF) based on the exchanged subscribe message,
wherein the first service discovery frame comprises a NAN connection capability attribute field,
wherein the NAN connection capability attribute field comprises a first type interface information field indicating whether the first NAN device supports a first type interface, and
wherein the NAN connection capability attribute field further comprises a beacon frame field containing information about a beacon frame associated with the first type interface.

US Pat. No. 10,193,977

SYSTEM, DEVICE AND PROCESS FOR DYNAMIC TENANT STRUCTURE ADJUSTMENT IN A DISTRIBUTED RESOURCE MANAGEMENT SYSTEM

HUAWEI TECHNOLOGIES CO., ...

1. A process for managing workloads by a distributed resource management system of a distributed computing system, the process comprising:receiving a tenant update for a hierarchical queue, the hierarchical queue comprising tenants and sub-tenants, the tenant update identifying a modification to a tenant or sub-tenant of the hierarchical queue;
retrieving, by a rule-based workload management engine, a rule having a tenant event corresponding to the tenant update, wherein the rule-based workload management engine retrieves the rule from a database storing rules, each rule stored in the database including a tenant event identifying a tenant or sub-tenant of the tenants or sub-tenants the rule is applicable to and an action for one or more workloads of the tenant or sub-tenant;
determining, from the retrieved rule, the action for the one or more workloads of the tenant or sub-tenant identified in the tenant event of the retrieved rule, each of the one or more workloads of the tenant or sub-tenant identified associated with a resource request; and
applying the action for the one or more workloads of the tenant or sub-tenant, without interrupting execution of any workloads of other tenants or sub-tenants of the hierarchical queue.

US Pat. No. 10,193,975

MANAGING MULTIPLE CLOUD STORES THROUGH A WEB SERVICE

Microsoft Technology Lice...

1. A computing system, comprising:a processor; and
memory storing instructions executable by the processor, wherein the instructions, when executed, configure the computing system to:
receive, from a client device through a storage system-independent application programming interface, a call that is associated with an application on the client device and indicates a data access request to move an identified file from a first cloud-based storage system to a second cloud-based storage system, wherein
the first cloud-based storage system implements a first storage system-specific interface, and
the second cloud-based storage system implements a second storage system-specific interface that is different than the first storage system-specific interface;
perform an authentication operation to authenticate the application to the first cloud-based storage system;
transform the call into a storage system-specific call that is configured in accordance with the first storage system-specific interface; and
execute the storage system-specific call against the first storage system-specific interface to perform the operation, by moving the identified file from the first cloud-based storage system to the second cloud-based storage system without downloading the identified file to the client device.

US Pat. No. 10,193,967

REDIRECTING DEVICES REQUESTING ACCESS TO FILES

Oracle International Corp...

1. A non-transitory computer readable medium comprising instructions which, when executed by one or more hardware processors, causes performance of operations comprising:receiving, at a first storage node of a plurality of storage nodes, a first file download request for a file;
wherein the first storage node has dual functionality to (a) serve file requests and (b) select other nodes to serve file requests;
serving, by the first storage node, the first file download request for the file;
receiving, at the first storage node, a second file download request for the file from a requesting device;
determining that an access load corresponding to the first storage node exceeds a threshold value;
responsive to determining that the access load corresponding to the first storage node exceeds the threshold value:
identifying, by the first storage node, at least two storage nodes in the plurality of storage nodes that can serve the second file download request for the file;
selecting, by the first storage node, a second storage node from the at least two storage nodes to serve the second file download request for the file;
wherein the second storage node is selected by the first storage node based on the second storage node having a higher priority value, than other nodes in the at least two storage nodes, for serving a geographical region of the requesting device; and
redirecting the requesting device to the second storage node that stores the file.

US Pat. No. 10,193,952

SYSTEMS AND METHODS FOR INTEGRATING EXTERNAL RESOURCES FROM THIRD-PARTY SERVICES

UberGrape GmbH, Vienna (...

1. A system for facilitating intelligent communication between users, the system comprising:a processor communicatively coupled to a memory and a network-accessible device, the processor operable to execute instructions stored in the memory; and
the memory, which includes specific instructions for facilitating intelligent communication, wherein the specific instructions cause the processor to:
identify a plurality of databases associated with different sources, wherein each of the plurality of databases hosts electronic resources;
integrate the electronic resources hosted by the plurality of databases by tagging metadata associated with each electronic resource;
index the metadata to make the electronic resources searchable using a single search architecture;
receive a communication entered by a user on the network-accessible device;
identify recognizable elements within the communication using natural language processing techniques; and
detect a reference to a desired electronic resource within the communication.

US Pat. No. 10,193,921

MALWARE DETECTION AND PREVENTION SYSTEM

Level 3 Communications, L...

1. A method for managing access to a public network, the method comprising:utilizing a control system to control a computing device to access a first node in the public network;
applying a personality profile to the computing device to access a second node in the public network, the personality profile comprising a plurality of inputs provided to the computing device, the plurality of inputs applied to a browser program displayed on a display of the computing device to mimic characteristics of a user associated with the computing device;
analyzing transmission of information between the computing device and the public network, in response to the browser program, during accessing of the second node of the public network;
detecting an indication of a malware program stored in the public network accessible through the second node based on the analyzed transmission of information; and
storing information of the malware program in a database according to the detected indication of the malware program.

US Pat. No. 10,193,917

RULE-BASED NETWORK-THREAT DETECTION

Centripetal Networks, Inc...

1. A method comprising:receiving, by a packet-filtering device, a plurality of packets;
responsive to a determination by the packet-filtering device that a first packet of the plurality of packets corresponds to one or more packet-filtering rules:
applying, by the packet-filtering device and to the first packet, an operator specified by a corresponding packet-filtering rule and configured to cause the packet-filtering device to either prevent the first packet from continuing toward a destination of the first packet or allow the first packet to continue toward the destination of the first packet; and
generating, by the packet-filtering device, a packet log entry comprising at least one threat identifier corresponding to the first packet and data indicating whether the packet-filtering device prevented the first packet from continuing toward the destination of the first packet or allowed the packet to continue toward the destination of the first packet;
updating, by the packet-filtering device and based on the packet log entry, a packet flow entry, corresponding to the generated packet log entry, of packet flow analysis data for a plurality of logged packets, wherein the packet flow analysis data comprises data corresponding to a plurality of packet flow entries, and wherein each packet flow entry consolidates a plurality of packet log entries corresponding to a common threat identifier;
communicating, by the packet-filtering device and to a computing device, the packet flow analysis data; and
causing, based on the communicated packet flow analysis data, display of at least a portion of the packet flow analysis data,
wherein the packet flow analysis data comprises at least one threat identifier corresponding to each of the plurality of logged packets, packet time data for packets corresponding to the packet flow entry, and data indicating whether the packet-filtering device prevented packets from continuing toward a respective destination or allowed packets to continue toward the respective destination.

US Pat. No. 10,193,907

INTRUSION DETECTION TO PREVENT IMPERSONATION ATTACKS IN COMPUTER NETWORKS

Cisco Technology, Inc., ...

1. A data processing method comprising:storing, by a central computer, authentication records in a hosts database, wherein each authentication record comprises a certificate and a host identifier of a sender computer;
receiving, by the central computer, a suspect record that was sent by a first intrusion sensor, from one or more intrusion sensors, and that comprises a first particular certificate and a first particular host identifier of a suspect sender computer, wherein the suspect record is generated based on network telemetry data exchanged in compliance with an Internet Protocol Flow Information Export (IPFIX) or a NetFlow protocol;
determining, by the central computer, whether the hosts database contains a matching record having a same certificate as the first particular certificate of the suspect record and a same host identifier as the first particular host identifier of the suspect record, the first particular certificate comprising a first particular thumbprint of a first particular public key certificate, the first particular host identifier comprising an Internet Protocol (IP) address of the suspect sender computer;
in response to determining, by the central computer, that the hosts database does not contain the matching record, generating, by the central computer, an intrusion alert;
propagating, by the central computer, the intrusion alert to the one or more intrusion sensors to ban network traffic from the suspect sender computer; and
instructing the one or more intrusion sensors to periodically request a second particular certificate from the suspect sender computer.

US Pat. No. 10,193,905

METHOD AND APPARATUS FOR ADAPTIVE CACHE MANAGEMENT

Samsung Electronics Co., ...

1. A method for processing data by a terminal implemented using at least one hardware processor, the method comprising:identifying, by the terminal, a plurality of inspection types for a packet;
determining, by the terminal, an inspection type from the plurality of inspection types for the packet based on a network type for transmitting or receiving the packet and an Internet Protocol (IP) version; and
processing, by the terminal, the determined inspection type for the packet,
wherein the network type includes at least one of a Wi-Fi network and a cellular network, and
wherein determining the inspection type comprises determining, by the terminal, if at least one packet is transmitted or received through an application being executed in the terminal, a size of the at least one packet is over a predetermined size that can be transmitted through an application, to process a security inspection for the packet.

US Pat. No. 10,193,901

INTERFACE PROVIDING AN INTERACTIVE TIMELINE FOR EVALUATING INSTANCES OF POTENTIAL NETWORK COMPROMISE

Splunk Inc., San Francis...

1. A method comprising:receiving event data generated by network activities of entities that interact with a computer network, wherein the event data comprises machine data, and the entities include at least one of computer users and devices in communication with the computer network;
identifying instances of potential network compromise from the event data comprising threats based on one or more anomalies automatically triggered by detecting deviations from expected or permitted network activities, wherein each of the instances of potential network compromise is classified by type and associated with a time period of occurrence and an entity or entities that participated in the network activity that triggered the corresponding automated determination;
causing display, in a graphical user interface, of an interactive graphic of data values indicating identified instances of potential network compromise occurring at time periods along a timeline, including graphical representations indicating a level of risk and the number of instances of network compromise occurring during a same time period;
upon receiving a selection by a user, via the graphical user interface, of a time period from the timeline, causing display of a listing of each identified instance of potential network compromise occurring at the selected time period, the listing including the type of instance and each associated entity; and
upon receiving a selection of a threat from the listing of instances of potential network compromise, causing display of a graphical representation of a relationship between the entities participating in the network activities that triggered the threat, wherein the display includes one or more lines that connect the entities whose participation together in a network activity triggered an anomaly, and upon receiving a selection of a line in the display, causing the type of the anomaly to be displayed.

US Pat. No. 10,193,899

ELECTRONIC COMMUNICATION IMPERSONATION DETECTION

Symantec Corporation, Mo...

1. A computer-implemented method for detecting electronic communication impersonation, comprising:connecting to a first device in a geographic area via a wireless connection;
initiating a request relating to the first device via the wireless connection, wherein the request comprises a randomized request sent to a designated source before other wireless communications are sent;
monitoring wireless communications within the geographic area;
registering system events for a predetermined period based at least in part on the monitoring;
identifying a second request initiated by a second device based at least in part on the registering, the second request relating to the first device, wherein the registered system events comprise network traffic associated with the first device and the second device;
comparing the initiated request and the second request;
identifying that at least a portion of the initiated request is identical to at least a portion of the second request based at least in part on the comparing;
analyzing, from the registered system events, at least a portion of the network traffic associated with the first device and the second device;
determining a suspicious event status relating to the second device based at least in part on the analyzing, wherein the suspicious event status is based at least in part on the registered system events exceeding a confidence threshold that the at least portion of the network traffic was repeated by the first device and the second device, wherein determining the suspicious event status is based at least in part on a response relating to the randomized request; and
transmitting, to the first device, an indication of the suspicious event status relating to the second device.

US Pat. No. 10,193,871

INFORMATION PROCESSING APPARATUS, CONTROL METHOD, AND PROGRAM

CANON KABUSHIKI KAISHA, ...

1. A camera comprising:a hardware processor; and
a memory for storing instructions to be executed by the hardware processor,
wherein, when the instructions stored in the memory are executed by the hardware processor, the camera functions as:
a first processing unit configured to perform a setting for performing encrypted communication on the camera in response to a command based on a Device Management service defined in the Open Network Video Interface Forum (ONVIF) standard;
a second processing unit configured to perform a setting for performing encrypted communication on the camera in response to a command based on an Advanced security service defined in the ONVIF standard; and
a transmitting unit configured to transmit information indicating that the setting for performing the encrypted communication is made in response to the command based on the Device Management service defined in the ONVIF standard to a client apparatus if the command based on the Advanced security service defined in the ONVIF standard is received from the client apparatus after the first processing unit performs the setting for performing the encrypted communication on the camera in response to the command based on the Device Management service defined in the ONVIF standard.

US Pat. No. 10,193,866

PRIVATE NETWORK PEERING IN VIRTUAL NETWORK ENVIRONMENTS

Amazon Technologies, Inc....

1. A provider network, comprising;a network substrate;
a plurality of host devices implementing a plurality of resource instances for clients of the provider network, wherein subsets of the resource instances are provisioned in virtual networks for the clients on the provider network;
one or more computing devices implementing a peering service, wherein the one or more computing devices implementing the peering service are configured to:
determine routing information for routing network packets between one or more resource instances of a first virtual network and one or more resource instances of another virtual network via a peering on the provider network; and
enable the first virtual network and the other virtual network to exchange network packets via the peering on the provider network, wherein the packets are addressed to respective private IP addresses of the first virtual network or the other virtual network when being transmitted from a resource instance of the first virtual network or the other virtual network.

US Pat. No. 10,193,856

METHOD, TERMINAL, AND SERVER FOR PROVIDING COMMUNICATION SERVICE

Samsung Electronics, Co.,...

1. A communication service method of a terminal, the method comprising:generating a transmission control protocol (TCP) connection request;
determining a communication network type for transmitting the TCP connection request to a server;
mapping a first internet protocol (IP) address associated with a first communication network to a virtual address, when the communication network type is determined to the first communication network;
transmitting a first mapping request message including first information on the first IP address and the virtual address to the server through the first communication network;
mapping a second IP address associated with a second communication network to the virtual address, when a handover from the first communication network to the second communication network is detected; and
transmitting a second mapping request including second information on the second IP address and the virtual address to the server through the second communication network.

US Pat. No. 10,193,851

TECHNIQUES FOR MAPPING MACHINE TO MACHINE COMMUNICATION TO DIFFERENT UNDERLYING NETWORKS

ZTE Corporation, Shenzhe...

1. A method for facilitating Machine-to-Machine (M2M) communication, the method comprising:providing a first machine identification to an M2M node, the first machine identification being specific to an underlying communication network via which the M2M node is communicatively accessible;
acquiring a second machine identification given to the M2M node, the second machine identification being specific to an M2M application layer by which other M2M application layer entities can communicate with the M2M node, wherein
the second machine identification is added as an additional attribute to an application resource structure of the M2M node,
the application resource structure is included at a Common Services Entity of an Infrastructure Node, and the application resource structure represents information about the M2M application layer known to the Common Service Entity of the Infrastructure Node;
storing a mapping between the first machine identification and the second machine identification; and
triggering the M2M node using the mapping.

US Pat. No. 10,193,849

DETERMINING STORIES OF INTEREST BASED ON QUALITY OF UNCONNECTED CONTENT

Facebook, Inc., Menlo Pa...

1. A computer-implemented method comprising:storing user profiles for users of the social networking system, each user profile comprising connections between one of the users and pages of social networking system, the connections representing interactions performed by the users on the pages of the social networking system;
receiving a plurality of content items posted on an additional page of the social networking system;
determining, by a processor, from the plurality of content items, a subset of content items determined to be high quality content items, the determination of the high quality content items comprising: computing a quality score representing a lexical quality for the content item;
extracting topics from the content items of the subset by analyzing terms and phrases of the content items of the subset;
selecting one of the content items of the subset having an extracted first topic;
mapping the extracted first topic to one or more related pages of the social networking system, the mapping comprising:
determining a first rate of interactions performed by additional users of the social networking system on the content item and additional rates of interactions performed by the additional users on the one or more related pages by accessing connections stored in the user profiles of the additional users of the social networking system; and
comparing the first rate of interactions to each of the additional rates of interactions;
for one of the one or more related pages:
identifying a user of the social networking system that previously interacted with the related page and previously did not interact with the additional page by accessing the connections in a stored user profile for the user of the social networking system; and
providing the content item in a newsfeed for display to the user.

US Pat. No. 10,193,848

SYSTEM AND RELATED METHOD FOR MANAGEMENT OF DEVICES OF A NETWORK SYSTEM VIA SOCIAL MEDIA INTERFACES

Extreme Networks, Inc., ...

1. A non-transitory social media agent implemented at one or more hardware computer devices for exchanging network management messages with a network infrastructure device of a network system via one or more social media interfaces, the social media agent comprising:a social media interface configured to receive an incoming message having a first message configuration via a social media network;
a session agent configured to translate the received incoming message into a command executable by the network infrastructure device of the network system, wherein the executable command has a second message configuration different from the first message configuration;
a network management interface configured to receive a log message acknowledging receipt of the executable command from the network infrastructure device, wherein the log message has the second message configuration;
the session agent being configured to translate the log message into an outgoing message having the first message configuration and select the social media network or another social media network for transmitting the outgoing message based on content of the outgoing message and a messaging format requirement defined by the social media network; and
the social media interface being configured to transmit the outgoing message having the first message configuration via the social media network.

US Pat. No. 10,193,841

PRODUCT ONBOARDING VIA MESSAGES

Microsoft Technology Lice...

1. A computer-implemented method comprising:accessing, via one or more data sources, email content data describing an email type of an email to be transmitted to a particular member of an online social network service;
accessing, via the one or more data sources, candidate information identifying a set of candidate onboarding content items associated with the email type, each of the onboarding content items in the set being configured to promote a product feature associated with the online social network service;
removing, from the set, a first subset of the candidate onboarding content items, responsive to determining that the particular member has already been onboarded to products associated with the candidate onboarding content items in the first subset;
removing, from the set, a second subset of the candidate onboarding content items, responsive to determining that the particular member has previously viewed and not further interacted with the candidate onboarding content items in the second subset after being exposed to the candidate onboarding content in accordance with an impression capping rule that is tuned to the particular member; and
dynamically selecting, using one or more processors, a specific onboarding content item from the set of candidate onboarding content items for inclusion in a portion of the email along with content displayed in an additional portion of the email.

US Pat. No. 10,193,839

MANAGING SECURITY IN MESSAGING PROTOCOL COMMUNICATIONS

Amazon Technologies, Inc,...

1. A computer-implemented method for managing the execution of commands on a computing device utilizing a messaging protocol comprising:receiving, at a message processing service, from an administrative client device, information related to configuration of message processing functionality to publish messages to a subset of registered devices to receive messages published in accordance with a topic, wherein the messages are formed in accordance with the MQ Telemetry Transport protocol;
receiving, by the message processing service, a received message from a device, wherein the received message includes a topic portion that includes one or more levels associated with subject matter descriptors;
identifying, by the message processing service, a set of recipient devices registered to receive messages based on the topic portion of the messages;
processing, by the message processing service, the received message to identify a security identifier and additional information to select a subset of the recipient devices based on evaluation of at least one of a set of business rules or routing tables; and
publishing, by the message processing service, the processed received message based, at least in part, on the processing of the received message.

US Pat. No. 10,193,828

EDGE DATAPATH USING INTER-PROCESS TRANSPORTS FOR CONTROL PLANE PROCESSES

NICIRA, INC., Palo Alto,...

1. A method for implementing a gateway datapath for a logical network, the gateway datapath comprising a plurality of pipeline stages corresponding to entities of the logical network, the method comprising:receiving a packet from a network external to the logical network at the gateway datapath, the gateway datapath executing in a user space of the computing device;
executing a first set of pipeline stages in the plurality of pipeline stages to process the received packet, the plurality of pipeline stages corresponding to logical entities along the data path, wherein one of the pipeline stages of the first set identifies the packet as a control plane packet; and
based on the identification of the packet as a control plane packet, transporting the packet to a kernel network stack via a user-kernel transport, wherein the network stack provides the packet to a control plane process, wherein transporting the packet to the kernel network stack bypasses a second set of pipeline stages in the plurality of pipeline stages subsequent to the particular pipeline stage.

US Pat. No. 10,193,827

HOT CARRIER INJECTION TOLERANT NETWORK ON CHIP ROUTER ARCHITECTURE

1. An apparatus comprising:a plurality of input buffers that receives a plurality of input buffer data bits;
a plurality of multiplexers that shuffles the plurality of input buffer data bits to output multiplexer outputs, wherein the multiplexer outputs are buffered by a plurality of buffers to output a plurality of shuffled input buffer data bits;
a coupling module comprising semiconductor gates that switches first input buffer data bits of the plurality of input buffer data bits at the plurality of input buffers from first shuffled input buffer data bits to second shuffled input buffer data bits using the plurality of multiplexers in response to reaching an end of a time interval to reduce hot carrier injection for the apparatus;
a selector comprising semiconductor gates that receives the plurality of shuffled input buffer data bits at a plurality of decoders and selects, using the plurality of decoders, a virtual channel path to a virtual channel of the plurality of virtual channels for the shuffled input buffer data bits;
a connection module comprising semiconductor gates that switches the second shuffled input buffer data bits from a first virtual channel to a second virtual channel of the plurality of virtual channels using the plurality of decoders in response to reaching the end of the time interval to reduce the hot carrier injection for the apparatus.

US Pat. No. 10,193,823

RICH RESOURCE MANAGEMENT INCORPORATING USAGE STATISTICS FOR FAIRNESS

Microsoft Technology Lice...

1. A system comprising:a processor and memory; and
an application executed by the processor and memory, the application configured to:
receive feedback from a target regarding ability of a plurality of resources of the target to service requests from one or more clients, the feedback including a metric indicative of a load of each of the resources;
calculate weights for the resources based on the feedback, wherein a weight for a resource is based on a product of a first term that determines a maximum difference in probabilities of selection between two resources and a second term including an exponent that is a difference between a current load of the resource and a current minimum load across the resources determined based on the feedback; and
select, for servicing a request from one of the clients, one of the resources in round robin manner based on the weights of the resources to evenly utilize the plurality of resources.

US Pat. No. 10,193,822

PREDICTIVE AUTO-SCALING AND REACTIVE AUTO-SCALING FOR NETWORK ACCESSIBLE MESSAGING SERVICES

Amazon Technologies, Inc....

1. A service provider network comprising:a network-accessible message processing service comprising asynchronous messaging protocol (AMP) infrastructure and configured to process messages;
a message prediction service configured to analyze control metrics for the network-accessible message processing service;
a resource management service configured to (i) predict, based upon the analyzing, a predicted level of resources needed by the network-accessible message processing service for processing of messages, and (ii) allocate, based at least in part upon the predicted level of resources, a first level of resources for the network-accessible message processing service for processing of messages;
a network-accessible queuing service configured to receive a stream of messages for processing by the network-accessible message processing service; and
a health check service configured to monitor an enqueue rate of messages at the network-accessible queuing service,
wherein based upon the monitoring, the resource management service is further configured to adjust the first level of resources for the network-accessible message processing service to a second level of resources.

US Pat. No. 10,193,821

ANALYZING RESOURCE PLACEMENT FRAGMENTATION FOR CAPACITY PLANNING

Amazon Technologies, Inc....

1. A distributed system, comprising:a plurality of resource hosts implementing a plurality of resources for the distributed system;
a capacity manager implemented via one or more hardware processors and memory and configured to:
access resource utilization data collected for the plurality of resource hosts;
analyze the resource utilization data to determine one or more capacity fragmentation measures that are associated with unutilized capacity of the distributed system unusable for placement of additional resources according to one or more placement constraints for placing resources in the distributed system, wherein the one or more placement constraints comprise an infrastructure diversity constraint to place a resource with respect to another one or more resources, and wherein to analyze the resource utilization data comprises to determine a number of possible resource placements amongst the resource hosts that satisfy the infrastructure diversity constraint;
update a capacity model for the distributed system to indicate an available capacity for placing additional resources at the distributed system based, at least in part, on the one or more capacity fragmentation measures;
compare the available capacity to a capacity threshold; and
responsive to a determination that the available capacity crosses the capacity threshold, perform at least one of:
generating a notification of a deficient state of the available capacity,
triggering a modification in total capacity of the distributed system, or
triggering a diversion of additional resource placement requests with respect to the distributed system.

US Pat. No. 10,193,819

ADAPTIVE THROTTLING FOR SHARED RESOURCES

Amazon Technologies, Inc....

1. A computer-implemented method, comprising:providing a requestor with a determined number of work units, the determined number of work units enabling the requestor to obtain an amount of work from a resource in a multi-tenant environment;
receiving a request from the requestor to perform an input/output (I/O) operation with respect to the resource, the I/O operation requiring at least one work unit in excess of the determined number of work units;
determining a multi-tenant environment performance criterion;
providing the requestor a sufficient number of borrowed work units to complete the I/O operation based at least in part upon an analysis of the multi-tenant environment performance criterion; and
associating a negative work unit value with the requestor based at least in part on the sufficient number of borrowed work units, the negative work unit value representing a time period to restore a normal operating state, wherein a maximum number of work units available for work requesting parties is required to be reattained by the requestor before the requestor is allowed to request additional work units.

US Pat. No. 10,193,807

PENALTY-BOX POLICERS FOR NETWORK DEVICE CONTROL PLANE PROTECTION

Juniper Networks, Inc., ...

1. A method comprising:executing, by a host process executing by a control unit of a network device of a network, a protocol to exchange packets with other network devices of the network to perform control plane functions of the network device;
configuring, by the control unit, a line card of the network device with a goal weight for the protocol that determines respective packet limits for a plurality of packet flows associated with the protocol, wherein each of the plurality of packet flows is destined for the network device, wherein the goal weight defines a share of host-bound path resources available to the protocol for a host-bound path from the line card to the control unit;
computing, by the line card based at least on the goal weight for the protocol, the respective packet limits for the plurality of packet flows;
policing, by the line card in response to detecting congestion of the host-bound path caused at least in part by forwarding the packet flows from the line card to the control unit, based on the packet limit for a first packet flow from the plurality of packet flows, the first packet flow to constrain a rate at which the line card sends packets of the first packet flow to the control unit;
policing, by the line card in response to detecting the congestion, based on the packet limit for a second packet flow from the plurality of packet flows, the second packet flow to constrain a rate at which the line card sends packets of the second packet flow to the control unit; and
processing, by the host process executing by the control unit, the packets of the first packet flow and packets of the second packet flow.

US Pat. No. 10,193,801

AUTOMATIC TRAFFIC MAPPING FOR MULTI-PROTOCOL LABEL SWITCHING NETWORKS

Juniper Networks, Inc., ...

1. A method comprising:executing, by a network device, a multiprotocol label switching protocol to direct a plurality of routers along a path to establish a label switched path along the path, the plurality of routers including a head-end label edge router that acts as an ingress to admit traffic into the label switched path and a tail-end label edge router that acts as an egress from the label switched path;
executing, by the network device, a path computation element communication protocol to generate a communication associating a label switched path community with the established label switched path;
transmitting, by the network device, in accordance with the path computation element communication protocol, and after the label switched path has been established to use one or more labels when admitting traffic into the label switched path, the communication to the head-end label edge router;
identifying, by the network device and based on traffic mapping rules, a mapping between a layer three network flow and the label switched path community;
executing, by the network device, a routing protocol used for routing advertising information to generate an advertisement advertising the mapping; and
transmitting, by the network device and in accordance with the routing protocol, the advertisement to the head-end label edge router so that the head-end label edge router is able to map the layer three network flow to the label switched path identified by the label switched path community and admit traffic corresponding to the layer three network flow into the label switched path identified by the label switched path community, and the layer three network flow identified in the advertisement by one or more of a destination address, a destination port, a source address, a source port, and a protocol.

US Pat. No. 10,193,800

SERVICE LABEL ROUTING IN A NETWORK

Level 3 Communications, L...

6. A telecommunications network, comprising:a service edge device in communication with a customer device to receive a request from the customer device to add a telecommunication service for a customer, wherein the telecommunication service comprises one of Firewall services or distributed denial of service (DDOS) protection;
metro edge devices in communication with the service edge device wherein an intermediate metro edge device of the metro edge devices on the telecommunication network is intermediate to two of the metro edge devices; and
a network management computing device comprising a processor configured to:
instantiate the telecommunication service on the service edge device and the metro edge devices, wherein instantiating the telecommunication service comprises associating a unique service label identifier to the requested telecommunication service; and
configure the service edge device and the metro edge devices to route information associated with the telecommunication service;
generate a segment label identifier associated with the service edge device and the metro edge devices;
wherein the service edge device and the metro edge devices route at least one data packet associated with the telecommunication service on the telecommunications network to the customer based at least on the unique service label identifier associated with the data packet, the at least one data packet comprising at least one of the unique service label identifier, the segment label identifier, and a frame associated with the instantiated telecommunication service;
wherein the intermediate metro edge device modifies the unique service label identifier based on network changes, and
wherein the service edge device and the metro edge devices comprise at least a portion of a Multiprotocol Label Switching (MPLS) network.

US Pat. No. 10,193,795

ROBUST DATA ROUTING IN WIRELESS NETWORKS WITH DIRECTIONAL TRANSMISSIONS

SONY CORPORATION, Tokyo ...

1. A wireless communication apparatus, comprising:(a) a wireless communication circuit configured for wirelessly communicating with other wireless communication stations;
(b) a computer processor coupled to said wireless communication circuit;
(c) a non-transitory computer-readable memory storing instructions executable by the computer processor; and
(d) wherein said instructions, when executed by the computer processor, perform steps comprising:
(i) communicating with the other wireless communication stations utilizing a routing protocol;
(ii) performing primary and secondary path discovery in establishing communications with a destination wireless communication station, through intermediate wireless communication stations;
(iii) determined by the processor that intermediate station of the primary and secondary path to be selected such that the antenna pattern for the primary and secondary path are spatially uncorrelated, using beamforming (BF) training information toward candidate intermediate stations;
(iv) transmitting data on the primary and the same data on the secondary path, for receipt by the destination wireless communication station toward overcoming link blockages of the primary path in response to data received on the secondary path; and
(v) wherein said instructions when executed by the computer are configured to provide reception at a destination station which is selected from the group of reception types consisting of: uncoordinated reception, coordinated reception by combining received signal powers, or coordinated reception with conditional reception from the secondary routing path.

US Pat. No. 10,193,781

FACILITATION OF MULTIPATH TRANSMISSION CONTROL PROTOCOLS

1. A method, comprising:receiving, by a network device comprising a processor, web site request data related to a request for a web site made by a mobile device;
receiving, by the network device, preference data associated with sending web site data related to the web site request data via a Wi-Fi connection of the network device or via a cellular network connection of the network device, wherein the preference data comprises benefit data related to a number of bytes that are deliverable via the Wi-Fi connection of the mobile device and the cellular network connection of the mobile device;
receiving, by the network device, resource data associated with the sending the web site data via the Wi-Fi connection of the network device or via the cellular network connection of the network device;
analyzing, by the network device, the preference data and the resource data, resulting in analyzed data; and
in response to a condition associated with the analyzed data being determined to have been satisfied, sending, by the network device, the web site data.

US Pat. No. 10,193,780

SYSTEM AND METHOD FOR ANOMALY ROOT CAUSE ANALYSIS

Futurewei Technologies, I...

1. A method comprising:receiving, by a processor from a radio network controller (RNC) of a network, one of a first anomaly data point, a second anomaly data point, and a third anomaly data point, the first, second, and third anomaly data points being related to a plurality of variables;
classifying, by the processor in response to receiving the first anomaly data point, the first anomaly data point as a relationship type anomaly, upon determining that the first anomaly data point is inside a magnitude bounding box and outside a principal component analysis (PCA) bounding box, wherein the PCA bounding box excludes all of a plurality of anomaly data points of a data set, and limits of the PCA bounding box are orthogonal to eigenvectors of the data set;
classifying, by the processor in response to receiving the second anomaly data point, the second anomaly data point as a joint magnitude anomaly, upon determining that the second anomaly data point is outside the magnitude bounding box, outside the PCA bounding box, and between major limits of the PCA bounding box;
classifying, by the processor in response to receiving the third anomaly data point, the third anomaly data point as both the relationship type anomaly and the joint magnitude anomaly, upon determining that the third anomaly data point is outside the magnitude bounding box, outside the PCA bounding box, and not between the major limits of the PCA bounding box;
determining, in response to classifying the first anomaly data point as the relationship type anomaly, at least a first subset of the variables related to the classified first anomaly data point;
performing, by the processor based on classifying the first anomaly data point as the relationship type anomaly, corrective action on the network in accordance with the classified first anomaly data point and the at least a first subset of the variables related to the classified first anomaly data point;
determining, in response to classifying the second anomaly data point as the joint magnitude anomaly, at least a second subset of the variables related to the classified second anomaly data point;
performing, by the processor based on classifying the second anomaly data point as the joint magnitude anomaly, corrective action on the network in accordance with the classified second anomaly data point and the at least a second subset of the variables related to the classified second anomaly data point;
determining, in response to classifying the third anomaly data point as both the relationship type anomaly and the joint magnitude anomaly, at least a third subset of the variables related to the classified third anomaly data point; and
performing, by the processor based on classifying the third anomaly data point as both the relationship type anomaly and the joint magnitude anomaly, corrective action on the network in accordance with the classified third anomaly data point and the at least a third subset of the variables related to the classified third anomaly data point.

US Pat. No. 10,193,777

WI-FI/BPL DUAL MODE REPEATERS FOR POWER LINE NETWORKS

1. A method for transmitting information, comprising:receiving a message, at a node of a power line network, from a first power line segment of the power line network;
detecting, at the node, an interruption in the power line network;
in response to detecting the interruption in the power line network, comparing, using a processor at the node, a transmission characteristic of a wireless transmission of the message and a transmission characteristic of a wired transmission of the message; and
transmitting the message, from the node, via one of the wireless transmission or the wired transmission, to a second power line segment of the power line network, based on the comparing of the transmission characteristic of the wireless transmission of the message and the transmission characteristic of the wired transmission of the message.

US Pat. No. 10,193,776

ANONYMIZATION OF TRAFFIC PATTERNS OVER COMMUNICATION NETWORKS

International Business Ma...

1. A computer program product for obfuscating communication traffic patterns occurring over a communication infrastructure including a computer server, the computer program product comprising:one or more non-transitory computer-readable storage devices and program instructions stored on at least one of the one or more non-transitory storage devices, the program instructions executable by a processor, the program instructions comprising:
instructions to detect, at a first communications device, data communication sessions with a second communications device via the computer server using a network protocol;
instructions to access, at the first communications device, a first traffic pattern based on the data communication sessions, the first traffic pattern determining communication occurrences between the first and the second communication devices over a first predefined time period;
instructions to access, at the first communications device, a second traffic pattern based on the data communication sessions, the second traffic pattern determining communication occurrences between the first and the second communications devices over a second predefined time period that occurs after the first predefined time period; and
instructions to generate, at the first communications device, based on a randomization process, a dummy data communication pattern for transmission to the second communications device, wherein the dummy data communication pattern is appended to the second traffic pattern for obfuscating a traffic pattern change between the first and the second traffic pattern at the computer server used to establish the communication sessions, wherein the generating of the dummy data communication pattern comprises:
instructions to determine, at the first communications device, a first information content value associated with the first traffic pattern;
instructions to determine, at the first communications device, a second information content value associated with the second traffic pattern;
instructions to compare, at the first communications device, the first and the second information content values; and
instructions to generate a first binary value based on the comparing determining the second information content value to be outside a predefined threshold range of the first information content value.

US Pat. No. 10,193,765

PROTECTION SWITCHING SYSTEMS AND METHODS IN A PACKET NETWORK BASED ON SIGNAL DEGRADE

Ciena Corporation, Hanov...

1. A method of protection switching in a packet network based on signal/service degrade, the method comprising:monitoring a packet network connection;
detecting the packet network connection has a signal/service degrade comprising a condition where the packet network connection is operational, but experiencing errors determined on the packet network connection at a packet layer below a threshold, wherein the signal/service degrade is detected in part through a Frame Error Rate which is inferred from a Bit Error Rate and frame size; and
responsive to detection of the signal/service degrade, performing one or more of notifying nodes in the packet network and performing a protection switch at the packet layer based on the signal/service degrade.

US Pat. No. 10,193,751

SYSTEM, METHOD AND APPARATUS FOR CONFIGURING A NODE IN A SENSOR NETWORK

Senseware, Inc., Vienna,...

1. A method, comprising:receiving, by a sensor data control system, a request to change a configuration of a wireless node in a wireless sensor network at a monitored location, the wireless node supporting one or more sensors at the monitored location;
transmitting, by the sensor data control system, a configuration message for delivery to the wireless node, the configuration message including configuration information that enables the wireless node to change at least one configuration setting used by the wireless node in controlling a delivery of sensor data from the one or more sensors to the sensor data control system;
generating, by the sensor data control system, a first configuration hash value using a hash function having an input based on the at least one configuration setting identified by the request;
receiving, by the sensor data control system from a gateway device at the monitored location, a status message associated with the wireless node at the monitored location, the status message including a second configuration hash value generated by the wireless node using the hash function and having an input based on current configuration settings of the wireless node;
comparing, by the sensor data control system, the first configuration hash value to the second configuration hash value; and when the comparison indicates that the first configuration hash value is different from the second configuration hash value, retransmitting, by the sensor data control system to the gateway device, the configuration message based on the request to effect a change in the current configuration settings of the wireless node.

US Pat. No. 10,193,748

ENABLING CONFIGURATION IN NETWORKS

Extreme Networks, Inc., ...

1. A method comprising:receiving a Link Layer Discovery Protocol (LLDP) message from an edge configuration device, wherein the LLDP message contains shortest path bridging (SPB) configuration information; and
performing, using the SPB configuration information within the LLDP message received from the edge configuration device, an intermediate system-to-intermediate system (IS-IS) configuration in response to receiving the LLDP message.

US Pat. No. 10,193,724

PREFIXING OF OFDM SYMBOLS TO SUPPORT VARIABLE SUBFRAME LENGTH

Telefonaktiebolaget LM Er...

26. A method of operating an orthogonal frequency division multiplexing (OFDM) first radio node, the method comprising:transmitting, in a first mode of operation with a first subcarrier spacing f1, a first sequence of prefixed OFDM symbols; and
transmitting, in a second mode of operation with a second subcarrier spacing f2, a second sequence of prefixed OFDM symbols:
wherein the first and second sequences of transmitted OFDM symbols are aligned with a predefined repeating radio frame, which is common to both the first and second modes of operation, or with an integer multiple of the predefined repeating radio frame; and
wherein the first and second subcarrier spacings are related by an integer factor, f1/f2=p or f1/f2=1/p, with p?1 integer.

US Pat. No. 10,193,718

METHOD FOR DATA MODULATION IN WIRELESS COMMUNICATION SYSTEM AND APPARATUS FOR THE SAME

ELECTRONICS AND TELECOMMU...

1. A data modulation apparatus comprising:a single-to-differential (S2D) conversion part including a first amplifier operating based on a carrier wave signal and two transformers receiving an output signal of the first amplifier;
a first switch part transferring status of input data to the first amplifier based on the input data;
a differential amplification part receiving output signals of the S2D conversion part and amplifying the output signals of the S2D conversion part;
a differential-to-signal (D2S) conversion part receiving output signals of the differential amplification part and performing modulation on the output signals of the differential amplification part by converting the output signals of the differential amplification part to a single signal; and
a second switch part transferring the output signals of the differential amplification part to the D2S conversion part based on the input data,
wherein the first switch part and the second switch part are alternately turned on and off, and
the two transformers include a first transformer connected to a first inductor of the first amplifier and a second transformer connected to a second inductor of the first amplifier, wherein the first inductor and the second inductor are connected in parallel with the first amplifier.

US Pat. No. 10,193,698

AVOIDING INTERDICTED CERTIFICATE CACHE POISONING FOR SECURE SOCKETS LAYER FORWARD PROXY

Juniper Networks, Inc., ...

1. A method, comprising:receiving, by a device, a message associated with establishing a secure session, the message including a first certificate chain associated with a server device, the first certificate chain including a plurality of certificates;
providing, by the device, information associated with each of the plurality of certificates included in the first certificate chain as an input to a cryptographic hash function;
receiving, by the device, a first certificate fingerprint as an output of the cryptographic hash function;
determining, by the device, that the device stores or has access to a certificate cache entry associated with the first certificate chain;
identifying, by the device and based on determining that the device stores or has access to the certificate cache entry, a second certificate fingerprint associated with the certificate cache entry, the second certificate fingerprint being based on a second certificate chain that has been validated;
determining, by the device, whether the first certificate fingerprint matches the second certificate fingerprint; and
identifying and providing, by the device, a stored interdicted certificate associated with the second certificate chain or the second certificate fingerprint based on determining that the first certificate fingerprint matches the second certificate fingerprint; orgenerating and providing, by the device, a generated interdicted certificate, associated with the first certificate chain, based on determining that the first certificate fingerprint does not match the second certificate fingerprint.

US Pat. No. 10,193,670

METHODS AND SYSTEMS FOR COMMUNICATION

1. A communication network, comprising:a central node configured to allocate bandwidth at which data is transferred to and from initial network nodes over a communication channel according to an initial frequency band plan, the initial frequency band plan comprising:
a number of dedicated frequencies associated with the respective initial network nodes; and
a common frequency band on which the central node and initial network nodes communicate, wherein communication over the common frequency band includes a number of time windows that are respectively and uniquely associated with the number of initial network nodes; andwherein the central node is further configured to reallocate the bandwidth according to a modified frequency band plan to account for a subsequent network node requesting access to the communication network,wherein frequencies of the common frequency band are interspersed with the dedicated frequencies, orwherein the frequencies of the common frequency band are all above the dedicated frequencies.

US Pat. No. 10,193,662

ROUTER, TERMINAL, AND CONGESTION CONTROL METHOD FOR ROUTER AND TERMINAL

PANASONIC INTELLECTUAL PR...

1. A congestion control method for use in a router connected to a content-oriented network, comprising:determining whether congestion occurs by monitoring the content-oriented network;
receiving an interest packet including a name of content data that is requested to be sent;
generating a first NACK packet indicating an occurrence of congestion if it is determined that the congestion occurs when the interest packet is received; and
sending the first NACK packet to the content-oriented network,
wherein in the generating of the first NACK packet, if first alternative content data which is an alternative of content data corresponding to a name included in the received interest packet is stored in a cache of the router, information regarding the first alternative content data is set in the first NACK packet, and
wherein at least one of the determining whether the congestion occurs, the receiving the interest packet, the generating of the first NACK packet, and the sending of the first NACK packet is performed by a processor of the router,
the congestion control method further comprising:
receiving a second NACK packet that further includes one of information regarding the content data corresponding to the name included in the received interest packet and information regarding second alternative content data which is an alternative of the content data and that indicates the occurrence of congestion,
wherein in the generating of the first NACK packet, if the first alternative content data is stored in the cache of the router, the first NACK packet is generated by additionally setting the information regarding the first alternative content data in the second NACK packet.

US Pat. No. 10,193,656

SYSTEMS AND METHODS FOR ADAPTIVE DOWNLINK CONTROL INFORMATION SET FOR WIRELESS TRANSMISSIONS

HUAWEI TECHNOLOGIES CO., ...

1. A method for performing blind detection, the method comprising:identifying, by a user equipment (UE), a search space in a control channel, the control channel carrying signaling using at least some control formats in a set of control formats defined for the control channel;
determining, by the UE, a subset of control formats to search for in the search space based at least on a sub-carrier spacing configuration assigned to the UE, at least two sub-carrier spacing configurations being associated with different subsets of control formats, and the subset of control formats excluding one or more control formats in the set of control formats defined for the control channel;
searching, by the UE, for the subset of control formats in the search space without searching for the one or more control formats excluded from the subset of control formats; and
transmitting or receiving, by the UE, a data signal in accordance with control information detected in the search space.

US Pat. No. 10,193,653

POLARIZATION MULTIPLEXING OPTICAL TRANSMISSION CIRCUIT AND POLARIZATION MULTIPLEXING OPTICAL TRANSMISSION AND RECEPTION CIRCUIT

Nippon Telegraph and Tele...

1. A polarization multiplexing optical transmission circuit, comprising:a first optical power splitter for branching an optical power of continuous light outputted from a light source;
a first polarization optical modulation circuit at a side of a path having a higher loss connected to a first output of the first optical power splitter;
a second optical power splitter connected to a second output of the first optical power splitter; and
a second polarization optical modulation circuit at a side of a path having a lower loss connected to one output of the second optical power splitter.

US Pat. No. 10,193,650

AUTOMATED, DYNAMIC MINIMIZATION OF INTER-CELL SITE INTERFERENCE IN CDMA NETWORKS

Telefonaktiebolaget LM Er...

1. A method, in a network node operatively connected to a wireless network, for detecting and correcting problems with scrambling code allocations among cells supported by a group of base stations in the wireless network, where each base station supports one or more of the cells, the method comprisingdesignating an initial one of the group of base stations as a source base station;
identifying a first set of scrambling codes, the first set of scrambling codes consisting of all scrambling codes allocated to cells supported by the source base station;
determining a second set of scrambling codes, the second set of scrambling codes comprising at least all scrambling codes allocated to cells neighboring any of the cells supported by the source base station;
comparing the first and second sets of scrambling codes to detect duplicate scrambling codes between the first and second sets;
upon detecting a duplicated scrambling code between the first and second sets, using location information for the cells corresponding to the duplicated scrambling code to determine whether interference between the cells is likely and, if interference is likely, changing the scrambling code for the cell that has the duplicated scrambling code and that is supported by a base station other than the source base station; and
selecting a next one of the base stations for designation as the source base station; and
repeating said identifying, determining, comparing, using, changing, and selecting operations until each one of the base stations has been designated as the source base station.

US Pat. No. 10,193,610

ENHANCING MU-MIMO TO GROUP CLIENTS ACROSS MULTIPLE BSSIDS FOR A PHYSICAL RADIO

Hewlett Packard Enterpris...

1. A method comprising:determining, by a network device, a first plurality of client devices associated with an access point (AP) corresponding to a first basic service set (BSS) that uniquely identifies a first wireless local area network (WLAN), wherein traffic flows between each of the first plurality of client devices and the AP comprise similar frame sizes and similar inter-arrival times;
transmitting, by the network device, sounding frames to the first plurality of client devices associated with the AP;
receiving, by the network device, a plurality of feedback frames, each feedback frame indicating how the sounding frames were received by each of the first plurality of client devices;
grouping, by the network device, the first plurality of client devices into a single multi-user multiple input multiple output (MU-MIMO) group for beamforming based on the received plurality of feedback frames;
simultaneously transmitting, by the network device, the traffic flows to the first plurality of client devices in the MU-MIMO group.

US Pat. No. 10,193,597

ELECTRONIC DEVICE HAVING SLOTS FOR HANDLING NEAR-FIELD COMMUNICATIONS AND NON-NEAR-FIELD COMMUNICATIONS

Apple Inc., Cupertino, C...

1. An electronic device, comprising:a housing having a peripheral conductive wall;
a dielectric-filled gap in the peripheral conductive wall that divides the peripheral conductive wall into first and second segments;
an antenna ground separated from the peripheral conductive wall by a slot;
a non-near-field communications antenna having an antenna feed coupled between the first segment and the antenna ground across the slot;
a near-field communications antenna having a first antenna feed terminal coupled to the first segment and a second antenna feed terminal coupled to the second segment;
a transmission line coupled to the first and second antenna feed terminals; and
near-field communications transceiver circuitry coupled to the transmission line, wherein the near-field communications transceiver circuitry is configured to convey near-field communications signals using the near-field communications antenna.

US Pat. No. 10,193,574

EFFICIENT SYNDROME CALCULATION IN PROCESSING A GLDPC CODE

APPLE INC., Cupertino, C...

1. An apparatus, comprising:an interface, which is configured to receive input data to be processed in accordance with a Generalized Low-Density Parity-Check (GLDPC) code defined by a parity-check-matrix comprising multiple sub-matrices, wherein each of the sub-matrices comprises N block-rows and N block-columns of block matrices, wherein the sub-matrices comprise main diagonals and secondary diagonals, and wherein each of the main diagonals and each of the secondary diagonals comprises N respective block matrices;
a main processing module, which is configured to calculate N first partial syndromes based on the input data and on the block matrices of the main diagonals of the sub-matrices;
a secondary processing module, which is configured to calculate N second partial syndromes based on the input data and on the block matrices of the secondary diagonals of the sub-matrices; and
combiner circuitry, which is configured to produce N syndromes by respectively combining the N first partial syndromes with the N second partial syndromes, and to encode or decode the input data, based on the N syndromes, in accordance with the GLDPC code.

US Pat. No. 10,193,561

PHASE LOCKED LOOPS

Cirrus Logic, Inc., Aust...

1. A phase-locked-loop apparatus comprising:a phase-and-frequency detector configured to:
receive a reference clock signal and a feedback signal; and
output first adjustment signal that is modulated between respective first and second signal levels to provide control pulses indicating that an increase in frequency required for phase and frequency lock, and
output a second adjustment signal that is modulated between respective first and second signal levels to provide control pulses indicating that a decrease in frequency required for phase and frequency lock; and
first and second time-to-digital converters configured to respectively receive the first and second adjustment signals respectively and output respective first and second digital signals indicative of the duration of said control pulses;
wherein each time-to-digital converter comprises:
a controlled-oscillator configured so as to operate at a first frequency when the respective adjustment signal is at the first signal level and operate at a second frequency when the respective adjustment signal is at the second signal level; and
a counter configured to produce a count value of the number oscillations of the controlled-oscillator in each of a succession of count periods defined by a count clock signal; and
wherein said first and second digital signals are based on the count values output from the respective counters.

US Pat. No. 10,193,540

LOW-POWER DECISION THRESHOLD CONTROL FOR HIGH-SPEED SIGNALING

XILINX, INC., San Jose, ...

1. An apparatus for decision threshold control, comprising:an alternating current coupler (“ac-coupler”) circuit configured as a high-pass circuit path for a first frequency range;
a buffer amplifier circuit coupled in parallel with the ac-coupler circuit and configured as a low-pass circuit path for a second frequency range; and
an offset injection circuit coupled to both the ac-coupler circuit and the buffer amplifier circuit and configured to inject an offset.

US Pat. No. 10,193,537

RANDOM DATA GENERATION CIRCUIT, MEMORY STORAGE DEVICE AND RANDOM DATA GENERATION METHOD

PHISON ELECTRONICS CORP.,...

1. A random data generation circuit, comprising:a phase difference detection circuit, configured to sample a first clock signal and a second clock signal based on a plurality of sampling clock signals, so as to detect a phase difference between the first clock signal and the second clock signal and output phase difference information; and
a random data output circuit, coupled to the phase difference detection circuit and configured to output random data according to the phase difference information.

US Pat. No. 10,193,533

METHODS AND SYSTEMS FOR EVENT-DRIVEN RECURSIVE CONTINUOUS-TIME DIGITAL SIGNAL PROCESSING

The Trustees of Columbia ...

1. A continuous-time digital signal processor comprising:an event-grouping block, configured to receive a first input timing signal, a second input timing signal, and to generate an intermediate timing signal;
a first time delay block, configured to receive the intermediate timing signal and generate an output timing signal;
a second time delay block, configured to receive the output timing signal and generate the second input timing signal;
a two-channel memory configured to receive a first data input and a second data input and to generate a first intermediate data signal and a second intermediate data signal;
an arithmetic operation block, configured to receive the first intermediate data signal, the second intermediate data signal and to generate an output data signal, the arithmetic operation block comprising:
a scalar block configured to receive the second intermediate data signal and generate a scaled version of the second intermediate data signal; and
an adder configured to receive the first intermediate data signal and the scaled version of the second intermediate data signal, and generate the output data signal; and
a first-in-first-out (FIFO) memory configured to receive the output data signal and to generate the second input data signal.

US Pat. No. 10,193,512

PHASE-SHIFTING POWER DIVIDER/COMBINER ASSEMBLIES AND SYSTEMS

Werlatone, Inc., Brewste...

1. A power divider/combiner assembly comprising:a divider network for dividing a received divider-network input signal into N divider-network output signals, where N is an integer greater than seven, the divider network including at least one divider and at least one of each of first, second, and third divider phase-shift circuits, each divider having a divider input and a plurality of divider outputs and being configured to divide a divider input signal on the divider input into a divider output signal on each of the plurality of divider outputs, each divider phase-shift circuit being configured to produce a respective non-zero phase shift between divider output signals on an associated pair of divider outputs of an associated divider of the at least one divider, each first divider phase-shift circuit producing a first phase shift, each second divider phase-shift circuit producing a second phase shift that is more than the first phase shift, and each third divider phase-shift circuit producing a third phase shift that is more than the second phase shift;
N amplifiers, each amplifier amplifying one of the N divider-network output signals into a respective amplified signal; and
a combiner network for combining the N amplified signals into a combiner-network output signal, the combiner network including at least one combiner and at least one of each of first, second, and third combiner phase-shift circuits, with each combiner having a plurality of combiner inputs and a combiner output and being configured to combine combiner input signals on the plurality of combiner inputs into a combiner output signal on the combiner output, each combiner phase-shift circuit being configured to produce a respective non-zero phase shift between combiner input signals on an associated pair of combiner inputs of an associated combiner of the at least one combiner, each first combiner phase-shift circuit producing the first phase shift, each second combiner phase-shift circuit producing the second phase shift, and each third combiner phase-shift circuit producing the third phase shift.

US Pat. No. 10,193,480

PROPORTIONAL INTEGRAL REGULATING LOOP FOR DIGITAL REGULATOR DEVICE FOR MOTOR VEHICLE EXCITATION ROTARY ELECTRICAL MACHINE

Valeo Equipements Electri...

1. A proportional integral regulating loop (10) for a digital regulator device (2) for a motor vehicle excitation rotary electrical machine (1) configured to function as a generator which provides an output voltage (Ub+) adjusted by an excitation current (Ie), said digital regulator device (2) comprising a control device (11) for controlling said excitation current (Ie) and said regulating loop (10), said regulating loop (10) comprising:at an input, a measuring device (35) for measurement by sampling of said output voltage (Ub+) generating a measurement signal (Um);
an error calculation system (13) generating an error signal (e) equal to a difference between said measurement signal (Um) and a set point (U0);
a processing system (14, 15, 16, 17, 18, 20) for processing of said error signal (e) generating a regulating signal (Ysat), said processing system comprising in parallel a first amplifier (14), an integrator (15) and an anti-saturation system (23); and
at an output, a generation system (38) for generation of a control signal (PWM) controlling said control device (11) according to said regulating signal (Ysat),
said anti-saturation system (23) comprising a saturation detector (24) generating a disconnection signal (Cmd) controlling a switch (25) which disconnects said integrator (15, 29) of said error calculation system (13) in the case of detection of a state of saturation (SM) of said regulating signal (Ysat).

US Pat. No. 10,193,428

ELECTRIC ROTATING MACHINE

DENSO CORPORATION, Kariy...

1. An electric rotating machine comprising:a stator serving as an armature including at least armature core segments and an armature coil; and
a radially outer rotor and a radially inner rotor, both rotatably provided relative to the stator with gaps therebetween,
wherein the stator has the armature coil wound around the armature core segments with M pairs of poles (M being a natural number), and N pairs of field poles (N being a natural number),
each of the outer and inner rotors has K (K being a natural number) soft magnetic members including a plurality of protrusions on a side facing the stator, and
the armature coil, the field poles, and the soft magnetic members satisfy a relational expression of |M±N|=K.

US Pat. No. 10,193,421

SYSTEM FOR THERMAL MANAGEMENT IN ELECTRICAL MACHINES

GENERAL ELECTRIC COMPANY,...

1. A component of an electrical machine, the component comprising:a magnetic core comprising teeth defining a plurality of slots, wherein each slot from the plurality of slots is defined between corresponding pair of adjacent teeth;
a conduction winding wound around each tooth of the teeth such that each slot accommodates two conduction windings; and
a heat dissipating element disposed in a slot of the plurality of slots between the two conduction windings, wherein the heat dissipating element comprises a thermally conducting material having an in-plane thermal conductivity higher than a through-plane thermal conductivity and wherein the heat dissipating element comprises a sheet-like element having a largest plane substantially parallel to a radial direction of the component.

US Pat. No. 10,193,375

CLOSED LOOP CURRENT CONTROL IN A WIRELESS POWER SYSTEM

MediaTek Inc., Hsin-Chu ...

1. A wireless power transmitter, comprising:a first controller configured to set a target coil current value based, at least in part, on a voltage value reported by a wireless power receiver;
an amplifier configured to generate a transmitter coil current based, at least in part, on a supply voltage received by the amplifier; and
a second controller configured to adjust the supply voltage received by the amplifier based, at least in part, on a comparison of a value of the transmitter coil current to the target coil current value.

US Pat. No. 10,193,372

OPERATING AN INDUCTIVE ENERGY TRANSFER SYSTEM

Apple Inc., Cupertino, C...

1. A method for operating an inductive energy transfer system that includes a transmitter device and a receiver device, the receiver device including a touch sensing device, the method comprising:detecting if an input surface of the touch sensing device is touched while the transmitter device is transferring energy inductively to the receiver device; and
if the input surface is touched, the transmitter device transferring energy inductively only during a first time period and the touch sensing device obtaining touch samples only during a different second time period.

US Pat. No. 10,193,363

HYBRID COUPLING FOR A SMART BATTERY SYSTEM

Bren-Tronics, Inc., Comm...

1. A smart battery system comprising:a battery housing containing a first battery, a second battery, and first and second memory locations for storing data about said first and second batteries respectively; and
a single hybrid coupling having a mating jack comprising
(i) a power coupling including two pairs of D.C. battery conductors disposed in a first circular configuration within said mating jack for electrically connecting an external device to said first and second batteries; and
(ii) a data coupling providing two system management buses for communicating data between the external device and said first and second memory locations respectively, wherein said data coupling has two pairs of digital bus conductors disposed in a second circular configuration within said mating jack, wherein said second circular configuration is concentric with said first circular configuration,wherein said power coupling and said data coupling terminate in contacts that are arranged in the jack starting from the 12:00 position and moving clockwise as follows:a first battery conductor of said first pair of D.C. battery conductors;
a first digital bus clock data conductor of said first pair of digital bus conductors;
an additional battery-type conductor;
a first digital bus data conductor of said first pair of digital bus conductors;
a first battery conductor of said second pair of D.C. battery conductors;
an additional data-type conductor;
a second battery conductor of said first pair of D.C. battery conductors;
a second digital bus clock data conductor of said second pair of digital bus conductors;
a second battery conductor of said second pair of D.C. battery conductors; and
a second digital bus data conductor of said second pair of digital bus conductors, andwherein the external device comprises a charger, and further comprising a further battery-type conductor in the center of the jack, and wherein said additional data-type conductor provides a charge enable signal and said further battery-type conductor provides a charge enable return signal.

US Pat. No. 10,193,351

HYBRID DISTRIBUTED LOW VOLTAGE POWER SYSTEMS

COOPER TECHNOLOGIES COMPA...

1. A hybrid distributed low voltage power system, comprising:a first primary power source that distributes line voltage power during a first mode of operation and fails to distribute the line voltage power during a second mode of operation, wherein the first mode of operation is when a market price for the line voltage power is less than a threshold value, and wherein the second mode of operation is when the market price for the line voltage power is greater than the threshold value;
a first secondary power source that receives an input signal during the first mode of operation and distributes a reserve signal during the second mode of operation, wherein the reserve signal is generated from the input signal;
a power distribution module (PDM) coupled to the first primary power source and the first secondary power source, wherein the PDM comprises a first power transfer device and a first output channel, wherein the PDM receives the line voltage power from the first primary power source during the first mode of operation, and wherein the first power transfer device generates a first low-voltage (LV) signal using the line voltage power during the first mode of operation; and
at least one first LV device coupled to the first output channel of the PDM, wherein the at least one LV device operates using the first LV signal generated by the PDM during the first mode of operation, and wherein the at least one first LV device receives a reserve LV signal based on the reserve signal during the second mode of operation,
wherein the LV signal is up to 100 VAC or up to 60 VDC, and
wherein the input signal is generated by the primary power source or the PDM.

US Pat. No. 10,193,344

POWER STORAGE SYSTEM, POWER STORAGE MODULE, AND CONTROL METHOD

MURATA MANUFACTURING CO.,...

1. A power storage system, comprising:a plurality of power storage modules that are connected in parallel to a power line; and
a system voltage acquisition unit that obtains a system voltage in the power line,
a power storage module of the plurality of power storage modules including:
a power storage section that is formed of one or more storage batteries, and
a current control unit that comprises at least one variable resistor and a resistance control unit,
wherein the resistance control unit sets a resistance value of the at least one variable resistor based on a voltage difference that exceeds a threshold voltage,
wherein the voltage difference is between a voltage of the power storage section and the system voltage, and
wherein the current control unit controls a current that flows between the power storage section and the power line according to the set resistance value.

US Pat. No. 10,193,308

SEMICONDUCTOR LASER WITH TENSILE STRAINED INALAS ELECTRON BLOCKER FOR 1310 NANOMETER HIGH TEMPERATURE OPERATION

Intel Corporation, Santa...

1. A multiple quantum well (MQW) laser for operating at high temperatures, comprising:at least one quantum well made of compressively strained Indium-Gallium-Aluminum-Arsenide (InGaAlAs) layers that are alternatively stacked with tensile strained InGaAlAs layers;
the at least one quantum well surrounded on one side by a n-doped cladding of Indium-Phosphide (InP) and on another side by a p-doped cladding of InP so as to form a double hetero-junction;
a confinement layer of lattice-matched Indium Aluminum Arsenide (InAlAs)
provided between the at least one quantum well and the p-doped InP cladding, the confinement layer having a first surface facing or adjacent to the quantum wells and a second surface facing or adjacent to the p-doped InP cladding;
an additional electron containment layer of tensile strained InAlAs, having a thickness smaller than that of the confinement layer, and provided either facing or adjacent to a surface of the confinement layer or between the two surfaces of the confinement layer.

US Pat. No. 10,193,305

WAVELENGTH TUNABLE LASER DEVICE AND LASER MODULE

FURUKAWA ELECTRIC CO., LT...

1. A wavelength tunable laser device, comprising:a laser cavity formed of a grating and a reflecting mirror optically coupled to the grating, said reflecting mirror including a ring resonator filter;
a gain portion arranged within the laser cavity; and
a phase adjusting portion arranged within the laser cavity,
wherein the grating forms a first comb-shaped reflection spectrum,
wherein the ring resonator filter of the reflecting mirror includes:
a ring-shaped waveguide; and
two arms that are respectively optically coupled to different points of the ring-shaped waveguide,
wherein the reflecting mirror further includes a coupler that unites respective ends of said two arms of the ring resonator filter on one end and that is optically coupled to the grating on another end,
wherein the reflecting mirror forms a second comb-shaped reflection spectrum having peaks of a narrower full width at half maximum than a full width at half maximum of peaks in the first comb-shaped reflection spectrum at a wavelength interval differing from a wavelength interval of the first comb-shaped reflection spectrum,
wherein the grating and the reflecting mirror are configured such that one of the peaks in the first comb-shaped reflection spectrum and one of the peaks in the second comb-shaped reflection spectrum are overlappable on a wavelength axis,
wherein the wavelength tunable laser device is configured to adjust a refractive index of the phase adjusting portion such that one of the cavity modes of the laser cavity enters an overlap region in which said one of the peaks in the first comb-shaped reflection spectrum and said one of the peaks in the second comb-shaped reflection spectrum are overlapped, thereby achieving laser oscillation at a wavelength of said one of the cavity modes,
wherein the laser cavity is configured such that a spacing between cavity modes is narrower than the full width at half maximum of the peaks in the first comb-shaped reflection spectrum, and such that two or more of the cavity modes are included within a peak in the first comb-shaped reflection spectrum,
wherein the wavelength tunable laser device is configured to adjust the refractive index of the phase adjusting portion so as to shift said two or more cavity modes on the wavelength axis and align only one of said two or more cavity modes with said overlap region, thereby achieving single mode laser oscillation at said one of said two or more cavity modes,
wherein the peaks in the second comb-shaped reflection spectrum protrude up higher than the peaks in the first comb-shaped reflection spectrum, and
wherein the refractive index of the phase adjustable portion is adjustable while maintaining a state in which the peaks in the second comb-shaped reflection spectrum protrude up higher than the peaks in the first comb-shaped reflection spectrum.

US Pat. No. 10,193,304

FAILSAFE PULSED LASER DRIVER

INTEL CORPORATION, Santa...

1. An apparatus comprising:a laser array having a plurality of lasers; and
a laser driver coupled to the laser array, wherein the laser driver comprises
a current limiter to limit a maximum current provided to the laser array at or below a combined threshold current of lasers in the laser array;
one or more capacitors coupled to current limiter and the laser array, the one or more capacitors to be charged in response to current from the current limiter;
a switch coupled to the one or more capacitors operable to cause current from the one or more capacitors to flow through the laser array.

US Pat. No. 10,193,293

SEMICONDUCTOR INSPECTION AND METROLOGY SYSTEM USING LASER PULSE MULTIPLIER

KLA-Tencor Corporation, ...

1. A method of generating output pulsed light at an output repetition pulse rate that is a multiplication factor greater than an input repetition pulse frequency of input laser pulses, the method comprising:optically splitting each input laser pulse of the input laser pulses into a plurality of pulses;
reflecting the plurality of pulses using a mirror and one or more multi-surface reflecting components including one or more partially reflective surfaces operably arranged and spaced apart such that the plurality of pulses are grouped into pulse trains that are of approximately equal energy and are approximately equally spaced in time; and
transmitting a set of the pulse trains as the output pulsed light.