US Pat. No. 10,792,295

COMPOSITIONS FOR MANAGEMENT OF HELICOBACTER PYLORI INFECTIONS

SAMI LABS LIMITED, Banga...

1. A method of inhibiting growth of Helicobacter pylori strains, said method comprising bringing into contact Helicobacter pylori strains with a composition containing:a) at least 10% w/w 1-O-galloyl-?-D-glucose (?-glucogallin) and at least 10% w/w total mucic acid gallates, and
b) an effective dose of probiotic bacteria Bacillus coagulans, thereby, inhibiting the growth of Helicobacter pylori.
US Pat. No. 10,793,832

PANCREATIC ENDOCRINE CELLS, METHOD FOR PRODUCING SAME, AND TRANSDIFFERENTIATION AGENT

Juntendo Educational Foun...

1. A method for transdifferentiating somatic cells into pancreatic endocrine cells, the method comprisingintroducing one or more genes of a GLIS family or one or more gene products thereof and a Neurogenin3 gene or one or more gene products thereof into the somatic cells,
wherein the one or more genes of a GLIS family or one or more gene products thereof is selected from the group consisting of GLIS1 and GLIS3 and wherein the somatic cells transdifferentiate into the pancreatic endocrine cells without undergoing an iPS cell stage.
US Pat. No. 10,792,296

COMPOSITIONS AND METHODS FOR TREATING AN INFECTION

CMPD LICENSING, LLC, Con...

1. A method of making a compounded composition, the method comprising mixing doxycycline hyclate and a diluent, wherein the diluent comprises a hydrocortisone/acetic acid otic solution.
US Pat. No. 10,793,833

GENERATION OF HUMAN IPS CELLS BY A SYNTHETIC SELF-REPLICATIVE RNA

The Regents of the Univer...

1. A composition comprising human cells transformed with an RNA replicon comprising:a plurality of non-structural replicase domains from an alphavirus and at least four heterologous polynucleotide sequences that encode reprogramming factors (RFs) for inducing the generation of pluripotent stem cells when expressed in a somatic cell;
wherein the RNA replicon comprises from 5? to 3?: polynucleotide sequences encoding the plurality of non-structural replicase domain sequences obtained from an alphavirus; a promoter; RF1; a coding sequence for a first self-cleaving peptide; RF2; a coding sequence for a second self-cleaving peptide; RF3; an IRES; RF4; an optional IRES or an optional promoter; an optional sequence encoding an optional selectable marker; an alphavirus 3? UTR and polyA tail;
wherein RF1-4 are heterologous polynucleotide sequences which encode reprogramming factors that induce de-differentiation of a somatic cell to a pluripotent cell; and
wherein RF1-4 are polynucleotides encoding RFs selected from the group consisting of Oct-3, Oct-4, Klf, Sox-2, c-Myc, n-Myc, L-Myc, Nanog, and Glis1.
US Pat. No. 10,792,297

METHODS OF TREATMENT AND MAINTENANCE THERAPY FOR BLADDER CANCER USING GEMCITABINE

TARIS Biomedical LLC, Le...

1. A method of providing maintenance therapy for an individual,wherein the maintenance therapy follows at least one previous therapy, wherein the maintenance therapy comprises
administering gemcitabine continuously to the individual two or more times during two or more delivery periods
wherein the gemcitabine is delivered locally to the bladder of the individual,
wherein each delivery period is at least one week,
wherein there is a rest period between each delivery period of at least one month, and
wherein the individual has muscle invasive bladder cancer.
US Pat. No. 10,793,834

LIVE-ATTENUATED VIRUS AND METHODS OF PRODUCTION AND USE

THE UNIVERSITY OF HONG KO...

1. A live-attenuated virus comprising a genome genetically engineered from a wild type virus to have mutated codons having an avian viral codon usage bias, the mutated codons having an avian viral codon usage bias present at conserved sites at the amino acid level and absent from genomic regions involving packaging or splicing, or overlapping reading frames encoding multiple proteins.
US Pat. No. 10,792,298

MIRNA PHARMACEUTICAL COMPOSITIONS AND THERAPEUTIC USES THEREOF

FONDAZIONE ISTITUTO ITALI...

1. A pharmaceutical composition comprising a plurality of microRNAs and a pharmaceutically acceptable carrier and/or diluent and/or excipient, said plurality of micro mRNAs comprising a microRNA comprising nucleotides 1-8 of SEQ ID NO:1, a microRNA comprising nucleotides 2-11 of SEQ ID NO:2, a microRNA comprising nucleotides 2-11 of SEQ ID NO:3, a microRNA comprising nucleotides 2-8 of SEQ ID NO:4, a microRNA comprising nucleotides 2-11 of SEQ ID NO:5, a microRNA comprising nucleotides 2-8 of SEQ ID NO:6, a microRNA comprising nucleotides 2-11 of SEQ ID NO:7, a microRNA comprising nucleotides 2-11 of SEQ ID NO:8, a microRNA comprising nucleotides 2-11 of SEQ ID NO:9, a microRNA comprising nucleotides 2-11 of SEQ ID NO:10 and a microRNA comprising nucleotides 2-11 of SEQ ID NO:11, wherein the nucleotide positions are indicated with reference to the 5? terminus of the sequence.
US Pat. No. 10,793,835

CHIMERIC ADENO-ASSOCIATED VIRUS/ BOCAVIRUS PARVOVIRUS VECTOR

University of Iowa Resear...

1. A method to express a heterologous gene product in mammalian cells comprising providing isolated chimeric virus comprising human bocavirus (BoV) capsid protein and a recombinant adeno-associated viral (AAV) genome comprising an expression cassette encoding the heterologous gene product; andinfecting mammalian cells having the tropism of human bovavirus with the chimeric virus an amount effective to express the heterologous gene product.
US Pat. No. 10,792,299

METHODS AND COMPOSITIONS FOR TREATING MALIGNANT TUMORS ASSOCIATED WITH KRAS MUTATION

NITTO DENKO CORPORATION, ...

1. A pharmaceutical composition for the treatment or therapy of a malignant tumor, the composition comprising RNAi molecules and pharmaceutically acceptable excipients, wherein the RNAi molecules each comprise a sense strand having the nucleotide base sequence GAAGCCUUUUGAGACCCUANN (SEQ ID NO:133) and an antisense strand having the nucleotide base sequence UAGGGUCUCAAAAGGCUUCNN (SEQ ID NO:159), wherein upper case A, G, C and U refer to ribo-A, ribo-G, ribo-C and ribo-U, respectively, and wherein N is ribo-A, ribo-C, ribo-G, ribo-U, 2?-OMe-U, 2?-deoxy-A, 2?-deoxy-C, 2?-deoxy-G, 2?-deoxy-U, or deoxythymidine (dT=T=t), or an inverted, or chemically modified nucleotide.
US Pat. No. 10,793,579

BICYCLIC-FUSED HETEROARYL OR ARYL COMPOUNDS

Pfizer Inc., New York, N...

1. A pharmaceutical combination comprising 1-(((2S,3S,4S)-3-ethyl-4-fluoro-5-oxopyrrolidin-2-yl)methoxy)-7-methoxyisoquinoline-6-carboxamide, or a pharmaceutically acceptable salt thereof, and tofacitinib, or a pharmaceutically acceptable salt thereof.
US Pat. No. 10,793,836

ENGINEERED IMINE REDUCTASES AND METHODS FOR THE REDUCTIVE AMINATION OF KETONE AND AMINE COMPOUNDS

Codexis, Inc., Redwood C...

1. A polynucleotide encoding an engineered polypeptide, wherein the engineered polypeptide comprises an amino acid sequence with at least 90% sequence identity to the reference sequence of SEQ ID NO:8, wherein the alanine at the position corresponding to amino acid 239 of SEQ ID NO:8 is substituted with another amino acid in the amino acid sequence of the engineered polypeptide, and wherein the engineered polypeptide has imine reductase activity.
US Pat. No. 10,793,837

PRODUCTION OF POLYUNSATURATED FATTY ACIDS (PUFAS) USING A NOVEL MODULAR DOCOSAHEXAENOIC ACID (DHA) SYNTHASE

DSM IP Assets B.V, Heerl...

1. A recombinant nucleic acid molecule selected from the group consisting of: (a) a nucleic acid molecule comprising a polynucleotide sequence encoding a protein having the amino acid sequence of SEQ ID NO: 1; (b) a nucleic acid molecule comprising a polynucleotide sequence encoding a protein with modular docosahexaenoic acid (DHA) synthase activity and having at least 95% amino acid sequence identity to the amino acid sequence of SEQ ID NO: 1; and (c) a nucleic acid molecule comprising the polynucleotide sequence of SEQ ID NO: 2 encoding the protein of SEQ ID NO: 1, wherein said recombinant nucleic acid molecule is operably linked to a transcription control sequence, and wherein said polynucleotide sequence is heterologous to said transcription control sequence.
US Pat. No. 10,793,838

GLUCOSYLTRANSFERASE ENZYMES FOR PRODUCTION OF GLUCAN POLYMERS

DUPONT INDUSTRIAL BIOSCIE...

1. A composition comprising water-insoluble poly alpha-1,3-1,6-glucan, wherein said poly alpha-1,3-1,6-glucan is a product of a glucosyltransferase enzyme comprising an amino acid sequence that is at least 90% identical to SEQ ID NO:2, and wherein the alpha-1,3 linkages and alpha-1,6 linkages of the poly alpha-1,3-1,6-glucan do not consecutively alternate with each other.
US Pat. No. 10,792,302

COMPOSITION FOR PREVENTING OR TREATING METABOLISM DISORDERS COMPRISING LEUCONOSTOC MESENTEROIDES-PRODUCING EXOPOLYSACCHARIDE AS ACTIVE INGREDIENT

Noster Inc., Muko (JP)

1. A method for preventing or treating a metabolic disorder, comprising administering an effective amount of an exopolysaccharide produced by Leuconostoc mesenteroides to a subject,wherein the Leuconostoc mesenteroides is Leuconostoc mesenteroides NTM048 strain deposited under accession number NITE BP-1519, and
wherein the metabolic disorder is at least one kind selected from the group consisting of obesity, type 2 diabetes, gestational diabetes, diabetic complications, impaired glucose tolerance, hyperinsulinemia, hyperlipemia, increase in adipose tissue, and fatty liver,
thereby preventing or treating the metabolic disorder in the subject.
US Pat. No. 10,793,839

O-GLYCAN SIALYLATED RECOMBINANT GLYCOPROTEINS

Cevec Pharmaceuticals Gmb...

1. A recombinant glycoprotein having GalNAc O-glycans that are sialylated to a degree of at least 80%, wherein said glycoprotein is a C1 esterase inhibitor comprising the amino acid sequence of SEQ ID NO: 3 or a hepatocyte growth factor comprising the amino acid sequence of SEQ ID NO: 4, wherein said glycoprotein is produced in a cell line that is genetically modified to overexpress a ?-galactoside ?-2,3-sialyltransferase 1 (ST3Gal1), which is further genetically modified to overexpress a ?-galactoside ?-2,3-sialyltransferase 4 (ST3Gal4), wherein said cell line can produce said glycoprotein comprising a sialylated GalNAc-O-glycan, said glycoprotein having an increased serum half-life as compared to a nonsialylated glycoprotein.
US Pat. No. 10,792,303

COMPOSITIONS AND METHODS FOR INDUCING BEIGE OR BROWN FAT TISSUE

Logick Energetics, Leide...

1. A pharmaceutical composition for use as a medicament for the inducement of beige/brite or brown fat tissue in vivo in the treatment of obesity or disorders contributed by obesity comprising a combination of active pharmaceutical ingredients consisting of: (ingredient i) a compound selected from at least one of Pentosan or polysulfated glycosaminoglycan in combination with (ingredient ii) at least one non-protein or non-nucleic acid compound, different from (ingredient i), that can activate PPAR, wherein (ingredient ii) is a PPAR? agonist selected from triglitazone, rosiglitazone, ciglitazone, pioglitazone, or indomethacin.
US Pat. No. 10,792,304

HEMORHEOLOGIC APPROACH FOR REDUCTION/PREVENTION OF CANCER METASTASIS FORMATION

UNM Rainforest Innovation...

1. A method for treating or ameliorating, cancer metastases in a subject having breast cancer comprising delivery to the subject a dosage of polyethylene oxide (PEO) wherein the PEO is a drag reducing polymer (DRP) that is a linear or branched blood soluble non-toxic macromolecule with a molecular weight near or over 106 Daltons.
US Pat. No. 10,793,841

T7 RNA POLYMERASE VARIANTS

Codexis, Inc., Redwood C...

1. An engineered RNA polymerase comprising a polypeptide sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity to the reference sequence of SEQ ID NO:4, wherein said engineered RNA polymerase comprises a substitution at position 404 in said polypeptide sequence, and wherein the amino acid positions of said polypeptide sequence are numbered with reference to SEQ ID NO:4.
US Pat. No. 10,793,842

CAS9 VARIANTS AND METHODS OF USE THEREOF

the regents of the univer...

1. A nucleic acid comprising a nucleotide sequence encoding a variant Cas9 protein with reduced HNH cleavage activity relative to a corresponding wild type Cas9 protein, wherein the variant Cas9 protein comprises:(a) a RuvC domain, and
(b) at least one of:
(i) a deletion of 100 or more amino acids within the HNH domain that reduces the HNH cleavage activity of the variant Cas9 protein relative to the HNH cleavage activity of the corresponding wild type Cas9 protein, and
(ii) an insertion, within the HNH domain, of a heterologous amino acid sequence that provides a heterologous activity to the variant Cas9 protein relative to the corresponding wild type Cas9 protein, wherein said insertion reduces the HNH cleavage activity of the variant Cas9 protein relative to the HNH cleavage activity of the corresponding wild type Cas9 protein.
US Pat. No. 10,792,306

COLONOSCOPY—PREPARATION

NORGINE BV, Amsterdam (N...

1. A kit comprising:A) a first component, being a composition for the preparation of a first colon cleansing solution by admixture with 400 to 600 ml water; and
B) a second component, being a composition for the preparation of a second colon cleansing solution by admixture with 400 to 600 ml water;
the first component comprising
a) 90 to 112.5 g polyethylene glycol having an average molecular weight of 2500 to 4500 Da,
b) 3.75 to 11.25 g sodium sulphate;
the second component comprising
a) 50 to 60 g ascorbate anion,
wherein the ascorbate anion is provided by sodium ascorbate and ascorbic acid, and
wherein the weight ratio of sodium ascorbate to ascorbic acid is from 1:10 to 10:1; and
b) 15 to 45 g polyethylene glycol having an average molecular weight of 2500 to 4500 Da.
US Pat. No. 10,793,843

CBLB ENDONUCLEASE VARIANTS, COMPOSITIONS, AND METHODS OF USE

bluebird bio, Inc., Camb...

1. A fusion polypeptide comprising an amino acid sequence at least 95% identical to the amino acid sequence set forth in SEQ ID NO: 13, wherein the polypeptide binds to and cleaves a target site in a human Cbl lymphoma proto-oncogene B (CBLB) set forth in SEQ ID NO: 22.
US Pat. No. 10,792,307

PEPTIDES AND COMBINATION OF PEPTIDES OF NON-CANONICAL ORIGIN FOR USE IN IMMUNOTHERAPY AGAINST DIFFERENT TYPES OF CANCERS

IMMATICS BIOTECHNOLOGIES ...

1. A method of treating a patient who has cancer, comprising administering to said patient a population of activated T cells that kill cancer cells that present a peptide consisting of the amino acid sequence of SEQ ID NO: 44, wherein said cancer is prostate cancer.
US Pat. No. 10,793,587

BIOFILM INHIBITING COMPOSITIONS ENHANCING WEIGHT GAIN IN LIVESTOCK

AKESO BIOMEDICAL, INC., ...

1. A non-human animal feed comprisinga grist or mixture of non-human animal's basal feed components comprising one or more ferric compounds comprising a conjugate base of an acid selected from the group consisting of an ?-hydroxy acid, amino acid, amino carboxylic acid and diacid, the ferric compound being present in a concentration between 0.1 g/Kg and 20 g/Kg of the basal feed, wherein the ?-hydroxy acid is selected from the group consisting of citric acid, tartaric acid, lactic acid, glycolic acid, quinic acid, glycolic acid, isoleucic acid, valic acid, malic acid, and mandelic acid; wherein the amino acid is selected from the group consisting of alanine, arginine, asparagine, aspartic acid, cysteine, glutamine, glutamic acid, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, and valine; wherein the diacid is selected from the group consisting of malic acid, tartaric acid and oxalic acid; and wherein the amino carboxylic acid is EDTA.
US Pat. No. 10,793,844

AMYLASES, NUCLEIC ACIDS ENCODING THEM AND METHODS FOR MAKING AND USING THEM

BASF Enzymes LLC, San Di...

1. A method for hydrolyzing a starch comprising:(a) providing a starch;
(b) providing a polypeptide having glucoamylase activity, wherein the polypeptide is at least 85% identical to the amino acid sequence of SEQ ID NO:12; and
(c) contacting the starch of (a) with the polypeptide of (b) wherein the polypeptide hydrolyzes the starch.
US Pat. No. 10,792,308

PEPTIDES AND COMBINATION OF PEPTIDES OF NON-CANONICAL ORIGIN FOR USE IN IMMUNOTHERAPY AGAINST DIFFERENT TYPES OF CANCERS

Immatics Biotechnologies ...

1. A method of treating a patient who has cancer, comprising administering to said patient a population of activated T cells that are capable of killing cancer cells that present a peptide consisting of the amino acid sequence of SEQ ID NO: 13,wherein said cancer is selected from the group consisting of gastric cancer, hepatocellular carcinoma, head and neck squamous cell carcinoma, melanoma, ovarian cancer, pancreatic cancer, small cell lung cancer, and urinary bladder carcinoma.
US Pat. No. 10,793,845

POLYPEPTIDES HAVING CELLULOLYTIC ENHANCING ACTIVITY AND POLYNUCLEOTIDES ENCODING SAME

Novozymes, Inc., Davis, ...

1. A nucleic acid construct, comprising a polynucleotide encoding a GH61 polypeptide having cellulolytic enhancing activity, wherein the polynucleotide is operably linked to one or more heterologous control sequences that direct the production of the GH61 polypeptide in a recombinant host cell, and wherein the GH61 polypeptide having cellulolytic enhancing activity is selected from the group consisting of:(a) a GH61 polypeptide having at least 95% sequence identity to the mature polypeptide of SEQ ID NO: 8;
(b) a GH61 polypeptide encoded by a polynucleotide that hybridizes under very high stringency conditions with the full-length complement of the mature polypeptide coding sequence of SEQ ID NO: 7 or the cDNA sequence of the mature polypeptide coding sequence of SEQ ID NO: 7, wherein the very high stringency conditions are defined as prehybridization and hybridization at 42° C. in 5×SSPE, 0.3% SDS, 200 micrograms/ml sheared and denatured salmon sperm DNA, and 50% formamide, for 12 to 24 hours, and washing three times each for 15 minutes using 2×SSC, 0.2% SDS at 70° C.; and
(c) a GH61 polypeptide encoded by a polynucleotide having at least 99% sequence identity to the mature polypeptide coding sequence of SEQ ID NO: 7 or the cDNA sequence of the mature polypeptide coding sequence of SEQ ID NO: 7.
US Pat. No. 10,793,846

COMPOSITIONS AND METHODS FOR TREATING CELIAC SPRUE DISEASE

University of Washington,...

1. A polypeptide comprising an amino acid sequence at least 90% identical to the amino acid sequence of SEQ ID NO: 1, wherein(a) residue 467 is Ser, residue 267 is Glu, and residue 271 is Asp; and
(b) the polypeptide comprises an amino acid change from SEQ ID NO: 1 at one or more residues selected from the group consisting of 463A/L/M/Q/R/T/V, 221 D/N/Q/H, 262E, 268S/T/A, 269L/T, 270A/T/V, 319A, 320M, 354A/E/Q/R/Y, 358N/S/Q/T, 368F/Q, 399Q, 4025/Q, 406S, 424K, 449E/N/Q, 461R, 105H, 171R/A/S, 172R/A/S, 173R/S, 174S, and 456V.
US Pat. No. 10,793,847

SYSTEMS AND METHODS FOR GROWING A BIOFILM OF PROBIOTIC BACTERIA ON SOLID PARTICLES FOR COLONIZATION OF BACTERIA IN THE GUT

MYBIOTICS PHARMA LTD., H...

1. A method comprising:providing a bacterial biofilm comprising at least one bacterial strain attached to particles, obtained by:
a. inoculation of a population comprising at least one strain of bacteria in a growth medium;
b. incubation of the particles with the population comprising at least one bacterial strain for a time sufficient for the population of at least one strain of bacteria to attach to the particles;
c. culturing of the population comprising at least one strain of bacteria attached to the particles in a growth medium, for a time sufficient to form a bacterial biofilm attached to the particles,
wherein the incubation step occurs in the growth medium,
wherein the growth medium exerts a shear force on the bacteria during the culturing step,
wherein the culturing step comprises culturing under anaerobic conditions,
thereby providing the bacterial biofilm comprising at least one bacterial strain attached to particles; and
d. administering the bacterial biofilm attached to particles to a subject in need thereof, wherein the bacterial biofilm comprising at least one bacterial strain attached to particles is configured to colonize the gastrointestinal tract of a subject, thereby colonizing the gastrointestinal tract of the subject with said bacterial biofilm attached to particles.
US Pat. No. 10,793,592

ACTIVATED CARBON FOR THE REMOVAL OF LEACHABLES AND/OR EXTRACTABLES

Merck Patent GmbH, Darms...

1. A method for purifying a target molecule comprising:separating a target molecule from leachables and/or extractables by contacting a liquid comprising the target molecule and leachables and/or extractables with activated carbon, wherein said leachables and/or extractables are removed from said liquid by said activated carbon,
wherein said target molecule is a protein with a molecular weight of 10,000 or more, and
wherein the activated carbon is an activated carbon obtained by pyrolysis of a synthetic, chemically defined organic polymeric material.
US Pat. No. 10,793,593

PURIFICATION OF PROTEINS

EMD Millipore Corporation...

1. A method of purifying a biomolecule of interest from a mixture containing the biomolecule of interest and one or more negatively charged impurities, wherein the biomolecule of interest is produced in a microbial cell and is positively charged, the method comprising:a) providing the mixture containing a biomolecule of interest and one or more impurities, wherein the biomolecule is expressed in a microbial cell;
b) adding to said mixture a polymer solubilized in a carrier liquid, wherein the polymer is poly(4-vinyl pyridine-co-vinyl pyridinium sulphopropyl betaine or poly(4-vinyl pyridine-co-vinyl pyridinium ethylene glycol;
c) adjusting the pH of the mixture to a pH of 5.2, to precipitate the polymer and form a supernatant, wherein the precipitated polymer binds the one or more impurities; and
d) subjecting said supernatant containing the biomolecule of interest to chromatography.
US Pat. No. 10,793,850

RECOMBINATION SYSTEM

DSM IP ASSETS B.V., Heer...

1. A method for carrying out recombination at a target locus in a host cell, which method comprises:providing two or more nucleic acids which comprise: (a) sequences capable of homologous recombination with sequences flanking the target locus; (b) two or more site-specific recombination sites; and (c) a sequence encoding a recombinase which recognizes the site-specific recombination sites,
wherein none of the two or more nucleic acids comprises all of the sequences of (a), (b), and (c) and wherein the sequences of (a), (b) and (c) must be comprised by the two or more nucleic acids when those nucleic acids are taken together as a group,
wherein the two or more nucleic acids are capable of homologous recombination with each other to yield a single nucleic acid, and
wherein the sequence of (c) is split across at least two of the two or more nucleic acids such that each of the at least two of the two or more nucleic acids comprise a sequence encoding a non-functional portion of the recombinase;
introducing the two or more nucleic acids into the host cell so that recombination into said host cell can take place; and
recombining the said two or more nucleic acids with each other and with the sequences flanking the target locus so that a contiguous nucleic acid sequence encoding a functional recombinase is inserted at the target locus, said recombinase-encoding sequence being flanked by at least two site-specific recombination sites and the said site-specific recombination sites being flanked by the sequences capable of homologous recombination with sequences flanking the target locus;
wherein the site-specific recombination sites are lox sites and the recombinase is Cre, the site-specific recombination sites are FRT sites and the recombinase is Flp, the site-specific recombination sites are Vlox sites and the recombinase is VCre, or the site-specific recombination sites are Slox and the recombinase is SCre.
US Pat. No. 10,793,852

HIGH-DENSITY DNA STORAGE WITH SALT

Microsoft Technology Lice...

1. A method comprising:diluting a solution containing DNA;
adding a salt solution at a molar ratio of less than 20:1 salt cation to phosphate groups in the DNA; and
drying to create a dried product, wherein the dried product does not include a solid phase media.
US Pat. No. 10,793,853

TARGETED DELIVERY SYSTEM

CEDARS-SINAI MEDICAL CENT...

1. A treatment delivery platform, comprising:a polypeptide sequence adapted to target and penetrate a cancer cell, wherein the polypeptide sequence comprises, from N-terminus to C-terminus, a Her segment, a penton base segment, and a decalysine motif, and
a delivery molecule bound to the decalysine motif via electrostatic interactions, wherein the delivery molecule comprises a triphosphate-capped siRNA.
US Pat. No. 10,793,597

METHODS FOR THE TREATMENT OF MITOCHONDRIAL DISEASES ASSOCIATED WITH A MUTATION IN SURF 1 OR POLG GENE RESULTING IN A DISRUPTION OF MITOCHONDRIAL OXIDATIVE PHOSPHORYLATION

STEALTH BIOTHERAPEUTICS C...

1. A method for ameliorating a disease selected from the group consisting of Leigh syndrome, Alpers' disease, ataxia-neuropathy disorders, and progressive external ophthalmoplegia in a subject in need thereof, the method comprising: administering to the subject a therapeutically effective amount of the peptide D-Arg-2?,6?-Dmt-Lys-Phe-NH2 or a pharmaceutically acceptable salt thereof, wherein the Leigh syndrome is associated with a loss-of-function mutation in the SURF 1 gene resulting in a disruption of mitochondrial oxidative phosphorylation due to impairment of the complete assembly of at least one mitochondrial complex selected from the group consisting of Complex I; Complex II; Complex III; Complex IV, and the Alpers' disease, ataxia-neuropathy disorders, and progressive external ophthalmoplegia are associated with a loss-of-function mutation in the POLG gene resulting in a disruption of mitochondrial oxidative phosphorylation.
US Pat. No. 10,793,854

SKIN AND HAIR COLOR-CONTROLLING FACTOR

Kao Corporation, Tokyo (...

1. A method for evaluating and/or selecting an agent that regulates the amount of melanin in keratinocytes, the method comprising:(a) administering a test substance to keratinocytes that are being cultured in medium and culturing the keratinocytes with the test substance in medium;
(b) assaying whether, while the keratinocytes were cultured with the test substance in medium in part (a), there was a change in expression of at least one gene selected from the group consisting of ATG7, RAB11A, CLIP-170, Rubicon and RAB7B, or in the expression or activity of at least one of the molecules encoded by the gene in the keratinocytes, as compared to the expression of the gene, or as compared to the expression or activity of the molecule, in control keratinocytes that either (i) were not administered the test substance or (ii) were administered a control substance;
(c) selecting a test substance that changes the expression of the gene or that changes the expression or activity of the molecule, in part (a) as compared to that in the control keratinocytes;
(d) administering the test substance selected in part (c) to cells in culture to which melanosomes have been added in vitro and determining whether the amount of melanin in the cells is increased or decreased as a result of the administering and as compared to the amount of melanin in control cells that either (i) were not administered the test substance selected in part (c) or (ii) were administered a control substance; and
(e) selecting a test substance that changes the amount of melanin in the cells of part (d) as compared to that in the control cells, as an agent that regulates the amount of melanin in keratinocytes,
wherein a test substance that both (i) increases the amount of melanin in the cells and (ii) suppresses the expression of the gene, or the expression or activity of the molecule encoded by the gene, is an agent that regulates the amount of melanin by increasing the amount of melanin in keratinocytes; and
wherein a test substance that both (i) decreases the amount of melanin in the cells and (ii) enhances the expression of the gene, or the expression or activity of the molecule encoded by the gene, is an agent that regulates the amount of melanin by decreasing the amount of melanin in keratinocytes.
US Pat. No. 10,793,598

GRB-EHITSN INHIBITORY PEPTIDES

Rush University Medical C...

1. A method of inhibiting activity of GrB-EHITSN, the method comprising administering a therapeutically effective amount of a fusion peptide comprising an isolated NPF peptide comprising the amino acid sequence of SEQ ID NO: 2 and a cell-permeable peptide operably connected to the isolated NPF peptide and inhibiting the activity of GrB-EHITSN, wherein the therapeutically effective amount of the fusion peptide is delivered to the lung.
US Pat. No. 10,793,855

COMPOSITIONS FOR MODULATING EXPRESSION OF C9ORF72 ANTISENSE TRANSCRIPT

Ionis Pharmaceuticals, In...

1. A compound comprising a modified oligonucleotide consisting of 16-30 linked nucleosides and having a nucleobase sequence comprising at least 16 contiguous nucleobases of a sequence selected from SEQ ID NO: 32, 33, 34 and 35, wherein the modified oligonucleotide comprises at least one modified internucleoside linkage and/or at least one modified sugar.
US Pat. No. 10,792,319

PROCESS FOR THE PRODUCTION OF AN ENRICHED NATURAL ANTIOXIDANT MIXTURE FROM A SINGLE SOURCE PLANT

Applied Food Sciences, In...

1. An antioxidant mixture prepared by a process comprising the steps of:blanching a plant material from a guayusa plant;
contacting said plant material for a first time with a solvent, thereby obtaining a first slurry;
filtering said first slurry, thereby obtaining a first extract;
contacting said plant material for a second time with said solvent, thereby obtaining a second slurry;
filtering said second slurry, thereby obtaining a second extract;
combining said first extract and said second extract, thereby generating an third extract containing at least antioxidants, xanthines, and amino acids; and
substantially drying said third extract.
US Pat. No. 10,793,599

MPHOSPH1-DERIVED PEPTIDE, AND VACCINE INCLUDING SAME

ONCOTHERAPY SCIENCE, INC....

1. An isolated peptide having cytotoxic T cell (CTL)-inducing ability and selected from the group consisting of:(i) a peptide consisting of an amino acid sequence selected from the group consisting of SEQ ID NOs: 5, 12, 27, 52, and 53 into which one or two substitution(s) selected from the group consisting of (a) to (d) below is introduced:
(a) the second amino acid from the N terminus is substituted with an amino acid selected from the group consisting of threonine, valine, isoleucine, leucine, phenylalanine and tyrosine;
(b) the third amino acid from the N terminus is substituted with an amino acid selected from the group consisting of leucine, phenylalanine, tyrosine, isoleucine and alanine;
(c) the seventh amino acid from the N terminus is substituted with an amino acid selected from the group consisting of leucine, isoleucine, tyrosine, valine and phenylalanine; and
(d) the C-terminal amino acid is substituted with an amino acid selected from the group consisting of lysine and arginine; and
(ii) a peptide consisting of an amino acid sequence selected from the group consisting of SEQ ID NOs: 118, 119, and 170 into which one or two substitution(s) selected from the group consisting of (a) to (c) below is introduced:
(a) the first amino acid from the N terminus is substituted with an amino acid selected from the group consisting of aspartic acid and glutamic acid;
(b) the second amino acid from the N terminus is substituted with an amino acid selected from the group consisting of phenylalanine, tyrosine, alanine, isoleucine, leucine, and valine; and
(c) the C-terminal amino acid is substituted with an amino acid selected from the group consisting of arginine and lysine.
US Pat. No. 10,793,856

COMPOSITIONS FOR MODULATING TAU EXPRESSION

Biogen MA Inc., Cambridg...

1. A compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of a sequence selected from among SEQ ID Nos: 56, 57, 248, 462-467, 1668-1698, 2025-2048, 2301-2309, 2331-2443, 2478-2483, and 2532-2565, wherein the nucleobase sequence of the modified oligonucleotide is at least 90% complementary to SEQ ID NO: 1, and wherein the modified oligonucleotide comprises at least one modified internucleoside linkage and/or at least one modified sugar.
US Pat. No. 10,794,881

SYSTEMS, DEVICES, AND METHODS FOR THRESHOLD ANALYTE CALIBRATION AND QUANTITATION USING THRESHOLD ANALYTE CALIBRATION

Waters Technologies Corpo...

1. A method for detecting analytes in biological specimens, comprising:analyzing a first sample using a chromatography system to obtain a first result, the first sample including a first portion of a biological specimen;
analyzing a second sample using the chromatography system to obtain a second result, the second sample including a second portion of the biological specimen and a reference analyte at a defined concentration, wherein the first sample does not include the reference analyte; and
calculating a ratio between (i) the first result and (ii) a difference between the second result and the first result.
US Pat. No. 10,792,320

METHODS FOR TREATMENT OF BLADDER DYSFUNCTION

1. A method of treating overactive bladder comprising administering to a patient suffering from overactive bladder a composition comprising a synergistic combination of therapeutically effective amounts of pumpkin seed extract, nitric oxide precursor, vitamin D3, and prebiotic fiber at sufficient intervals to reduce the patient's symptoms of overactive bladder.
US Pat. No. 10,793,857

TREATMENT OF SODIUM CHANNEL, VOLTAGE-GATED, ALPHA SUBUNIT (SCNA) RELATED DISEASES BY INHIBITION OF NATURAL ANTISENSE TRANSCRIPT TO SCNA

CuRNA, Inc., Miami, FL (...

1. A modified antisense oligonucleotide of 10-25 nucleotides in length which is at least 95% complementary to a 10-25 nucleotide target region on a natural antisense polynucleotide having SEQ ID NO: 12 wherein said target region is selected from the group consisting of nucleotides 128-147 of SEQ ID NO: 12; nucleotides 208-228 of SEQ ID NO: 12; nucleotides 441-461 of SEQ ID NO: 12; nucleotides 541-561 of SEQ ID NO: 12; nucleotides 456-475 of SEQ ID NO: 12; nucleotides 541-561 of SEQ ID NO: 12; nucleotides 540-563 of SEQ ID NO: 12; nucleotides 544-558 of SEQ ID NO: 12; nucleotides 541-560 of SEQ ID NO: 12; nucleotides 547-561 of SEQ ID NO: 12; nucleotides 541-561 of SEQ ID NO: 12; nucleotides 901-920 of SEQ ID NO: 12; nucleotides 906-924 of SEQ ID NO: 12; nucleotides 1015-1040 of SEQ ID NO: 12; nucleotides 1072-1092 of SEQ ID NO: 12; nucleotides 1018-1032 of SEQ ID NO: 12; nucleotides 1018-1038 of SEQ ID NO: 12; nucleotides 1024-1038 of SEQ ID NO: 12; nucleotides 1026-1038 of SEQ ID NO: 12; and nucleotides 1028-1038 of SEQ ID NO: 12 and wherein said modified oligonucleotide upregulates the expression of an SCN1a polynucleotide.
US Pat. No. 10,794,882

AQUEOUS COLORIMETRIC FLUORIDE DETECTION

HACH COMPANY, Loveland, ...

1. A method for preparing a fluoride sensitive species in an aqueous solution, comprising:causing a polyethylene glycol (PEG) monomethyl ether to produce an ester;
reacting the ester in ammoniated tetrahydrofuran to produce an amino polyethylene glycol;
placing, in a solution comprising a benzaldehyde species with a phenol functional group and a carboxylic acid functional group, a 1,2,3,3 3H-indolium iodide to produce a hemicyanine comprising a phenol functional group and a carboxylic acid functional group;
combining, in a polar aprotic solvent, the hemicyanine comprising the phenol functional group and the carboxylic acid functional group with a 1,1-carbonyldiimidazole (CDI) and adding the amino-PEG to produce a hemicyanine-PEG comprising a phenol functional group; and
creating a fluoride sensitive hemicyanine species containing a protecting group by reacting the hemicyanine-PEG comprising the phenol functional group with a SiR3 species, wherein the R3 is selected from the group consisting of: an alkyl chain of undefined length, an ethoxy group of undefined length, a phenyl ring, a tert-butyl group and an isopropyl group.
US Pat. No. 10,792,321

MASSAGE AND SPORT CREAM COMPOSITION SYSTEMS

1. A method for treating muscular pain, cramps and tension in humans in need thereof consisting essentially of:mixing and creaming ricinus communis seed oil, sesamum indium seed oil, deionized water, isopropyl myristate, triticum vulgare germ oil, butyrospermum parkii butter, white iodine, cetostearyl alcohol, sodium laureth sulfate, bentonite, dmdm hydantoin, sodium chloride, benzyl alcohol, and
behydroacetic acid, wherein:
approximately 25% of the volume of the composition is the ricinus communis seed oil,
approximately 25% of the volume of the composition is the sesamum indicum seed oil,
approximately 16% of the volume of the composition is the deionized water,
approximately 10% of the volume of the composition is the isopropyl myristate,
approximately 6% of the volume of the composition is the triticum vulgare germ oil,
approximately 6% of the volume of the composition is the butyrospermum parkii butter,
approximately 6% of the volume of the composition is the white iodine,
approximately 1% of the volume of the composition is the cetostearyl alcohol,
approximately 1% of the volume of the composition is the sodium laureth sulfate,
approximately 1% of the volume of the composition is the bentonite, and
wherein the dmdm hydantoin, the sodium chloride, the benzyl alcohol, and the behydroacetic acid each constitute less than 1% of the composition's volume but not 0%; and wherein the composition is applied topically to the human in need thereof and wherein the composition effectively treats muscular pain, cramps and tension in the human in need thereof.
US Pat. No. 10,793,601

THERAPEUTIC SPALT-LIKE TRANSCRIPTION FACTOR 4 (SALL4) PEPTIDE

National University of Si...

1. A peptide having less than 12 residues, comprising:the amino acid sequence set forth in formula I
RRKX1X2X3X4X5X6X7(SEQ ID NO: 62),   (I)
wherein X1, X2, X3, X4, X5, X6 or X7 is independently an amino acid with non-polar side chain, polar side chain that is not charged at neutral pH or polar side chain that is positively charged at neutral pH; wherein the peptide does not consist of the amino acid sequence of RRKQAKPQHI (SEQ ID NO: 3); wherein the sequence of amino acids is written from the N-terminus to the C-terminus; and wherein the peptide has an N-terminal acetyl group or protecting group, a C-terminal amine group or protecting group, or both.
US Pat. No. 10,793,858

RIBOZYME WITH TRNA SYNTHETASE ACTIVITY AND METHODS OF MANUFACTURING AND USING THE SAME

Purdue Research Foundatio...

1. An artificial ribozyme comprising:a T-box element comprising a 3?-terminus and a specifier loop for binding a cognate tRNA substrate with specificity; and
a flexizyme comprising dinitro-flexizyme, Fx3, or a variant of Fx3 and defines at least an active site for binding an amino acid, an acceptor end for base pairing to a terminus of a tRNA substrate, a nucleotide linker, and a P1 stem linked to the 3?-terminus of the T-box element;
wherein when the T-box element recognizes and preferentially binds the cognate tRNA substrate, the flexizyme can bind and aminoacylate the cognate tRNA substrate bound by the T-box element, and the active site of the flexizyme is not specific to one or more targeted amino acids.
US Pat. No. 10,797,956

EXTENDING CENTER CLUSTER MEMBERSHIP TO ADDITIONAL COMPUTE RESOURCES

CISCO TECHNOLOGY, INC., ...

1. A computer-implemented method comprising:sending, by a computing resource, a request to join a computing cluster including at least one member;
receiving, in one or more communications, a reply including metadata describing requirements to join the computing cluster and a reference to a software bundle used by devices in the computing cluster;
installing the software bundle; and
establishing membership in the computing cluster.
US Pat. No. 10,792,322

HERBAL COMPOSITIONS AND METHODS FOR THE PREVENTION AND TREATMENT OF PLANT OF NAIL INFECTIONS

MONDIAS NATURAL PRODUCTS ...

1. A phytosanitary composition comprising:between 0.2 and 2 wt % of Chelidonium majus root aqueous extract; and
between 0.1 to 5 wt % of at least one natural phenolic compound;
wherein the composition is usable for prevention or treatment of plant infections.
US Pat. No. 10,793,602

IMMUNOTHERAPY AGAINST SEVERAL TUMORS, SUCH AS LUNG CANCER, INCLUDING NSCLC

IMMATICS BIOTECHNOLOGIES ...

1. A method of eliciting an immune response in a patient who has lung cancer, comprising administering to the patient a composition comprising a population of activated T cells that kill the cancer cells that present a peptide consisting of the amino acid sequence of SEQ ID NO: 9,wherein the activated T cells are produced by contacting T cells with an antigen presenting cell that presents the peptide in a complex with a human class I or II WIC molecule on the surface of the antigen presenting cell.
US Pat. No. 10,792,323

PHARMACEUTICAL COMPOSITION FOR PREVENTING OR TREATING NEURODEGENERATIVE DISEASES WHICH INCLUDES FLOWER EXTRACT OF DAPHNE GENKWA OR FRACTIONS THEREOF AS ACTIVE INGREDIENT

KOREA RESEARCH INSTITUTE ...

1. A tablet or capsule consisting essentially of an extract of a flower of Daphne genkwa, polyvinylpyrrolidone, acacia rubber, and polyethylene glycol.
US Pat. No. 10,793,860

RNA INTERFERENCE MEDIATED INHIBITION OF HEPATITIS B VIRUS (HBV) GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (SINA)

Sirna Therapeutics, Inc.,...

1. A double-stranded short interfering nucleic acid (siNA) molecule comprisinga sense strand comprising the nucleotide sequence 5?-B GCCgAUCCAUACUGCGGAAUsU B-3? (SEQ ID NO:398) and an antisense strand comprising the nucleotide sequence 5?-UUCCGCAGUAUGGAUCGGCUsU-3? (SEQ ID NO:248), wherein B is an inverted abasic moiety, bolded nucleotides comprise 2?-O-methyl modifications, lower case nucleotides comprise 2?-fluoro modifications, italicized nucleotides are deoxynucleotides, and s is a phosphorothioate linkage.
US Pat. No. 10,792,324

COMPOSITIONS AND METHODS FOR THE TREATMENT OF ORTHOPEDIC AILMENTS

K.L.R.M., LLC, San Pedro...

1. A method for treatment of bone fractures, loss of bone mineral content or bone density, comprising:administering a pharmaceutically effective amount of a composition comprising ginger or a ginger derivative, Muira puama, Paullinia cupana, and at least one of the group consisting of L-arginine and L-citrulline that stimulates osteoblasts to increases production of NOS, nitric oxide production and cGMP resulting in bone formation.
US Pat. No. 10,793,861

PRODUCTS AND METHODS FOR TREATMENT OF FAMILIAL AMYOTROPHIC LATERAL SCLEROSIS

LUDWIG INSTITUTE FOR CANC...


wherein the recombinant adeno-associated virus genome lacks rep and cap genes.
US Pat. No. 10,792,325

SAFE DESMOPRESSIN ADMINISTRATION

Serenity Pharmaceuticals ...

1. A method of inducing an antidiuretic effect in a patient, the method comprising intranasally administering to the patient a composition of matter comprising an intranasal desmopressin dose in the form of a plume ejected over a time interval from the nozzle of a metered dose spray device, the plume comprising a volume of moving droplets together defining a conical volume having a central axis and an apex at the nozzle of the spray device, wherein the droplet density (number of droplets per unit volume) within the conical volume increases in a direction normal to the axis, the droplets together comprising between about 0.05 ?g and 5.0 ?g desmopressin, the plume serving to increase contact of the droplets with intranasal luminal mucosal surfaces.
US Pat. No. 10,792,837

PROCESS FOR MANUFACTURING OF A FIBRE-REINFORCED POLYMER COMPOSITION

BOREALIS AG, (AT)

1. A process for producing a fibre-reinforced polymer composition comprising the following steps:a) providing a polymer composition (A);
b) melting the polymer composition (A) in a compounding device;
c) feeding a non-woven fabric into the compounding device in the presence of the molten polymer composition (A), wherein the non-woven fabric comprises at least 75 wt. % carbon fibres based on the total weight of the non-woven fabric; and
d) withdrawing the fibre-reinforced polymer composition from the compounding device.
US Pat. No. 10,792,326

PHARMACEUTICAL FORMULATION FOR BEDWETTING AND METHOD OF USE THEREOF

WELLESLEY PHARMACEUTICALS...

1. An oral pharmaceutical composition, consisting of:acetaminophen;
ibuprofen;
desmopressin; and
one or more pharmaceutically acceptable carriers,
wherein the desmopressin is formulated for immediate release, and
wherein the composition is formulated for oral delivery, and
wherein at least a portion of each of the acetaminophen and ibuprofen is formulated for extended release.
US Pat. No. 10,793,606

MODIFIED AAV CAPSID PROTEINS AND USES THEREOF

University of Florida Res...

1. A variant recombinant adeno-associated virus (rAAV) capsid protein comprising any one of the following combinations of amino acid substitutions:(a) asparagine, alanine, aspartic acid, glycine, glutamic acid, aspartic acid, and phenylalanine at positions corresponding to amino acids 263, 264, 492, 493, 494, 499, and 500 of AAV2 VP1 capsid protein, respectively, and SAAGADXAXDS (SEQ ID NO: 5) at positions corresponding to amino acids 546-556 of AAV2 VP1 capsid protein;
(b) alanine, threonine, proline, aspartic acid, phenylalanine, and aspartic acid at positions corresponding to amino acids 263, 490, 492, 499, 500, and 530 of AAV2 VP1 capsid protein, respectively;
(c) asparagine, alanine, phenylalanine, alanine, asparagine, valine, threonine, arginine, aspartic acid, and aspartic acid at positions corresponding to amino acids 263, 264, 444, 451, 454, 455, 459, 527, 530, and 531 of AAV2 VP1 capsid protein, respectively;
(d) aspartic acid, glycine, glutamic acid, aspartic acid, and phenylalanine at positions corresponding to amino acids 492, 493, 494, 499, and 500 of AAV2 VP1 capsid protein, respectively, and EDATENXIXXDR (SEQ ID NO: 4) at positions corresponding to amino acids 545-556 of AAV2 VP1 capsid protein;
(e) alanine, glutamine, aspartic acid, glutamic acid, phenylalanine, and proline at positions corresponding to amino acids 263, 491, 492, 494, 500, and 503 of AAV2 VP1 capsid protein, respectively; or
(f) phenylalanine, GAXNMXTXAXR (SEQ ID NO: 31), threonine, proline, aspartic acid, phenylalanine, and aspartic acid at positions corresponding to amino acids 444, 451-461, 490, 492, 499, 500, and 530 of AAV2 VP1 capsid protein, respectively;
wherein each X corresponds to amino acids of a wild-type AAV2 VP1 capsid sequence as set forth in SEQ ID NO: 1, or homologous amino acids of a wild-type VP1 capsid sequence of an AAV serotype other than AAV2.
US Pat. No. 10,792,327

SUPRAMOLECULAR GYLCOSAMINOGLYCANS

Northwestern University, ...

1. A method comprising contacting a population of cells with a supramolecular glyconanostucture, the supramolecular glyconanostucture comprising a nanofiber of glycosylated peptide amphiphiles (GPAs) self-assembled into a nanofiber; wherein the GPAs comprise a hydrophobic non-peptide tail, a structured peptide segment, a charged peptide segment, and a terminal saccharide; and wherein the nanofiber comprises a hydrophobic core, peptide surface, and saccharides displayed on the surface.
US Pat. No. 10,793,607

TRIMER STABILIZING HIV ENVELOPE PROTEIN MUTATIONS

1. A recombinant human immunodeficiency virus (HIV) envelope (Env) protein, comprising two or more of the following amino acid residues:(i) Phe, Leu, Met, or Trp at position 651;
(ii) Phe, Ile, Met, or Trp at position 655;
(iii) Asn or Gln at position 535;
(iv) Val, Ile or Ala at position 589;
(v) Phe or Trp at position 573;
(vi) Ile at position 204; and/or
(vii) Phe, Met, or Ile at position 647,wherein the numbering of the positions is according to the numbering in gp160 of HIV-1 isolate HXB2 having the amino acid sequence of SEQ ID NO: 1.
US Pat. No. 10,793,864

METHODS AND COMPOSITIONS FOR ASSESSING VIRAL NUCLEAR LOCALIZATION

GEORGE MASON UNIVERSITY, ...

1. A recombinant DNA construct comprising a promotor operably linked to a nucleotide sequence encoding a fusion protein comprising a LIM Domain Only Protein 2 (LMO2) polypeptide, a reporter polypeptide, and a Viral Protein R (Vpr), wherein the Vpr polypeptide comprises the polypeptide encoded by SEQ ID NO: 5; and wherein the LMO2 polypeptide comprises the polypeptide encoded by SEQ ID NO: 1.
US Pat. No. 10,792,584

ACETYLATION OF CANNABIDIOL

Nextleaf Solutions Ltd., ...

1. A process for producing acetylated cannabidiol from cannabis oil comprising:refluxing cannabis oil with acetic anhydride at a temperature of 120-135° C. to form a crude product;
distilling the crude product at a temperature of 90-125° C. to form a partially refined product;
removing impurities from the partially refined product using a saline water solution wash with hexane;
evaporating hexane from the partially refined product;
removing further impurities from the partially refined product using a saline water solution wash with petroleum ether; and
evaporating petroleum ether from the partially refined product.
US Pat. No. 10,793,608

HYPERSENSITIVE RESPONSE ELICITOR-DERIVED PEPTIDES AND USE THEREOF

PLANT HEALTH CARE, INC., ...


wherein
X at position 5 is optional and, when present, is selected from Asp (D), isoD, Glu (E), y-glutamate, Gln (Q), Asn (N), Ser (S), and Gly (G), and
each X at positions 4, 9, 12, 13, and 14 is independently selected from Met (M), Ala (A), Asp (D), isoD, Glu (E), y-glutamate, Gln (Q), Asn (N), Ser (S), and Gly (G), wherein the peptide induces an active plant response, but does not induce a hypersensitive response, when applied to plant tissue, or wherein the peptide induces a hypersensitive plant response when applied to plant tissue.
US Pat. No. 10,793,865

TRANSFERRABLE MECHANISM OF GENERATING INDUCIBLE, BAR DOMAIN PROTEIN-MEDIATED BACTERIAL OUTER MEMBRANE EXTENSIONS

The Government of the Uni...

1. A method of causing outer membrane extensions in bacteria, the method comprising:providing an expression plasmid comprising an inducible promoter and a nucleic acid encoding SEQ ID No. 1;
transforming the bacteria with the expression plasmid; and then
inducing expression of SEQ ID No. 1, thereby causing outer membrane extensions in the bacteria.
US Pat. No. 10,792,329

S100 BASED TREATMENT OF CARDIAC POWER FAILURE

1. A method for improving cardiac function in a human suffering from ischemic heart failure comprising: intravenously administering to a human suffering from ischemic heart failure an AAV6 vector comprising a nucleic acid encoding an S100A1 protein, wherein the AAV6 vector is administered in a dosage of 5×1010-1×1012 total viral particles (tvp),wherein expression of the nucleic acid results in the increase in the concentration of the S100A1 protein in the myocardium of the human suffering from ischemic heart failure by 2-20 fold compared to a concentration of S100A1 protein in a control human, whereby said increase in S100A1 protein leads to improved cardiac function.
US Pat. No. 10,793,609

COMPRESSED PATHWAYS FOR NONRIBOSOMAL MOLECULAR BIOSYNTHESIS

Massachusetts Institute o...

1. A method of producing a nonribosomal molecule, the method comprising culturing a modified bacterial cell in the presence of an exogenous polyamine linker precursor, under conditions that results in the production of the nonribosomal molecule, wherein the modified bacterial cell is transformed with a compressed biosynthetic pathway that comprises:(a) Escherichia coli biosynthetic genes comprising an entA gene, an entB gene, an entC gene, an entD gene and an entE gene encoding a 2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase, a 2,3-dihydro-2,3-dihydroxybenzoate synthase, an isochorismate synthase, an Sfp-type phosphopantetheinyl transferase, and 2,3-dihydroxybenzoate-AMP ligase, respectively;
(b) Vibrio cholera biosynthetic genes comprising a vibH gene, vibF gene or a combination of a vibH gene and vibF gene encoding an amide synthase and peptide synthase, respectively; and
(c) an schH gene encoding an amide synthase.
US Pat. No. 10,793,866

EDIBLE VACCINES EXPRESSED IN YEAST FOR PREVENTING AND TREATING INFECTIOUS DISEASES, INCLUDING HEPATITIS B, IN HUMANS

DrD LifeSciences Group Li...

1. A composition for preventing and treating hepatitis B virus (HBV) infection in humans comprising a yeast expression plasmid, pYD5, for N-terminal surface display, wherein the recombinant plasmid contains SEQ ID NO: 1 or SEQ ID NO:2.
US Pat. No. 10,794,891

FUEL OIL STABILITY

BP Corporation North Amer...

1. A method for preparing a visbroken residue stream of interest in a refinery process, the precipitation of asphaltenes prevented from the visbroken residue stream of interest, said method comprising:comparing solvent power of the visbroken residue stream of interest, SPVisRes(OI), with critical solvent power of the visbroken residue stream of interest, CSPVisRes(OI),
categorizing the visbroken residue stream of interest as unstable if SPVisRes(OI) is not greater than CSPVisRes(OI), and
if SPVisRes(OI) is not greater than CSPVisRes(OI), adjusting the refinery process to provide the visbroken residue stream of interest with a value of SPVisRes(OI) that is greater than CSPVisRes(OI),whereinCSPVisRes(OI) is predicted from the critical percentage titrant for asphaltene stability in an atmospheric residue stream, CPTAR(OI), the atmospheric residue stream of interest being derived from the same crude oil as the visbroken residue stream of interest, using a correlation obtained by a method comprising:for each of a plurality of crude oils, determining:
CSPVisRes of a visbroken residue stream derived therefrom, and
CPTAR of an atmospheric residue stream derived therefrom, and
determining a correlation between CSPVisRes and CPTAR.SPVisRes(OI) is predicted using the following formula:SPVisRes(OI)=(100×CSP VisRes(OI))/(100?CPTVisRes)wherein:CPTVisRes is the critical percentage titrant (vol %) for asphaltene stability in the visbroken residue stream,
wherein CPTVisRes is derived from the critical percentage cetane (vol %) for asphaltene stability in the visbroken residue stream, CPCVisRes using the following formula:
CPTVisRes=CF+CPCVisRes wherein:CF is a conversion factor that relates CPTVisRes to CPCVisRes,
and wherein CPCVisRes is calculated from the P-value of the visbroken residue stream using the following formula:
CPCVisRes=([(P-value?1)*?VisRes]/[((P-value?1)*?VisRes)+1])*100wherein:?VisRes is the density of the visbroken residue stream.
US Pat. No. 10,792,330

TREATMENT WITH METHYLATION-CONTROLLED J PROTEIN (MCJ)

University of Vermont and...

1. A method of increasing mitochondrial metabolism in a CD 8+ T cell, the method comprising contacting a CD 8+ T cell in vitro with an exogenous MCJ-modulating compound that decreases an MCJ activity in an amount effective to decrease MCJ activity and increase mitochondrial metabolism in the CD 8+ T cell, wherein the MCJ-modulating compound comprises an MCJ siRNA molecule.
US Pat. No. 10,793,610

PESTICIDAL GENES AND METHODS OF USE

AgBiome, Inc., Durham, N...

1. A DNA construct comprising a heterologous promoter operably linked to a recombinant nucleic acid molecule comprisinga nucleotide sequence that encodes a polypeptide comprising an amino acid sequence having at least 95% sequence identity to the amino acid sequence set forth in SEQ ID NO: 409 or 410, wherein said polypeptide has pesticidal activity.
US Pat. No. 10,793,867

METHODS FOR TARGETED TRANSGENE-INTEGRATION USING CUSTOM SITE-SPECIFIC DNA RECOMBINASES

Monsanto Technology, LLC,...

1. A method of integrating a nucleic acid sequence into a selected genomic locus comprising:a) transforming a host cell with:
i) at least one linear donor DNA construct comprising a first TALER target sequence and an exogenous DNA sequence, wherein the donor DNA construct further comprises nucleic acid sequences that cause the formation of a circular intermediate comprising the exogenous DNA sequence and the first TALER target sequence;
ii) at least one nucleic acid sequence encoding a TALER, wherein the TALER comprises a small serine recombinase catalytic domain and forms part of a tetramer and mediates recombination between the first TALER target sequence and a second TALER target sequence located in the host cell genome, wherein the second TALER target sequence is endogenous to the host cell genome; and b) identifying a transformed host cell comprising the donor DNA construct integrated at a selected genomic locus in said host cell wherein the first and second TALER target sequences comprise a pair of TALE binding sites flanking a recombinase core sequence, wherein the pair of TALE binding sites are spaced from about 18 bp to about 50 bp apart.
US Pat. No. 10,792,331

METHODS FOR REDUCING CARDIOTOXICITY FROM CHEMOTHERAPY BY ADMINISTERING HUMANIN ANALOG COMPOSITIONS

LOS ANGELES BIOMEDICAL RE...

1. A method of reducing, decreasing, or inhibiting cardiotoxicity caused or induced by a cardiotoxic anti-cancer or anti-tumor therapeutic agent, comprising administering to a subject prior to, during or after treatment with the cardiotoxic anti-cancer or anti-tumor therapeutic agent an amount of:(a) a humanin analog comprising the sequence of SEQ ID NO: 2; and
(b) Dexrazoxane or a salt thereof sufficient to reduce, decrease, or inhibit cardiotoxicity in the subject.
US Pat. No. 10,793,611

BACILLUS THURINGIENSIS CYT1A MUTANTS

1. A Cyt1A variant polypeptide comprising an amino acid substitution at a residue corresponding to position 59 and/or 61 of SEQ ID NO: 2, wherein the Cyt1A variant polypeptide has decreased hemolytic activity compared to the Cyt1A polypeptide of SEQ ID NO: 2, and has at least 95% sequence identity to SEQ ID NO: 2.
US Pat. No. 10,793,868

PLANTS WITH INCREASED SEED SIZE

INSTITUTE OF GENETICS AND...

1. A plant comprising:i) reduced or abolished expression of a nucleic acid sequence encoding a NGAL2 polypeptide or reduced or abolished activity of a NGAL2 polypeptide compared to the expression or activity of said nucleic acid or polypeptide in a control plant; and
ii) reduced or abolished expression of a nucleic acid sequence encoding a NGAL3 polypeptide or reduced or abolished activity of a NGAL3 polypeptide compared to the expression or activity of said nucleic acid or polypeptide in a control plant;
wherein said reduced expression or activity of NGAL2 and NGAL3 nucleic acid sequences or polypeptides is caused by a mutation introduced in the promoter of said nucleic acids, by a mutation introduced in said nucleic acids that reduces activity or expression of the encoded polypeptides compared to expression of a control plant or activity of a wild-type polypeptide, or by introduction and expression of a silencing or co-suppressing nucleic acid into the plant that targets and silences or suppresses said NGAL2 and NGAL3 nucleic acid sequences; and wherein a) said NGAL2 nucleic acid molecule comprises SEQ ID NO: 1 or 2 or a sequence having at least 95% identity to SEQ ID NO: 1 or 2, and said NGAL3 nucleic acid molecule comprises SEQ ID NO: 4 or a sequence having at least 95% identity to SEQ ID NO: 4; or b) said NGAL2 polypeptide comprises SEQ ID NO: 3 or a polypeptide having at least 95% identity to SEQ ID NO: 3, and said NGAL3 polypeptide comprises SEQ ID NO: 5 or a polypeptide having at least 95% identity to SEQ ID NO: 5.
US Pat. No. 10,792,332

ANTI-INFECTIVE PROPERTIES OF ANTIFREEZE PROTEIN

Yale University, New Hav...

1. A method of reducing, partially or completely, microbial colonization of a surface, comprising coating onto or applying to the surface a composition comprising (a) a peptide comprising amino acid sequence SEQ ID NO:2 (P0 sequence) or a peptide that is at least 95% identical to amino acid sequence SEQ ID NO: 2 and (b) a pharmaceutically acceptable/biocompatible agent, in sufficient quantity to reduce microbial colonization of the surface.
US Pat. No. 10,792,588

ORGANIC MATERIAL PRODUCTION SYSTEM USING BIOMASS MATERIAL AND METHOD

MITSUBISHI HITACHI POWER ...

1. An organic material production method using biomass material, the organic material production method consisting of:(i) a pretreatment step and subsequently (ii) a hydrothermal decomposition step, in said order,
in the pretreatment step the biomass material is broken into particles having a diameter of equal to or less than 5 millimeters;
the hydrothermal decomposition step comprises a process of
feeding the biomass material and hot compressed water in a hydrothermal decomposition apparatus, a weight ratio of the biomass material and the hot compressed water being 1:1 to 1:10,
causing the biomass material and the hot compressed water to countercurrently contact with each other,
hydrothermally decomposing the biomass material in the hydrothermal decomposition apparatus to transfer a lignin component and a hemicellulose component as inhibitors for enzymatic saccharification from the biomass material to the hot compressed water while suppressing decomposition of a cellulose component of the biomass material, so as to obtain a cellulose-based biomass solid residue, the hydrothermally decomposing of the biomass material comprises:
providing a temperature gradient in the hydrothermal decomposition apparatus in which a temperature increases in a direction from an input for the biomass material into the hydrothermal decomposition apparatus to an input for the hot compressed water into the hydrothermal decomposition apparatus, wherein temperatures in the temperature gradient fall within a range of from 180° C. to 240° C.;
a first enzymatic hydrolysis process of treating, with an enzyme, cellulose in the cellulose-based biomass solid residue discharged from the hydrothermal decomposition apparatus, so as to enzymatically hydrolyze the cellulose to a sugar solution containing hexose;
a first fermentation process of producing, using the sugar solution obtained by the first enzymatic hydrolysis process, any one of alcohols, substitutes for petroleum, or amino acids by fermentation;
a second enzymatic hydrolysis process of treating, with an enzyme, the hemicellulose component in discharged hot water, so as to hydrolyze the hemicellulose component to a pentose solution, the discharged hot water containing the lignin component and the hemicellulose component;
a second fermentation process of producing, using the pentose solution obtained by the second enzymatic hydrolysis process, any one of alcohols, substitutes for petroleum, or amino acids by fermentation;
a first residue separation process of separating a first residue from the any one of alcohols, substitutes for petroleum, or amino acids produced at the first fermentation process; and
a second residue separation process of separating a second residue from the any one of alcohols, substitutes for petroleum, or amino acids produced at the second fermentation process,
wherein the inhibitors for enzymatic saccharification have a property of inhibiting the first enzymatic treatment and the first fermentative treatment.
US Pat. No. 10,793,612

PROCESS FOR DESIGNING DIVERGED, CODON-OPTIMIZED LARGE REPEATED DNA SEQUENCES

Dow AgroSciences LLC, In...

1. A method for chemically synthesizing a nucleic acid molecule, the method comprising:(i) isolating an amino acid sequence that provides a polypeptide of interest, wherein the polypeptide of interest comprises at least one amino acid repeat region;
(ii) extracting a nucleic acid sequence from the amino acid sequence and identifying at least one amino acid repeat region from the polypeptide of interest within the nucleic acid sequence;
(iii) deducing a plurality of sample codon-optimized nucleic acid sequences that each encodes the amino acid sequence;
(iv) aligning the plurality of sample codon-optimized nucleic acid sequences by sequence homology and assembling a neighbor-joining tree comprising the plurality of sample codon-optimized nucleic acid sequences;
(v) selecting one of the plurality of sample codon-optimized nucleic acid sequences as a diverged, codon-optimized nucleic acid sequence, wherein the selected sample codon-optimized nucleic acid sequence is from the most deeply branched section of the neighbor-joining tree; and
(vi) chemically synthesizing the nucleic acid sequence encoding the polypeptide of interest that includes the selected sample codon-optimized nucleic acid sequence.
US Pat. No. 10,793,869

RECOMBINANT DNA CONSTRUCTS AND METHODS FOR CONTROLLING GENE EXPRESSION

MONSANTO TECHNOLOGY LLC, ...

1. A recombinant DNA construct comprising a promoter functional in a plant cell and operably linked to a DNA sequence that transcribes to RNA comprising:(a) at least one miRNA recognition site recognizable by a plant mature endogenous miRNA; and
(b) an RNA sequence encoding a Bacillus thuringiensis insecticidal protein.
US Pat. No. 10,794,894

INTEGRATED DIELECTROPHORETIC AND SURFACE PLASMONIC APPARATUS AND METHODS FOR IMPROVEMENT IN THE DETECTION OF BIOLOGICAL MOLECULES

NDSU Research Foundation,...

1. An interdigitated electrode apparatus to quantify biomarkers in low conductivity buffers, comprising:an array of interdigitated T-shaped microelectrodes wherein the distance between the microelectrodes is from about 10 ?m to about 100 ?m;
glass substrate;
conductive metal;
a well for receiving biological samples;
wherein the T-shaped microelectrodes comprises rough edges and generates hotspots at the periphery of the T-shaped microelectrodes; and
wherein the T-shaped microelectrodes are layered between the glass substrate and the conductive metal within the well for receiving biological samples and assembled as a unitary device.
US Pat. No. 10,792,333

PEPTIDES DERIVED FROM ACTIN-LIKE PROTEIN 8 (ACTL8)

IMMUNOCORE LIMITED, Oxfo...

1. A method of treating cancer in a subject, comprising:administering to the subject a therapeutically effective amount of a binding moiety capable of specifically binding a polypeptide,
wherein the polypeptide comprises:
(a) the amino acid sequence of any one of SEQ ID NOS: 1-6, or
(b) the amino acid sequence of any one of SEQ ID NOs: 1-6 with the exception of 1, 2 or 3 amino acid substitutions and/or 1, 2 or 3 amino acid insertions, and/or 1, 2 or 3 amino acid deletions, and
wherein the polypeptide is capable of forming a complex with a Major Histocompatibility Complex (MHC) molecule.
US Pat. No. 10,793,613

COMPOSITIONS AND METHODS FOR TARGETED CYTOKINE DELIVERY

1. A composition comprising a chimeric peptide, the chimeric peptide comprising an orthopoxvirus major histocompatibility complex class 1-like protein (OMCP) peptide linked to an IL2 peptide, wherein the OMCP peptide comprises the amino acid sequence of SEQ ID NO: 7, and the IL2 peptide comprises the amino acid sequence of SEQ ID NO: 5 or SEQ ID NO: 5 with at least one mutation, wherein said at least one mutation is selected from the group consisting of R38A, F42K, and C125S.
US Pat. No. 10,793,870

METHODS OF INCREASING BIOMASS AND/OR GROWTH RATE OF A PLANT UNDER NON-STRESS CONDITIONS

Evogene Ltd., Rehovot (I...

1. A method of increasing yield, biomass, growth rate, and/or nitrogen use efficiency of a plant, comprising transforming a plant with a polynucleotide comprising a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 921, and 84, thereby increasing the yield, biomass, growth rate, and/or nitrogen use efficiency of the plant.
US Pat. No. 10,792,334

STABLE LIQUID GONADOTROPIN FORMULATION

Ferring B.V., Hoofddorp ...

1. A liquid pharmaceutical gonadotropin formulation, comprising a gonadotropin;0.05-1.5 mg/mL methionine;
50-160 mM arginine;
4.0-6.0 mg/mL phenol;
0.001-0.05 mg/mL polysorbate 20; and
water for injection (WFI);
wherein the pH of the formulation is between 6.0 and 7.5 and the formulation does not additionally comprise a buffer.
US Pat. No. 10,793,614

ANTAGONISTS OF FISH REPRODUCTION

Yissum Research Developme...

1. A peptidomimetic of 6-10 amino acid residues comprising the sequence X1-NMeVal-?Ala-Leu-Met-Z (SEQ ID NO: 7), wherein X1 consists of 2 or 3 amino acid residues comprising an aromatic residue, a negatively charged acidic residue, and optionally an N-terminal capping moiety or modification; and Z represents the C-terminus of the peptide which may be amidated, acylated, reduced or esterified.
US Pat. No. 10,793,871

NUCLEIC ACID MOLECULE ENCODING GLEI PROTEIN VARIANT WITH INCREASED PHYTIC ACID SENSITIVITY AND USE THEREOF

UNIVERSITY-INDUSTRY FOUND...

1. A non-natural synthetic nucleic acid molecule comprising a nucleotide sequence having at least 90% identity to the nucleotide sequence of SEQ ID NO: 1 and which encodes plant Gle1 protein variant:wherein said plant Gle1 protein variant comprises a phytic acid-binding pocket represented by SEQ ID NO: 18,
wherein the eighth amino acid residue of SEQ ID NO: 18 is substituted with a basic amino acid residue and the fourth amino acid residue of SEQ ID NO: 18 is selected from Glu and a basic amino acid residue, and wherein transgenic expression of said nucleotide sequence encoding said plant Gle1 protein in a transgenic plant increases seed yield, seed germination, plant growth or abiotic stress tolerance as compared to a control plant of the same plant species grown under identical conditions and lacking said non-natural synthetic nucleic acid molecule.
US Pat. No. 10,793,615

LONG-ACTING CO-AGONISTS OF THE GLUCAGON AND GLP-1 RECEPTORS

whereinX2 is aminoisobutyric acid (aib), D-Ser or alpha-Methyl-L-Serine (alpha-MS);
X9 is Asp or alpha-Methyl-L-Aspartic acid (alpha-MD);
X10 is Lys conjugated to a fatty diacid, p-aminomethyl-L-phenylalanine (pAF) conjugated to a fatty diacid or Tyr-;
X12 is Lys conjugated to a fatty diacid, pAF conjugated to a fatty diacid, Lys, or (1S,2S)-Fmoc-2-aminocyclopentane carboxylic acid (?c);
X14 is Leu or alpha-L-Leucine (alpha-ML);
X16 is aib, Ala, or Glu;
X20 is Lys is conjugated to a fatty diacid, pAF conjugated to a fatty diacid or Gln;
X21 is Lys conjugated to a fatty diacid, pAF conjugated to a fatty diacid, Asp, or alpha-MD;
X22 is Phe or alpha-Methyl-L-phenylalanine (alpha-MF);
X24 is Gln (1S,2S)-Fmoc-2-aminocyclopentane carboxylic acid (?c), Lys conjugated to a fatty diacid or pAF conjugated to a fatty diacid;
X27 is L-Met sulphone or Leucine;
X28 is Asp, alpha-MD, alpha-Methyl-L-Tryptophan (alpha-MW), Lys, Ala, Lys conjugated to a fatty diacid, or pAF conjugated to a fatty diacid; and
X30 is Lys linked at the C-terminus to gamma-Glu when X27 is Leu and X28 is Ala, or absent;
with the proviso that for each peptide, only one of X10, x12, x20, X21, X24, or X28 is conjugated to a fatty diacid.
US Pat. No. 10,793,872

HPPD VARIANTS AND METHODS OF USE

BASF Agricultural Solutio...

1. A recombinant nucleic acid molecule encoding a 4-hydroxyphenylpyruvate dioxygenase (HPPD) polypeptide, wherein said HPPD polypeptide has an amino acid sequence having at least 95% sequence identity to SEQ ID NO:1, wherein said amino acid sequence comprises the following amino acid substitutionsa proline at the amino acid position corresponding to amino acid position 335 of SEQ ID NO:1, a tryptophan at the amino acid position corresponding to amino acid position 336 of SEQ ID NO: 1, an alanine at the amino acid position corresponding to amino acid position 339 of SEQ ID NO:1, and a glutamine at the amino acid position corresponding to amino acid position 340 of SEQ ID NO:1;
wherein said HPPD polypeptide, when expressed in a soybean plant, confers to said plant tolerance to 200 g AI/ha tembotrione.
US Pat. No. 10,794,897

SYSTEM AND METHODS FOR PREDICTING DRUG-INDUCED INOTROPIC AND PRO-ARRHYTHMIA RISK

AnaBios Corporation, San...

1. A method for predicting a drug-induced pro-arrhythmia risk in connection with an at least one drug that has been administered to an at least one isolated primary adult cardiomyocyte from a human heart, based on an at least one after-contraction transient (“AC”) associated with the at least one cardiomyocyte, the method comprising the steps of:implementing an at least one monitoring device positioned and configured for measuring data related to the at least one cardiomyocyte, wherein the at least one monitoring device is an optical device positioned and configured for measuring visual data associated with contractions of the at least one cardiomyocyte;
implementing a user application residing in memory on an at least one computing device, the at least one computing device configured for receiving and processing select data obtained by the at least one monitoring device;
measuring, via the at least one monitoring device, the effect of the at least one drug on the at least one cardiomyocyte;
determining, via the user application, the at least one drug has taken effect on the at least one cardiomyocyte;
applying a controlled external electrical stimulus to the at least one cardiomyocyte;
measuring, via the at least one monitoring device, a sequence of at least 60 sarcomere contraction transients of the at least one cardiomyocyte;
transmitting, via the at least one monitoring device, the measured sarcomere contraction transients to the user application;
determining, via the user application, the presence of an after-contraction transient for each of the measured sarcomere contraction transients, wherein the after-contraction transient is a secondary peak in a late portion of a relaxation phase of the associated sarcomere contraction transient;
calculating, via the user application, a delta corresponding to a quantity of measured sarcomere contraction transients containing an after-contraction transient;
determining, via the user application, a drug-induced pro-arrhythmia risk in connection with the at least one drug wherein the delta equals or exceeds a pre-determined risk threshold value, said risk threshold value being one percent of the quantity of sarcomere contraction transients in the measured sequence; and
determining, via the user application, a likelihood of an absence of a drug-induced pro-arrhythmia risk in connection with the at least one drug wherein the delta is less than the risk threshold value.
US Pat. No. 10,792,336

METHOD OF TREATING HEMOPHILIA A

UCL BUSINESS LTD, London...

1. A method of treating Hemophilia comprising:administering adeno associated virus (AAV) particles comprising a vector to a patient suffering from Hemophilia,
wherein the vector comprises a nucleic acid molecule and a 5? and 3? inverted terminal repeat (ITR) from an AAV vector, wherein the nucleic acid molecule comprises a nucleotide sequence that encodes a functional factor VIII protein, and
wherein the B domain of the Factor VIII protein is replaced by a spacer sequence that comprises the amino acid sequence set forth in SEQ ID NO: 4.
US Pat. No. 10,793,616

SINGLE-CHAIN CD40-RECEPTOR AGONIST PROTEINS

Apogenix AG, Heidelberg ...

1. A CD40 receptor agonist protein comprising a single-chain fusion polypeptide comprising:(i) a first soluble CD40L domain,
(ii) a first peptide linker,
(iii) a second soluble CD40L domain,
(iv) a second peptide linker, and
(v) a third soluble CD40L domain, and
(vi) an antibody Fc fragment, wherein the antibody Fc fragment (vi) consists of the amino acid sequence as shown in SEQ ID NO: 13 or amino acids 1-217 of SEQ ID NO: 13, wherein the soluble CD40L domains (i), (iii) and (v) each consists of amino acids 120-261 or 121-261 of SEQ ID NO: 1.
US Pat. No. 10,793,873

USE OF INTERFERING RNA IN THE PRODUCTION OF TRANSGENIC ANIMALS

Revivicor, Inc., Blacksb...

1. A heritable DNA template encoding iRNA molecules that regulate the expression of a porcine endogenous retrovirus (PERV) family of genes wherein:(i) the heritable DNA template encodes at least two iRNA molecules that can stably integrate into the genome of a porcine cell;
(ii) at least one of the iRNA molecules is homologous to
(a) the following pol sequence of PERV: GTAGAGACTTACTGACCAA (SEQ ID NO. 244) or a complement thereof: or
(b) the following gag sequence of PERV: GTTAGATCCAGGGCTCATAAT (SEQ ID NO. 211) or a complement thereof; and
(iii) PERV gene expression is functionally eliminated by the iRNA molecules in porcine cells and animals infected by PERV.
US Pat. No. 10,794,898

HIGH-THROUGHPUT, HIGH-PRECISION METHODS FOR DETECTING PROTEIN STRUCTURAL CHANGES IN LIVING CELLS

Regents of the University...

1. A method for identifying a compound that alters fluorescence resonance energy transfer (FRET) of a protein comprising:providing a genetically engineered cell comprising a target protein,
wherein the cell is a live cell,
wherein the target protein comprises two heterologous domains, wherein a first heterologous domain comprises a first chromophore, wherein a second heterologous domain comprises a second chromophore, and wherein each heterologous domain comprises a fluorescent protein;
contacting the live cell with a test compound to form a mixture;
measuring the fluorescence lifetime of the first chromophore, the second chromophore, or the combination thereof, of the live cell,
wherein the measuring comprises use of a plate reader and direct waveform recording of fluorescence lifetime decays,
wherein the measuring occurs over a period of time no greater than 0.5 seconds;
calculating a coefficient of variation (CV) for the fluorescence lifetime of the first chromophore, the second chromophore, or the combination thereof, wherein CV is no greater than 0.5%; and
calculating a Z? parameter, wherein the Z? parameter is >0.5;
wherein a difference between the fluorescence lifetime in the presence of the test compound and the fluorescence lifetime in the absence of the test compound indicates that the test compound alters the FRET of the target protein.
US Pat. No. 10,793,617

METHODS OF USE OF SOLUBLE CD24 FOR THERAPY OF RHEUMATOID ARTHRITIS

ONCOIMMUNE, INC., Rockvi...

1. A method of treating multiple sclerosis (MS) in a human subject in need thereof, comprising administering to the subject a CD24 protein comprising a mature human CD24 polypeptide, wherein the sequence of the mature human CD24 polypeptide comprises the sequence set forth in SEQ ID NO: 1, wherein the CD24 protein does not comprise an alanine or valine immediately C-terminal to SEQ ID NO: 1, and wherein a Fc portion of a human Ig protein is fused to the C-terminus of the mature human CD24 polypeptide.
US Pat. No. 10,793,874

METHODS AND COMPOSITIONS FOR TARGETED GENETIC MODIFICATIONS AND METHODS OF USE

Regeneron Pharmaceuticals...

1. A method for modifying a target genomic locus on the Y chromosome in a mouse embryonic stem (ES) cell, comprising:(a) providing a mouse ES cell comprising a target genomic locus on the Y chromosome, wherein the target genomic locus on the Y chromosome comprises a recognition site for a nuclease agent, and wherein the mouse ES cell is in a culture comprising a DMEM base medium, wherein the DMEM base medium is not a KO-DMEM base medium;
(b) introducing into the mouse ES cell of step (a):
(i) the nuclease agent or a polynucleotide encoding the nuclease agent, wherein the nuclease agent induces a nick or double-strand break at the recognition site, and wherein the nuclease agent is a zinc finger nuclease (ZFN), a Transcription Activator-Like Effector Nuclease (TALEN), or a Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-associated 9 (Cas9) protein and a guide RNA (gRNA) comprising: (1) a CRISPR RNA (crRNA) that targets the recognition site, wherein the recognition site is immediately flanked by a Protospacer Adjacent Motif (PAM) sequence; and (2) a trans-activating CRISPR RNA (tracrRNA); and
(ii) a large targeting vector comprising an insert polynucleotide flanked by first and second homology arms corresponding to first and second target sites located in the target genomic locus on the Y chromosome, wherein the sum total of the first homology arm and the second homology arm is at least 10 kb, and wherein the large targeting vector undergoes homologous recombination with the target genomic locus on the Y chromosome; and
(c) identifying at least one mouse ES cell from step (b) comprising in its genome the insert polynucleotide integrated at the target genomic locus on the Y chromosome, wherein integration of the insert polynucleotide introduces a genetic modification comprising replacement of an endogenous nucleic acid sequence with an exogenous nucleic acid sequence at the target genomic locus on the Y chromosome.
US Pat. No. 10,794,899

TIM PROTEIN-BOUND CARRIER, METHODS FOR OBTAINING, REMOVING AND DETECTING EXTRACELLULAR MEMBRANE VESICLES AND VIRUSES USING SAID CARRIER, AND KIT INCLUDING SAID CARRIER

FUJIFILM WAKO PURE CHEMIC...

1. A method for obtaining an extracellular membrane vesicle in the sample, comprising the following steps:(1) a step for forming a complex of Tim-4 protein bound to a carrier, and the extracellular membrane vesicle in a sample, in the presence of a calcium ion (complex formation step),
(2) a step for separating the complex and the sample (complex separation step), and
(3) a step for separating the extracellular membrane vesicle from the complex using a calcium ion chelating agent to obtain the extracellular membrane vesicle (obtaining step).
US Pat. No. 10,792,338

ERYTHROPOIETIN AND FIBRONECTIN COMPOSITIONS FOR THERAPEUTIC AND COSMETIC APPLICATIONS

Remedor Biomed Ltd., Naz...

1. A pharmaceutical composition comprising about 10-30 ?g/mL Erythropoietin, about 100-200 ?g/mL Fibronectin, about 0.20% Methyl Paraben, about 9% laureth and isoparaffin and polyacrylamide, about 12% deionized water and a phosphate buffer solution.
US Pat. No. 10,793,618

POLYPEPTIDES AND MEDICAL USES THEREOF

COLZYX AB, Lund (SE)

1. A polypeptide comprising an amino acid sequence selected from the group consisting of:(a) SEQ ID NO: 1 from the ?3 chain of collagen type VI;
(b) a fragment of SEQ ID NO: 1, wherein the fragment of SEQ ID NO: 1 comprises at least 20 contiguous amino acids of SEQ ID NO: 1; and
(c) a variant of SEQ ID NO: 1, wherein the variant comprises an amino acid sequence with at least 80% sequence identity to SEQ ID NO: 1,
wherein the polypeptide is between 20 and 200 amino acids in length, and
wherein the polypeptide has antimicrobial activity.
US Pat. No. 10,793,875

COMPOSITIONS AND METHODS FOR VIRAL DELIVERY OF NEOEPITOPES AND USES THEREOF

Nant Holdings IP, LLC, C...

1. A method of generating a recombinant virus, comprising:assaying deoxyribonucleic acid (DNA), ribonucleic acid (RNA), and protein from matched tumor and histologically normal tissue samples from a patient to identify a patient-specific cancer-related neoepitope of the patient, wherein the protein assay is mass spectroscopy based sequencing;
determining binding of the patient-specific cancer-related neoepitope to an HLA-type of the same patient, and determining an expression level of the patient-specific cancer-related neoepitope;
selecting at least one co-stimulatory molecule; and
genetically modifying a virus to include a nucleic acid encoding the at least one co-stimulatory molecule and the patient-specific cancer-related neoepitope.
US Pat. No. 10,792,339

METHODS AND COMPOSITIONS FOR TREATING PHENYLKETONURIA

1. A pharmaceutical formulation comprising a phenylalanine dehydrogenase polypeptide, or a functional fragment thereof, and a pharmaceutically-acceptable carrier, wherein the phenylalanine dehydrogenase polypeptide, or the functional fragment thereof, comprises an amino acid sequence having at least 80% sequence identity to SEQ ID NO: 1, wherein the pharmaceutical formulation is in a solid or semi-solid dosage form, or contained within an artificial membrane.
US Pat. No. 10,793,619

PREPARATION AND SELECTION OF CELLS FOR PRODUCING BISPECIFIC ANTIBODIES

Wuhan YZY Biopharma Co., ...

1. A method for determining that a cell produces and secrets a bispecific antibody, wherein the cell has been transfected with a first vector comprising a sequence encoding a monovalent antigen-binding, single-chain variable fragment (scFv) having specificity to a first antigen and a second vector comprising a sequence encoding a heavy chain and a light chain both together forming a monovalent antigen-binding unit having specificity to a second antigen, the method comprising:contacting the transfected cell with (i) a complex comprising a cell-binding agent capable of binding to the surface of the transfected cell and the first antigen and (ii) an antibody having specificity to the light chain, to allow the complex to bind to the cell surface via the cell-binding agent, the first antigen to bind to the scFv, the antibody to bind to the light chain, and the light chain to bind to the heavy chain; and
detecting that the antibody is linked to the transfected cell, thereby determining that the antibody binds to the light chain, which binds to the heavy chain, which binds to the scFv, which binds to the first antigen in the complex, which complex binds to the surface of the transfected cell, indicating that the transfected cell produces and secrets a bispecific antibody that comprises the scFv and the antigen-binding unit having the heavy chain and the light chain.
US Pat. No. 10,793,876

RETRO- AND LENTI-HBV HYBRID VECTORS AND CONSTRUCTS

VIRONGY L.L.C., Manassas...

1. A retro- or lenti-viral HBV (hepatitis B virus) hybrid vector, comprising a HBV genome, wherein said hybrid vector is transcribed 3?-5?, and comprises a HIV 5? LTR (long terminal repeat), ? HIV genome packaging signal, HIV RRE (Rev-dependent element), and at least one of HIV 3? LTR (long terminal repeat) or HIV 3? SIN LTR (self-inactivating LTR with ?U3 deletion).
US Pat. No. 10,792,340

ANTIBACTERIAL COMPOSITION FOR COMBATING CARBAPENEM-RESISTANT GRAM-NEGATIVE BACTERIA COMPRISING ADK PROTEIN AS ACTIVE INGREDIENT

KONKUK UNIVERSITY GLOCAL ...

1. A method of treating an infectious disease caused by carbapenem-resistant gram-negative bacteria comprising administering a composition comprising adenylate kinase (ADK) protein as an active ingredient to a subject in need thereof.
US Pat. No. 10,793,620

METHOD FOR PRODUCING ANTIGEN-SPECIFIC B CELLS AND THEIR USE FOR THE PRODUCTION OF HYBRIDOMA CELLS AND MONOCLONAL ANTIBODIES

BIOGENES GMBH, Berlin (D...

1. A method for producing a hybridoma cell producing an antibody specific for an antigen of interest, comprising the steps of:producing antigen-specific B cells, wherein the antigen-specific B cells are produced by:
a) providing primed B cells isolated from non-human animals which have been immunized with an antigen of interest;
b) administration of the primed B cells and the antigen of interest to a nave non-human animal in order to induce a humoral immune response against the antigen of interest; and
c) isolation of antigen-specific B cells from the non-human animal of step b); and
fusing an antigen-specific B cell and a myeloma cell, resulting in a hybridoma cell producing an antibody specific for the antigen of interest.
US Pat. No. 10,792,341

TREATMENT OF GLYCOGEN STORAGE DISEASE TYPE II

Duke University, Durham,...

1. A method of treating glycogen storage disease type II in a human individual having glycogen storage disease type II, comprising administering to the individual a therapeutically effective amount of human acid ?-glucosidase periodically at an administration interval, wherein the human acid ?-glucosidase is a precursor of recombinant human acid ?-glucosidase that has been produced in Chinese hamster ovary cell cultures, and wherein the human acid ?-glucosidase has a specific enzyme activity in the range of about 1.0-3.5 ?mol/min/mg protein.
US Pat. No. 10,793,621

NUCLEIC ACID ENCODING DUAL FC ANTIGEN BINDING PROTEINS

Hoffmann-La Roche Inc., ...

1. A method for the preparation of an antigen binding protein comprising the steps ofa) transforming an isolated host cell with isolated vectors comprising nucleic acid molecules encoding the antigen binding protein,
b) culturing the isolated host cell under conditions that allow synthesis of said antigen binding protein molecule; and
c) recovering said antigen binding protein molecule from said culture; wherein
the antigen binding protein comprises
i) two modified heavy chains of an antibody which specifically binds to an antigen, wherein VH of each heavy chain is replaced by the VL of said antibody, said modified heavy chains being associated with each other via their CH3 domains of the Fc part; and
ii) two modified heavy chains of said antibody wherein CH1 of each heavy chain is replaced by CL of said antibody, said modified heavy chains being associated with each other via their CH3 domains of the Fc part;
and wherein the VL domains of the heavy chains of i) are associated with the VH domains of the heavy chains of ii), and the CH1 domains of the heavy chains of i) are associated with the CL domains of the heavy chains of ii);
wherein the CH2 and CH3 domains of the Fc part of the modified heavy chains of i) and the CH2 and CH3 domains of the Fc part of the modified heavy chains of ii) are of the human IgG1 isotype; and
wherein either the two modified heavy chains of i), or the two modified heavy chains of ii), are further modified by the amino acid substitutions S364G, L368F, D399K and K409D, wherein the amino acid positions are numbered according to the EU Index of Kabat, and wherein the other two modified heavy chains comprise wild type CH3 amino acid sequences.
US Pat. No. 10,793,878

METHODS AND COMPOSITIONS FOR RNA-DIRECTED TARGET DNA MODIFICATION AND FOR RNA-DIRECTED MODULATION OF TRANSCRIPTION

The Regents of the Univer...

1. A method of targeting and binding a target DNA, the method comprising:contacting a target DNA with:
(a) a chimeric Cas9 protein comprising a Cas9 polypeptide fused to a heterologous polypeptide, wherein the Cas9 polypeptide comprises one or more mutations in a RuvC domain and/or an HNH domain; and
(b) a single molecule DNA-targeting RNA comprising in 5? to 3? order:
(i) a targeter-RNA comprising a targeting sequence that hybridizes with a target sequence of the target DNA, and
(ii) an activator-RNA that hybridizes with the targeter-RNA to form a double-stranded duplex,
wherein (i) and (ii) are covalently linked by intervening nucleotides,
wherein the single molecule DNA-targeting RNA forms a complex with the chimeric Cas9 protein, and the complex binds the target DNA.
US Pat. No. 10,792,342

TARGETING OF GLYCOPROTEIN THERAPEUTICS

Genzyme Corporation, Cam...

1. A method of making a conjugate, the method comprising:(a) reacting a masking moiety (M) with a therapeutic glycoprotein (G), wherein the masking moiety comprises a first functional group to react with the therapeutic glycoprotein; and
(b) reacting the masking moiety with a thiol group of a targeting moiety (T), wherein the masking moiety comprises a thiol-reactive group as a second functional group,
wherein the masking moiety is covalently linked to the therapeutic glycoprotein through a first linker (L1), the targeting moiety is covalently linked to the masking moiety through a second linker (L2), and the conjugate has formula G(L1-M(L2-T)n)m, wherein 16 wherein the masking moiety is capable of reducing or blocking binding of the therapeutic glycoprotein to its cognate receptor, and
wherein the conjugate is configured to release the therapeutic glycoprotein from the conjugate under lysosomal conditions.
US Pat. No. 10,793,622

CONTINUOUS MULTISTEP PROCESS FOR PURIFYING ANTIBODIES

SANOFI, Paris (FR)

1. A method for purifying a protein from solution comprising:(a) a first chromatography step comprising:
passing said solution over a first chromatography matrix, wherein the first chromatography matrix is a Protein A affinity chromatography matrix;
eluting a crude protein eluent from the first chromatography matrix using a first elution buffer;
(b) a second chromatography step comprising:
passing the crude protein eluent obtained at the end of step (a) over a second chromatography matrix;
eluting a protein eluate from the second chromatography matrix using a second elution buffer; and
(c) a third chromatography step comprising:
passing the protein eluate obtained at the end of step (b) through a third chromatography matrix in the flow-through mode;
recovering purified protein from the flow-through of the third chromatography matrix;wherein the protein is a monoclonal antibody, wherein each of the buffers comprises Bis Tris, acetic acid, NaCl, and water, wherein one or more of the buffers further comprises NH4Cl, and wherein the method is a large-scale purification method.
US Pat. No. 10,793,879

HIGH PURITY STARCH STREAM METHODS AND SYSTEMS

POET Research, Inc., Sio...

1. A process for producing starch streams in a dry mill ethanol fermentation facility, the process comprising:(a) dry milling a corn grain to produce a first treated stream including soft endosperm, hard endosperm, and other corn grain components; wherein the other corn grain components comprise bran and germ;
(b) separating the first treated stream into a second stream and a third stream, the second stream being a high starch stream comprising soft endosperm;
(c) providing the second stream to a non-ethanol process, wherein the non-ethanol process comprises producing one or more non-ethanol bio-chemicals from the second stream; and
(d) processing the third stream in a fermentation process into ethanol;
wherein the third stream comprises hard endosperm and other corn grain components; wherein the other corn grain components comprise bran and germ;
wherein the dry mill ethanol fermentation facility is the facility for producing the first, second and third streams;
and wherein the third stream produces an ethanol titer similar to an ethanol titer produced by the same ethanol facility without the step of separating the first treated stream into a second and third stream.
US Pat. No. 10,792,343

COMPOSITIONS AND METHODS FOR TREATING MPSI

The Trustees of the Unive...

1. A vector carrying an expression cassette comprising a modified human alpha-L-iduronidase (hIDUA) gene, wherein the modified hIDUA gene is at least 85% identical to SEQ ID NO: 1, which encodes a functional human alpha-L-iduronidase, wherein said expression cassette further comprises regulatory control sequences which direct expression of the human alpha-L-iduronidase, said regulatory control sequences comprising a liver-specific promoter.
US Pat. No. 10,793,623

OPTIMIZED CROSSLINKERS FOR TRAPPING A TARGET ON A SUBSTRATE

The University of North C...

1. A method for preventing or treating an infection on a mucosa in a subject, wherein the infection is caused by a respiratory syncytial virus (RSV), said method comprising: administering to the subject in need thereof an effective amount of a population of an antibody against RSV, wherein the antibody in the population has been selected so that the antibody associates with the mucins between 20% to less than 95% of the time, has a rate of binding to the pathogen greater than about 1×104 M?1 s?1, and has a diffusion coefficient between 20% to 99% less compared to the diffusion coefficient of the antibody in water.
US Pat. No. 10,793,880

PRODUCTION OF FRAMBINONE BY A RECOMBINANT FUNGAL MICROORGANISM

LESAFFRE et COMPAGNIE, P...

1. A genetically modified fungal microorganism for the production of frambinone, said microorganism having the following characteristics:a capacity to produce frambinone from tyrosine; and
a limited capacity or no capacity to break tyrosine down into tyrosol, p-hydroxyphenylacetaldehyde and/or p-hydroxyphenylacetate,
wherein said genetically modified fungal microorganism has hydroxyphenyl pyruvate decarboxylase (HPPDC) activity less than or equal to 2×10?6 kat per g of protein, and comprises at least one mutation or deletion in at least one of the genes encoding the following enzymes: deaminase Aro8, deaminase Aro9, decarboxylase Aro10, decarboxylase Pdc5, decarboxylase Pdc6, or alcohol dehydrogenase (ADH).
US Pat. No. 10,792,344

HIGH FREQUENCY APPLICATION OF BOTULINUM TOXIN THERAPY

1. A method of treating a disease or condition caused by or associated with hyperactive cholinergic innervation of muscles in a patient, the method comprising administering a composition comprising a therapeutically effective amount of a neurotoxic component of a Clostridium botulinum toxin complex, the composition being devoid of any other protein component of the Clostridium botulinum toxin complex, to remove partially or completely the treated disease or condition symptoms, wherein(a) the patient is a human;
(b) the composition is locally administered by injection of a non-lethal dose to a muscle exhibiting hyperactive cholinergic innervation; and
(c) the therapeutically effective amount of a non-lethal dose of the neurotoxic component of Clostridium botulinum is locally administered to a muscle exhibiting hyperactive cholinergic innervation in a total dosage of from 500 U to 2000 U of the neurotoxic component.
US Pat. No. 10,793,624

HUMAN ANTIBODIES TO BET V 1 AND METHODS OF USE THEREOF

REGENERON PHARMACEUTICALS...

1. An isolated monoclonal antibody or antigen-binding fragment thereof that binds to natural Bet v 1 or birch pollen extract (BPE), wherein the antibody or fragment thereof comprises:(a) a heavy chain complementarity determining region (HCDR)1 comprising the amino acid sequence of SEQ ID NO: 148; an HCDR2 comprising the amino acid sequence of SEQ ID NO: 150; an HCDR3 comprising the amino acid sequence of SEQ ID NO: 152; a light chain complementarity determining region (LCDR)1 comprising the amino acid sequence of SEQ ID NO: 156; an LCDR2 comprising the amino acid sequence of SEQ ID NO: 158; and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 160; or
(b) an HCDR1 comprising the amino acid sequence of SEQ ID NO: 292; an HCDR2 comprising the amino acid sequence of SEQ ID NO: 294; an HCDR3 comprising the amino acid sequence of SEQ ID NO: 296; an LCDR1 comprising the amino acid sequence of SEQ ID NO: 300; an LCDR2 comprising the amino acid sequence of SEQ ID NO: 302; and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 304; or
(c) an HCDR1 comprising the amino acid sequence of SEQ ID NO: 100; an HCDR2 comprising the amino acid sequence of SEQ ID NO: 102; an HCDR3 comprising the amino acid sequence of SEQ ID NO: 104; an LCDR1 comprising the amino acid sequence of SEQ ID NO: 108; an LCDR2 comprising the amino acid sequence of SEQ ID NO: 110; and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 112; or
(d) an HCDR1 comprising the amino acid sequence of SEQ ID NO: 116; an HCDR2 comprising the amino acid sequence of SEQ ID NO: 118; an HCDR3 comprising the amino acid sequence of SEQ ID NO: 120; an LCDR1 comprising the amino acid sequence of SEQ ID NO: 124; an LCDR2 comprising the amino acid sequence of SEQ ID NO: 126; and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 128; or
(e) an HCDR1 comprising the amino acid sequence of SEQ ID NO: 4; an HCDR2 comprising the amino acid sequence of SEQ ID NO: 6; an HCDR3 comprising the amino acid sequence of SEQ ID NO: 8; an LCDR1 comprising the amino acid sequence of SEQ ID NO: 12; an LCDR2 comprising the amino acid sequence of SEQ ID NO: 14; and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 16; or
(f) an HCDR1 comprising the amino acid sequence of SEQ ID NO: 20; an HCDR2 comprising the amino acid sequence of SEQ ID NO: 22; an HCDR3 comprising the amino acid sequence of SEQ ID NO: 24; an LCDR1 comprising the amino acid sequence of SEQ ID NO: 28; an LCDR2 comprising the amino acid sequence of SEQ ID NO: 30; and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 32; or
(g) an HCDR1 comprising the amino acid sequence of SEQ ID NO: 36; an HCDR2 comprising the amino acid sequence of SEQ ID NO: 38; an HCDR3 comprising the amino acid sequence of SEQ ID NO: 40; an LCDR1 comprising the amino acid sequence of SEQ ID NO: 44; an LCDR2 comprising the amino acid sequence of SEQ ID NO: 46; and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 48; or
(h) an HCDR1 comprising the amino acid sequence of SEQ ID NO: 52; an HCDR2 comprising the amino acid sequence of SEQ ID NO: 54; an HCDR3 comprising the amino acid sequence of SEQ ID NO: 56; an LCDR1 comprising the amino acid sequence of SEQ ID NO: 60; an LCDR2 comprising the amino acid sequence of SEQ ID NO: 62; and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 64; or
(i) an HCDR1 comprising the amino acid sequence of SEQ ID NO: 68; an HCDR2 comprising the amino acid sequence of SEQ ID NO: 70; an HCDR3 comprising the amino acid sequence of SEQ ID NO: 72; an LCDR1 comprising the amino acid sequence of SEQ ID NO: 76; an LCDR2 comprising the amino acid sequence of SEQ ID NO: 78; and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 80; or
(j) an HCDR1 comprising the amino acid sequence of SEQ ID NO: 84; an HCDR2 comprising the amino acid sequence of SEQ ID NO: 86; an HCDR3 comprising the amino acid sequence of SEQ ID NO: 88; an LCDR1 comprising the amino acid sequence of SEQ ID NO: 92; an LCDR2 comprising the amino acid sequence of SEQ ID NO: 94; and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 96; or
(k) an HCDR1 comprising the amino acid sequence of SEQ ID NO: 132; an HCDR2 comprising the amino acid sequence of SEQ ID NO: 134; an HCDR3 comprising the amino acid sequence of SEQ ID NO: 136; an LCDR1 comprising the amino acid sequence of SEQ ID NO: 140; an LCDR2 comprising the amino acid sequence of SEQ ID NO: 142; and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 144; or
(l) an HCDR1 comprising the amino acid sequence of SEQ ID NO: 164; an HCDR2 comprising the amino acid sequence of SEQ ID NO: 166; an HCDR3 comprising the amino acid sequence of SEQ ID NO: 168; an LCDR1 comprising the amino acid sequence of SEQ ID NO: 172; an LCDR2 comprising the amino acid sequence of SEQ ID NO: 174; and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 176; or
(m) an HCDR1 comprising the amino acid sequence of SEQ ID NO: 180; an HCDR2 comprising the amino acid sequence of SEQ ID NO: 182; an HCDR3 comprising the amino acid sequence of SEQ ID NO: 184; an LCDR1 comprising the amino acid sequence of SEQ ID NO: 188; an LCDR2 comprising the amino acid sequence of SEQ ID NO: 190; and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 192; or
(n) an HCDR1 comprising the amino acid sequence of SEQ ID NO: 196; an HCDR2 comprising the amino acid sequence of SEQ ID NO: 198; an HCDR3 comprising the amino acid sequence of SEQ ID NO: 200; an LCDR1 comprising the amino acid sequence of SEQ ID NO: 204; an LCDR2 comprising the amino acid sequence of SEQ ID NO: 206; and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 208; or
(o) an HCDR1 comprising the amino acid sequence of SEQ ID NO: 212; an HCDR2 comprising the amino acid sequence of SEQ ID NO: 214; an HCDR3 comprising the amino acid sequence of SEQ ID NO: 216; an LCDR1 comprising the amino acid sequence of SEQ ID NO: 220; an LCDR2 comprising the amino acid sequence of SEQ ID NO: 222; and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 224; or
(p) an HCDR1 comprising the amino acid sequence of SEQ ID NO: 228; an HCDR2 comprising the amino acid sequence of SEQ ID NO: 230; an HCDR3 comprising the amino acid sequence of SEQ ID NO: 232; an LCDR1 comprising the amino acid sequence of SEQ ID NO: 236; an LCDR2 comprising the amino acid sequence of SEQ ID NO: 238; and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 240; or
(q) an HCDR1 comprising the amino acid sequence of SEQ ID NO: 244; an HCDR2 comprising the amino acid sequence of SEQ ID NO: 246; an HCDR3 comprising the amino acid sequence of SEQ ID NO: 248; an LCDR1 comprising the amino acid sequence of SEQ ID NO: 252; an LCDR2 comprising the amino acid sequence of SEQ ID NO: 254; and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 256; or
(r) an HCDR1 comprising the amino acid sequence of SEQ ID NO: 260; an HCDR2 comprising the amino acid sequence of SEQ ID NO: 262; an HCDR3 comprising the amino acid sequence of SEQ ID NO: 264; an LCDR1 comprising the amino acid sequence of SEQ ID NO: 268; an LCDR2 comprising the amino acid sequence of SEQ ID NO: 270; and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 272; or
(s) an HCDR1 comprising the amino acid sequence of SEQ ID NO: 276; an HCDR2 comprising the amino acid sequence of SEQ ID NO: 278; an HCDR3 comprising the amino acid sequence of SEQ ID NO: 280; an LCDR1 comprising the amino acid sequence of SEQ ID NO: 268; an LCDR2 comprising the amino acid sequence of SEQ ID NO: 270; and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 272; or
(t) an HCDR1 comprising the amino acid sequence of SEQ ID NO: 284; an HCDR2 comprising the amino acid sequence of SEQ ID NO: 286; an HCDR3 comprising the amino acid sequence of SEQ ID NO: 288; an LCDR1 comprising the amino acid sequence of SEQ ID NO: 268; an LCDR2 comprising the amino acid sequence of SEQ ID NO: 270; and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 272.
US Pat. No. 10,793,881

METHOD FOR THE MICROBIAL PRODUCTION OF 8-METHYL NONANOIC ACID

Conagen Inc., Bedford, M...

1. A biosynthetic method of producing 8-methyl nonanoic acid (8M) comprising:a) expressing a KASIIIa gene, a KASIIIb gene and one or more genes encoding an acyl-acyl carrier protein (ACP) thioesterase in a transformed cellular system;
b) feeding or producing isobutyryl-CoA in said transformed cellular system; and,
c) producing 8-methyl nonanoic acid;
wherein the KASIIIa gene comprises a nucleic acid sequence that is at least 90% identical to SEQ ID NO. 6 and the KASIIIb gene comprises a nucleic acid sequence that is at least 90% identical to SEQ ID NO. 7.
US Pat. No. 10,794,906

ASSAYS FOR DETECTING NEUTRALIZING AUTOANTIBODIES TO BIOLOGIC THERAPY

Prometheus Biosciences, I...

1. A method for measuring the level or percent of a neutralizing form of an autoantibody to an anti-TNF? drug in a sample, the method comprising:(a) contacting the sample with a labeled anti-TNF? drug and a labeled TNF? to form:
(i) a first labeled complex of the labeled anti-TNF? drug and the autoantibody; and/or
(ii) a second labeled complex of the labeled anti-TNF? drug, the labeled TNF?, and the autoantibody;
(b) subjecting the first labeled complex and/or the second labeled complex to size exclusion chromatography to separate them from free labeled TNF?, free labeled anti-TNF? drug, and/or a complex of labeled anti-TNF? drug and labeled TNF?;
(c) measuring the level of free labeled TNF? after size exclusion chromatography;
(d) comparing the level of free labeled TNF? measured in step (c) to a normalized level or percent of free labeled TNF? in a control sample; and
(e) determining the level or percent of the neutralizing form of the autoantibody in the sample based on the level of free labeled TNF? measured in step (c) compared to the normalized level or percent of free labeled TNF? in the control sample.
US Pat. No. 10,792,345

DERMAL FILLER

ALLERGAN, INC., Irvine, ...

1. A method for treating facial wrinkles in a patient, comprising administering to the patient a pharmaceutical composition comprising a botulinum neurotoxin and a viscous carrier for the botulinum neurotoxin, wherein the facial wrinkles are alleviated for a longer period of time than they are by administration of a pharmaceutical composition which does not comprise a botulinum toxin, further wherein the viscous carrier is selected from the group consisting of cross linked hyaluronic acid, carbomer, polyacrylic acid, cellulose polycarbophil, polyvinylpyrrolidone, gelatin, dextrin, polysaccharide, polyacrylamide, polyvinyl alcohol, polyvinyl acetate, chitosans, algenates and derivatives and mixtures thereof, thereby treating the facial wrinkles in the patient.
US Pat. No. 10,793,625

COMPOSITIONS AND METHODS FOR TREATING OR PREVENTING OSTEOARTHRITIS

The Johns Hopkins Univers...

1. A method comprising the step of administering to a patient a transforming growth factor beta (TGF-beta) inhibitor, wherein the administering inhibits cartilage degeneration in the patient, wherein the inhibitor is administered into the subchondral bone area, wherein the TGF-beta inhibitor is a TGF-beta antibody or SB505124.
US Pat. No. 10,793,882

MICROORGANISMS AND METHODS FOR THE BIOSYNTHESIS OF AROMATICS, 2,4-PENTADIENOATE AND 1,3-BUTADIENE

Genomatica, Inc., San Di...

1. A non-naturally occurring microbial organism having a 1,3-butadiene pathway comprising at least one exogenous nucleic acid encoding a 3-butene-1-ol pathway enzyme expressed in a sufficient amount to produce 3-butene-1-ol, said 3-butene-1-ol pathway comprising a set of enzymes selected from the group consisting of:1) A. 3-hydroxypropanoyl-CoA acetyltransferase, F. 3-oxo-5-hydroxypentanoyl-CoA synthetase, transferase and/or hydrolase, I. 3-oxo-5-hydroxypentanoate reductase, U. 3,5-dihydroxypentanoate decarboxylase;
2) A. 3-hydroxypropanoyl-CoA acetyltransferase, F. 3-oxo-5-hydroxypentanoyl-CoA synthetase, transferase and/or hydrolase, I. 3-oxo-5-hydroxypentanoate reductase, J. 3,5-dihydroxypentanoate dehydratase, V. 5-hydroxypent-2-enoate decarboxylase;
3) A. 3-hydroxypropanoyl-CoA acetyltransferase, B. 3-oxo-5-hydroxypentanoyl-CoA reductase, G. 3,5-dihydroxypentanoyl-CoA synthetase, transferase and/or hydrolase, U. 3,5-dihydroxypentanoate decarboxylase;
4) A. 3-hydroxypropanoyl-CoA acetyltransferase, B. 3-oxo-5-hydroxypentanoyl-CoA reductase, G. 3,5-dihydroxypentanoyl-CoA synthetase, transferase and/or hydrolase, J. 3,5-dihydroxypentanoate dehydratase, V. 5-hydroxypent-2-enoate decarboxylase;
5) A. 3-hydroxypropanoyl-CoA acetyltransferase, B. 3-oxo-5-hydroxypentanoyl-CoA reductase, C. 3,5-dihydroxypentanoyl-CoA dehydratase, H. 5-hydroxypent-2-enoyl-CoA synthetase, transferase and/or hydrolase, V. 5-hydroxypent-2-enoate decarboxylase;
6) M. acrylyl-CoA acetyltransferase, L. 3-oxo-5-hydroxypentanoyl-CoA dehydratase, F. 3-oxo-5-hydroxypentanoyl-CoA synthetase, transferase and/or hydrolase, I. 3-oxo-5-hydroxypentanoate reductase, U. 3,5-dihydroxypentanoate decarboxylase;
7) M. acrylyl-CoA acetyltransferase, L. 3-oxo-5-hydroxypentanoyl-CoA dehydratase, F. 3-oxo-5-hydroxypentanoyl-CoA synthetase, transferase and/or hydrolase, I. 3-oxo-5-hydroxypentanoate reductase, J. 3,5-dihydroxypentanoate dehydratase, V. 5-hydroxypent-2-enoate decarboxylase;
8) M. acrylyl-CoA acetyltransferase, L. 3-oxo-5-hydroxypentanoyl-CoA dehydratase, B. 3-oxo-5-hydroxypentanoyl-CoA reductase, G. 3,5-dihydroxypentanoyl-CoA synthetase, transferase and/or hydrolase, U. 3,5-dihydroxypentanoate decarboxylase;
9) M. acrylyl-CoA acetyltransferase, L. 3-oxo-5-hydroxypentanoyl-CoA dehydratase, B. 3-oxo-5-hydroxypentanoyl-CoA reductase, G. 3,5-dihydroxypentanoyl-CoA synthetase, transferase and/or hydrolase, J. 3,5-dihydroxypentanoate dehydratase, V. 5-hydroxypent-2-enoate decarboxylase;
10) M. acrylyl-CoA acetyltransferase, L. 3-oxo-5-hydroxypentanoyl-CoA dehydratase, B. 3-oxo-5-hydroxypentanoyl-CoA reductase, C. 3,5-dihydroxypentanoyl-CoA dehydratase, H. 5-hydroxypent-2-enoyl-CoA synthetase, transferase and/or hydrolase, V. 5-hydroxypent-2-enoate decarboxylase;
11) K. 3-hydroxypropanoyl-CoA dehydratase, A. 3-hydroxypropanoyl-CoA acetyltransferase, F. 3-oxo-5-hydroxypentanoyl-CoA synthetase, transferase and/or hydrolase, I. 3-oxo-5-hydroxypentanoate reductase, U. 3,5-dihydroxypentanoate decarboxylase;
12) K. 3-hydroxypropanoyl-CoA dehydratase, A. 3-hydroxypropanoyl-CoA acetyltransferase, F. 3-oxo-5-hydroxypentanoyl-CoA synthetase, transferase and/or hydrolase, I. 3-oxo-5-hydroxypentanoate reductase, J. 3,5-dihydroxypentanoate dehydratase, V. 5-hydroxypent-2-enoate decarboxylase;
13) K. 3-hydroxypropanoyl-CoA dehydratase, A. 3-hydroxypropanoyl-CoA acetyltransferase, B. 3-oxo-5-hydroxypentanoyl-CoA reductase, G. 3,5-dihydroxypentanoyl-CoA synthetase, transferase and/or hydrolase, U. 3,5-dihydroxypentanoate decarboxylase;
14) K. 3-hydroxypropanoyl-CoA dehydratase, A. 3-hydroxypropanoyl-CoA acetyltransferase, B. 3-oxo-5-hydroxypentanoyl-CoA reductase, G. 3,5-dihydroxypentanoyl-CoA synthetase, transferase and/or hydrolase, J. 3,5-dihydroxypentanoate dehydratase, V. 5-hydroxypent-2-enoate decarboxylase;
15) K. 3-hydroxypropanoyl-CoA dehydratase, A. 3-hydroxypropanoyl-CoA acetyltransferase, B. 3-oxo-5-hydroxypentanoyl-CoA reductase, C. 3,5-dihydroxypentanoyl-CoA dehydratase, H. 5-hydroxypent-2-enoyl-CoA synthetase, transferase and/or hydrolase, V. 5-hydroxypent-2-enoate decarboxylase;
16) K. 3-hydroxypropanoyl-CoA dehydratase, M. acrylyl-CoA acetyltransferase, L. 3-oxo-5-hydroxypentanoyl-CoA dehydratase, F. 3-oxo-5-hydroxypentanoyl-CoA synthetase, transferase and/or hydrolase, I. 3-oxo-5-hydroxypentanoate reductase, U. 3,5-dihydroxypentanoate decarboxylase;
17) K. 3-hydroxypropanoyl-CoA dehydratase, M. acrylyl-CoA acetyltransferase, L. 3-oxo-5-hydroxypentanoyl-CoA dehydratase, F. 3-oxo-5-hydroxypentanoyl-CoA synthetase, transferase and/or hydrolase, I. 3-oxo-5-hydroxypentanoate reductase, J. 3,5-dihydroxypentanoate dehydratase, V. 5-hydroxypent-2-enoate decarboxylase;
18) K. 3-hydroxypropanoyl-CoA dehydratase, M. acrylyl-CoA acetyltransferase, L. 3-oxo-5-hydroxypentanoyl-CoA dehydratase, B. 3-oxo-5-hydroxypentanoyl-CoA reductase, G. 3,5-dihydroxypentanoyl-CoA synthetase, transferase and/or hydrolase, U. 3,5-dihydroxypentanoate decarboxylase;
19) K. 3-hydroxypropanoyl-CoA dehydratase, M. acrylyl-CoA acetyltransferase, L. 3-oxo-5-hydroxypentanoyl-CoA dehydratase, B. 3-oxo-5-hydroxypentanoyl-CoA reductase, G. 3,5-dihydroxypentanoyl-CoA synthetase, transferase and/or hydrolase, J. 3,5-dihydroxypentanoate dehydratase, V. 5-hydroxypent-2-enoate decarboxylase;
20) K. 3-hydroxypropanoyl-CoA dehydratase, M. acrylyl-CoA acetyltransferase, L. 3-oxo-5-hydroxypentanoyl-CoA dehydratase, B. 3-oxo-5-hydroxypentanoyl-CoA reductase, C. 3,5-dihydroxypentanoyl-CoA dehydratase, H. 5-hydroxypent-2-enoyl-CoA synthetase, transferase and/or hydrolase, V. 5-hydroxypent-2-enoate decarboxylase;
21) a malonyl-CoA:acetyl-CoA acyltransferase; a 3-oxoglutaryl-CoA reductase (aldehyde forming); a 3,5-dioxopentanoate reductase (aldehyde reducing); a 5-hydroxy-3-oxopentanoate reductase; a 3,5-dihydroxypentanoate dehydratase; and a 5-hydroxypent-2-enoate decarboxylase;
22) a malonyl-CoA:acetyl-CoA acyltransferase; a 3-oxoglutaryl-CoA reductase (aldehyde forming); a 3,5-dioxopentanoate reductase (aldehyde reducing); a 5-hydroxy-3-oxopentanoate reductase; and a 3,5-dihydroxypentanoate decarboxylase;
23) a malonyl-CoA:acetyl-CoA acyltransferase; a 3-oxoglutaryl-CoA reductase (CoA reducing and alcohol forming); a 5-hydroxy-3-oxopentanoate reductase; a 3,5-dihydroxypentanoate dehydratase; and a 5-hydroxypent-2-enoate decarboxylase;
24) a malonyl-CoA:acetyl-CoA acyltransferase; a 3-oxoglutaryl-CoA reductase (CoA reducing and alcohol forming); a 5-hydroxy-3-oxopentanoate reductase; and a 3,5-dihydroxypentanoate decarboxylase;
25) a malonyl-CoA:acetyl-CoA acyltransferase; a 3-oxoglutaryl-CoA reductase (aldehyde forming); a 3,5-dioxopentanoate reductase (ketone reducing); a 3-hydroxy-5-oxopentanoate reductase; a 3,5-dihydroxypentanoate dehydratase; and a 5-hydroxypent-2-enoate decarboxylase;
26) a malonyl-CoA:acetyl-CoA acyltransferase; a 3-oxoglutaryl-CoA reductase (aldehyde forming); a 3,5-dioxopentanoate reductase (ketone reducing); a 3-hydroxy-5-oxopentanoate reductase; and a 3,5-dihydroxypentanoate decarboxylase;
27) a malonyl-CoA:acetyl-CoA acyltransferase; a 3-oxoglutaryl-CoA reductase (ketone-reducing); a 3-hydroxyglutaryl-CoA reductase (aldehyde forming); a 3-hydroxy-5-oxopentanoate reductase; a 3,5-dihydroxypentanoate dehydratase; and a 5-hydroxypent-2-enoate decarboxylase;
28) a malonyl-CoA:acetyl-CoA acyltransferase; a 3-oxoglutaryl-CoA reductase (ketone-reducing); a 3-hydroxyglutaryl-CoA reductase (aldehyde forming); a 3-hydroxy-5-oxopentanoate reductase; and a 3,5-dihydroxypentanoate decarboxylase;
29) a malonyl-CoA:acetyl-CoA acyltransferase; a 3-oxoglutaryl-CoA reductase (ketone-reducing); a 3-hydroxyglutaryl-CoA reductase (alcohol forming); a 3,5-dihydroxypentanoate dehydratase; and a 5-hydroxypent-2-enoate decarboxylase; and
30) a malonyl-CoA:acetyl-CoA acyltransferase; a 3-oxoglutaryl-CoA reductase (ketone-reducing); a 3-hydroxyglutaryl-CoA reductase (alcohol forming); and a 3,5-dihydroxypentanoate decarboxylase.
US Pat. No. 10,794,907

THERAPEUTIC AGENT FOR AUTOIMMUNE DISEASES OR ALLERGY, AND METHOD FOR SCREENING FOR THE THERAPEUTIC AGENT

OSAKA UNIVERSITY, Suita-...

1. A method for screening a Sema3A neutralizing antibody, the method comprising:(a) contacting a Sema3A polypeptide with eukaryotic cells expressing Neuropilin-1 and Plexin-A1, in the presence of a Sema3A antibody;
(b) measuring a signal produced by an interaction between the Sema3A polypeptide and the eukaryotic cells expressing Neuropilin-1 and Plexin-A1 in the presence of the Sema3A antibody, and comparing the signal with a control signal produced by an interaction between the Sema3A polypeptide and the eukaryotic cells expressing Neuropilin-1 and Plexin-A1 in the absence of the Sema3A antibody; and
(c) selecting a Sema3A antibody that reduces the signal in comparison to the control signal,
wherein the Sema3A antibody that reduces the signal in comparison to the control signal is identified as a Sema3A neutralizing antibody, and
wherein the Sema3A neutralizing antibody inhibits T cell activation.
US Pat. No. 10,792,346

METHOD AND COMPOSITIONS FOR INHIBITING OR PREVENTING ADVERSE EFFECTS OF ORAL ANTIBIOTICS

Synthetic Biologics, Inc....

1. A formulation comprising a beta-lactamase, wherein the formulation releases the beta-lactamase in the gastrointestinal (GI) tract, and wherein the formulation comprises at least one pellet with each pellet comprising:about 5-15% by weight beta-lactamase;
about 10-20% by weight sucrose sphere;
about 25-35% by weight hydroxypropylcellulose;
about 20-30% by weight croscarmellos sodium;
about 1-10% by weight ethylcellulose dispersion;
about 1-10% by weight talc; and
about 0.5-1.5% by weight buffer salt; and
wherein the hydroxypropylcellulose and croscarmellose sodium serve as a swell layer and an osmotic rupture coating that degrades independent of pH or enzymatic activity.
US Pat. No. 10,792,858

WASH LIQUIDS FOR USE IN ADDITIVE MANUFACTURING WITH DUAL CURE RESIN

Carbon, Inc., Redwood Ci...

1. A method of forming a three-dimensional object, comprising:(a) providing a carrier and a fill level, and optionally an optically transparent member having a build surface defining said fill level, said carrier and said fill level having a build region therebetween;
(b) filling said build region with a polymerizable liquid, said polymerizable liquid comprising a mixture of (i) a light polymerizable liquid first component, and (ii) a second solidifiable component that is different from said first component;
(c) irradiating said build region with light to form a solid polymer scaffold from said first component and also advancing said carrier away from said build surface to form a three-dimensional intermediate having the same shape as, or a shape to be imparted to, said three-dimensional object and containing said second solidifiable component carried in said scaffold in unsolidified and/or uncured form;
(d) washing said three-dimensional intermediate with an organic solvent; and
(e) subsequent to said washing step, solidifying and/or curing said second solidifiable component in said three-dimensional intermediate to form said three-dimensional object, wherein said solidifying and/or curing is carried out by contacting said second solidifiable component to water.
US Pat. No. 10,793,626

ADRENOMEDULLIN BINDER FOR USE IN THERAPY OF CANCER

ANGIOBIOMED GMBH, Hennig...

1. A method for the treatment of cancer comprising:administering an effective amount of an antibody to a patient in need thereof wherein said antibody is obtained by a method comprising:
immunizing with an antigen containing a C-terminal portion of ADM including the free C-terminal amidated tyrosine residue of ADM that is SEQ ID NO: 1: APRSKISPQGY, and
selecting IgG antibodies which require the C-terminally amidated tyrosine residue at the C-terminal portion of ADM that is SEQ ID NO: 1: APRSKISPQGY for binding.
US Pat. No. 10,793,883

ENGINEERED CYANOBACTERIA WITH ENHANCED LIPID PRODUCTION

Morgan State University, ...

1. A recombinant Fremyella diplosiphon cyanobacterium comprising at least one plasmid, said at least one plasmid including at least one polynucleotide having the sequence of SEQ ID NO: 1 which encodes a sterol desaturase polypeptide.
US Pat. No. 10,793,627

GARP-TGF-? 1 IGG ANTIBODIES

argenx BVBA, Zwijnaarde ...

1. An antibody that binds to a complex of human glycoprotein A repetitions predominant (hGARP) and TGF-?1, which is an IgG antibody consisting of heavy chains each consisting of the amino acid sequence of SEQ ID NO:16 and light chains each consisting of the amino acid sequence of SEQ ID NO:17.
US Pat. No. 10,793,884

METHODS AND MATERIALS FOR MAKING SIMVASTATIN AND RELATED COMPOUNDS

THE REGENTS OF THE UNIVER...

1. A method of making simvastatin comprising the steps of:(1) combining together monacolin J; an acyl thioester that donates an acyl moiety to the C8 hydroxyl group of monacolin J in the presence of LovD acyltransferase; and a functional LovD acyltransferase that comprises an amino acid sequence having from 3 to 29 amino acid substitution mutations in SEQ ID NO:1; and
(2) allowing the functional LovD acyltransferase to transfer the acyl group from the acyl thioester to regioselectively acylate the C8 hydroxyl group of monacolin J;so that simvastatin is made;wherein the acyl thioester is selected to possess at least one of the following properties:
(a) is a butyrlyl-thioester, a N-acetylcysteamine thioester or a methyl-thioglycolate thioester;
(b) comprises medium chain length (C3-C6) acyl group moieties;
(c) is able to cross the cellular membranes of Escherichia coli or Aspergillus terreus cells growing within a fermentation media; or
(d) is selected from the group consisting of ?-dimethylbutyryl-S-methyl-mercaptopropionate (DMB-S-MMP), dimethylbutyryl-S-ethyl mercaptopropionate (DMB-S-EMP) and dimethylbutyryl-S-methyl thioglycolate (DMB-S-MTG) and dimethylbutyryl-S-methyl mercaptobutyrate (DMB-S-MMB).
US Pat. No. 10,794,909

COMPANION DIAGNOSTIC METHOD FOR USE IN THE TREATMENT OF IRRITABLE BOWEL SYNDROME WITH DIETARY INTERVENTIONS OR FAECAL MICROBIOTA TRANSPLANT

GENERIC ANALYSIS AS, Osl...

1. An in vitro method to determine the likelihood that a subject with irritable bowel syndrome (IBS) will respond to treatment with faecal microbiota transplant (FMT), said method comprising(i) determining for a test sample from the GI tract of a subject with diarrhea subtype IBS or mixed subtype IBS to be treated with FMT the amount of bacteria from at least one taxonomic group selected from
Clostridium sp.,
Eubacterium hallii, and
Bacteroides spp. and Prevotella spp.,
(ii)(a) comparing the amount of said bacteria from said at least one taxonomic group with a reference value prepared from at least one sample from the GI tract of at least one subject non-symptomatic for IBS, and determining if the amount of said bacteria from said at least one taxonomic group in said test sample differs from, or corresponds to, the reference value, wherein an amount of bacteria in the taxonomic group Clostridium sp., or Eubacterium hallii which is greater than the reference values, or an amount of bacteria in the taxonomic group Bacteroides spp. and Prevotella spp., which is lower than the reference values is indicative that the subject will respond to FMT; and/or
(ii)(b) comparing the amount of said bacteria from said at least one taxonomic group with a cut-off value which has been determined as a median amount of said bacteria in at least one sample from the GI tract of at least one IBS subject with said IBS subtype which has been previously shown to be responsive to said treatment and determining if the amount of said bacteria from said at least one taxonomic group in said test sample is greater than or less than said median cut-off value, wherein an amount of bacteria in the taxonomic group Clostridium sp., or Eubacterium hallii which is greater than said median cut-off value for said bacteria, or an amount of bacteria in the taxonomic group Bacteroides spp. and Prevotella spp., which is less than said median cut-off value for said bacteria is indicative that the subject will respond to FMT.

US Pat. No. 10,798,685

CYCLIC REDUNDANCY CHECK FOR UPLINK CONTROL INFORMATION ON CONTROL AND DATA CHANNELS

QUALCOMM Incorporated, S...

19. An apparatus for wireless communication, comprising: a processor; memory in electronic communication with the processor; and instructions stored in the memory and operable, when executed by the processor, to cause the apparatus to: identify uplink control information (UCI) for a plurality of component carriers (CCs) of a carrier aggregation (CA) configuration, the UCI having a payload size of a first number of bits; identify, for the UCI, a UCI type from a set of UCI types or an uplink control channel format from a set of uplink control channel formats, wherein the set of UCI types comprises at least a first UCI type and a second UCI type, and the set of uplink control channel formats comprises at least a first uplink control channel format and a second uplink control channel format; determine a threshold payload size from a set of threshold payload sizes based at least in part on the UCI type or the uplink control channel format of the UCI, the threshold payload size indicating a second number of bits, wherein, the set of threshold payload sizes comprises at least a first threshold payload size for the first UCI type or the first uplink control channel format and a second threshold payload size for the second UCI type or the second uplink control channel format, and wherein the first threshold payload size for the first UCI type or the first uplink control channel format is different from the second threshold payload size for the second UCI type or the second uplink control channel format; determine whether to include cyclic redundancy check (CRC) information in a transmission of the UCI based at least in part on a comparison of the first number of bits of the payload size to the second number of bits of the threshold payload size; and transmit the transmission of the UCI according to the determination of whether to include the CRC information.

US Pat. No. 10,798,684

MULTIPOINT TRANSMISSION IN WIRELESS COMMUNICATION

InterDigital Patent Holdi...

1. A wireless transmit/receive unit (WTRU), comprising:a receiver configured to receive downlink control information (DCI) and a configuration having at least two sets of power control parameters, each set of power control parameters having at least information of a desired received power and a partial path-loss compensation;
a processor configured, at least in part, to:
select a set of power control parameters, based on the DCI, from the at least two sets of power control parameters for an uplink transmission; and
determine a desired received power and a partial path-loss compensation associated with the uplink transmission based on the set of power control parameters and the DCI;
derive a path-loss estimate from a set of path-loss references based on the DCI; and
identify a power control adjustment state associated with the uplink transmission based on the DCI; and
a transmitter configured to transmit the uplink transmission using a power based on at least the desired received power, the partial path-loss compensation, the path-loss estimate, and the power control adjustment state.

US Pat. No. 10,798,683

TERMINAL APPARATUS AND METHOD

SHARP KABUSHIKI KAISHA, ...

1. A terminal apparatus for communicating with a base station apparatus, the terminal apparatus comprising:a receiver that receives:
(i) a first Physical Uplink Control CHannel (PUCCH) configuration, a second PUCCH configuration and a first parameter indicating a Transmission Time Interval (TTI) length, the first PUCCH configuration including at least a second parameter associated with a PUCCH format, the second PUCCH configuration including at least a second parameter associated with a PUCCH format, and the second PUCCH configuration being used to configure a PUCCH supporting a TTI length shorter than a TTI length of a PUCCH configured by the first PUCCH configuration, and
(ii) a Downlink Control Information (DCI) format and a Physical Downlink Shared CHannel (PDSCH) scheduled by the DCI format; and
a transmitter that transmits a PUCCH including a Hybrid Automatic Repeat Request Acknowledgement (HARQ-ACK) corresponding to the PDSCH; wherein
the transmitter determines the PUCCH format of the PUCCH based on the first PUCCH configuration, the second PUCCH configuration, the one or more second parameters, the DCI format, and a bit count of the HARQ-ACK included in the PUCCH.

US Pat. No. 10,798,682

METHODS AND APPARATUS FOR PROCESSING CONTROL AND/OR SHARED CHANNELS IN LONG TERM EVOLUTION (LTE)

QUALCOMM Incorporated, S...

1. A method for wireless communications, comprising:receiving a shared channel within a subframe;
receiving a grant of a state associated with the shared channel including at least one bit indicating whether bundling was used for the shared channel across all resource blocks of a same resource block group, when multiple Channel State Information (CSI) processes are configured, wherein the state includes a quasi co-location state which indicates quasi co-location with a specific non-zero power (NZP) channel state information reference signal (CSI-RS) resource in a measurement set;
determining, based on the indication, whether to assume the same precoding is used across all resource blocks belonging to the same resource block group of the shared channel; and
processing the shared channel based on the determination.

US Pat. No. 10,798,681

POINT-TO-POINT RADIO APPARATUS, MOBILE BACKHAUL SYSTEM, AND COMMUNICATION CONTROL METHOD

NEC Corporation, Tokyo (...

14. A communication system comprising:a plurality of radio apparatuses configured to provide a first radio link and a second radio link, the first and second radio links being included in a communication path between a base station and a core network node, wherein the first radio link is disposed downstream of the communication path and is closer to the base station than the second radio link is to the base station; and
a controller configured to determine the second radio link is unavailable, and to perform a first channel search to search for a channel available to use in the first radio link in response to determining that the second radio link is unavailable.

US Pat. No. 10,798,680

POINT TO MULTI-POINT SERVICES USING HIGH SPEED SHARED CHANNELS IN WIRELESS COMMUNICATION SYSTEMS

INTERDIGITAL TECHNOLOGY C...

1. A method for use in wireless communications, the method comprising:selectively transmitting on a control channel, on a time interval basis, point to multipoint (PtM) control information or point to point (PtP) control information;
wherein on a condition that PtM control information is transmitted, the PtM control information is transmitted using a PtM service identification to PtM users and includes a modulation and coding scheme (MCS) for PtM data, the PtM service identification indicating that the PtM users are to receive the PtM data in a first time interval, and the PtM data is transmitted in the first time interval to the PtM users; and
wherein on a condition that PtP control information is transmitted, the PtP control information is transmitted using a user equipment identification (UE ID) of a single user, and PtP data is transmitted in a second time interval to the single user on a shared channel that shares resources with the PtM data.

US Pat. No. 10,798,679

PAGING METHOD, PAGING MONITORING METHOD, DEVICE AND APPARATUS, AND STORAGE MEDIUM

ZTE Corporation, Shenzhe...

1. A paging method, comprising:selecting, by a base station, a paging approach according to paging capacity of a terminal and paging capacity supported by the base station, and
sending, by the base station, a paging message through the selected paging approach,wherein the method further comprises:indicating, by the base station, a resident mode to the terminal in at least one manner of a group consisting of:
broadcasting the resident mode through a system message; or
indicating the resident mode through a dedicated signaling;wherein the resident mode is represented as at least one of resident mode information or resident mode preference indication information,wherein sending, by the base station, the paging message through the selected paging approach comprises:determining, by the base station, according to the resident mode indicated to the terminal, a system for the terminal in an idle status to reside or reside in priority, and sending the paging message in the system resided or resided in priority by the terminal; and
in a case of sending the paging message in a system resided in priority by the terminal, continuing, by the base station, paging in at least one system supported by both the terminal and the base station after a paging failure.

US Pat. No. 10,798,678

METHODS AND APPARATUSES FOR PAGING IN A WIRELESS COMMUNICATIONS NETWORK

TELEFONAKTIEBOLAGET LM ER...

1. A method performed by a User Equipment (UE), the method comprising:receiving a response-driven page transmitted by a network node of the wireless communication network, the response-driven page indicating a group paging identifier and further indicating whether the response-driven page is initiated by a core network (CN) of the wireless communication network or is initiated by a radio access network (RAN) of the wireless communication network;
responsive to the UE being in an idle state with respect to the RAN and the response-driven page being RAN-initiated, ignoring the response-driven page; and
responsive to the response-driven page being CN-initiated or the UE not being in the idle state with respect to the RAN:
deriving a group paging identifier from a same particular one among one or more temporary identifiers assigned to the UE by the wireless communication network, irrespective of whether the response-driven page is CN-initiated or RAN-initiated; and
responsive to the derived group paging identifier matching the indicated group paging identifier, contacting the network node or another node in the wireless communication network, to determine whether the UE is a target of the response-driven page.

US Pat. No. 10,798,677

METHODS AND APPARATUS FOR PAGING AN INACTIVE UE IN A WIRELESS NETWORK

TELEFONAKTIEBOLAGET LM ER...

1. A method in a network node of a wireless telecommunication network, the method comprising:initiating transmission by a second base station of one or more paging messages for a terminal device via a radio interface of the second base station, in response to the second base station receiving a first paging request message sent from a neighboring first base station over an inter-base-station interface,
wherein the first paging request message comprises an indication of an identity of the terminal device, and a request that the second base station transmit the one or more paging messages for the terminal device,
wherein the first paging request message further comprises a paging context identity, and
wherein the method further comprises:
upon receipt by the second base station of a further paging request message, the further paging request message comprising a paging context identity, comparing the paging context identity of the further paging request message to the paging context identity of the first paging request message; and
responsive to a determination that the paging context identity of the further paging request message matches the paging context identity of the first paging request message, ignoring the further paging request message.

US Pat. No. 10,798,676

METHOD AND APPARATUS FOR INACTIVE MODE OPERATION IN WIRELESS COMMUNICATION SYSTEM

Samsung Electronics Co., ...

1. A method performed by a terminal in a wireless communication system, the method comprising:receiving, from a first base station, a first radio resource control (RRC) release message including paging area information;
transmitting, to a second base station, an RRC resume request message including a resume cause set to an update of paging area in case that the terminal is in an RRC inactive state and the update of paging area is required based on the paging area information, wherein the update of paging area is required in case that the terminal enters an area not belonging to a paging area configured by the paging area information;
receiving, from the second base station, a second RRC release message including new paging area information;
applying the new paging area information;
receiving a paging message including a paging identifier;
performing actions upon going to an RRC idle in case that the paging identifier corresponds to a core network (CN) paging identifier; and
transmitting an RRC connection resume request message for an RRC connection resume procedure in case that the paging identifier corresponds to a radio access network (RAN) paging identifier.

US Pat. No. 10,798,675

METHOD, DEVICE AND READABLE STORAGE MEDIUM FOR PAGING

HuiZhou TCL Mobile Commun...

1. A paging method, comprising:measuring synchronization signal blocks to obtain signal qualities of the synchronization signal blocks, wherein each synchronization signal block respectively corresponds to at least one downlink beam, a random access channel resource, and/or a random access preamble;
selecting suitable synchronization signal blocks from the synchronization signal blocks based on the signal qualities, wherein the signal qualities of the suitable synchronization signal blocks satisfies a first predetermined condition;
selecting a target synchronization signal block from the suitable synchronization signal blocks, wherein a specified parameter of the target synchronization signal block satisfies a second predetermined condition, and the specified parameter and the second predetermined condition are irrelevant to a user equipment; and
transmitting a paging response message to a base station utilizing the random access channel resource and/or the random access preamble corresponding to the target synchronization signal block, wherein the paging response message is configured to instruct the base station to transmit a paging message utilizing the downlink beam corresponding to the target synchronization signal block.

US Pat. No. 10,798,674

CONDITIONAL TERMINATION OF RSTD MEASUREMENTS

Telefonaktiebolaget LM Er...

1. A method for use in a wireless device of reporting positioning measurements, the method comprising:receiving network assistance information from a network node, the network assistance information for assisting the wireless device in performing Observed Time Difference Of Arrival (OTDOA), the network assistance information comprising:
a list of reference cells;
a list of neighbor cells;
a rule for terminating Reference Signal Time Difference (RSTD) measurements; and
performing RSTD measurement between a cell in the reference cell list and a cell in the neighbor cell list;
upon determining the RSTD measurement satisfies the rule for terminating RSTD measurements, reporting the RSTD measurements to the network node; and
upon determining the RSTD measurement does not satisfy the rule for terminating RSTD measurements, performing another RSTD measurement between the cell in the reference cell list and a cell in the neighbor cell list.

US Pat. No. 10,798,673

AUTONOMOUS RESOURCE SELECTION FOR VEHICLE-TO-VEHICLE SIDELINK COMMUNICATIONS

Apple Inc., Cupertino, C...

1. An apparatus to be implemented in a user equipment (“UE”), the apparatus comprising:decoding circuitry to decode a message, received from a base station and including an allocation of spectrum resources to one or more GSRs of a plurality of geographical sub-regions (“GSRs”), to obtain the allocation of the spectrum resources to the plurality of GSRs; and
central processing circuitry to:
determine, based at least on geo-information associated with one or more other UEs that are within a target communication range of the UE, a position of the one or more other UEs relative to the position of the UE; and
select a set of the spectrum resources for one or more vehicle-to-vehicle (“V2V”) sidelink transmissions based at least on (i) a position of the UE relative to a GSR of the plurality of GSRs and (ii) the position of the one or more other UEs relative to the position of the UE, wherein the set of spectrum resources are spectrum resources that conform with reliability criteria.

US Pat. No. 10,798,672

INTER-RADIO ACCESS TECHNOLOGY POSITIONING MEASUREMENTS IN NEW RADIO SYSTEMS

Intel Corporation, Santa...

1. An apparatus to be employed in a user equipment (UE), the apparatus comprising:interface circuitry to receive, from a location management function (LMF), a first positioning protocol message that requests location information; and
processing circuitry, coupled with the interface circuitry to:
encode, based on the first positioning protocol message, a measurement indication or measurement gap request for transmission to a serving next generation nodeB (gNB), wherein the measurement indication or measurement gap request is to include an indication of a gap offset for a measurement gap and an indication of a carrier frequency;
perform, subsequent to a transmission of the measurement indication or measurement gap request, a measurement based on the first positioning protocol message, wherein the measurement is a reference signal time difference (RSTD) measurement based on a positioning reference signal transmitted on the carrier frequency within the measurement gap; and
encode, based on the measurement, a second positioning protocol message for transmission to the LMF.

US Pat. No. 10,798,671

TELECOMMUNICATIONS METHOD AND APPARATUS FOR FACILITATING POSITIONING MEASUREMENTS

OPTIS WIRELESS TECHNOLOGY...

1. A method of operating a wireless terminal in communication with a radio access network over a radio interface comprising:while the wireless terminal is in a discontinuous reception (DRX) mode comprising idle periods, receiving a message from the radio access network indicating that measurements are to be performed by the wireless terminal on downlink signals transmitted from one or more cells of the radio access network or be performed by one or more cells of the radio access network on uplink signals transmitted by the wireless terminal; and
in response to receiving the message, changing a parameter associated with the DRX mode and shortening or eliminating at least one idle period of the DRX mode, based on the changed parameter, to facilitate performance of the measurements.

US Pat. No. 10,798,670

INFORMATION PROCESSING DEVICE, PORTABLE DEVICE, AND SYSTEM

UNERRY INC., Tokyo (JP)

13. A method executed by a portable device, the method comprising:transmitting first positional information related to a position of the portable device to an information processing device via a network;
receiving identification information of a predetermined number or less of first transmitters from the information processing device via the network, the identification information obtained by extracting second transmitters, a first coordinate of a second positional coordinate of each of the second transmitters being located within a first certain range including a first coordinate of a first positional coordinate and a second coordinate of the second positional coordinate of each of the second transmitters being located within a second certain range including a second coordinate of a first positional coordinate from among a plurality of transmitters registered in the information processing device, the first positional coordinate being a positional coordinate of the portable device based on the first positional information, the second positional coordinate being positional coordinate of each of the plurality of transmitters registered, calculating respective distances between the second transmitters located within the first certain range and within the second certain range and the portable device in a coordinate system of the first coordinate and the second coordinate based on the second positional coordinate corresponding to each of the second transmitters located within the first certain range and within the second certain range and the first positional coordinate after extracting the second transmitters, and extracting the identification information of the predetermined number or less of the first transmitters based on the calculated distances among the second transmitters located within the first certain range and within the second certain range, the predetermined number being less than a number of the plurality of transmitters registered;
receiving identification information that is transmitted from a transmitter and indicates the transmitter; and
determining whether the identification information indicating the transmitter is included in the identification information of the predetermined number or less of first transmitters and performing a particular process when the identification information indicating the transmitter is included in the identification information of the predetermined number or less of first transmitters.

US Pat. No. 10,798,669

METHOD OF ENABLING A WIRELESS INFORMATION DEVICE TO ACCESS LOCATION DATA

Conversant Wireless Licen...

1. A method of operating a system of wireless information devices according to location information, a first wireless information device not possessing its own absolute location finding system, the method comprising:executing a first one of a plurality of applications on the first wireless information device, each of the plurality of applications using location data as an input;
wirelessly communicating an inquiry for service discovery protocol records via the first one of the plurality of applications to a corresponding application in a second wireless information device to acquire location data of the second wireless information device;
selecting, by the second wireless information device, one or more of a plurality of absolute location finding systems based on a quality of position setting associated with the corresponding application;
wirelessly receiving, from the second wireless information device, a service discovery protocol response comprising the location data acquired by the one or more of a plurality of absolute location finding systems on the second wireless information device selected according to the quality of position parameters; and
applying the location data to the first one of the plurality of applications.

US Pat. No. 10,798,668

SYNCHRONIZATION CIRCUIT, SYNCHRONIZATION METHOD, SIGNAL GENERATING DEVICE, SIGNAL GENERATING METHOD, AND RECORDING MEDIUM

ANRITSU CORPORATION, Ats...

1. A method by which a signal generating device generates a multicarrier signal, comprising:acquiring, via the device, a signal type of the multicarrier signal and a number of subcarriers, and setting a signal generation operator and an order in which the signal generation operator is caused to act for generating the multicarrier signal of the signal type; and
acquiring, via the device, a number of input signals corresponding to the number of the subcarriers, and causing the signal generation operator to act on the input signal in accordance with the order in which the signal generation operator is caused to act, thereby generating the multicarrier signal from the input signal,
wherein
the signal generation operator is an operator Ak or Bk used in a state variable which is one of a time sequence, a frequency sequence and a code sequence, the state variable being expressed by a following state-space expressing expression at each generation process specified by a suffix k indicating the order:
Xk=AkXk?1+BkU
wherein k is equal to 1, . . . , N (N being a positive integer), U is an input vector expressing the input signal of each subcarrier by a vector, and Xk is a state vector expressing a state variable xk, and
a scenario forming module sets the signal generation operator and an order of the operation, wherein
Bp1 is conversion operator for mapping of U in a generation process of k=p1,
Ap2 is an operator of Fourier inverse transform in a generation process of k=p2,
in case of presence of CP for synchronization, a generation process of k=p3 is added, and a signal generation operator Ap3 in the generation process of k=p3 is an operator for adding CP for synchronization,
where 1?p1 when filtering processing is performed, a generation process of k=p4 is added, and a signal generation operator Ap4 in the generation process of k=p4 is an operator for adding filtering processing,
where p4 when Windowing processing is performed, a generation process of k=p5 is added, and a signal generation operator Ap5 in the generation process of k=p5 is an operator for adding Windowing processing,
where p4 the scenario forming module sets the signal generation operator and the order of the operation by combining the operators based on presence or absence of the CP for synchronization, presence or absence of the filtering processing or presence or absence of the Windowing processing.

US Pat. No. 10,798,667

AUTOMATIC TRANSMIT POWER CONTROL FOR RADIO POINTS OF A CENTRALIZED RADIO ACCESS NETWORK THAT PRIMARILY PROVIDE WIRELESS SERVICE TO USERS LOCATED IN AN EVENT AREA OF A VENUE

CommScope Technologies LL...

1. A system to provide wireless service to user equipment using an air interface in a venue having an event area, the system comprising:a controller communicatively coupled to a core network; and
a plurality of radio points to transmit and receive radio frequency signals to and from the user equipment, each of the radio points associated with at least one antenna and located remote from the controller;
wherein the controller configured to perform at least some Layer-3, Layer-2, and Layer-1 processing for the air interface;
wherein a subset of the radio points is mounted in or near the venue so as to primarily provide wireless coverage to user equipment located in the event area; and
wherein the controller is configured to automatically perform the following:
if the subset of radio points is operated in a reduced transmit power state:
determine, using information derived from transmissions from the user equipment received by the radio points, if conditions associated with the plurality of radio points indicate that spectators are located in the event area of the venue; and
cause the subset of radio points to be operated in a normal transmit power state in response to determining that the conditions associated with the plurality of radio points indicate that spectators are located in the event area of the venue; and
if the subset of radio points is operated in the normal transmit power state:
determine, using the information derived from the transmissions from the user equipment received by the radio points, if the conditions associated with the plurality of radio points indicate that spectators are not located in the event area of the venue; and
cause the subset of radio points to be operated in the reduced transmit power state in response to determining that the conditions associated with the plurality of radio points indicate that spectators are not located in the event area of the venue.

US Pat. No. 10,798,666

METHOD AND APPARATUS FOR ADAPTIVE POWER USAGE IN TIME OF FLIGHT LOCALIZATION INSTANCES

Ford Global Technologies,...

1. A system comprising: a processor configured to: determine a predefined communication scheme at 60 GHz for localizing a user via time of flight (ToF), responsive to a request designated for fulfilment upon condition that a user is within a certain distance of a vehicle;identify a first user location via a first ToF location using the predefined communication scheme;
identify a second user location via a second ToF localization using a lower power communication scheme within 2.4 GHz to 5 GHz, the lower power communication scheme configured to use less power for user localization from a power source as compared to the predefined communication scheme; and
responsive to a difference between the first user location and the second user location being within a predefined threshold difference, save coordinate information indicative of a location of the request as being suitable for use of the lower power communication scheme for localization in future requests at locations corresponding to the coordinate information, wherein the coordinate information comprises one or more of a vehicle Global Positioning System (GPS) location, an address associated with the vehicle GPS location, or GPS coordinates of the request.

US Pat. No. 10,798,665

METHOD AND SYSTEM FOR WIRELESS POWER DELIVERY

Supply, Inc., Emeryville...

1. A method for wireless power transmission, comprising:during a first time period, at a first transmitter, determining a first parameter value set for operating the first transmitter to transmit radio frequency (RF) power;
throughout a second time period after the first time period, operating the first transmitter based on the first parameter value set, wherein an RF environment generated by the first transmitter is substantially constant throughout the second time period;
during the second time period, at a second transmitter separate from the first transmitter, determining a second parameter value set for operating the second transmitter to transmit RF power, wherein determining the second parameter value set comprises optimizing operation of the second transmitter based on a first objective function associated with power transmission to a first receiver; and
after the second time period, concurrently operating the first transmitter based on the first parameter value set and operating the second transmitter based on the second parameter value set.

US Pat. No. 10,798,664

METHOD AND APPARATUS FOR REPORTING POWER HEADROOM IN WIRELESS COMMUNICATION SYSTEM

LG Electronics Inc., Seo...

1. A method for power headroom (PH) reporting by a user equipment (UE) in a wireless communication system supporting different transmission time interval (TTI) lengths including a first TTI length and a second TTI length, the second TTI length being shorter than the first TTI length, the method comprising:obtaining a PH value for a first cell configured with the first TTI length, wherein the PH value for the first cell is obtained based on whether a first physical uplink shared channel (PUSCH) transmission is scheduled on the first cell, wherein the first PUSCH transmission has the first TTI length; and
transmitting, to a second cell, the obtained PH value through a second PUSCH having the second TTI length,
wherein obtaining the PH value for the first cell comprises:
based on the first PUSCH transmission being scheduled on the first cell and the first PUSCH transmission being dropped due to a collision with the second PUSCH, obtaining the PH value for the first cell based on at least (i) a bandwidth of the first PUSCH transmission and (ii) a modulation and coding scheme (MCS) related parameter, and
based on the first PUSCH transmission not being scheduled on the first cell, obtaining the PH value for the first cell based on power control parameters other than (i) the bandwidth of the first PUSCH transmission and (ii) the MCS related parameter.

US Pat. No. 10,798,663

UPLINK POWER HEADROOM REPORTING FOR CARRIER AGGREGATION

InterDigital Patent Holdi...

1. A wireless transmit/receive unit (WTRU), the WTRU comprising:a processor configured to:
determine a first carrier that does not have a physical uplink shared channel (PUSCH) transmission for a transmission occasion;
determine a maximum power for the first carrier;
calculate a power headroom for the first carrier using the maximum power for the first carrier and transmit power information determined based on a reference grant; and
send a power headroom report, the power headroom report being sent on a PUSCH of a second carrier and comprising an indication of the power headroom for the first carrier.

US Pat. No. 10,798,662

METHOD FOR REPORTING POWER HEADROOM AND CORRESPONDING USER EQUIPMENT

Samsung Electronics Co., ...

1. A method for transmitting power headroom information by a terminal in a wireless communication system, the method comprising:receiving, on a first serving cell from a base station, first uplink scheduling information in a first subframe, wherein the first uplink scheduling information schedules a transmission in a second subframe;
identifying power headroom information for a second serving cell based on whether second uplink scheduling information scheduling a transmission in the second subframe is received on the second serving cell in or earlier than the first subframe; and
transmitting, on the first serving cell to the base station, the power headroom information for the second serving cell in the second subframe,
wherein the second serving cell is a cell on an unlicensed band.

US Pat. No. 10,798,661

TECHNIQUES AND APPARATUSES FOR RESOURCE-SPECIFIC POWER CONTROL IN 5G

QUALCOMM Incorporated, S...

1. A method of wireless communication performed by a control node, comprising:determining a power setting for at least one of a first signal or a second signal to be simultaneously communicated between a target wireless node and at least one other wireless node, wherein the power setting is determined based at least in part on whether a first set of resources or a second set of resources are allocated for the first signal or the second signal, wherein a power allocation approach is selected for determination of the power setting, and wherein the power allocation approach comprises at least one of:
a semi-static or fixed power allocation approach,
a dynamic or flexible power allocation approach, or
a hybrid power allocation approach; and
configuring the power setting to be used for the first signal or the second signal.

US Pat. No. 10,798,660

TECHNIQUES FOR DEVICE-TO-DEVICE FREQUENCY REUSE IN CELLULAR NETWORKS

Sprint Spectrum L.P., Ov...

1. A method of operating a communication system, comprising:configuring a first wireless device to communicate directly with a second wireless device;
scheduling uplink air-interface resources among a plurality of wireless devices;
receiving, by the first wireless device, a plurality of indicators of scheduled uplink air-interface resources;
using the plurality of indicators, determining, by the first wireless device, at least one unscheduled uplink air-interface resource; and,
communicating, by the first wireless device, directly with the second wireless device using the at least one unscheduled uplink air-interface resource for device-to-device communication to transmit data between the first and second wireless device,
wherein the at least one unscheduled uplink air-interface resource comprises a guard resource comprising one or both of a guard period and a guard band for the device-to-device communication, the data transmitted between the first and second wireless devices via the guard resource.

US Pat. No. 10,798,659

TRANSMISSION POWER CONTROL METHOD, COMMUNICATION DEVICE AND PROGRAM

Sony Corporation, Tokyo ...

1. A secondary usage node comprising:processing circuitry configured to:
operate a second communication service using a part or whole of a spectrum assigned to a first communication service;
acquire an acceptable transmission power that is determined by a management node based on a sum of interference power levels, each from one of a plurality of secondary usage nodes including the secondary usage node, on the first communication service; and
allocate transmission power to at least one terminal device.

US Pat. No. 10,798,658

METHOD AND APPARATUS FOR SETTING UPLINK TRANSMITTING POWER IN WIRELESS COMMUNICATION SYSTEM

Samsung Electronics Co., ...

1. A method performed by a terminal in a wireless communication system, the method comprising:receiving, from a base station, system information including a power associated with a random access preamble;
transmitting, to the base station, the random access preamble based on a first transmission power identified based on at least one of the power associated with the random access preamble, a power ramping value, and a number of times the random access preamble is transmitted;
in case that the terminal receives a random access response message including a transmit power control (TPC) command, identifying whether beam switching occurs between a beam that transmitted the random access preamble and a beam for transmitting a request message for a radio resource control (RRC) connection;
identifying a second transmission power for transmitting the request message based on the TPC command, the power ramping value, and the number of times the random access preamble is transmitted in case that the beam switching does not occur;
identifying the second transmission power based on the TPC command in case that the beam switching occurs; and
transmitting, to the base station, the request message through a physical uplink shared channel (PUSCH) based on the second transmission power.

US Pat. No. 10,798,657

POWER CONTROL IN HIGH SPEED SCENARIO

TELEFONAKTIEBOLAGET LM ER...

1. A method performed by a network node, where the network node is connected to a plurality of antenna nodes that are located along a path where a wireless communication device is moving, the method comprising:controlling the antenna nodes to maintain a respective reception radio lobe along the path such that the wireless communication device during movement along the path, can communicate with the network node via consecutive reception radio lobes, wherein the consecutive reception radio lobes are located in a same direction as one another, wherein the same direction is one of a same direction as a direction of movement of the wireless communication device, and an opposite direction to the direction of movement of the wireless communication device; and
determining that the wireless communication device is about to move out of a current reception radio lobe and move into a subsequent reception radio lobe and, as a consequence of said determination:
controlling at least one antenna node to provide an instruction at a specific point in time to the wireless communication device to perform a correction of transmission power, wherein the correction is adapted to account for a difference between a first and a second path loss associated with the current reception radio lobe and the subsequent reception radio lobe, respectively.

US Pat. No. 10,798,656

INFORMATION TRANSMISSION APPARATUS AND METHOD AND COMMUNICATION SYSTEM

FUJITSU LIMITED, Kawasak...

1. An information transmission apparatus, configured in a remote user equipment (UE) of a cellular communication system that supports sidelink communication, the information transmission apparatus comprising:an information reporting processor circuitry configured to report information comprising an identifier (ID) of a relay UE to a base station, the information further indicating that the remote UE supports sidelink communication of the cellular communication system and other communication that is different from the cellular communication system with the relay UE; and
a data communication processor circuitry configured to perform communication with the relay UE based on the sidelink communication of the cellular communication system or the other communication that is different from the cellular communication system selected by the remote UE or the relay UE.

US Pat. No. 10,798,655

ENHANCED POWER CONSUMPTION MANAGEMENT OF A USER EQUIPMENT USING A MOBILE COMMUNICATION NETWORK, WHEREIN DIFFERENT SETS OF RADIO RESOURCES ARE USED IN DEPENDENCY OF A POWER CONSUMPTION INFORMATION

DEUTSCHE TELEKOM AG, Bon...

1. A method for power consumption management of a user equipment using a mobile communication network, wherein the mobile communication network comprises a core network and an access network, wherein the access network comprises a plurality of base station entities, wherein the mobile communication network comprises a radio resource management entity, and wherein the method comprises the following steps:in a first step, a set of first radio resources is assigned, by the radio resource management entity, to the user equipment for transmitting uplink data and/or receiving downlink data;
in a second step, subsequent to the first step, power consumption information is obtained by the radio resource management entity, the power consumption information indicating that a current rate of power consumption of the user equipment while using the assigned set of first radio resources is above a predefined upper power consumption threshold or below a predefined lower power consumption threshold; and
in a third step, subsequent to the second step, in response to the power consumption information indicating that the current rate of power consumption of the user equipment while using the assigned set of first radio resources is above the predefined upper power consumption threshold or below the predefined lower power consumption threshold, a set of second radio resources is assigned, by the radio resource management entity, to the user equipment for transmitting uplink data and/or receiving downlink data, wherein a rate of power consumption of the user equipment while using the assigned set of second radio resources is between the predefined lower power consumption threshold and the predefined upper power consumption threshold.

US Pat. No. 10,798,654

METHOD TO DECREASE ENERGY CONSUMPTION FOR SENSOR NODES IN A WIRELESS SENSOR NETWORK

1. A method of reducing energy consumption of sensor nodes in a wireless sensor network, comprising:the sensor nodes are alternating a power-on and a power-off stage during a period T, all sensors nodes of the same rank, without hierarchy;
turning on a power of at least a first sensor node by a wakening signal from an initiator;
transmitting the wakening signal from a first wakened sensor node to at least a second sensor node within a limited time interval Tm thus wakening at least the second sensor node;
thus, sequentially wakening up all sensor nodes of the wireless sensor network; wherein
period T is less than interval Tm;
transmitting a message from the initiator to any of the sensor nodes or transmitting a message from any of the sensor nodes to the initiator or from one sensor node to another sensor node;
after completing of the transmission of the message all sensor nodes return to power-on-power-off regime during each period T;
wherein the turning on the power of at least the first sensor node is performed if the power level of the wakening signal from the initiator is above a threshold.

US Pat. No. 10,798,653

SYSTEMS AND METHODS FOR MANAGING COMMUNICATION BETWEEN DEVICES

Kinetic Technologies, Sa...

1. A configurable device for managing communication between devices, the configurable device comprising:one or more master channel connectors;
one or more slave channel connectors;
a master logic enabling the configurable device configured in a master mode to exchange clockless communication with multiple devices on one or more channels, the multiple devices having a slave logic, wherein the configurable device configured in the master mode communicates with one or more devices having the slave logic on a single channel over a wired serial connection via a single master channel connector of the configurable device; and
a slave logic enabling the configurable device configured in a slave mode to:
exchange clockless communication with a master device on a single channel over a first wired serial connection via a first slave channel connector of the configurable device, the master device having the master logic; and
exchange clockless communication with a slave device on the single channel over a second wired serial connection via a second slave channel connector of the configurable device, the slave device having the slave logic.

US Pat. No. 10,798,652

DISTRIBUTED ANTENNA SYSTEM FOR USE ALONG TRAIN TRACK

CommScope Technologies LL...

1. A distributed antenna system (DAS) comprising:a main unit communicatively coupled to one or more base stations; and
one or more remote antenna units communicatively coupled to the main unit, wherein at least one of the remote antenna units is deployed near a railroad track over which a train travels;
wherein the DAS is configured to do the following for each of the at least one of the remote antenna units:
cause said remote antenna unit to operate in a low-power and/or muted operational state;
while said remote antenna unit is operating in the low-power and/or muted operational state, determine if the train is sufficiently close to a coverage area of said remote antenna unit to trigger a change in an operational state of said remote antenna unit;
in response to determining that the train is sufficiently close to the coverage area of said remote antenna unit to trigger the change in the operational state of said remote antenna unit, cause said remote antenna unit to operate in a normal operational state;
while said remote antenna unit is operating in the normal operational state, determine if the train has exited the coverage area of said remote antenna unit; and
in response to determining that the train has exited the coverage area of said remote antenna unit, cause said remote antenna unit to operate in the low-power and/or muted operational state.

US Pat. No. 10,798,651

METHOD AND SYSTEM FOR ENERGY EFFICIENT WIRELESS COMMUNICATIONS

INTELLIGENT FUSION TECHNO...

1. A system for energy-efficiency wireless communication in a wireless device, comprising:a three-layer protocol stack, comprising:
a physical layer;
a medium access control (MAC) layer; and
a network layer, wherein:
the physical layer includes one or more circuits to conduct a power consumption minimization and a waveform selection to select, from a plurality of waveforms, a waveform with a minimal average energy consumption for a data packet transmission,
the MAC layer is configured to perform a medium access control and a resource block reconfiguration in response to a connection loss,
the network layer is configured to perform a route selection to select an energy efficient routing of data packet transmission between the wireless communication device and another communication device and to perform a connection maintenance to maintain a connection during the data packet transmission between the wireless communication device and the other communication device, and
the physical layer, the MAC layer and the network layer cooperate with each other to at least reduce an energy consumption of the wireless communication device; and
a battlefield environment learning circuitry, configured to learn variation of environments by tracking channel fading and interference strength via channel estimation and channel sensing techniques, respectively, and determine probability density functions of a channel gain and interference power using a kernel density estimation approach, and deliver the probability density functions to the three-layer protocol stack,
wherein the physical layer is configured to receive information including the probability density functions of the channel gain and the interference power to conduct the average energy consumption minimization.

US Pat. No. 10,798,650

AP-LOCAL DYNAMIC SWITCHING

Trapeze Networks, Inc., ...

1. An apparatus, comprising:a processor; and
a non-transitory memory in operable communication with the processor, the memory storing instructions executable by the processor to:
receive a signal representing a priority characteristic of a first virtual local area network (VLAN) associated with a first wireless station;
determine whether to AP-locally switch traffic from the first wireless station based on the priority characteristic, thereby determining a priority of the first VLAN as compared with a second VLAN;
when the priority characteristic is a first value, switch the traffic locally to the second wireless station by forwarding the traffic to the second wireless station without forwarding the traffic to an intervening wireless station; and
when the priority characteristic is a second value less than the first value, tunnel the traffic from the first wireless station upstream to the second wireless station.

US Pat. No. 10,798,649

METHOD AND APPARATUS FOR LAYER 3 CONFIGURATION IN A HETEROGENEOUS NETWORK

BlackBerry Limited, Wate...

1. A method at a user equipment operating in a network having a macro cell and at least one assisted serving cell, the method comprising:while the user equipment is connected to both the macro cell and an assisted serving cell:transmitting, from the user equipment to the macro cell, radio resource control signaling intended for a radio resource control layer of the assisted serving cell, the assisted serving cell having its own cell identifier and having an S1 interface with a mobility management entity (MME), and the assisted serving cell having a smaller coverage size than the macro cell; and
receiving, from the macro cell, radio resource control signaling originating from the radio resource control layer of the assisted serving cell.

US Pat. No. 10,798,648

METHOD FOR PERFORMING PLMN SELECTION AND DEVICE SUPPORTING THE SAME

LG ELECTRONICS INC., Seo...

1. A method for performing, by an access stratum (AS) layer of a user equipment (UE), public land mobile network (PLMN) selection in a wireless communication system, the method comprising:entering an RRC_INACTIVE state in a visited PLMN (VPLMN);
informing, to a non-access stratum (NAS) layer of the UE, whether or not there is on-going data transmission in the RRC_INACTIVE state, wherein the data transmission in the RRC_INACTIVE state is configured by a network;
receiving, from the NAS layer of the UE, a request of a PLMN searching upon that there is no on-going data transmission;
searching one or more available PLMNs according to the request of the PLMN searching;
informing, to the NAS layer of the UE, of a list of the one or more available PLMNs, wherein the list includes at least one of Home PLMN (HPLMN), Equivalent Home PLMN (EHPLMN), or higher priority PLMN than the VPLMN;
receiving, from the NAS layer of the UE, a selected PLMN among the list of the one or more available PLMNs; and
selecting a cell in the selected PLMN while in the RRC_INACTIVE state.

US Pat. No. 10,798,647

NETWORK SLICE SELECTION

Apple Inc., Cupertino, C...

1. An apparatus, comprising:a memory; and
a processor operably coupled to the memory and configured to cause a network slice selection function (NSSF) of a cellular network to:
receive a network slice selection request associated with a non-access stratum (NAS) request by a user equipment device (UE), wherein the network slice selection request comprises a network slice identifier (NSID) indicating a UE-preferred network slice for the UE included in the NAS request;
select a network slice based on at least a network operator's policy, wherein to select the network slice the processor is configured to cause the NSSF to:
determine that the UE-preferred network slice is not compatible with a selection policy; and
select a network slice of the cellular network different from the UE-preferred network slice in response to the network slice selection request, wherein the selected network slice matches the selection policy; and
provide a network slice selection response, wherein the network slice selection response indicates the selected network slice, wherein the selected network slice is associated with a control plane entry point.

US Pat. No. 10,798,646

NETWORK SLICE DETERMINING METHOD AND SYSTEM, AND APPARATUS

HUAWEI TECHNOLOGIES CO., ...

1. A network slice determining method, comprising:obtaining, by a network selection function (NSF) node, an identity of a terminal;
sending, by the NSF node, the identity to a home subscriber server (HSS);
receiving, by the NSF node, a slice identifier of a network slice that is sent by the HSS, wherein the slice identifier is determined by the HSS based on the identity; and
determining, by the NSF node based on the slice identifier, a network slice to which the terminal belongs, wherein the determining is based at least in part on a matching of information of the terminal with network slice attribute information for the determined network slice, and wherein the NSF node stores a correspondence between slice identifiers of different network slices and different network slice attribute information, and each piece of network slice attribute information includes at least one of a terminal type, a service type, and a location range that are supported by a network slice corresponding to the network slice attribute information.

US Pat. No. 10,798,645

EXTENDING SUBSCRIBER SERVICES TO ROAMING WIRELESS USER EQUIPMENT

Juniper Networks, Inc., ...

1. A method comprising:processing, by a network device, a request, from a subscriber device, via a wireless connection device, for network parameters for accessing one or more services provided by a service provider network, the request for network parameters comprising identifying data associated with a subscriber of the service provider network;
outputting, by the network device, to a service server, an authentication request for the subscriber device, the authentication request indicating the identifying data;
in response to receiving an authentication reply indicating the authentication request for the subscriber device has been approved and a service profile for the subscriber:
outputting, by the network device, to the wireless connection device, configuration information corresponding to the service profile for the subscriber; and
outputting, by the network device, to the subscriber device, network parameters for accessing the one or more services provided by the service provider network; and
in response to determining, by the network device, a bandwidth usage of the one or more services by the subscriber device, outputting, by the network device, to the service server, an accounting message indicating the identifying data and the bandwidth usage of the one or more services by the subscriber device.

US Pat. No. 10,798,644

TECHNIQUE FOR INTERNET PROTOCOL ANCHOR RELOCATION

Telefonaktiebolaget LM Er...

1. A method for Internet Protocol (IP) Point of Presence (POP) change for a user equipment in a communication architecture, the communication architecture having a user plane for packet data communication of user data and a control plane for controlling the packet data communication, the method comprising:managing a first communication path in the user plane between a user equipment and a first IP POP having a first IP address, the first communication path having a first uplink path and a first downlink path;
deciding, in the control plane, on an IP POP change to a second communication path in the user plane between the user equipment and a second IP POP having a second IP address, the second communication path having a second uplink path and a second downlink path; and
performing, in the control plane, the IP POP change from the first communication path to the second communication path, wherein the IP POP change is effected by:
preparing the second communication path;
switching from the first uplink path to the second uplink path, wherein premature use of the second downlink path is inhibited by firewall settings in the verification entity which are removed as part of the step of switching from the first downlink path to the second downlink path;
assigning the second IP address to the user equipment;
activating the second downlink path; and
releasing the first downlink path.

US Pat. No. 10,798,643

SIGNAL SENDING METHOD AND DEVICE

Huawei Technologies Co., ...

1. A signal sending method comprising:sending, by a first transmit site, a first discovery reference signal (DsRS 1) to first user equipment (UE) by using a first transmit power and a first transmit period, wherein the first discovery reference signal is used by the first UE for signal quality measurement;
sending, by the first transmit site, a second discovery reference signal (DsRS 2) to second UE by using a second transmit power and a second transmit period, wherein the second discovery reference signal is used by the second UE for signal quality measurement;
receiving, by a second transmit site, a first signal measurement result of the first UE for the first discovery reference signal, and a second signal measurement result of the second UE for the second discovery reference signal;
sending, by the second transmit site, the first signal measurement result of the first UE and the second signal measurement result of the second UE to the first transmit site; and
determining, by the second transmit site, whether to switch an operation mode of the first transmit site according to the first signal measurement result and the second signal measurement result, wherein the first transmit site is in a sleeping mode.

US Pat. No. 10,798,642

ON-DEMAND SYSTEM INFORMATION DELIVERY PROCEDURE

MediaTek INC., Hsin-Chu ...

1. A method comprising: receiving a System Information (SI) change: notification message and a minimum system information (MSI) by a user equipment (UE) from a base station in a wireless network; obtaining an other SI (OSI) delivery mode indicator from the MSI, wherein the OSI delivery mode indicator indicating either a periodic broadcast delivery mode or an on-demand delivery mode for each OSI, wherein the on-demand delivery mode includes an on-demand unicast delivery mode and an on-demand broadcast delivery mode; sending an on-demand SI request for a set of requested OS in response to the OSI delivery mode indicating the on-demand delivery mode, wherein the UE sends the on-demand SI request using a radio resource when configured by the SI change notification message, and wherein the UE receives a first SI response that includes a first subset of requested OSI via the on-demand unicast delivery mode, and receives a second SI response that includes a second subset of requested OSI via the on-demand broadcast delivery mode; and acquiring OS information in a predefined or scheduled period in response to the OSI delivery mode indicating the periodic broadcast delivery mode for each requested OSI.

US Pat. No. 10,798,641

SYSTEM INFORMATION TRANSMISSION METHOD AND APPARATUS

HUAWEI TECHNOLOGIES CO., ...

1. A system information transmission method implemented by a first terminal device, the method comprising:obtaining identifier information from a second terminal device, wherein the identifier information comprises a first cell identifier, and wherein the first cell identifier identifies either a first camped-on cell or a first serving cell that is accessed before a direct link between the second terminal device and the first terminal device is established; and
sending a first message to the second terminal device when the first cell identifier is inconsistent with a second cell identifier, wherein the second cell identifier identifies one of a second camped-on cell, a second serving cell that is accessed after the direct link between the second terminal device and the first terminal device is established, a third camped-on cell, or a third serving cell of the first terminal device, and wherein the first message is at least a part of system information from a first network device of the third camped-on cell or the third serving cell.

US Pat. No. 10,798,640

ENHANCEMENT OF UNIFIED ACCESS CONTROL

MEDIATEK INC., Hsin-Chu ...

1. A method comprising:obtaining a set of access categorization rules by a user equipment (UE) in a mobile communication network, wherein each access categorization rule defines one or more conditions of a match to an access category;
initiating an action that is subject to access barring control, wherein the initiating action is initiated in an application layer, an IP Multimedia Subsystem (IMS) layer or a non-access stratum (NAS) layer, and wherein the initiating action does not transmit a barring indication;
determining an access category for the action in a categorization layer by matching the action using the access categorization rules, wherein the access category is associated with a set of access control parameters; and
performing access barring for the action in a barring check layer by performing a random draw using the set of access control parameters.

US Pat. No. 10,798,639

CONNECTION TRY METHOD AND USER EQUIPMENT, AND CONNECTION CONTROL METHOD AND BASE STATION

LG Electronics Inc., Seo...

1. A method of controlling an access attempt to a network by a user equipment (UE) in a wireless communication system, the method comprising:receiving first mapping information for at least one access category defined by an operator of the network;
receiving barring information;
determining an access category for an access attempt type that is associated with the access attempt from among a plurality of access categories based on mapping information; and
determining whether to perform the access attempt to the network based on (i) the determined access category for the access attempt type that is associated with the access attempt and iii) the barring information,
wherein the plurality of access categories includes (i) the at least one access category defined by the operator of the network and (ii) access categories defined in a standard specification for the wireless communication system,
wherein the mapping information defines mapping relation between the plurality of access categories and a plurality of access attempt types, respectively,
wherein the mapping information includes (i) the first mapping information for the at least one access category defined by the operator of the network and (ii) second mapping information for the access categories defined in the standard specification,
wherein the at least one access category defined by the operator of the network includes an access category for a network slice, and
wherein the first mapping information at least defines mapping relation between the access category for the network slice and the network slice.

US Pat. No. 10,798,638

APPARATUS AND METHOD FOR CONTROLLER AND SLICE-BASED SECURITY GATEWAY FOR 5G

NETSIA, INC., Santa Clar...

2. A method implemented in a first gateway that is directly attached to a first network service function of a mobile core network, a second gateway attached to a second network service function, both the first gateway and the second gateway attached to an SDN network, the SDN network comprising a plurality of switches, the first gateway and the second gateway and SDN network controlled by a controller,wherein a plurality of GPRS Tunneling Protocol-U (GTP-U) tunnels originate from the first network service function and terminate at the second network service function, each GTP-U tunnel in the GTP-U tunnels identifiable by a Tunnel ID, each GTP-U tunnel in the GTP-U tunnels having a similar feature set, and each GTP-U tunnel in the GTP-U tunnels carrying different user equipment's (UE's) IP packets, and
wherein the controller receiving at least the Tunnel ID and feature set of each GTP-U tunnel in the GTP-U tunnels from the mobile core network,
the method comprising:
a. receiving an instruction from the controller to form a new outer tunnel that has a feature set identical to that of the plurality of GTP-U tunnels, the instruction including an identifier and a header of the new tunnel;
b. mapping each GTP-U tunnel received from the first network service function to the new outer tunnel by encapsulating it with the header of the new outer tunnel; and
c. routing IP packets in the new outer tunnel towards the second gateway via an interface associated with a next hop switch, the next hop switch having only instructions to route the new outer tunnel towards its next hop.