US Pat. No. 10,188,225

ADJUSTABLE SCANNER MOUNTING ASSEMBLY AND METHOD

Mettler-Toledo, LLC, Col...

1. An adjustable scanner mounting assembly, comprising:a pair of first mounting rails forming a part of opposite walls of a scanner/scale device housing or adapted for attachment to opposite walls of a scanner/scale device housing;
a pair of second mounting rails adapted to cooperatively support a scanner and extending transversely between the first mounting rails and slidably connected thereto, a scanner retention wall extending upwardly from and along the length of each second mounting rail; and
at least one scanner locating mechanism movably affixed to each of the second mounting rails so as to be slidable along the length thereof;
wherein, positional adjustment of a scanner along a first axis is accomplishable by sliding the second mounting rails along the length of the first mounting rails; and
wherein, positional adjustment of a scanner along a second axis is accomplishable by sliding the scanner locating mechanisms along the length of the second mounting rails.

US Pat. No. 10,188,224

REFRIGERATED CASE WITH A SELF-CONTAINED CONDENSATE REMOVAL SYSTEM AND LEAK DETECTION

Killion Industries, Inc.,...

1. A refrigerated case, comprising:a refrigerated space;
an air inlet;
an air outlet;
a condensate collection tray configured to collect condensate from the refrigerated space;
a refrigeration system having a controller and configured to remove heat from the refrigerated space and remove the condensate from the condensate collection tray collected from the refrigerated space;
a condensate level detector located within the condensate collection tray and configured to measure a level of the condensate in the condensate collection tray and to generate a condensate level signal in response to a presence of the condensate at a predetermined condensate level in the condensate collection tray;
a means to remove the condensate from the condensate collection tray in communication with the condensate level detector, wherein the means to remove the condensate from the condensate collection tray is configured to remove the condensate upon detection of the condensate level signal;
a leak detector located at a high point of the condensate collection tray and configured to generate a high point signal in response to the presence of condensate at the high point of the condensate collection tray;
a condensate sensor located at a low point of the refrigerated case outside of said condensate collection tray and configured to generate a condensate detected signal in response to the presence of the condensate;
wherein the condensate level signal from the condensate level detector causes the means to remove the condensate from the condensate collection tray to turn on until the condensate level signal is no longer detected;
wherein the high point signal from the leak detector causes the refrigeration system to automatically shut down and turns on the means to remove the condensate from the condensate collection tray until the high point signal is no longer detected; and
wherein the condensate detected signal from the condensate sensor causes the refrigeration system to automatically shut down until the condensate detected signal is no longer detected.

US Pat. No. 10,188,223

REFRIGERATED MERCHANDISER INCLUDING EUTECTIC PLATE REFRIGERATION

Hussmann Corporation, Br...

1. A refrigerated merchandiser comprising:a case including a base and a canopy at least partially defining a product display area;
a eutectic plate positioned in the product display area and including a housing defining a hollow cavity;
a fluid contained in the housing; and
a heat exchanger including a coil positioned in the housing to cool the fluid, the coil having an inlet, an outlet spaced from the inlet, a serpentine portion extending between the inlet and the outlet, a linear return portion extending adjacent an outer edge of the housing and between the serpentine portion and the outlet, the coil further including a first portion, and a second portion adjacent and in thermal communication with the first portion to define a tube-to-tube heat exchanger, wherein the second portion is positioned between the return portion and the outlet.

US Pat. No. 10,188,221

PLAY YARD WITH REMOVABLE LINER

KIDS II, INC., Atlanta, ...

1. A children's play yard comprising:a play yard frame comprising: one or more upper horizontal frame members defining an upper perimeter of the play yard frame
one or more vertical frame members having a first end and a second end, the one or more vertical frame members extending downwardly from the one or more upper horizontal frame members, the one or more vertical frame members including at least one mating fastener positioned at a height below the one or more upper horizontal frame members;
one or more elongate liner retention members operatively connected to the first end of the one or more vertical frame members and releasably connected to the second end of the one or more vertical frame members; and
a removable play yard liner configured for being removably secured to the one or more retention members of the play yard frame, wherein the removable play yard liner includes at least one fastener configured for engaging the at least one mating fastener to secure at least a portion of the removable play yard liner over the one or more upper horizontal frame members and over an outer portion of at least one of the one or more vertical frame members,
wherein in an inward receiving orientation the one or more elongate liner retention members are configured for slidingly receiving the removable play yard liner and in a retaining orientation the one or more elongate liner retention members are configured for securing the play yard liner to the play yard frame.

US Pat. No. 10,188,220

SEAT COVER WITH OCCUPANT COVERING FEATURE

1. A removable cover for a seat in the form of a reclining chair, comprising:a chair covering portion configured to cover at least a part of the reclining chair, the chair covering portion including at least a seating section, a headrest section, a pair of arm sections, and a pair of rearwardly extending sections that extend from opposite sides of the chair covering portion and are configured for connection to one another after wrapping around a back portion of the reclining chair;
at least one covering-to-chair retention mechanism configured to releasably secure the various chair covering portion sections to corresponding parts of the reclining chair; and
an occupant covering portion associated with the chair covering portion, the occupant covering portion having a first end attached near the headrest section of the chair covering portion and an opposite end attached near a bottom of the chair covering portion, the occupant covering portion extending from at least one side of the chair covering portion and configured to cover at least a portion of an occupant of the reclining chair while the chair covering portion is simultaneously secured to the reclining chair;
wherein the sections of the chair covering portion are configured to remain secured to the corresponding parts of the reclining chair and to remain in place during movement of the reclining chair between an upright position and an inclined position; and
wherein the occupant covering portion is usable in both the upright position and the inclined position of the reclining chair.

US Pat. No. 10,188,214

PILLOWCASE AND TRAVEL PILLOW WITH EYE-COVERING APPARATUS

1. A travel pillowcase, comprising:a pillowcase body for enclosing a smaller travel-sized pillow, the pillowcase body including a first pillowcase body end and a second pillowcase body end, wherein the second pillowcase body end has a top side and a bottom side; and
an eye-covering band dimensioned for blocking ambient light from reaching a user's eyes, the eye-covering band including a length between a first eye-covering band end and a second eye-covering band end, enabling selective adjustment of the eye-covering band for comfort, wherein the first eye-covering band end is attached to the top side of the second pillowcase body end and the second eye-covering band end is attached to the bottom side of the second pillowcase body end, in juxtaposition with the first eye-covering band end.

US Pat. No. 10,188,210

LEVELING DEVICE

1. A generally wedge shaped leveling device having a first midline axis and a transverse midline axis that perpendicularly intersects the first midline axis at approximately a middle of the first midline axis, the leveling device comprising:a top surface having a substantially constant slope relative to a bottom surface;
the bottom surface being substantially planar other than a relatively small, singular, central protrusion of the bottom surface located at an intersection of the first midline axis and the transverse midline axis, the central protrusion extending a first distance from the bottom surface in a direction away from the top surface; and
a rear surface connecting the top surface to the bottom surface at a rear end thereof; and
an integrally formed pattern disposed on the bottom surface, the formed pattern having at least one continuous channel spanning between a first edge of the bottom surface and a second edge opposite the first edge of the bottom surface.

US Pat. No. 10,188,203

SYSTEMS AND METHODS FOR PROVIDING MOTIVATION FEEDBACK TO A USER BEFORE BRUSHING

KONINKLIJKE PHILIPS N.V.,...

8. An oral cleaning method which provides feedback to a user, comprising the steps of:processing, using a processor within a power toothbrush, sensor information obtained from one or more sensors on or within the toothbrush during a first brushing session of a user;
detecting, by a sensor, that the toothbrush has been picked up after the first brushing session and is about to be used, wherein the sensor is different from the one or more sensors; and
in response to the detecting by the sensor after the first brushing session, communicating, using a feedback system on or within the toothbrush responsive to the processor, brushing information based on the sensor information obtained from the one or more sensors to the user at a time subsequent to the first brushing session but before a second brushing session of the user.

US Pat. No. 10,188,201

BROOM

GORDON BRUSH MFG. CO., IN...

1. A broom that can be used to move, sweep, clean dirt, debris, water, or other matter, comprising: a rigid head, a connector mounted to the head and a handle having one end mated to the connector and extending away from the head, and bristles extending from a bottom surface of said head; the head having a generally straight central section and opposite end portions angled relative to said central section, such that said head is generally curved in a horizontal plane;said head further comprising a rigid frame; said bristles being contained in a bristle package comprising a bristle holder from which said bristles extend; said bristle package being removably secure to the frame.

US Pat. No. 10,188,199

EXTENDABLE CLEANING BRUSH

1. An extendable cleaning brush, comprising:an elongated handle having a first end and a second end, wherein the elongated handle has a telescopic construction;
the second end of the handle having a housing therein, wherein a brush head having a plurality of bristles is connected to the housing;
a reservoir operably connected to a dispensing mechanism adapted to selectively release a quantity of a cleaning solution stored within the reservoir;
wherein the dispensing mechanism comprises a tube that extends from the reservoir to a lower surface of the brush head such that the cleaning solution is dispensed onto the brush head;
wherein the elongated handle is affixed to the housing via a ball and socket joint at a center region, wherein the ball and socket joint is configured to freely rotate the housing thereabout;
wherein the housing is a hemisphere.

US Pat. No. 10,188,196

BACK PACK WITH RAIN COVER

1. A back pack comprising:a front side facing away from a user's back when said back pack is carried;
a back side facing towards said user's back when said back pack is carried;
a water proof base portion disposed at a lower end of a lengthwise direction of said front side of said back pack when said back pack is carried;
a rain cover compartment disposed at an upper end of said water proof base portion;
a rain cover adapted to be coupled to said rain cover compartment and cover more than half of said front side of said back pack in a mounted state such that at least portions of said back pack other than said water proof base portion are covered; and
a harness attached to said back side of said back pack, said harness comprising a first strap and a second strap,
wherein said first strap is attached at a lower portion and an upper portion of said back side of said back pack, and
wherein said second strap is attached at said lower portion and said upper portion of said back side of said back pack.

US Pat. No. 10,188,195

DECORATIVE WIPERS FOR COSMETIC CONTAINERS

HCT GROUP HOLDINGS LIMITE...

1. A wiper for cosmetic products comprising:a first end adapted to be placed at an opening or upper end of a cosmetic bottle and comprising an upper face which surrounds a decorative design defining a first opening therethrough, the decorative design having a non-circular shape;
a second end adapted to sit farther within the cosmetic bottle, the second end defining a circular second opening narrower than first opening in at least one dimension; and
a passage between the first opening and the second opening having walls which define a taper therebetween,
wherein the walls taper selectively to form the non-circular shape of the first opening.

US Pat. No. 10,188,193

APPLICATOR HEADS FOR HANDHELD TREATMENT APPARATUS FOR MODIFYING KERATINOUS SURFACES

1. An applicator head releasably connectable to an outer housing of an apparatus for treating human skin, the applicator head comprising:a body having a housing connector end configured to releasably connect to the outer housing and a skin engaging end having an opening therethrough for delivering a skin treatment composition through the opening in the applicator head onto human skin; and
a pair of skin engagement members arranged and configured to flatten a surface of the skin, wherein the pair of skin engagement members comprises a first roller at a first side of the opening and a second roller at a second, opposite side of the opening, wherein each of the first and second rollers is connected to the applicator head at a pivot axis, wherein the distance between the pivot axes of the first and second rollers is between about 5 mm and about 15 mm.

US Pat. No. 10,188,190

DEODORANT PRODUCT APPLICATION DEVICE

ELEMENTZ LLC, London (GB...

1. A device for applying a substance to a surface comprising:a vessel containing the substance to be applied;
an applicator head mounted on a top of the vessel;
an enclosure;
a delivery mechanism located in the enclosure to create and deliver a form of energy directed toward the applicator head;
a power source for the mechanism; and
a control module to control the delivery mechanism located in the enclosure;
wherein the form of energy is air movement and the delivery mechanism is an air movement mechanism and the air movement mechanism draws air from an area above the top of the vessel and delivers air to an area above the top of the vessel.

US Pat. No. 10,188,182

CLASP FOR BEADED JEWELRY

10. An improved clasp, comprising:a first mating section having an elongated cavity integrally fused to a first slide tube with a first tubular cavity, a first bead slot and a first bendable flap;
a tab positioned on said first mating section;
a second mating section having an elongated shaft integrally fused to a second slide tube with a second tubular cavity, a second bead slot and a second bendable flap;
a release lever having a locking tab slot attached to said elongated shaft of said second mating section;
wherein said elongated shaft of said second mating section is sized and adapted to be positioned within said elongated cavity of said first mating section, and said first mating section and said second mating section are in sliding engagement with one another; and
wherein said tab is fitted to said locking tab slot to hold and fasten the first mating section to the second mating section when said first mating section and said second mating section are engaged with one another.

US Pat. No. 10,188,179

FASTENER

APLIX, Le Cellier (FR)

1. A slide-in fastening element presenting a multitude of installed orientations, comprising:a gripping portion having a gripping face and a back face, the gripping face comprising at least one row of gripping elements;
an anchoring portion located opposite the back face and configured to anchor the fastening element to a retainer, the anchoring portion comprising a flange parallel to the back face and having a shape selected from among a pentagon, a hexagon, a heptagon, and an octagon, enabling the slide-in fastening element to be retained in one of the multitude of orientations, wherein the flange is configured to be removably inserted at a portion of the retainer; and
a support connecting the back face with the flange, and having a height measured between the back face and the flange, wherein
the flange presents a flange surface area (FSA) defined by a flange length and a flange width as measured on a lower face of the flange that is between 10 and 90 percent of a gripping face surface area (GFSA) as measured on the gripping face, and
wherein the support includes a support length and a support width, wherein the support length and the support width are less than the flange length and the flange width.

US Pat. No. 10,188,177

FRICTION STOP STRAP ADJUSTOR

Bell Sports, Inc., Scott...

1. A strap adjustor, comprising:a top surface;
a bottom surface opposite the top surface;
an upper surface that extends between the top surface and the bottom surface;
a lower surface opposite the upper surface;
a front surface extending between the top surface and the bottom surface and between the upper surface and the lower surface;
a back surface opposite the front surface, the back surface extending between the top surface and the bottom surface and between the upper surface and the lower surface;
a first through opening, between the front surface and the back surface, that extends completely through the strap adjustor from the top surface to the bottom surface;
a second through opening, between the front surface and the back surface, that extends completely through the strap adjustor from the top surface to the bottom surface;
a bar separating the first through opening from the second through opening, the bar extending from the top surface to the bottom surface and from the front surface to the back surface;
a first end opening positioned on the upper surface, the first end opening extending from the upper surface to the first through opening;
a second end opening positioned on the upper surface adjacent to but separate from the first end opening, the second end opening extending from the upper surface to the first through opening;
a first strap configured to extend from a helmet to the first end opening and to be disposed through the first end opening, through the first through opening, and over the bar; and
a second strap configured to extend from the helmet to the second end opening and to be disposed through the second end opening, through the first through opening, and over the bar.

US Pat. No. 10,188,174

SOLE STRUCTURES AND ARTICLES OF FOOTWEAR HAVING A LIGHTWEIGHT MIDSOLE MEMBER WITH PROTECTIVE ELEMENTS

NIKE, Inc., Beaverton, O...

1. An article of footwear, comprising:an upper;
a sole structure engaged with the upper, wherein the sole structure includes a first portion configured to support at least a heel and midfoot area of a wearer's foot, wherein an exposed outer edge of the first portion includes a billows structure that extends continuously from a medial midfoot or forefoot area of the sole structure to a lateral midfoot or forefoot area of the sole structure, wherein the billows structure includes a plurality of billow outer ridges connected by billow interstitial areas located between adjacent billow outer ridges of the billow outer ridges, the plurality of billow outer ridges being fewer than five billow outer ridges, wherein individual billows of the billows structure have a thickness at a rear end of the first portion that is larger than a thickness at a front end of the first portion, and wherein an upper surface of the billows structure is secured to the upper; and
an outsole assembly secured to a bottom surface of the sole structure.

US Pat. No. 10,188,173

SYSTEM AND METHODS FOR ADJUSTING VARIABLE GEOMETRY, HEIGHT, WEIGHT DISTRIBUTION DYNAMICS IN ORTHOTIC DEVICES AND EQUIPMENT

Alliance Design and Devel...

1. A orthotic platform comprising:a heel section;
a front section; and
an mid-arch section between the heel section and the front section; and
a variable adjuster comprising:
a rod inserted, at an angle, through the heel section and extending toward, and contacting at a first end, the mid arch section, said rod comprising a major axis wider than a minor axis and configured to:
deflect along an edge of the heel section,
a selector, positioned substantially near the heel section, comprising:
at least one indentation at a second end, said at least one indentation providing a means for:
incrementally rotating an orientation of the rod with respect to the mid-arch section.

US Pat. No. 10,188,172

MASSAGE INSOLE WITH MULTIPLE SUPPORT REGIONS

Health Shoes Plus, Inc., ...

1. An insole for use on a human foot, the human foot including a medial longitudinal arch, a lateral longitudinal arch, a transverse arch, and toes, the insole comprising:a foot bed of substantially consistent thickness;
the foot bed being flexible to permit insertion into a shoe;
a multiplicity of nodules affixed to the foot bed, the multiplicity of nodules of varying heights, the varying heights taken as an average to define an average nodule height;
a transverse arch support adapted to support the transverse arch;
the transverse arch support created by nodules having a greater than average height;
lateral longitudinal arch support;
the lateral longitudinal arch support created by nodules having a lesser than average height;
medial longitudinal arch support;
the medial longitudinal arch support created by nodules having a greater than average height;
a partial insole wedge beneath a portion of the foot bed;
the partial insole wedge formed from a material with greater shock absorption than that of the foot bed;
the partial insole wedge having a tapered shape from thin to thick, being thin at a center of the insole and thick at a back of the insole;
the insole for placement into a shoe;
whereby the nodule height determines the amount of support provided to the human foot.

US Pat. No. 10,188,170

SIGNALING SOLE FOR SHOES, SHOE PROVIDED WITH SAID SOLE AND KIT COMPRISING AT LEAST ONE OF SAID SOLE

VIBRAM S.P.A., Albizzate...

1. A sole for shoes comprising an upper surface, in use facing a user, a lower surface, in use facing a ground, and a thickness, wherein said thickness corresponds to a distance between said upper surface and said lower surface, wherein said sole comprises at least one signaling means, whereinsaid at least one signaling means comprises at least one vibrating motor, capable of vibrating inside said sole and at least one light device, wherein said sole comprises means for receiving-processing a control signal (sc) to receive and process said control signal (sc) and to emit in reply an activation-deactivation signal (S) towards said at least one signaling means, wherein said at least one vibrating motor and said at least one light device are activated in response to the activation-deactivation signal (S).

US Pat. No. 10,188,169

SENSOR FOR AN ARTICLE OF FOOTWEAR

NIKE, Inc., Beaverton, O...

1. An article of footwear, the article of footwear comprising:an upper and a sole structure, the sole structure including a cavity;
a force sensitive resistor including an active portion joined to a tail portion;
the force sensitive resistor including a plurality of layers; each of the plurality of layers being elongated in a substantially horizontal direction;
the plurality of layers comprising a top substrate layer, a first adhesive layer, and a bottom substrate layer, wherein the first adhesive layer is disposed between the top substrate layer and the bottom substrate layer;
a shaft extending in a substantially vertical direction through at least the bottom substrate layer, the shaft leading to an opening formed in an outermost surface of the bottom substrate layer;
a horizontal passageway extending in a substantially horizontal direction from the active portion to the tail portion, the horizontal passageway being in fluid communication with the shaft;
the horizontal passageway providing a first flowpath through the force sensitive resistor, the shaft providing a second flowpath through the force sensitive resistor;
an elastic membrane being secured over the opening; and
wherein the elastic membrane deforms in response to increased air pressure in the shaft.

US Pat. No. 10,188,168

SHOCK-ABSORBENT JUNCTION APPARATUS AND FACEMASK SYSTEM

1. A shock absorbing junction comprising:a first plate;
a second plate;
a resilient material comprising at least three springs having a triangular configuration;
a clip comprising an opening for receiving a portion of a facemask;
a button shaped to mate with a slot in a helmet;
wherein said resilient material is located between said first plate and said second plate;
wherein said first plate comprises a first top face and a first bottom face;
wherein said second plate comprises a second top face and a second bottom face;
wherein each of the at least three springs comprises a first end and a second end;
wherein each first end is connected to said first bottom face and each second end is connected to said second top face;
wherein the clip is coupled to the first top face; and
wherein the button is coupled to the second bottom face.

US Pat. No. 10,188,167

TIME TRIAL BICYCLE HELMET WITH EAR SHIELD

Bell Sports, Inc., Scott...

1. A helmet, comprising:an aerodynamic helmet body comprising a front portion, an opposite a tail portion, and an opening configured to receive a wearer's head, the tail portion comprising two side portions each having a lower edge curving downward behind an ear of a wearer when the helmet body is worn by the wearer; and
a shield comprising two ear shield portions connected to each other adjacent the front portion of the helmet body by a brow portion;
wherein the shield is releasably coupled to the helmet body through magnetic coupling when the shield is connected to the helmet body, the magnetic coupling occurring between at least one shield magnet coupled to the shield and aligned with at least one body magnet in the helmet body; and
wherein the helmet body is configured to leave a majority of the ear of the wearer exposed with respect to the helmet body, and the ear shield portions extend rearward from the brow portion of the shield aligned with the front portion of the helmet body to respective front edges of the two side portions of the tail portion and align aerodynamically with the two side portions of the tail portion and cover at least a portion of the ears of the wearer when connected to the helmet body adjacent to the front portion.

US Pat. No. 10,188,164

VENTED COOLING GARMENT

NIKE, Inc., Beaverton, O...

1. A vented upper body garment, comprising:a back panel comprising an inner surface intended for contacting the skin of a user and an outer surface, a top edge, a bottom edge, a right edge and a left edge, a first region and a second region;
the first region comprising a first plurality of overlay film structures affixed to the back panel, each overlay film structure in the first plurality of overlay film structures having a shape, wherein the first plurality of overlay film structures are affixed to the outer surface of the back panel;
a plurality of perforations aligning with the first plurality of overlay film structures, each of the perforations extending through each overlay film structure in the first plurality of overlay film structures and the back panel;
each overlay film structure in the first plurality of overlay film structures defining a reinforcing perimeter for each of the perforations in the plurality of perforations on the back panel; and
a flocked silicone pattern aligned with a perimeter of each perforation in the plurality of perforations in the first region, the flocked silicon pattern extending into the second region, wherein the flocked silicone pattern is deposited on the inner surface of the back panel proximate to each of the reinforcing perimeters formed by the first plurality of overlay film structures.

US Pat. No. 10,188,163

DOUBLE-LAYER TRIM PIECE

NIKE, Inc., Beaverton, O...

1. An article of unitary construction for forming a double-layer trim piece, the article comprising:when in an un-assembled configuration:
a first zone having a first set of apertures, each of the first set of apertures having a first size;
a second zone having a second set of apertures, each of the second set of apertures having a second size; and
a third zone interposed between the first zone and the second zone, wherein the first zone, the second zone, and the third zone lie in a continuous plane.

US Pat. No. 10,188,160

GARMENTS HAVING COMPARTMENTS THAT SUPPORT POST-OPERATIVE DRAIN DEVICES

1. A garment comprising:an inner surface;
an outer surface;
a front panel comprising a left front panel and a right front panel;
a rear panel; and
a plurality of post-operative drain compartments disposed along the inner surface of the garment, wherein a first of the plurality of post-operative drain compartments is disposed between a first axis and a second axis, wherein the first post-operative drain compartment has an upper edge, a lower edge, and two side edges, wherein the upper edge of the first post-operative drain compartment provides a first opening, wherein the first post-operative drain compartment has a length and a width, wherein the two side edges of the first post-operative drain compartment extend parallel to the length, wherein the upper edge and the lower edge of the first post-operative drain compartment extend parallel to the width, wherein the first post-operative drain compartment is disposed above a navel portion of the garment, wherein the first post-operative drain compartment is disposed below a breast portion of the garment, wherein a second of the plurality of post-operative drain compartments is disposed between a third axis and a fourth axis, wherein a third of the plurality of post-operative drain compartments is disposed between the third axis and the fourth axis, wherein the first post-operative drain compartment is also disposed between a fifth axis and a sixth axis, wherein a fourth of the plurality of post-operative drain compartments is disposed between the fifth axis and the sixth axis, and between the third axis and the fourth axis, wherein the fourth post-operative drain compartment has an upper edge and a lower edge, wherein the upper edge of the fourth post-operative drain compartment provides a second opening, wherein a distance between the upper edge of the fourth post-operative drain compartment and the lower edge of the first post-operative drain compartment is greater than half of the length of the first post-operative drain compartment, wherein the upper edge of the fourth post-operative drain compartment and the lower edge of the first post-operative drain compartment define a space which is free of any post-operative drain compartments, wherein the fourth post-operative drain compartment is disposed below the navel portion of the garment, wherein the second post-operative drain compartment is adjacent to the third post-operative drain compartment, wherein the second and third post-operative drain compartments are disposed below the first post-operative drain compartment, wherein the first, second, third, and fourth axes are parallel to each other, wherein the first, second, third, and fourth post-operative drain compartments are all disposed on one of either the left front panel or the right front panel, and wherein the first, second, third, and fourth post-operative drain compartments are all disposed on the inner surface of the garment.

US Pat. No. 10,188,145

PERSONAL VAPORIZER HAVING REVERSING AIR FLOW

1. A personal vaporizer having a distal end and a proximal end, a distal direction defined moving axially from the proximal end toward the distal end, a proximal direction being opposite the distal direction, comprising:an atomizer module comprising an atomizer cup having a distal wall and a side wall extending in the proximal direction from the distal wall to a proximal edge, a heating element being arranged in or adjacent the atomizer cup, the cup being configured to accept a vaporizing medium so that the vaporizing medium is atomized when the heating element is energized;
a vaporizing chamber defined in part by the distal and side walls of the atomizer cup, the vaporizing medium being contained within the vaporizing chamber;
a flow body selectively attachable to a proximal side of the atomizer module, the flow body comprising an inlet passage through a side of the flow body, the inlet passage communicating with a delivery passage that extends in the distal direction from the inlet passage to a delivery opening, the delivery passage and delivery opening being defined by the flow body, the delivery opening being distal of the inlet passage and proximal of the vaporizing chamber, and being configured to direct intake air into the vaporizing chamber;
an exit passage communicating with the vaporizing chamber and defined by the flow body adjacent the delivery passage, and an exit opening communicating with the exit passage and being proximal of the vaporizing chamber; and
a mouthpiece having a mouthpiece outlet that is in communication with the exit passage, the mouthpiece being proximal of the flow body;
wherein a vaporizing chamber flow path is defined within the vaporizing chamber between the delivery opening and the exit passage, and atomized vaporizing medium becomes entrained in the air flowing along the vaporizing chamber flow path so as to form a vapor; and
wherein the vaporizer is configured so that as air is drawn out of the mouthpiece outlet, air is drawn in through the inlet passage and flows along the vaporizing chamber flow path.

US Pat. No. 10,188,141

METHOD AND APPARATUS FOR INCORPORATING OBJECTS INTO CIGARETTE FILTERS

R.J. REYNOLDS TOBACCO COM...

1. A method for providing filter rods for use in the manufacture of smoking articles, each filter rod having objects individually spaced at predetermined intervals along a length thereof, the method comprising:supplying a continuous web of filter material from a source of filter material;
rotating a vacuum-assisted insertion wheel having a peripheral face, the peripheral face defining a plurality of spaced pockets;
introducing individual spherical objects into the plurality of spaced pockets along the peripheral face of the insertion wheel, at least one of the pockets having a seat comprising a hollow tube having a cylindrical-shaped side wall with a plurality of protrusions extending inwardly from the side wall that define gaps therebetween to permit flow of air past the individual spherical object supported on the seat, said plurality of protrusions defining a support surface to position one individual spherical object centrally within the hollow tube, and wherein only one individual spherical object is held within a pocket, and a vacuum is applied to at least a portion of the pockets through the gaps to maintain the individual spherical objects within the pockets during rotation of the insertion wheel;
separating the continuous web of filter material;
inserting at predetermined intervals the individual spherical objects from within the pockets to within cavities formed where the web of filter material is separated; and
compressing the continuous web of filter material to form a continuous rod of filter material having the individual spherical objects positioned at the predetermined intervals within the rod.

US Pat. No. 10,188,128

AUTOMATIC FROZEN FOOD PRODUCT VENDING MACHINE

The Vollrath Company, L.L...

1. An automatic frozen food product vending machine, comprising:a frozen food product dispensing station for dispensing at least one frozen food product;
a container dispenser for storing a plurality of frozen food product containers and configured to automatically dispense one frozen food product container at a time;
a first movable platform for supporting a dispensed frozen food product container;
a topping dispensing station for dispensing at least one topping;
a second movable platform for supporting the dispensed frozen food product container;
a user input device configured to receive a user selection of a desired frozen food product, a user selection of a desired amount of frozen food product, and a user selection of a desired topping;
processing electronics configured to:
receive the user selection of the desired frozen food product, the user selection of the desired amount of frozen food product, and the user selection of the desired topping;
move the first movable platform below the container dispenser;
cause the container dispenser to dispense one frozen food product container onto the first movable platform;
move the first movable platform and the dispensed frozen food product container below the frozen food product dispensing station;
cause the frozen food product dispensing station to dispense into the frozen food product container a predetermined amount of the selected frozen food product as determined by the user selection of the desired frozen food product and the user selection of the desired amount of frozen food product;
transfer the dispensed frozen food product container from the first movable platform to the second movable platform;
move the second movable platform and the dispensed frozen product container below the topping dispensing station; and
cause the topping dispensing station to dispense into the frozen food product container a predetermined amount of topping as determined by the user selection of the desired topping.

US Pat. No. 10,188,126

COTTON CANDY PREPARING DEVICE

AGATSUMA CO., LTD., Toky...

1. A cotton candy preparing device, comprising:a rotary pot that can be divided into a pot upper portion and a pot bottom portion;
a plurality of legs that extend downwards from a vicinity of a circumferential edge portion of a lower end of the pot upper portion and which each include a leg end portion that expands outwards at a lower end thereof;
a heating plate that is provided on an upper surface of the pot bottom portion; and
an opening and closing member having a depression that is formed at a center of a top portion of the pot upper portion as a semi-spherical loading port,
wherein the pot upper portion includes a cylindrical inner wall that is provided below the opening and closing member, a diametrically expanded inclined portion having a plurality of ribs projecting inward under the cylindrical inner wall, an annular projecting portion formed in a flat annular shape that extends radially outwards in a horizontal direction from a lower end of the diametrically expanded inclined portion, and a ring member that is provided on a lower surface of the annular projecting portion,
wherein a plurality of depressed portions are provided on the lower surface of the annular projecting portion and are opened to an outer edge of the annular projecting portion,
wherein the ring member has an outer diameter and an inner diameter substantially coincident with the outer diameter and the inner diameter of the annular projecting portion, a plurality of first expanded portions having a predetermined width in a circumferential direction from an inner edge of the ring member, and a second expanded portion that is narrower in the circumferential direction than the plurality of first expanded portions and continues outside the plurality of first expanded portions,
wherein the ring member is overlapped on the heating plate by bringing into contact with the heating plate from the inner edge to near the outer edge thereof,
wherein an outer end portion of the second expanded portion is connected to an inner end portion of a depressed portion of the plurality of depressed portions so as to form a slight gap continuing from the second expanded portion to the depressed portion,
wherein the pot bottom portion includes leg receiving holes that are provided near the circumferential edge portion of the upper surface of the pot bottom portion and into which the plurality of legs can be inserted individually,
wherein the leg receiving holes each have an inserting portion that can permit passage of the leg end portion and a leg stopping portion that connects continuously to a side of the inserting portion and whose width to an outer circumferential direction of the rotary pot is made narrower than the inserting portion,
wherein the pot bottom portion further includes a rod-shaped engaging pin below the heating plate,
wherein the rod-shaped engaging pin is positioned on a lower side of the annular projecting portion at a first end thereof and is attached to a pot bottom main body in an oscillating fashion, and the rod-shaped engaging pin has an engaging projecting body that is provided on a side of the rod-shaped engaging pin so as to project into a triangular shape therefrom and is biased by an elastic body so as to cause the engaging projecting body to project into at least one of the leg receiving holes;
wherein a second end of the rod-shaped engaging pin is formed into a rod-shaped body configured to be brought into engagement with an operation pin,
wherein the operation pin faces toward the center of the pot bottom main body, and the outer end portion thereof protrudes outward from the annular projecting portion, and
wherein when the leg end portion protruding from the annular projecting portion is pressed toward the center of the pot bottom main body, the rod-shaped engaging pin is swung around the first end so as to compress the elastic body, and the engaging projecting body projecting into the leg receiving holes is moved to the inside of the pot bottom main body and the leg end portion inserted into the leg stopping portion is moved to the inserting portion, such that a leg of the plurality of legs is configured to be removed from the leg receiving holes.

US Pat. No. 10,188,118

CUTTER FOR MANUFACTURING THREE-DIMENSIONAL NOODLES

1. A three-dimensional noodle cutter comprising:rotation shafts (10, 11) arranged in parallel with each other and driven by a motor;
first roller (20) and second roller (21) provided on an outer peripheral surface of the rotation shafts (10, 11) in a form of a cylinder and driven to rotate in close contact with each other; and
a molding groove (30) depressed inwardly along an outer peripheral surface of the first roller (20) and the second roller (21),
wherein edges of dough introduced in the molding groove (30) are cut by friction between the first roller (20) and the second roller (21), thereby producing noodles, wherein the molding groove (30) is formed in a space between a first curved part (31) and a second curved part (32) alternatively arranged in a longitudinal direction of the rotation shafts (10, 11), a small space part (33) and a large part (34) formed in the first roller, and the first curved part (31) and the second curved part (32) formed in the second roller (21) are arranged to be engaged with each other and rotate so that the first curved part (31) and the second curved part (32) of the first curved part (31) are aligned with the first curved part (31) and the second curved part (32) of the second curved part (31), respectively, whereby dough introduced in the molding grove (30) is produced into noodles (50) having an embossed three-dimensional shapes,
wherein both ends of first and second rollers (20, 21) are attached with the first and second control saw teeth (40, 41), which precisely control a contact of the first and second curved part (31, 32) formed by the first and second rollers (20, 21), and on an inside of each of the first and second control saw teeth (40, 41) is an alignment pin (43) which fastens a coupling of the rollers and saw teeth; outsides of the first and second control saw teeth (40, 41) are marked with first and second contact points (42a, 42b) to easily identify when the first and second rollers (20, 21) break away from one another and are loosened and make necessary adjustments to the first and second control saw teeth (40, 41).

US Pat. No. 10,188,108

FUSED BICYCLIC HETEROCYCLE DERIVATIVES AS PESTICIDES

BAYER CROPSCIENCE AKTIENG...

1. A compound of formula (I)
wherein
R1 is ethyl,
R3 is hydrogen,
Q is

 where the bond from Q to the remainder of the molecule is identified by a wavy line,
n is 0, and
R2 is selected from the group consisting of H, 8-CF3, 8-Cl, 8-SC2H5, 5-CF3 and 6-CH3;
or
R1 is ethyl,
R3 is hydrogen,
Q is

 where the bond from Q to the remainder of the molecule is identified by a wavy line,
n is 1, and
R2 is selected from the group consisting of 6-Cl, 6-CF3, 7-CF3, 5-CF3, 8-CF3 and 6-OCH3;
or
R1 is ethyl,
R3 is hydrogen,
Q is

 where the bond from Q to the remainder of the molecule is identified by a wavy line,
n is 2, and
R2 is selected from the group consisting of H, 8-Cl, 5-CF3, 8-CF3, 8-SO2C2H5, 6-CH3 and 6-OCH3;
or
R1 is ethyl,
R3 is hydrogen,
Q is

 where the bond from Q to the remainder of the molecule is identified by a wavy line,
n is 0, and
R2 is selected from the group consisting of H, 5-CH3, 5-CF3, 6-CF3, 6-Cl, 7-CF3, 5-SC2H5, 7-SC2H5, 7-CH3 and 6-CH3;
or
R1 is ethyl,
R3 is hydrogen,
Q is

 where the bond from Q to the remainder of the molecule is identified by a wavy line,
n is 1, and
R2 is hydrogen;
or
R1 is ethyl,
R3 is hydrogen,
Q is

 where the bond from Q to the remainder of the molecule is identified by a wavy line,
n is 2, and
R2 is selected from the group consisting of H, 7-CH3, 7-CF3, 6-CH3, 6-CF3, 6-Cl and 5-CH3;
or
R1 is ethyl,
R3 is hydrogen,
Q is

 where the bond from Q to the remainder of the molecule is identified by a wavy line,
n is 2, and
R2 is H.

US Pat. No. 10,188,106

PESTICIDE COMPOSITION COMPRISING A TETRAZOLYLOXIME DERIVATIVE AND A FUNGICIDE OR AN INSECTICIDE ACTIVE SUBSTANCE

BAYER CROPSCIENCE AKTIENG...

1. A composition comprising:A) a tetrazolyloxime derivative of formula (I)

wherein
X represents a hydrogen atom, a halogen atom, an alkyl group, an alkoxy group, a cyano group, a methanesulfonyl group, a nitro group, a trifluoromethyl group or an aryl group;
A represents a tetrazoyl group of formula (A1) or (A2):

wherein Y represents an alkyl group; and
Het represents a pyridyl group of formula (Het1) or a thiazolyl group of formula (Het2);

wherein R represents a hydrogen atom or a halogen atom; Z represents a hydrogen atom, an amino group, a group of formula QC(?O)NH— wherein Q represents a hydrogen atom; an alkyl group having 1 to 8 carbon atoms; an alkyl group having 1 to 6 carbon atoms substituted by a halogen atom; a cycloalkyl group having 3 to 6 carbon atoms; an alkoxyl group having 1 to 8 carbon atoms; a cycloalkyloxy group having 3 to 6 carbon atoms; a benzyloxy group; a 2-phenylethyloxy group; a thioalkyl group substituted by an alkyl group having 1 to 4 carbon atoms; an alkyl group having 1 to 2 carbon atoms substituted by an alkoxyl group having 1 to 4 carbon atoms; an alkyl group having 1 to 6 carbon atoms substituted by an acylamino group having 1 to 4 carbon atoms; an alkoxy group having 1 to 6 carbon atoms substituted by an acylamino group having 1 to 4 carbon atoms; an alkylamino group having 1 to 8 carbon atoms; an alkenyl group having 2 to 6 carbon atoms; an aralkyl group or a phenyl group; and
B) a fungicide compound in an A/B weight ratio ranging from 1/0.01 to 1/100;
wherein said fungicide is selected from the group consisting of azoxystrobin, bixafen, boscalid, chlorothalonil, clothianidin, cymoxanil, dimethomorph, fluazinam, fludioxonil, fluopicolide, fluoxastrobin, fosetyl-Al, imidacloprid, ipconazole, iprodione, iprovalicarb, isopyrazam, mancozeb, metalaxyl, metalaxyl-M (mefenoxam), metconazole, penthiopyrad, propamocarb-HCl, propineb, prothioconazole, pyraclostrobin, tebuconazole, trifloxystrobin, triticonazole, and N-[2-(1,3-dimethylbutyl)phenyl]-5-fluoro-1,3-dimethyl-1H-pyrazole-4-carboxamide.

US Pat. No. 10,188,083

INSECT PRODUCTION SYSTEMS AND METHODS

1. A method to separate insects from an insect and gas mixture, the method includes:(a) providing:
(a1) a first separator having a first input and a first output, the first input is configured to accept an insect and gas mixture, the first separator separates insects from the insect and gas mixture and outputs a first insect-depleted gas stream via said first output, the first insect-depleted gas stream has a reduced amount of insects relative to the insect and gas mixture; and
(a2) a second separator having a second input and a second output, said second input is in fluid communication with said first output of the first separator, the second separator is configured to accept at least a portion of the first insect-depleted gas stream from the first separator and separate additional insects therefrom and output a second insect-depleted gas stream via said second output, the second insect-depleted gas stream has a reduced amount of insects relative to the first insect-depleted gas stream;
(b) separating insects from the insect and gas mixture to form a first insect-depleted gas stream that has a reduced amount of insects relative to the insect and gas mixture; and
(c) after step (b), separating additional insects from the first insect-depleted gas stream to form a second insect-depleted gas stream that has a reduced amount of insects relative to the first insect-depleted gas stream.

US Pat. No. 10,188,081

PORT AND PERCH INSERT FOR A BIRD FEEDER

1. A port and perch insert for fitting into an aperture through a wall of a container of a birdfeeder, the port and perch insert comprising a port, a perch, and a snap fit element which flexes to snap over an edge of the aperture and retain the port and perch insert to the container, wherein the snap fit element comprises:a protrusion which snaps over the edge of the aperture to engage against an inside surface of the container;
a flexible root portion which connects the snap fit element to a main body of the port and perch insert, and which flexes to allow the protrusion to snap over the edge of the aperture; and
a paddle portion which is pushable from outside the container once the port and perch insert has been fitted to the container, to flex the root portion and move the protrusion out of engagement with the inside surface of the container to allow the port and perch insert to be removed from the container.

US Pat. No. 10,188,080

FULL 360 DEGREES HANDS-FREE LEASH ATTACHMENT UNIT

1. A hands-free leash attachment unit, comprising:a flexible outer hose shaped as a ring and having an innermost perimeter facing a center point of said ring and an outermost perimeter opposite said innermost perimeter, said flexible outer hose having a longitudinal length and a slot extending said longitudinal length along said outermost perimeter of said flexible outer hose;
a pad located on said innermost perimeter of said flexible outer hose;
a corrugated inner hose shaped as a ring, said corrugated inner hose being placed within a hollow of said flexible outer hose and having a longitudinal length and a slot extending said longitudinal length of said corrugated inner hose and along an outermost perimeter of said corrugated inner hose;
an innermost ring being one of a rope or a chain, said innermost ring being placed in a hollow of said corrugated inner hose so that said corrugated inner hose is between said flexible outer hose and said innermost ring;
whereby said innermost ring is configured to move independently of said flexible outer hose within said hollow of said corrugated inner hose.

US Pat. No. 10,188,078

GRAVITY FLOW FEEDER

1. A gravity flow animal feeder, comprising:a. first and second canisters having an upper and lower ends;
b. first and second funnels having an upper and lower ends, said upper end of said first funnel attached to said first canister at said lower end of said first canister and said second funnel attached to said second canister at said lower end of said second canister;
c. a chute having an upper and lower end, said upper end of said chute attached to said lower ends of said first and second funnels;
d. a trough attached to said lower end of said chute, said trough having an internal cavity, wherein said first and second canisters, said first and second funnels, said chute, and said trough are engaged to allow for the passage of feed there through;
e. an access in said trough, said access being pivotally articulable between an open and closed position;
f. a cylinder having a piston movable therein, said cylinder attached to said access, said cylinder being articulable for extending and retracting said piston for pivotally opening and closing said cavity; and
g. a timing mechanism means for triggering said cylinder to open and close said access.

US Pat. No. 10,188,076

CAT LITTER PRODUCT

OIL-DRI CORPORATION OF AM...

1. A lightweight clumping cat litter, comprising 45%-80% by weight of sodium bentonite and 20%-55% by weight of a non-swelling sorbent material, wherein the non-swelling sorbent material includes a cellulose-containing material, and wherein the sodium bentonite comprises 47% or more of the external surface area of the litter, and wherein upon contact with a sufficient amount of liquid, a portion of the litter so-contacted forms an intact, removable clump within thirty seconds of the contact, which clump remains intact for at least one hour after the contact.

US Pat. No. 10,188,051

METHOD FOR CONTROLLING IRRIGATION

1. A method for controlling irrigation of one or more agricultural plants comprisingA. Allowing irrigation water to fall on agricultural plants from a container through an aperture in the container that may be opened or closed electronically;
B. Collecting irrigation water that exits the agricultural plants into a collector,
C. Funneling the irrigation water from the collector into a tipping bucket, wherein the tipping bucket has two sides of triangular shape, and a bottom beneath and common to both sides, and wherein an electrode is fixedly attached to the bottom;
D. Allowing the irrigation water to fill one side of the tipping bucket sufficiently to cause it to tip, causing the electrode fixedly attached to the bottom of the tipping bucket to move past a second electrode electrically connected to an electrical circuit that is also connected to the aperture in the container from which the irrigation water comes;
E. Completing an electrical circuit for a time sufficient to generate an electrical pulse;
G. Counting each electrical pulse,
H. Sending the electrical pulse created when the first fixedly attached electrode instantaneously contacts the second electrode to the aperture of the container from which the irrigation water comes;
I. Opening or closing the aperture of the container; and
K. Not using weight measurements, pH measurements, soil moisture measurements, nor measurements of chemical composition of the irrigation water exiting the agricultural plant to control the opening or closing of the container from which the irrigation water comes.

US Pat. No. 10,188,043

VARIABLE SPEED ROUND BALE CHAMBER CONTROL WITH ACCUMULATOR SENSOR

AGCO Corporation, Duluth...

1. A variable speed baler, comprising:a baling chamber configured to bale crop material, the baling chamber having a plurality of bale forming belts driven at a determined speed by at least one powered drive roll;
a crop height sensor to detect a height of accumulated crop material at an accumulation region to be fed to the baling chamber;
a bale size sensor to detect a size of a bale in the baling chamber; and
a controller configured to compare the height of the accumulated crop material to a comparison value using information from the crop height sensor and to determine a growth rate of the bale being formed in the baling chamber using information from the bale size sensor and manipulate the speed of the bale forming belts in the baling chamber in response to the height of accumulated crop material and the growth rate of the bale in the baling chamber, wherein if the bale growth rate is less than zero, the controller determines whether the height of the accumulated crop material is greater than the comparison value, and if the height of the accumulated crop material is greater than the comparison value, the bale forming belts are operated at a user-provided desired speed.

US Pat. No. 10,188,041

SQUARE BALER

1. A square baler comprising:a frame;
a bale chamber formed on the frame so as to be opened forward and backward, and having a square cross-section;
a knotting part having a knotting member and a needle member, wherein the knotting member is provided at an upper portion of a rear side of the bale chamber so as to knot and cut a bale string, and the needle member is provided at a lower part of the rear side of the bale chamber so as to perform a vertical angular movement and guide the bale string to the knotting member;
a pickup part picking up and providing hay in a front inner space of the bale chamber;
a rake part rotatably installed on an upper portion of a front side of the bale chamber so as to, during a rotation and a downward motion of the rake part, push and compress the hay, which was picked up and provided to the front inner space of the bale chamber, towards the rear side where the bale string is positioned between the knotting member and the needle member; and
a compression arm provided to prevent the hay, which was pushed and compressed backwards by the rake part, from being uncompressed during the rotation and upward motion of the rake part and re-compress the hay.

US Pat. No. 10,188,040

HAY RAKE WHEEL ANTI-CLOGGING SYSTEM

1. A hay rake wheel anti-clogging system comprising:a vehicle;
a hay rake wheel coupled to said vehicle, said hay rake wheel comprising a plurality of tines extending from a hub, said tines being rotated wherein said tines are configured for raking;
a mount, said mount being coupled to said vehicle proximate to said hay rake wheel, said mount comprising a housing, said housing having a flat face;
a rod, said rod being coupled to and extending from said mount, said rod being elongated, said rod being positioned adjacent to said hay rake wheel such that said rod contacts said tines as said tines are urged towards said rod by movement of said vehicle in a manner rotating said hay rake wheel; and
a coupler, said coupler being coupled to said housing and forming a loop with said housing wherein said coupler is positionable to extend around an axle housing coupled to said vehicle adjacent to said hay rake wheel whereby said coupler couples said housing to said axle housing, said flat face being positionable to abut a hub guard extending from said axle housing.

US Pat. No. 10,188,039

ELECTRICAL POWER GENERATION FOR HEADER SYSTEMS FROM A COMBINE BACKSHAFT

1. An electrical power system for a header of a combine harvester, the header including a working element and a header backshaft, wherein the header backshaft is mechanically coupleable to a drive mechanism of the combine harvester to cause rotation of the header backshaft, wherein the header backshaft is further mechanically coupled to the working element of the header, and wherein rotation of the header backshaft drives operation of the working element of the header, the electrical power system comprising:an alternator mounted to the header and mechanically coupled to the header backshaft, wherein the alternator is configured to convert rotation of the header backshaft into electrical power; and
a power supply circuit mounted to the header and configured to transfer the electrical power from the alternator to one or more electric devices mounted on the header.

US Pat. No. 10,188,038

QUICK ATTACH CORN REEL ASSEMBLY

1. A corn reel finger assembly attachable to a corn reel axle, the assembly comprising:an elongate finger defining a finger axis and having a first end portion and a second end portion, and a yoke member;
a pin member,
the yoke member being positioned about the second end portion of the elongate finger, the yoke member defining at least one recess at an end portion of the yoke member and a pin receiving hole spaced from the recess and adapted to receive the pin member therethrough;
a mount adapted to engage with the corn reel axle, the mount including a brace having at least one catch adapted to engage the pin member, the mount further comprising a collar adapted to engage with the corn reel axle and configured to fit within the recess, and when assembled the yoke member recess is mated with a portion of an outer radial surface of the collar; and
when in an assembled form, the pin member is positioned within the pin receiving hole and engages the catch, and the second end portion of the finger is stationary relative to the corn reel axle.

US Pat. No. 10,188,037

YIELD ESTIMATION

1. A method comprising:receiving a first signal indicating an aggregate yield measured by an aggregate yield sensor during a measurement interval;
receiving a second signal indicating a plurality of geo-referenced regions across which a harvester has traveled prior to the measurement interval, each of the plurality of geo-referenced regions having a region width less than a width of a head of the harvester;
allocating, to each of at least two geo-referenced regions, an aggregate yield portion allocation based upon different conveyance times selected from a manufacture's database or measured for crops to travel from different transverse portions of the width of the head of the harvester to the aggregate yield sensor and Visual-Infrared Vegetative Index data derived from sensing of plants in selected portions of the electromagnetic spectrum at a time other than harvest; and outputting the aggregate yield portion allocations.

US Pat. No. 10,188,036

SYSTEM FOR EVALUATING AGRICULTURAL MATERIAL

CARNEGIE MELLON UNIVERSIT...

1. A method for evaluating performance of an imaging system, the method comprising:collecting a set of images that relate to agricultural material in a passage;
determining an average image of the set of collected images;
identifying a last image in the set of collected images;
determining a difference between the average image and the last image to yield a differenced image containing candidate pixels;
eliminating background image data from the differenced image to produce an initial image mask of unchanged content in the last image;
determining a mask area of the initial image mask; and
generating an alert data message to inspect the imaging system if the mask area exceeds a threshold area.

US Pat. No. 10,188,034

MATERIAL GUIDE FOR A STRAW HOOD OF AN AGRICULTURAL VEHICLE

CNH Industrial America LL...

11. A residue handling system for an agricultural harvester, comprising:at least one spreader device defining a spreader exit;
a windrow exit;
a straw door selectively positionable between a first position and a second position, said straw door directed toward said spreader exit in said first position and directed toward said windrow exit in said second position; and
a flexible guide associated with said straw door and having a shape that deforms when said straw door switches between said first position and said second position, wherein in said first position said flexible guide is placed in a flow of crop material such that said shape of said flexible guide creates a smooth trajectory path of crop material flow toward said spreader exit.

US Pat. No. 10,188,030

CUTTING MECHANISM FOR WHOLE PLANT HARVESTING

1. A cutting mechanism for the harvesting of whole plants, comprising:a frame, extending transverse to a forward direction;
a plurality of rotatable mowing elements positioned on a front side of the cutting mechanism and distributed over a width of the cutting mechanism, each of the plurality of rotatable mowing elements configured to rotate about a rotational axis and comprising a lower cutting disk configured to cut off crops from the ground and a conveyor rotor located above the lower cutting disk, the conveyor rotor configured to rotate around the rotational axis, coaxial to the cutting disk;
first and second transverse conveyors, located on sides of the cutting mechanism, configured to convey the crops cut off by the mowing elements to a middle of the cutting mechanism; and
a delivery conveyor located in the middle of the cutting mechanism configured to receive crops from the first and second transverse conveyors and convey the crops to a rear delivery opening of the cutting mechanism;
wherein the lower cutting disks of the mowing elements work together with one or more frame-affixed counter-blades and are driven together with the corresponding conveyor rotors by a shaft;
wherein the shafts of the mowing elements are driven by a gear arrangement that extends, on the front side, over the width of the cutting mechanism;
wherein the frame comprises a middle part and first and second lateral parts configured to swivel on the middle part between a horizontal operating position and a raised transporting position; and
wherein the first and second transverse conveyors are wider than the corresponding first and second lateral parts in the horizontal operating position and are within the width of the first and second lateral parts before being raised to the transporting position.

US Pat. No. 10,188,028

PLANTING APPARATUS OF NURSERY TREES AND PLANTING VEHICLE OF NURSERY TREES

1. A planting apparatus of nursery trees comprising:an auger for excavating a planting hole on a ground;
a guide member having a hollow cylindrical tube shape for putting a nursery tree into the excavated planting hole;
a blade member for leveling, covering and pressing soil around the nursery tree which has been put into the excavated planting hole;
a lifting means for moving the auger, the guide member and the blade member up and down in a same vertical axis line direction; and
a rotation means for rotating the auger and the blade member, wherein
the auger, the guide member and the blade member form a nested structure of three layers which are centered upon the auger, and
at least the auger and the blade member are rotation members rotating on the same vertical axis line.

US Pat. No. 10,188,026

AGRICULTURAL METERING SYSTEM HAVING METER ROLLER COVERS

CNH Industrial Canada, Lt...

1. An agricultural metering system, comprising:a plurality of meter boxes;
a plurality of meter rollers, wherein each meter roller of the plurality of meter rollers is disposed in a respective meter box of the plurality of meter boxes;
a corresponding plurality of meter roller covers, wherein each meter roller cover of the plurality of meter roller covers is disposed over at least part of a respective meter roller of the plurality of meter rollers, and each meter roller cover of the plurality of meter roller covers is configured to move relative to the respective meter roller along a longitudinal axis of the respective meter roller to cover a selected portion of the respective meter roller; and
a control bar coupled to the plurality of meter roller covers, wherein the control bar is configured to collectively move the plurality of meter roller covers relative to the plurality of meter rollers along the respective longitudinal axes of the plurality of meter rollers.

US Pat. No. 10,188,025

YIELD MONITOR FOR WINDROW-COLLECTED MATERIALS

Clemson University Resear...

1. A yield monitoring system comprising:a windrow collecting implement having an operating width representing the distance between adjacent windrows;
a first sensor carried by the windrow collecting implement and configured to detect a height of a windrow along a travel path at detection points, the windrow disposed below the windrow collecting implement and the first sensor disposed above the windrow;
a second sensor carried by the windrow collecting implement and configured to detect a distance traveled by the windrow collecting implement;
a moisture sensor carried by the windrow collecting implement;
a GPS carried by the windrow collecting implement providing location data of the windrow and windrow collecting implement; and,
a processor configured to process the height of the windrow from the first sensor, the length traveled by the windrow collecting implement from the second sensor, and the operating width to determine a volume of a material contained in the windrow, configured to process the volume of a material contained in the windrow and moisture data to determine a yield map and configured to process location data and the yield map to determine a yield per unit acre.

US Pat. No. 10,188,024

SYSTEM FOR CONDUCTING AN AGRICULTURAL OPERATION USING AN AUTONOMOUS VEHICLE

CNH Industrial America LL...

1. A method for conducting agricultural operations in an area having a boundary using first and second autonomous vehicles, comprising:(a) providing a mission plans for the first and second autonomous vehicles, the mission plans including paths for the first and second autonomous vehicles to travel within the area to perform agricultural operations by the first and second autonomous vehicles within the boundary;
(b) receiving with a base station, via wireless transmission, progress information from the first and second autonomous vehicles indicating progress with respect to the agricultural operations;
(c) monitoring for an event condition with the base station;
(d) upon receiving an event condition, revising at least one of the mission plans for the first and second autonomous vehicles with the base station without real time user input to optimize performance of the agricultural operation within the area based on current agricultural conditions;
(e) transmitting the at least one revised mission plan without user approval of the revised mission plan from the base station to the first and second autonomous vehicles; and
(f) adjusting the path of at least one of the first and second autonomous vehicles in accordance with the at least one revised mission plan so as to resolve the event condition.

US Pat. No. 10,188,023

IMPLEMENT WITH FOLDABLE TOOLBAR SYSTEM

Unverferth Manufacturing ...

1. An agricultural implement comprising:a frame having a longitudinal axis and laterally opposed sides;
motive supports mounted to and supporting the frame;
a first wing carried by the frame and at least one second wing, each second wing being pivotably connected to the first wing;
an elevator mechanism comprising a first actuator configured to raise and lower the first wing and the second wing; and
a wing pivot assembly comprising a skewed hinge pivotably connecting each second wing to the first wing, wherein the wing pivot assembly is configured to cause each second wing to pivot with respect to the first wing between an operating position extending from the frame in a lateral direction with respect to the longitudinal axis and a transport position alongside one of the opposed sides, and wherein the skewed hinge defines a first pivot axis oriented at an acute angle with respect to the longitudinal axis; and
a pivot bar pivotably connected at a first end to the frame and connected at a second end to the first wing.

US Pat. No. 10,188,021

PATH PLANNING SYSTEM FOR AUTONOMOUS OFF-ROAD VEHICLES

CNH Industrial America LL...

1. A path planning system for off-road vehicles, comprising:a processor configured to:
receive, via a plan requestor and executor system, a plan request;
derive, via a swath and partition generator system, a set of partitions and a set of swaths corresponding to the set of partitions based on the plan request;
generate a partition hierarchy based on the set of partitions and a map of a field;
assign, via a swath connector, costs to potential connections between swaths in the set of swaths; and
derive a first vehicle plan based on the costs to the potential connections between swaths, wherein the first vehicle plan comprises a first path for a first off-road vehicle to operate in the field.
US Pat. No. 10,188,130

EDTA—FREE MAYONNAISE FOR THE PRODUCTION THEREOF

CONOPCO, INC., Englewood...

1. An EDTA-free mayonnaise that comprises:5-85 wt. % of a dispersed oil phase; and
15-95 wt. % of a continuous aqueous phase, wherein the continuous aqueous phase comprises:
reduced grape juice in an amount providing 5-2,000 ?g gallic acid equivalents per milliliter of aqueous phase, said reduced grape juice containing at least 50% by weight of dry matter of monosaccharides selected from glucose, fructose and combinations thereof;
a source of acetic acid in an amount providing 0.2-15% acetic acid by weight of the continuous aqueous phase, said source of acetic acid containing at least 20% acetic acid by weight of dry matter; and
egg protein in an amount of 0.02-4% by weight of the mayonnaise.
US Pat. No. 10,189,926

METHOD FOR PREPARATION OF DERIVATIVES OF POLYVINYLIDENE FLUORIDE

ARKEMA FRANCE, Colombes ...

1. A method for preparing a polymer starting from monomers comprising vinylidene fluoride, trifluoroethylene and a third monomer, the method comprising, successively:injecting all the monomers to be reacted into a reactor;
initiating polymerization of the monomers;
(a) continuing the polymerization of the monomers, during which the pressure in the reactor is kept constant by injecting into the reactor a stream of liquid which is immiscible with the monomers and inert with regard to the polymerization, whereby pressure in the reactor is kept about equal to a reference value of 50-130 bar absolute.
US Pat. No. 10,188,645

METHODS AND COMPOSITIONS FOR AMELIORATING SYMPTOMS OF TERMINATION OF OPIOID PAIN THERAPY

1. A self-tapering dosage package, wherein the dosage package comprises a first dosage of a first formulation and a second dosage of a second formulation for administering after the first dosage,wherein the first formulation comprises a dose of hydroxyzine, a dose of clonidine, and a dose of ondansetron in a single unit dosage,
wherein, the second formulation comprises a tapered dose of hydroxyzine, a tapered dose of clonidine, a tapered dose of ondansetron, and a dose of naltrexone in a single unit dosage, and
wherein the first and second dosages are configured to alleviate or prevent symptoms of the patient's termination of opioid pain therapy.
US Pat. No. 10,188,649

AMINOHETEROARYL BENZAMIDES AS KINASE INHIBITORS

Novartis AG, Basel (CH)

1. A method of treating non-small cell lung cancer comprising administering to a subject in need of such treatment a therapeutically effective amount of 4-(3-amino-6-((1S,3S,4R)-3-fluoro-4-hydroxycyclohexyl)pyrazin-2-yl)-N-((S)-1-(3-bromo-5-fluorophenyl)-2-(methylamino)ethyl)-2-fluorobenzamide, or a pharmaceutically acceptable salt thereof.
US Pat. No. 10,188,650

TREATMENT OF NEUROLOGICAL DISORDERS

THE REGENTS OF THE UNIVER...

1. A method for treating a subject having aberrant and/or dysregulated expression of Dscam, the method comprising administering an effective amount of an Abl tyrosine kinase inhibitor to said subject.
US Pat. No. 10,188,655

LIQUID PHARMACEUTICAL COMPOSITION COMPRISING PEMETREXED

Synthon B.V., Nijmegen (...

1. A liquid pharmaceutical composition suitable for parenteral administration comprising:a. 25-50 mg/ml of pemetrexed diacid;
b. arginine;
c. at least one monothiolic antioxidant;
d. 10-200 mg/ml of propylene glycol, and
e. one or more parenteral solvents,
wherein the preparation thereof is conducted in an atmosphere of inert gas and wherein the amount of arginine as a molar ratio to pemetrexed diacid is at least 2.5:1 (arginine:pemetrexed diacid) and said amount of arginine is sufficient to reach a pH of the composition in the range from 8.3 to 9.1.
US Pat. No. 10,190,193

LEACHING OF MINERALS

GLENCORE TECHNOLOGY PTY L...

1. A method for treating a mineral composition containing iron, arsenic or other Group VA compounds comprising milling the mineral composition to a particle size of P80 of less than 25 ?m and leaching said mineral composition in the presence of lime and/or limestone and a soluble alkali complexing agent in the presence of an oxygen containing gas at a pH in the range of from 3.5 to 6.
US Pat. No. 10,190,201

METHOD OF PRODUCING A COPPER-NICKEL-TIN ALLOY

MATERION CORPORATION, Ma...

1. A method of producing a spinodal copper-nickel-tin alloy, comprising:casting a copper-nickel-tin alloy;
homogenizing the alloy;
hot working the homogenized alloy to obtain a reduction ratio which is a minimum of about 5:1;
solution annealing the hot worked alloy at a temperature of from about 1470° F. to about 1650° F.;
cold working the solution annealed alloy until a reduction of area of from about 15% to about 80% occurs in the alloy; and
spinodally hardening the alloy after the cold working to produce a spinodal alloy;
wherein the copper-nickel-tin alloy consists of:
from about 5 wt % to about 20 wt % nickel;
from about 5 wt % to about 10 wt % tin;
minor additions, wherein the minor additions are selected from at least one of a group consisting of boron, zirconium, iron, niobium, manganese and magnesium, and wherein each of the minor additions is present at a content of no more than about 0.3% wt % in the spinodal alloy;
and
balance copper; and
wherein the alloy has a 0.2% offset yield strength of at least 110 ksi, an impact toughness of at least 12 foot-pounds when measured according to ASTM E23, V notch at room temperature, and an ultimate tensile strength of at least 120 ksi, and a minimum elongation of 20%.
US Pat. No. 10,188,669

MITOCHONDRIA-TARGETED ANTIOXIDANTS FOR TREATMENT OF AGE-RELATED BRAIN DISORDERS

MITOTECH S.A., Luxembour...

1. A method for providing to a mammal a neuroprotective effect against a brain pathology that is mediated by reactive oxygen species originating from mitochondria (mROS), wherein the brain pathology is selected from the group consisting of alcohol intoxication, hyperhomocysteinemia, and brain trauma, the method comprising the step of administering to the mammal an SkQ mitochondria-targeted antioxidant in an amount effective to provide said neuroprotective effect, wherein the SkQ mitochondria-targeted antioxidant is administered either prophylactically to inhibit the course of the pathology or for treatment of the pathology after its onset with the exception that, where the pathology is brain trauma, the SkQ mitochondria-targeted antioxidant is administered only for treatment after onset of the pathology.
US Pat. No. 10,188,673

ANHYDROUS COMPOSITIONS

Novan, Inc., Morrisville...

1. An anhydrous composition consisting essentially of:hydroxypropyl cellulose at a concentration in a range of 0.5% to about 2% by weight of the anhydrous composition,
ethanol or isopropyl alcohol at a concentration in a range of 45% to 90% by weight of the anhydrous composition,
hexylene glycol at a concentration of about 10% by weight of the anhydrous composition,
cyclomethicone at a concentration of about 2.5% by weight of the anhydrous composition, and
a nitric oxide (NO)-releasing compound at a concentration in a range of 0.01% to 40% by weight of the anhydrous composition.
US Pat. No. 10,188,678

COMPOSITION COMPRISING CINNAMALDEHYDE AND ZINC TO IMPROVE SWALLOWING

Nestec S.A., Vevey (CH)

1. A method for treating dysphagia, the method comprising administering to a patient having dysphagia a composition comprising an amount of a combination of cinnamaldehyde and zinc that provokes a swallow reflex in the patient, wherein the composition is a food product having a cinnamaldehyde:zinc ratio of 1:0.5 to 1.0.03 in molarity, and the cinnamaldehyde is present in the food product at a concentration of about 100 pm or less.
US Pat. No. 10,188,681

METHOD FOR INDUCING IMMUNE TOLERANCE USING NON-PROLIFERATIVE POLYMER-MODIFIED ALLOGENEIC LEUKOCYTES

CANADIAN BLOOD SERVICES, ...

1. A method of increasing a ratio of the level of endogenous regulatory T (Treg) cells to the level of endogenous pro-inflammatory T cells in a subject in need thereof for treating or alleviating the symptoms associated with an auto-immune disease afflicting the subject, said method comprising administering to the subject a therapeutic amount of:a first cellular preparation comprising a first leukocyte having a cytoplasmic membrane associated to a low-immunogenic biocompatible polymer, wherein the low-immunogenic biocompatible polymer is covalently associated with the first leukocyte, and wherein the first leukocyte is allogeneic to the subject and is irradiated;wherein the low-immunogenic biocompatible polymer is polyethylene glycol (PEG), or 2-alkyloxazoline (POZ), or hyperbranched polyglycerol (HPG);thereby increasing the ratio of the level of Treg cells to the level of pro-inflammatory T cells in the subject for treating or alleviating the symptoms associated with an auto-immune disease afflicting the subject.
US Pat. No. 10,189,963

ADDITIVES FOR IMPROVING POLYURETHANE FOAM PERFORMANCE

Evonik Degussa GmbH, Ess...

1. A composition comprising: at least one polyol, at least one blowing agent, at least one catalyst, at least one surfactant, and a solution comprising dimethyl sulfoxide and at least one guanidine derivative selected from the group consisting of guanidine hydrochloride salt, guanidine phosphate salts, guanidine sulfate salts, cyano guanidine, 1-acetylguanidine, nitroguanidine, 1-(o-tolyl)-biguanidine, and mixtures thereof.
US Pat. No. 10,188,683

TISSUE ENGINEERING OF LUNG

Yale University, New Hav...

1. A method of making a decellularized tissue, comprising perfusing a natural tissue comprising a capillary network with a decellularization solution, wherein the natural tissue is isolated from a mammal, wherein the decellularization solution comprises a solution hypertonic to cells in the tissue, a zwitterionic detergent, and a chelating agent, and wherein the decellularization solution removes cellular material and retains collagen, capillary structure, and structural integrity of the matrix similar to the natural tissue, further comprising monitoring a perfusion pressure during the perfusing and adjusting the perfusion pressure to maintain a pressure of less than 30 mmHg.
US Pat. No. 10,188,684

METHOD FOR PREVENTING OR TREATING FUNCTIONAL GASTROINTESTINAL DISORDER BY LACTIC ACID BACTERIUM

National Yang-Ming Univer...

1. A method for treating a functional gastrointestinal disorder in a subject in need thereof, comprising administering a composition which comprises an effective amount of a Lactobacillus plantarum subsp. plantarum PS128 as the only active ingredient for treating the functional gastrointestinal disorder, which is deposited under DSMZ Accession No. DSM 28632, and a carrier, wherein the functional gastrointestinal disorder is selected from the group consisting of constipation, and functional dyspepsia.
US Pat. No. 10,189,966

COMPOSITION FOR MANUFACTURING POLYURETHANE FOAM AND MOLDED ARTICLE THEREOF

Hyundai Motor Company, S...

1. A composition for manufacturing a polyurethane foam, comprising:an amount of 100 parts by weight of a polyol composition (A),
an isocyanate composition (B)
wherein the isocyanate composition (B) is obtainable by a step comprising polymerizing 1) an amount of about 1 to 5 parts by weight of polyether polyol (b2) with respect to 100 parts by weight of the polyol composition (A) and 2) an isocyanate composition (b1) that comprises i) an amount of about 15 to 40 parts by weight of methylene diphenyl isocyanate (M-MDI) with respect to 100 parts by weight of the polyol composition (A), and ii) an amount of about 8 to 21 parts by weight of polymethylene diphenyl isocyanate (P-MDI) with respect to 100 parts by weight of the polyol composition (A),
wherein, based on the total weight of polyol composition (A), polyol composition (A) comprises:
an amount of about 85 to 95 wt % of a polyether polyol (a1); and
an amount of 5 to 15 wt % of a mixture (a2?) comprising one or more monomers selected from the group consisting of acrylonitrile and styrene dispersed in a polyether polyol having a weight average molecular weight of 5,000 to 8,000 g/mol and a OH value of 25 to 35 mg KOH/g, and
wherein the polyether polyol (a1) is obtainable by steps comprising polymerizing propylene oxide (PO) and ethylene oxide (EO), and has a weight average molecular weight of about 6,000 to 8,000 g/mol and a OH value of 20 to 30 mg KOH/g.
US Pat. No. 10,188,686

ONCOLYTIC HSV VECTOR

1. A recombinant oncolytic Herpes Simplex Virus (oHSV), comprising:(a) a non-HSV ligand displayed on the surface of the oHSV envelope, which is specific for a molecule present on the surface of a cancer cell;
(b) a plurality of copies of one or more microRNA target sequences inserted into one or more loci of an HSV gene required for HSV replication in normal (non-cancerous) cells;
(c) a deletion of the internal repeat (joint) region in the HSV genome comprising one copy of the ICP0, ICP34.5, LAT, and ICP4 genes and the ICP47 promoter; and
(d) a transgene that encodes a protein or polypeptide that induces patient immune response against cancer.
US Pat. No. 10,189,199

HIGHLY MODIFIED POLYESTERS FOR CONTAINERS

1. A process to form a polyester container from a polyester preform having an opening at the level of a neck, the process comprising utilizing an expansion step carried out with a cavity or a mold, wherein, during said expansion step, an incompressible fluid is injected through the opening of said preform to form said container; characterized in thatthe polyester preform comprises
a crystallizable polyester polymer comprised of acid moieties and glycol moieties, with at least 85% of the total moles of acid moieties being terephthalate derived from terephthalic acid or its dimethyl ester and at least 85% of the total moles of glycol moieties derived from ethylene glycol and with at least 2% of the total moles of acid plus glycol moieties derived from a primary comonomer with the mole percents of the acid plus glycol moieties totaling 100 mole %,
wherein the primary comonomer has functional groups connected by a non-cyclic structure containing more than two carbon atoms, and
wherein the crystallizable polyester has a melting temperature in the range of 235 to 242° C. and a glass transition temperature in the range of 60° C. to 73° C.
US Pat. No. 10,188,688

THERAPY FOR PROMOTING CELL GROWTH

MOLEAC PTE. LTD., Singap...

1. A composition for diminishing the effects of a stroke and/or a neurodegenerative disorder comprising effective amounts of Radix Angelicae (root of Chinese Angelica or Danq Gui), Rhizome of Ligusticum Chuanxionq (Chuan Xiong), Radix Polygalae (root of thinleaf milkwort, Polygala tenuifolia Willd., Polygala sibirica L. or Yuanzhi), and Radix Astragali (root of Membranous Milkvetch or Huang Qi), wherein the Radix Angelicae, Rhizome of Ligusticum Chuanxionq, Radix Polygalae, and Radix Astragali are present in the composition in a ratio of about 1:1:1:5 by weight, respectively.
US Pat. No. 10,192,025

ROTAVIRUS PARTICLES WITH CHIMERIC SURFACE PROTEINS

Novartis AG, Basel (CH)

1. A chimeric protein complex comprising a trimer-forming rotavirus VP7 surface protein linked to a heterologous protein, wherein the rotavirus VP7 surface protein is linked to the heterologous protein non-covalently by a two-part adapter system, wherein the first part of the adapter system comprises a first adapter polypeptide that is fused to the rotavirus VP7 surface protein optionally via a linker sequence, and the second part of the adapter system comprises a second adapter polypeptide that is fused to the heterologous protein optionally via a linker sequence, wherein the first and the second parts of the adapter system form a stable complex with each other, and wherein the chimeric protein complex is capable of recoating and thereby forming a part of an outer layer of double-layered rotavirus particles in vitro.
US Pat. No. 10,188,696

PHARMACEUTICAL COMPOSITIONS

Novartis AG, Basel (CH) ...

1. A capsule for oral administration comprising a pharmaceutical composition comprising:(i) alisporivir in an amount of about 15% to about 20% by weight of the composition,
(ii) water in an amount of about 2% to about 10% by weight of the composition and a carrier medium comprising
(iii) a lipophilic component;
(iv) a surfactant; and
(v) a hydrophilic component comprising ethanol, wherein ethanol is present in an amount of about 10 to about 25% by weight of the composition.
US Pat. No. 10,188,699

CAPCNA PEPTIDE THERAPEUTICS FOR CANCER

1. A method of inducing cell death in a breast cancer cell, a leukemia cell, or a premalignant breast cell, the method comprising administering a therapeutically effective amount of a composition comprising a cancer-specific proliferating cell nuclear antigen (caPCNA) peptide molecule, wherein the caPCNA peptide molecule comprises an amino acid sequence selected from LAIPEQEY (SEQ ID NO: 2), LGIAEQEY (SEQ ID NO: 3), LGIPAQEY (SEQ ID NO: 4), LGIPEQAY (SEQ ID NO: 6), LGIAEAEY (SEQ ID NO: 7), LGIPEAAY (SEQ ID NO: 8), LGIAEQAY (SEQ ID NO: 9), and LGIAEAAY (SEQ ID NO: 10), and wherein the cell has a mutation in a deoxyribonucleic acid (DNA) repair protein.
US Pat. No. 10,188,701

COMPOSITIONS AND METHODS FOR ADJOINING TYPE I AND TYPE II EXTRACELLULAR DOMAINS AS HETEROLOGOUS CHIMERIC PROTEINS

HEAT BIOLOGICS, INC., Du...

1. A heterologous chimeric protein comprising:(a) a first domain comprising a portion of SIRP? (CD172a) that is capable of binding a SIRP? (CD172a) ligand,
(b) a second domain comprising a portion of CD40 ligand (CD40L) that is capable of binding a CD40L receptor, and
(c) a linker linking the first domain and the second domain and comprising a hinge-CH2-CH3 Fc domain.
US Pat. No. 10,188,706

PLASMINOGEN ACTIVATOR MUTANTS AS ANTI-FIBRINOLYTIC AGENTS

1. A method for inhibiting the fibrinolytic activity of tPA (tissue plasminogen activator) and uPA (urokinase plasminogen activator) in a subject suffering from a disorder or condition associated with fibrinolysis, with the proviso that said disorder or condition is not a brain or neural disorder or trauma, the method comprising:administering to said subject a therapeutically effective amount of at least one tPa mutant, said mutant being selected from the group consisting of:
(a) a tPA mutant designated tPASer481Ala comprising the amino acid sequence as denoted by SEQ ID NO. 1, or a derivative thereof comprising the amino acid sequence as denoted by SEQ ID NO. 12; and
(b) a tPA mutant designated tPASer481Ala-DS comprising the amino acid sequence as denoted by SEQ ID NO. 2, or a derivative thereof comprising the amino acid sequence as denoted by SEQ ID NO. 13;
or of a composition comprising the same.
US Pat. No. 10,189,989

POLYESTER MIXTURE INCLUDING POLYETHYLENE 2,5-FURANDICARBOXYLATE

BASF SE, (DE)

6. A polyester mixture comprising:i) from 95 to 99.95% by weight, based on components i and ii, of a polycyclohexylenedimethylene 2,5-furandicarboxylate, and
ii) from 0.05 to 5% by weight, based on components i and ii, of polyethylene 2,5-furandicarboxylate.
US Pat. No. 10,188,708

ENOLASE 1 (ENO1) COMPOSITIONS AND USES THEREOF

Berg LLC, Framingham, MA...

1. A method of decreasing blood glucose in a subject with elevated blood glucose, the method comprising administering to the subject a pharmaceutical composition comprising Enolase 1 (Eno1) or a fragment thereof, thereby decreasing blood glucose in the subject, wherein the Eno1 or a fragment thereof has glycolytic activity and is present in a therapeutically effective amount.
US Pat. No. 10,188,710

REGULATORY T CELL EPITOPE AND HEPATITIS C VIRUS HOMOLOG

Rhode Island Council on P...

1. A pharmaceutical composition comprising an isolated T-cell epitope peptide adapted to repress an immune response and a pharmaceutically acceptable carrier or excipient; said peptide consists of an amino acid sequence of PLLLLLLXLPXRA (SEQ ID NO:5), wherein X is an amino acid and does not have to be the same amino acid in each occurrence in a given sequence.
US Pat. No. 10,188,711

PEPTIDE CONJUGATED PARTICLES

Northwestern University, ...

1. A composition comprising surface functionalized biodegradable particles comprising encapsulated allergen or one or more antigenic epitopes thereof, wherein the particle has a negative zeta potential of about ?100 mV to about ?30 mV.
US Pat. No. 10,188,714

YEAST-MUC1 IMMUNOTHERAPEUTIC COMPOSITIONS AND USES THEREOF

GlobeImmune, Inc., Louis...

1. A method to reduce tumor burden, inhibit tumor growth, and/or increase survival of an individual who has a cancer that expresses MUC1, comprising administering to the individual an immunotherapeutic composition, wherein the immunotherapeutic composition comprises:a) a yeast vehicle;
b) at least one MUC1 antigen expressed by the yeast vehicle, wherein the MUC1 antigen comprises an amino acid sequence that is at least 95% identical to SEQ ID NO:25 or to positions 92-566 of SEQ ID NO:25, and wherein the MUC1 antigen comprises 2, 3, 4, 5, 6, 7, 8, 9, 10 or 11 of the following amino acids L184, Y232, L233, V240, Y241, L242, Y483, V497, L535, F536, and Y551.
US Pat. No. 10,188,717

VACCINES AND COMPOSITIONS AGAINST STREPTOCOCCUS PNEUMONIAE

Genocea Biosciences, Inc....

1. A method for treating a subject suffering from or susceptible to Streptococcus pneumoniae infection, comprising administering an effective amount of a vaccine formulation comprising:(1) a first isolated polypeptide comprising an amino acid sequence at least 95% identical to the amino acid sequence of SEQ ID NO: 265; and
(2) a second isolated polypeptide comprising:
(a) an amino acid sequence at least 95% identical to the amino acid sequence of SEQ ID NO: 10, or
(b) an amino acid sequence at least 95% identical to the amino acid sequence of SEQ ID NO:6.
US Pat. No. 10,189,742

GLASS FIBER, COMPOSITION FOR PRODUCING THE SAME, AND COMPOSITE MATERIAL COMPRISING THE SAME

JUSHI GROUP CO., LTD., T...


wherein
a weight percentage ratio of CaO/MgO is greater than 2 and less than or equal to 2.6; and
a weight percentage ratio SiO2/CaO is 3.3-4.3.
US Pat. No. 10,190,001

IR REFLECTIVE SURFACE TREATMENT

1. A water-based IR reflecting surface treatment composition of the following compounds:a base comprising:
a. 30 to 60% by weight of an acrylic resin;
b. 1 to 10% by weight of an alkyd resin;
c. 0.1 to 2% by weight of a polyolefin;
d. 0.1 to 1% by weight of an ammonium salt, wherein the ammonium salt comprises a carboxylated acrylic polymers;
e. Less than 0.1% by weight of a preservative;
f. Water such that base reaches 100% by weight; and
a paste comprising:
i. metal oxides having-a mean particle size between 0.05 and 5 ?m;
ii. a polymeric binder; and
wherein the water-based IR reflecting surface treatment composition is applied to an exterior surface of a building.
US Pat. No. 10,188,721

RECOMBINANT ADENOVIRUS VECTORED FMDV VACCINES AND USES THEREOF

Merial, Inc., Duluth, GA...

1. A composition or vaccine comprising a recombinant viral vector that, when expressed, expresses a foot and mouth Disease Virus (FMDV) antigen comprising a polypeptide sequence selected from any one of SEQ ID NOS: 2, 4, 6, and 8.
US Pat. No. 10,189,748

HEAT MOLDABLE CERAMIC COMPOSITION

DOW GLOBAL TECHNOLOGIES L...

1. A heat moldable composition comprisingan inorganic material that sets as a result of baking or sintering, and
a hydroxypropyl methylcellulose having a DS of at least 1.4 and a MS of at least 0.6, wherein DS is the degree of substitution of methoxyl groups and MS is the molar substitution of hydroxypropoxyl groups, and a viscosity of up to 80 mPa·s, determined as a 2% by weight solution in water at 20° C.,
wherein the heat moldable composition comprises at least 40 weight percent of the inorganic material and at least 10 weight percent of the hydroxypropyl methylcellulose, and
wherein the composition does not comprise more than 5 weight percent of water, all percentages being based on the total weight of the composition.
US Pat. No. 10,188,724

EFFICIENT MUCOSAL VACCINATION MEDIATED BY THE NEONATAL FC RECEPTOR

University of Maryland, C...

1. A composition comprising a fusion protein comprising an Fc fragment of an immunoglobulin recognized by neonatal receptors (FcRn), wherein the Fc fragment is fused at its amino terminal end to a desired antigen, wherein the Fc fragment comprises the hinge region, a CH2 domain and a CH3 domain of the immunoglobulin, wherein C1q motif has been mutated such that it renders the fragment non-lytic, and wherein there is a linker between the hinge region and the antigen, and wherein the antigen is selected from the group of antigens consisting of antigens from viruses, bacteria, parasites, and fungi, wherein said composition is administered to a mucosal epithelium and induces in said subject the formation of memory lymphocytes specific for said antigen.
US Pat. No. 10,189,750

FERTILIZER COMPOSITIONS COMPRISING A CELLULOSE NUTRIENT COMPONENT AND METHODS FOR USING SAME

1. A kit comprising:a) a cellulose nutrient component;
b) a microbial blend component;
c) a source of nitrogen;
d) a source of phosphorus;
e) exotic micronutrients;
f) binder; and
g) instructions for mixing and pelletizing components a)-f) to produce a pelletized fertilizer composition.
US Pat. No. 10,189,756

ADIABATIC PLUG FLOW REACTORS AND PROCESSES INCORPORATING THE SAME

BLUE CUBE IP LLC, Clayto...

1. A process for producing a chlorinated and/or fluorinated propene, having the formula CH2-c-gClcFg=CH1-d-hCldFh-CH3-e-fCleFf wherein c is 0-2, d is 0-1, e is 0-3, f is 0-3, g is 0-2 and h is 0-1, while c+g?2, d+h?1, and e+f?3 which process comprises providing a feed comprising methanes, chloromethanes, fluoromethanes, or chlorofluoromethanes, having the formula CH4-a-bClaFb, wherein each a and b are independently 0-3 and 4-a-b is greater than 0, and a chloroethylene or chlorofluoroethylene in an adiabatic plug flow reactor wherein the reactor is operably disposed relative to a mixer having a diameter and shape that are the same as those of the reactor, the reactants flow through the mixer, and the reactor further comprises a collector having the same shape and/or diameter as the reactor; wherein a turbulence flow region exists within at least a portion of the reactor having a Reynolds number (Re) of at least 2100, wherein the adiabatic plug flow reactor further comprises at least one of i) an insulation material, ii) a temperature controller for the reactor effluent; or iii) one or more temperature and flow controllers for one or more reactants, initiator(s) and/or diluents; wherein the reactor provides reduced backmixing and/or recirculation prior to entry into, or upon exit from, the reactor.
US Pat. No. 10,188,988

CLAUS UNIT TREATMENT OF SHUTDOWN TAIL GAS

EXXONMOBIL RESEARCH AND E...

1. A method for regenerating a Claus unit in a sulfur removal complex comprising a plurality of Claus units and a smaller number of tail gas treating units (TGTUs), the method comprising the steps of:(a) switching a feed to a regenerating Claus unit's reaction furnace to natural gas;
(b) combusting the natural gas in the reaction furnace using an approximately stoichiometric amount of oxygen;
(c) sending tail gas from the regenerating Claus unit to an in-service TGTU;
(d) once liquid sulfur is no longer produced from the regenerating Claus unit in step (b), sending the tail gas to an in-service Claus unit's reaction furnace; and
(e) adding excess oxygen to the regenerating Claus unit's reaction furnace.
US Pat. No. 10,191,038

IMMUNOLOGICAL MEASURING METHOD AND MEASURING KIT FOR WHOLE BLOOD SAMPLE

LSI MEDIENCE CORPORATION,...

1. A method of measuring a target substance, comprising:providing a sample suspected of containing the target substance, or a solution derived from the sample, a first reaction solution, and a second reaction solution;
aspirating the sample or the solution derived therefrom, and the first reaction solution, using a measuring apparatus equipped with a dispensing unit, sequentially in this order into the dispensing unit;
discharging the sample or the solution derived therefrom, and the first reaction solution at the same time from the dispensing unit, to bring the sample or the solution derived therefrom, and the first reaction solution into contact with the second reaction solution, and to form a complex of the target substance, a first partner which is contained in the first reaction solution and reacts specifically with the target substance, and a second partner which is contained in the second reaction solution and reacts specifically with the target substance; and
analyzing the complex, or a signal derived from the complex, wherein
the specific gravity of the first reaction solution is higher than the specific gravity of the sample or the solution derived therefrom;
the sample or the solution derived therefrom and the first reaction solution are aspirated into the dispensing unit in an overlaid state; and
the first partner, which is contained in the first reaction solution and reacts specifically with the target substance, is labeled with a labeling substance, and the second partner, which is contained in the second reaction solution and reacts specifically with the target substance, is immobilized on a solid-phase carrier selected from the group consisting of beads, magnetic particles, and latex particles.
US Pat. No. 10,188,733

VACCINES COMPRISING BISPHOSPHONATE AND METHODS OF USE THEREOF

President and Fellows of ...

1. A method for stimulating an immune response to at least one viral immunogen in a human subject, comprisingadministering to the subject a single dose of about 0.001 mg to about 5.0 mg of a bisphosphonate to stimulate an immune response to the at least one viral immunogen in the subject,
wherein the bisphosphonate is free bisphosphonate and is not provided as a component of a particle delivery system, and
wherein the at least one viral immunogen and the bisphosphonate contact a population of naïve B cells in the subject and directly stimulate B cells to produce a neutralizing antibody specific to the at least one viral immunogen,
thereby stimulating an immune response to the at least one viral immunogen in the subject.
US Pat. No. 10,191,039

HUMAN FACTOR XIII AS A NORMALIZATION CONTROL FOR IMMUNOASSAYS

Bio-Rad Laboratories, Inc...

1. A kit for correcting for variations in sample processing and/or biological matrix effects when performing biological assays, said kit comprising human blood coagulation Factor XIII (hFXIII) immobilized on a solid support, anda plurality of solid supports having binding members immobilize thereon that bind an analyte in a sample, wherein the plurality of solid supports are divided into subpopulations that are differentiable from each other by a differentiation parameter comprising a characteristic that is independent of the binding members immobilized on the solid supports, and the binding members immobilized on each subpopulation are capable of binding to one analyte in the sample,
wherein the solid support and/or the plurality of solid supports is selected from the wall or floor of an assay vessel, a dipstick, particles inside or suspended in an assay vessel, a bead, a magnetic bead, or a microparticle formed of a polymeric material.
US Pat. No. 10,188,734

REDUCED FOAMING VACCINE COMPOSITIONS

MERIAL, INC., Duluth, GA...

1. A stable vaccine composition comprising:i) at least one anhydrous antigenic component comprising a stabilizer susceptible to foaming when the composition is mixed with liquid diluent; and
ii) an effective amount of a foam controlling agent which is a sugar alcohol, and
iii) an effervescent agent,wherein:the effective amount of sugar alcohol is about 25% to 40% by weight of the composition,
the antigenic component is newcastle disease virus, infectious bronchitis virus, fowl pox virus, avian encephalomyelitis virus, marek's disease virus, trichophyton verrucosum, avian paramyxovirus, mycobacterium paratuberculosis, meleagrid herpesvirus, orf virus, or sheep pox virus, and
upon dissolution of the composition, the effervescent agent reacts and gas is formed in situ.
US Pat. No. 10,190,016

TWO-COMPONENT PAINT COMPOSITION AND MULTILAYER COATING FORMATION METHOD USING THIS

BASF Coatings GmbH, Muen...

1. A two-component paint composition, comprising (A) a base resin and (B) a curing agent,wherein,
the base resin (A) comprises a hydroxy group-containing acrylic resin (A-1) and a curing catalyst (A-2);
the curing agent (B) comprises an isocyanate compound (B-1) and an alkoxysilyl group-containing copolymer (B-2);
the hydroxy group-containing acrylic resin (A-1) has a hydroxyl value of 80 to 180 mg KOH/g, a glass transition temperature of ?40 to 40° C. and a weight average molecular weight of 2,000 to 20,000 g/mol; and
the alkoxysilyl group-containing copolymer (B-2) is a copolymer obtained by copolymerizing 30 to 80 parts by weight of a vinylic monomer comprising alkoxy-silyl groups and 20 to 70 parts by weight of other copolymerizable monomers, its weight average molecular weight is 2,000 to 20,000 g/mol, and it does not contain hydroxy groups, carboxyl groups amino groups which react with isocyanate groups.
US Pat. No. 10,191,040

METHOD OF MULTIPLEX IMMUNOASSAYS UTILIZING DIFFERENTIAL AFFINITY AND METHODS FOR SYNTHESIZING APTAMER-BASED REAGENTS FOR MULTIPLEX IMMUNOASSAYS

1. A method of selecting aptamers, wherein each selected aptamer can bind to a plurality of different target analytes (i), comprising:a) providing a library of oligonucleotides with random nucleotide sequences denoted a random sequence library and heating and quenching the random sequence library to incude the formation of the secondary structure;
b) preparing a plurality of magnetic particles conjugated with negative samples (j) (NS-MPs(j)), wherein the magnetic particles (MPs) are nanoparticles (MNPs) or microparticles (MMPs), and wherein j is a variable integer with a value from 1 to J and each type of J types of negative samples (j) is a different type of negative sample from the others;
c) incubating the random sequence library, from step a) if j equals one or from step d) of the preceding round if j is greater than one, with the NS-MPs(j) in a first binding buffer, wherein the random sequence library is incubated with each different NS-MPs(j) one by one, or the random sequence library is incubated with all of the different NS-MPs(j) in one batch, to allow oligonucleotides to bind to the NS-MPs(j);
d) removing oligonucleotides bound to the NS-MPs(j) by performing a first magnetic separation using a magnetic stand and collecting a supernatant containing oligonucleotides not bound to the NS-MPs(j) for step e) if j equals J or as a random sequence library for step c) of a following round if j is less than J, wherein the process steps c) and d) are performed J times if in step c) the random sequence library is incubated with the different NS-MPs(j) one by one and j increases with an increment of one for a following round during repetition or if in step c) the random sequence library is incubated with all of the different NS-MPs(j) in one batch, the process steps c) and d) are performed once;
e) preparing a plurality of magnetic particles conjugated with target analytes (i) (PS-MPs(i) and incubating the supernatant containing oligonucleotides, from step d) if i equals one or from step i) of the preceding round if i is greater than one, with the PS-MPs(i) to form a bound mixture containing oligonucleotides bound to PS-MPs(i), wherein the magnetic particles (MPs) are MNPs or MMPs and i is a variable integer with a value from 1 to I;
f) collecting the bound mixture containing oligonucleotides bound to the PS-MPs(i) by performing a second magnetic separation using the magnetic stand, removing a supernatant containing oligonucleotides not bound to the PS-MPs(i), and redispersing the collected bound mixture containing oligonucleotides bound to the PS-MPs(i) in a second binding buffer;
g) subjecting the redispersed bound mixture obtained in step f) to a window-MARAS in a first oscillating magnetic field with a lower-bound frequency fiL and/or a lower-bound strength HiL to detach oligonucleotides with a first binding affinity toward the PS-MPs(i) from the PS-MPs(i), and then removing a supernatant containing the oligonucleotides detached from the PS-MPs(i) and collecting the remaining bound mixture containing oligonucleotides bound to the PS-MPs(i) by performing a third magnetic separation using the magnetic stand;
h) redispersing the collected bound mixture obtained in step g) in a third binding buffer;
i) subjecting the redispersed bound mixture obtained in step h) to a window-MARAS at a second oscillating magnetic field with an upper-bound frequency fiU and/or an upper bound strength HiU to detach oligonucleotides with a second binding affinity toward the PS-MPs(i) from the PS-MPs(i), and then collecting a supernatant containing the oligonucleotides with the second binding affinity toward the PS-MPs(i) for step j) if i equals I or for step e) of a following round if i is less than I and removing oligonucleotides bound to the PS-MPs(i) with a third binding affinity toward the PS-MPs(i) by performing a fourth magnetic separation using the magnetic stand,
wherein the process steps e)-i) are repeated as one round for I times or the process steps e)-i) are repeated as one round for (I-1) times and followed by performing the process steps e)-h) once, eluting the oligonucleotides having a binding affinity toward the PS-MPs(i) stronger than the first binding affinity toward the PS-MPs(i) out of the PS-MPs(i), collecting a supernatant containing the oligonucleotides having a binding affinity toward the PS-MPs(i) stronger than the first binding affinity toward the PS-MPs(i) for step j) by performing a fifth magnetic separation using the magnetic stand, wherein the second binding affinity is stronger than the first binding affinity and the third binding affinity is stronger than the second binding affinity, and wherein fiL j) obtaining oligonucleotides capable of conjugating with PS-MPs(i) that are aptamers that can bind to I types of different target analytes (i).
US Pat. No. 10,188,738

FORMULATIONS USEFUL IN THE TREATMENT OF PROLIFERATIVE DISEASES AFFECTING THE RESPIRATORY TRACT

1. A dry powder pharmaceutical formulation configured for administration by inhalation, comprising microparticles formed by at least one carrier and, embedded in the microparticles, nanoparticles comprising at least one antineoplastic agent and at least one folate receptor (FR)-targeting compound, wherein the at least one carrier comprises mannitol or dextran or mannitol and leucine, and wherein the at least one carrier is configured to allow for reconstitution of the nanoparticles when the microparticles are dissolved or dispersed in an aqueous medium.
US Pat. No. 10,188,227

VASE ARTICLE WITH IMITATIVE CERAMIC EFFECT

1. An imitation ceramic vase, being manufactured by a method comprising the steps of:(1) applying a primer layer material on a vase made by a non-ceramic material, and letting said primer layer material on said vase to dry;
(2) applying at least one layer of first middle layer material on said primer layer material on said non-ceramic material vase, said middle layer material being applied on at least a portion of said vase;
(3) applying at least a layer of second middle layer material on said first middle layer material, and letting said second middle layer material to dry, said second middle layer material having a color which is different from that of said first middle later material, and
(4) applying a surface layer material on at least one of said first middle layer material and said second middle layer material, and allowing said surface layer material to dry, said surface layer material being a polyurethane imitating porcelain surface coating or an ultraviolet imitating porcelain surface coating to form an imitation ceramic vase having an imitation ceramic effect,
wherein said vase in said step (1) is made of plastic material.
US Pat. No. 10,188,741

TARGETING OF INNATE IMMUNE RESPONSE TO TUMOR SITE

GAVISH-GALILEE BIO APPLIC...

1. A method of treatment of tumors, comprising administering to a patient in need microparticles or nanoparticles comprising:(i) a targeting agent to the tumor or the tumor environment, optionally biotinylated, wherein said targeting agent is an agent that recognizes and binds to an antigen, a receptor or other molecules found on the surface of tumor cells or in the tumor cells;
(ii) two or more inducers, optionally biotinylated, that stimulate an innate immune response in the tumor environment, leading to tumor apoptosis, selected from the group consisting of mannose, mannan, lipopolysaccharide (LPS), a Toll-like Receptor (TLR) ligand, N-formyl-methionyl-leucyl-phenylalanine (fMLF or fMLP), Complement 3a (C3a), Complement 5a (C5a), and a C, CC, CXC or CX3C chemokine,
wherein components (i) and (ii) are non-covalently or covalently attached to the surface of said microparticles or nanoparticles.
US Pat. No. 10,189,768

PROCESS FOR HYDROGENOLYSIS OF ALPHA-HYDROXY ESTERS OR ACIDS USING A HETEROGENEOUS CATALYST

Danmarks Tekniske Univers...

1. A method for hydrogenolysis of alpha-hydroxy esters or acids, comprising:reacting the alpha-hydroxy ester or acid in the presence of a solid catalyst and a catalyst support,
wherein the catalyst comprises at least two different metals that are Cr, Mn, Fe, Co, Ni, Cu, Zn, Mo, Ru, Rh, Pd, Ag, Cd, W, Re, Os, Ir, Pt, Au, or Hg, or a combination thereof, and
wherein the catalyst support is a porous solid material with the proviso that if the porous solid material consists of one metal oxide, the metal oxide is not SiO2.
US Pat. No. 10,191,051

COMPOSITIONS AND METHODS FOR IMPROVED CELL-BASED BOTULINUM NEUROTOXIN ASSAYS

BIOMADISON, INC., Del Ma...

1. A method of increasing the sensitivity of cell-based detection of a botulinum toxin, comprising:(i) providing, in a first media having a sodium concentration greater than 65 mM, a transfected cell that produces a construct comprising;
(a) a terminus comprising a reporter-containing portion, wherein the reporter-containing portion exhibits a signal; and,
(b) a cleavage site that interacts with the botulinum toxin in a manner that produces a cleavage of the reporter-containing portion from a remainder of the construct;
(ii) transferring the transfected cell to a second media having a sodium concentration of less than 50 mM;
(iii) contacting the transfected cell with the botulinum toxin; and
(iv) obtaining the signal from the reporter-containing portion.
US Pat. No. 10,188,751

PAPILLOMAVIRUS PSEUDOVIRUSES FOR DETECTION AND THERAPY OF TUMORS

The United States of Amer...

1. A method comprising administering to cancer cells in a subject, a papilloma pseudovirus that comprises a fluorescent dye or a papilloma virus-like particle (VLP) that comprises a fluorescent dye, and exposing the fluorescent dye in the cancer cells in the subject to an excitation wavelength of light.
US Pat. No. 10,191,059

IN VITRO METHOD FOR THE PROGNOSIS OF PROGRESSION OF A CANCER AND OF THE OUTCOME IN A PATIENT AND MEANS FOR PERFORMING SAID METHOD

Institut National de la S...

1. A method for treating a patient suffering from a solid cancer comprising the steps of:(i) evaluating the intra-tumor adaptive immune status of said patient before administration of an anti-cancer agent by quantifying, in a pre-administration tumor sample, at least two biological markers indicative of the status of the adaptive immune response of said patient against cancer, wherein two of said at least two biological markers are PDCD1LG1 combined with CD8A,
(ii) administering an anti-cancer agent to the patient,
(iii) evaluating the intra-tumor adaptive immune status of said patient after administration of said anti-cancer agent by quantifying in a post-administration tumor sample said at least two biological markers indicative of the status of the adaptive immune response of said patient against cancer,
(iv) comparing the levels of said at least two biological markers quantified in steps (i) with the levels of said at least two biological markers quantified in step (iii),
(v) administering to the patient:
a PDCD1LG1 inhibitor and/or a PDCD1 inhibitor to the patient when the level of PDCD1LG1 has increased between steps (i) and (iii); and/or
an immuno-stimulatory agent when the level of CD8A has not increased between step (i) and step (iii).
US Pat. No. 10,188,755

MAGNETIC MICROSTRUCTURES FOR MAGNETIC RESONANCE IMAGING

The United States of Amer...

1. A magnetic resonance contrast agent comprising one or a plurality of contrast structures, wherein each contrast structure consists of a single wall consisting of a magnetic material arranged as a substantially cylindrical magnetic structure with a length-to-diameter ratio between 0.8 and 1.6, wherein each contrast structure has a maximum dimension between about 10 nm and about 100 ?m, wherein each contrast structure defines an axially extending hollow region therethrough, and wherein the hollow region encompasses a spatially extended region contained within a near-field region of the contrast structure over which the structure on its own or in conjunction within an applied magnetic field results in a substantially homogeneous field, such that nuclear magnetic moments of a second material when arranged within said spatially extended region precess at a characteristic Larmor frequency, whereby the magnetic resonance contrast agent, combined with the second material, induces a characteristic magnetic resonance signal of the magnetic material.
US Pat. No. 10,191,064

THYROGLOBULIN QUANTITATION BY MASS SPECTROSCOPY

Quest Diagnostics Investm...

1. A method for determining the amount of thyroglobulin in a test sample, comprising:(a) adding a thyroglobulin peptide standard in said test sample containing thyroglobulin peptides, wherein one or more valine of the thyroglobulin peptide standard is isotopically labeled with 13C, 15N;
(b) enriching said thyroglobulin peptides and thyroglobulin peptide standard from step (a);
(c) ionizing said thyroglobulin peptides and thyroglobulin peptide standard from step (b) to produce one or more thyroglobulin peptide ions and thyroglobulin peptide standard ions detectable by mass spectrometry; and
(d) detecting the amount of the ion(s) from step (c) by mass spectrometry; wherein the amount of the ion(s) detected in step (c) is related to the amount of thyroglobulin in said test sample and the amount of thyroglobulin peptide standard.
US Pat. No. 10,193,117

SEPARATOR FOR NONAQUEOUS SECONDARY BATTERY, AND NONAQUEOUS SECONDARY BATTERY

TEIJIN LIMITED, Osaka (J...

1. A separator for a nonaqueous secondary battery, comprising a porous substrate and an adhesive porous layer that is formed on at least one side of the porous substrate and contains a polyvinylidene-fluoride-based resin,the separator for a nonaqueous secondary battery being characterized in that the adhesive porous layer has a crystal size of 1 nm or more and 13 nm or less.
US Pat. No. 10,191,069

ACCURATE ASSAY MEASUREMENT OF HYDROPHOBIC HAPTENIC ANALYTES

Siemens Healthcare Diagno...

1. A method of determining an actual concentration of a hydrophobic haptenic analyte in an unknown sample suspected of containing the hydrophobic haptenic analyte, wherein the unknown sample is suspected of containing an interfering substance, the method comprising:(a) conducting a first assay method on an unknown sample to obtain a measured concentration of the hydrophobic haptenic analyte in the unknown sample and conducting a second assay method on the unknown sample to obtain a concentration of the interfering substance in the unknown sample, wherein the hydrophobic haptenic analyte is selected from the group consisting of fat-soluble vitamins, steroid hormones, therapeutic drugs, and drugs of abuse, and wherein the interfering substance is lipoproteins; and
(b) applying a predetermined correction formula that utilizes the measured concentration of the hydrophobic haptenic analyte and the measured concentration of the interfering substance obtained in step (a) to determine an actual concentration of the hydrophobic haptenic analyte in the unknown sample, wherein the correction formula is predetermined by a method that comprises:
(i) measuring a concentration of the hydrophobic haptenic analyte for at least two different samples using the first assay method and measuring the concentration of the hydrophobic haptenic analyte for the at least two different samples using a reference method wherein the samples also comprise the interfering substance,
(ii) determining a bias between the first assay method and the reference method wherein the bias is the difference between the concentration of the hydrophobic haptenic analyte determined by the reference method and the first assay method for each different sample;
(iii) measuring a concentration of the interfering substance for the at least two different samples; and
(iv) determining the correction formula by conducting a regression analysis using the bias and the concentration of the interfering substance for each of the at least two different samples,wherein the regression analysis comprises forming a regression line and using the slope and intercept of the regression line to form the following correction formula:[An]=[mAn]+(a×[mIS]+b)wherein:[An] is the actual concentration of the hydrophobic haptenic analyte in the unknown sample,
[mAn] is the measured concentration of the hydrophobic haptenic analyte in the unknown sample,
[mIS] is the measured concentration of the interfering substance in the unknown sample,
a is the slope of the regression line, and
b is the intercept of the regression line; wherein the first assay method is an immunoassay method and wherein the reference method directly measures a character specific to the analyte and is different from the first assay method.
US Pat. No. 10,191,326

FILM FOR BACKLIGHT UNIT AND BACKLIGHT UNIT AND LIQUID CRYSTAL DISPLAY INCLUDING SAME

SAMSUNG ELECTRONICS CO., ...

1. A semiconductor nanocrystal-polymer composite, comprisinga semiconductor nanocrystal and a matrix polymer in which the semiconductor nanocrystal is dispersed,
wherein the matrix polymer comprises a polymerization product of a multifunctional photo-curable oligomer, a mono-functional photo-curable monomer, and a multifunctional photo-curable cross-linking agent,
a content by weight (A1) of a first structural unit derived from the multifunctional photo-curable oligomer, a content by weight (A2) of a second structural unit derived from the mono-functional photo-curable monomer, and a content by weight (A3) of a third structural unit derived from the multifunctional photo-curable cross-linking agent satisfy Equation 1:
A1<(A2+A3).  Equation 1
US Pat. No. 10,188,772

DRUG DELIVERY MEDICAL DEVICE

Micell Technologies, Inc....

1. A medical device comprising:a balloon; and
a coating on at least a portion of the balloon,
wherein the coating comprises smooth and spherical particles having rapamycin particles encapsulated in a first polymer material prior to inclusion in the coating, the particles being from about 0.5 ?m to about 10 ?m in size and the first polymer being PLGA, and
wherein each particle is at least partially encapsulated in a second polymer material in the coating.
US Pat. No. 10,188,773

COMPOSITIONS AND DEVICES OF POLY-4-HYDROXYBUTYRATE

Tepha, Inc., Lexington, ...

1. A composition comprising a polyhydroxyalkanoate (PHA) polymer obtained by a process comprising: suspending a PHA polymer biomass in ethanol for a period of time effective to extract lipids into the ethanol, separating the PHA polymer biomass from the ethanol by solid-liquid separation, collecting the ethanol-washed biomass, and extracting the PHA polymer into a solvent.
US Pat. No. 10,188,783

METHOD FOR EXTRACORPOREAL REMOVAL OF PATHOGENIC MICROBE, AN INFLAMMATORY CELL OR AN INFLAMMATORY PROTEIN FROM BLOOD

ExThera Medical Corporati...

1. A method for extracorporeal removal of a virus from a subject, said method comprising:a) contacting said subject's whole blood with heparin immobilized on a solid substrate, said heparin having a terminal residue, wherein heparin immobilization consists of a single covalent link of said terminal residue to said solid substrate by covalent end-point attachment, under conditions allowing binding of said virus in said subject's whole blood sample to the heparin;
b) separating the whole blood from the solid substrate;
c) recovering said whole blood containing a reduced amount of said virus; and
d) reintroducing into said subject said whole blood containing a reduced amount of said virus.
US Pat. No. 10,190,084

METHOD OF CULTURING EUKARYOTIC CELLS

Genentech, Inc., South S...

1. A method for culturing Chinese hamster ovary (CHO) cells comprising:(i) providing cell culture inoculant comprising CHO cells in about 6 L of a bicarbonate-containing culture liquid to a vessel to achieve a target cell density of about 7.5×105 CHO cells/mL, wherein said vessel has a volume of about 50 L and has walls that encapsulate said cell culture and a gas phase head space above said cell culture, and wherein said vessel comprises at least one port that provides an entrance and an egress of gas to and from said head space;
(ii) providing gas to said head space through said port, wherein said gas contains CO2 in an amount of 8% (v/v) of said gas on day 1, in an amount of 5% (v/v) of said gas on day 2, and in an amount of 2% (v/v) of said gas thereafter, thereby modulating the pH of said cell culture to maintain the pH of the culture between pH 6.8 and 7.2;
(iii) providing fresh culture medium to said vessel to achieve a volume of about 20 L;
(iv) providing gas to said head space through said port, wherein said gas contains CO2 in an amount of 8% (v/v) of said gas on day 1, in an amount of 5% (v/v) of said gas on day 2, and in an amount of 2% (v/v) of said gas thereafter, thereby modulating the pH of said cell culture to maintain the pH of the culture between pH 6.8 and 7.2;
(v) perfusing fresh culture medium into said vessel and removing spent culture medium from said vessel at a perfusion rate of about 1 volume per day; and
(vi) providing gas to said head space through said port to sweep accumulated CO2 from the head space of the vessel, wherein said gas contains O2 in an amount of 30% (v/v) of said gas 48 hours after the start of perfusion, thereby maintaining dissolved O2 to a level greater than 20% of air saturation,
wherein the fresh culture medium has a pH of 7.2, the clearance rate of the head space is between 0.002 and 0.1 head space volume per minute (hvm), the vessel is agitated by rocking the vessel at a rock rate between 15 and 30 rocks per minute (rpm) at a rock angle of between 5° and 15°, and wherein the method does not require monitoring and feedback control of pH and dissolved O2.
US Pat. No. 10,190,099

IBV STRAINS AND USES THEREOF

BIOMUNE COMPANY, Lenexa,...

1. A method for protecting or vaccinating poultry against infectious bronchitis virus, comprising orally administering to said poultry an attenuated infectious bronchitis virus (IBV), wherein said attenuated IBV comprises a S1 gene having a nucleotide sequence with at least 98% identity to SEQ ID NO: 1, and wherein said attenuated IBV is formulated in gel drops.
US Pat. No. 10,190,100

CHEMICAL MODIFICATION OF GLUCOSE OXIDASE AND ITS APPLICATION TO BIOSENSORS

Verily Life Sciences LLC,...

1. A modified glucose oxidase comprising a glucose oxidase wherein at least one amino group is substituted with a methacrylate through a hydrophilic linker comprising at least one ethylene or propylene oxide unit.
US Pat. No. 10,188,057

SOYBEAN CULTIVAR CL1462431

Syngenta Participations A...

1. A plant, a plant part, or a seed of soybean variety CL1462431, wherein a representative sample of seed of said soybean variety CL1462431 has been deposited under ATCC Accession Number PTA-123834.
US Pat. No. 10,190,108

METHOD FOR REDUCING VISCOSITY IN SACCHARIFICATION PROCESS

DANISCO US INC., Palo Al...

1. A biomass saccharification mixture comprising:a. a pretreated biomass material; and
b. a non-naturally occurring enzyme composition comprising a glycosyl hydrolase family 61 (“GH61”) polypeptide having GH61/endoglucanase activity, wherein the GH61 polypeptide
i) has at least 65% in sequence identity to residues 22-344 of SEQ ID NO:27; or
ii) is encoded by a polynucleotide sequence or a complement thereof that has at least 65% sequence identity to SEQ ID NO:30; or
iii) is encoded by a polynucleotide sequence that hybridizes under high stringency conditions to a sequence that is complementary to SEQ ID NO:30;
wherein the enzyme composition is a whole cellulase comprising at least one polypeptide having cellobiohydrolase activity, at least one polypeptide having endoglucanase activity that is different from the GH61 polypeptide, and at least one polypeptide having beta-glucosidase activity and wherein the whole cellulase is derived from a host cell containing a heterologous expression cassette comprising a nucleic acid encoding the GH61 polypeptide, wherein the GH61 polypeptide is present in the whole cellulase in an amount of at least 6 wt % and no more than 50 wt % based on the total weight of protein in the whole cellulase and wherein said biomass saccharification mixture has a lower viscosity than a biomass saccharification mixture without the GH61 polypeptide and/or is capable of increasing the level of saccharification in the mixture as compared to the level of saccharification in a mixture having no or a lower level of GH-61 polypeptide.
US Pat. No. 10,193,188

AQUEOUS ELECTROLYTE WITH ETHERS AND BATTERIES USING THE ELECTROLYTE

5. A lithium ion battery comprising:an anode capable of intercalation and de-intercalation of lithium ions;
a cathode comprising an active material selected from the group consisting of LiMn2O4, LiCoO2, LiFe(PO4), LiMn1/3Ni1/3Co1/3O2, LiNi0.5Mn1.5O4 and LiCoPO4; and
an aqueous electrolyte in contact with the anode and cathode which comprises:
water;
at least one of a linear ether and a cyclic ether; and
a lithium salt of an anion comprising a fluoroalkylsulfonyl group of formula (I):
R—SO2-  (I)
wherein R is a perfluoroalkyl group of 1-5 carbons, and
wherein relative mole ratios of ether (Y) and water (Z) to Li-salt of formula satisfy the following formulas:
Y/X is from 1/10 to 50/1; and
Z/X is from 1/10 to 5/1.
US Pat. No. 10,190,116

MODULATION OF EXON RECOGNITION IN PRE-MRNA BY INTERFERING WITH THE SECONDARY RNA STRUCTURE

ACADEMISCH ZIEKENHUIS LEI...

1. A method for inducing the skipping of exon 51 of the human dystrophin pre-mRNA in a patient or cell derived from the patient, said method comprising providing to said patient or said cell, an oligonucleotide of 15 to 24 nucleotides in length comprising at least 15 consecutive bases of a base sequence of the sequence UCAAGGAAGAUGGCAUUUCU (SEQ ID NO: 27), wherein said oligonucleotide induces exon 51 skipping in the human dystrophin pre-mRNA in the patient or a cell derived from the patient.
US Pat. No. 10,189,606

DRINKING OR EATING VESSEL

AT Promotions LTD, Kings...

1. A drinking or eating vessel comprising an inner surface that defines a volume for receiving liquid or solid food and an outer surface that supports a polymeric coating and a decorative layer,wherein the polymeric coating comprises a polymer formed by curing a coating mixture on the outer surface of the drinking or eating vessel, said coating mixture comprising a matting agent,
the polymeric coating has an inner surface in contact with the drinking or eating vessel and an outer surface in contact with the decorative layer, and
the decorative layer comprises a dry toner image applied to the outer surface of the polymeric coating.
US Pat. No. 10,188,069

SOYBEAN CULTIVAR CL1460745

Syngenta Participations A...

1. A plant, a plant part, or a seed of soybean variety CL1460745, wherein a representative sample of seed of said soybean variety CL1460745 has been deposited under ATCC Accession Number PTA-123857.
US Pat. No. 10,190,125

HAPLOID INDUCTION COMPOSITIONS AND METHODS FOR USE THEREFOR

Syngenta Participations A...

1. A method of creating a new haploid inducer maize plant with a silenced patatin-like phospholipase 2A, comprising transcribing a polynucleotide sequence that silences the patatin-like phospholipase 2A in maize, wherein said polynucleotide sequence comprises a first sequence selected from the group consisting of:a) a polynucleotide sequence comprising the nucleic acid sequence set forth in SEQ ID NO: 33 or the complement thereof;
b) a functional fragment comprising at least 22 contiguous bases of SEQ ID NO: 33 or the complement thereof; and
c) a polynucleotide sequence having at least 95% sequence identity as determined using the BLASTN alignment tool to the nucleic acid sequence set forth in SEQ ID NO: 33 or the complement thereof,and a second sequence that is the complement of the first sequence, wherein the polynucleotide sequence expresses a double-stranded ribonucleotide sequence which silences the patatin-like phospholipase 2A when contacted with a maize plant and thus creates a new haploid inducer maize plant.
US Pat. No. 10,190,126

TRANSGENIC PLANTS WITH MODIFIED SUGAR CONTENT AND METHODS OF GENERATING SAME

A.B. Seeds Ltd., (IL)

1. A method of increasing the sucrose level or increasing the sucrose to glucose ratio in a tomato plant comprising expressing in said tomato planta DNA encoding a miR397-, miR528-, or miR1110-resistant target gene, wherein said miR397-, miR528-, or miR1110-resistant target gene comprises an introduced silent mutation in a nucleotide sequence that is otherwise substantially identical to the nucleotide sequence of an endogenous gene that is natively regulated by miR397, miR528, or miR1110, and wherein said silent mutation prevents binding by a mature miR397, miR528, or miR1110 to a transcript of said miR397-, miR528-, or miR1110-resistant target gene,
wherein the sucrose level or the sucrose-to-glucose ratio is increased in said tomato plant.
US Pat. No. 10,190,127

METHODS AND MEANS FOR OBTAINING MODIFIED PHENOTYPES

COMMONWEALTH SCIENTIFIC A...

1. A process for producing an unpolyadenylated RNA, the process comprising a step of culturing a cell comprising a chimeric DNA under conditions suitable for expressing the chimeric DNA, wherein the chimeric DNA comprises a promoter operably linked to a target specific DNA region which encodes an unpolyadenylated hairpin RNA,wherein the target specific DNA region comprises a target specific sense nucleotide sequence and a target specific antisense nucleotide sequence,
wherein the target specific antisense nucleotide sequence comprises 20 consecutive nucleotides in a sequence identical to the sequence of a complement of a part of an RNA molecule transcribed or produced from a nucleic acid of interest,
wherein the target specific sense nucleotide sequence comprises consecutive nucleotides in a sequence identical to the sequence of the part of the RNA molecule transcribed or produced from the nucleic acid of interest,
wherein the target specific sense nucleotide sequence and the target specific antisense nucleotide sequence are separated and linked by a spacer sequence, such that the unpolyadenylated hairpin RNA resulting from transcription of the target specific DNA region comprises the spacer sequence located between sense and antisense nucleotide sequences in the unpolyadenylated hairpin RNA, and
wherein the sense and antisense nucleotide sequences are complementary to each other so as to form the unpolyadenylated hairpin RNA.
US Pat. No. 10,190,132

RECOMBINANT INFLUENZA VIRUS-LIKE PARTICLES (VLPS) PRODUCED IN TRANSGENIC PLANTS EXPRESSING HEMAGGLUTININ

MEDICAGO INC., Quebec (C...

1. A method of producing an influenza virus like particle (VLP) in a plant comprising:a) introducing a nucleic acid comprising a nucleotide sequence encoding an influenza hemagglutinin (HA) into a plant, or portion of a plant, the HA being operatively linked to a regulatory element that is operative in a plant and wherein the regulatory element comprises a Cowpea Mosaic Virus (CPMV) regulatory region, and
b) incubating the plant or portion of the plant under conditions that permit the expression of the nucleic acid, thereby producing the VLP.
US Pat. No. 10,188,082

METHODS FOR INCREASING GENETIC PROGRESS IN A LINE OR BREED OF SWINE USING SEX-SELECTED SPERM CELLS

Inguran, LLC, Navasota, ...

1. A method of producing an embryo or zygote in a genetic nucleus comprising the steps of:collecting a semen sample from a boar from the genetic nucleus;
sorting the semen sample into at least two subpopulations of sperm cells, wherein at least 60% of a first subpopulation bears X-chromosomes or Y-chromosomes;
fertilizing an egg from a sow from the genetic nucleus with one or more sperm cells from the first subpopulation to produce a zygote or embryo;
genotyping the zygote or embryo to obtain a genotype;
determining an estimated breeding value for the zygote or embryo; and
selecting the zygote or embryo to develop into offspring that is used for breeding in the genetic nucleus based on the estimated breeding value.
US Pat. No. 10,188,603

TOPICAL SYSTEMS AND METHODS FOR TREATING SEXUAL DYSFUNCTION

Transdermal Biotechnology...

1. A method, comprising:providing a sealed container containing a composition comprising molecular nitric oxide, a peptide, and phosphatidylcholine, wherein the sealed container contains less than about 20 mol % oxygen;
unsealing the sealed container to allow access to the composition; and
administering the composition to a subject having or at risk of sexual dysfunction.
US Pat. No. 10,189,886

PEPTIDES AND COMBINATION OF PEPTIDES FOR USE IN IMMUNOTHERAPY AGAINST ESOPHAGEAL CANCER AND OTHER CANCERS

Immatics Biotechnologies ...

1. A method of treating a patient who has a cancer overexpressing a SLC7A11 polypeptide comprising the amino acid sequence of SEQ ID NO: 67, comprising administering to said patient a population of activated T cells that kill the cancer cells,wherein the activated T cells are antigen-specific CD8+ cytotoxic T cells produced by contacting CD8+ T cells with an antigen presenting cell that presents a peptide consisting of the amino acid sequence of SEQ ID NO: 67 in a complex with an MHC molecule class I molecule on the surface of the antigen presenting cell,
wherein said cancer is selected from the group consisting of esophageal cancer and lung cancer, hepatocellular cancer, renal cell cancer, brain cancer, gallbladder cancer, bile duct cancer and head and neck cancer.
US Pat. No. 10,188,607

PHARMACEUTICAL FORMULATION OF RACECADOTRIL

Rivopharm SA, Manno, Lug...

1. A method of dry granulating racecadotril in the presence of a diluent and a disintegrant, the diluent being lactose monohydrate, said method being carried out by means of a dry granulation technique by operatinga compaction step with a compaction strength of less than 30 kN and equal to or greater than 4 kN, and
a step of grinding and calibration of the slugs and/or ribbon so as to obtain a granulate in which not more than 50% by weight of the product has a particle size of less than 90 microns.
US Pat. No. 10,189,888

VIRAL VECTORS ENCODING RECOMBINANT FVIII VARIANTS WITH INCREASED EXPRESSION FOR GENE THERAPY OF HEMOPHILIA A

Baxalta Incorporated, Ba...

1. A polynucleotide comprising a nucleotide sequence encoding a Factor VIII polypeptide, the Factor VIII polypeptide comprising a light chain, a heavy chain, and a polypeptide linker joining the C-terminus of the heavy chain to the N-terminus of the light chain,wherein the heavy chain of the Factor VIII polypeptide is encoded by a first nucleotide sequence having at least 99% identity over the entire length of SEQ ID NO: 3;
wherein the light chain of the Factor FVIII polypeptide is encoded by a second nucleotide sequence having at least 99% identity over the entire length of SEQ ID NO: 4; and
wherein the polypeptide linker comprises a furin cleavage site and a glycosylation peptide having an amino acid sequence of SEQ ID NO:55.
US Pat. No. 10,189,889

VIRAL VECTORS ENCODING RECOMBINANT FVIII VARIANTS WITH INCREASED EXPRESSION FOR GENE THERAPY OF HEMOPHILIA A

Baxalta Incorporated, Ba...

1. A polynucleotide comprising the nucleotide sequence of SEQ ID NO:1, wherein the polynucleotide encodes a Factor VIII polypeptide.
US Pat. No. 10,188,115

PROTEINS TOXIC TO HEMIPTERAN INSECT SPECIES

Monsanto Technology LLC, ...

1. An insect inhibitory recombinant polypeptide comprising the amino acid sequence as set forth in SEQ ID NO: 36.
US Pat. No. 10,189,911

INNOVATIVE DISCOVERY OF THERAPEUTIC, DIAGNOSTIC, AND ANTIBODY COMPOSITIONS RELATED TO PROTEIN FRAGMENTS OF VALYL-TRNA SYNTHETASES

aTyr Pharma, Inc., San D...

1. A therapeutic composition for detecting or modulating a biological activity of a splice variant polypeptide, comprising a pharmaceutically-acceptable carrier and an antibody or antigen-binding fragment thereof that exhibits binding specificity for an isolated aminoacyl-tRNA synthetase (AARS) splice variant polypeptide that consists of SEQ ID NO: 14, 74, 76, or 78 or an epitope comprising at least 5 amino acids selected from SEQ ID NOs: 55, 57, 69, 182, 194, and 196, wherein the composition has a purity of at least about 90% on a protein basis and less than about 10 EU endotoxin/mg protein.
US Pat. No. 10,189,912

CARRIER IMMUNOGLOBULINS

AMGEN INC., Thousand Oak...

1. An isolated antigen binding protein comprising an immunoglobulin heavy chain variable region and an immunoglobulin light chain variable region, wherein the heavy chain variable region comprises three complementarity determining regions (CDRs) designated CDRH1, CDRH2 and CDRH3, and the light chain variable region comprises three CDRs designated CDRL1, CDRL2 and CDRL3, wherein:(a) CDRH1 comprises the amino acid sequence of SEQ ID NO: 190;
(b) CDRH2 comprises the amino acid sequence of SEQ ID NO: 194;
(c) CDRH3 comprises the amino acid sequence of SEQ ID NO: 200;
(d) CDRL1 comprises the amino acid sequence of SEQ ID NO:204;
(e) CDRL2 comprises the amino acid sequence of SEQ ID NO:206; and
(f) CDRL3 comprises the amino acid sequence of SEQ ID NO:210.
US Pat. No. 10,190,168

METHOD FOR PREDICTING A TREATMENT RESPONSE TO A CRHR1 ANTAGONIST AND/OR A V1B ANTAGONIST IN A PATIENT WITH DEPRESSIVE AND/OR ANXIETY SYMPTOMS

1. A method of treating a human patient with unipolar or bipolar depression comprisingadministering an effective amount of a V1B receptor antagonist and/or CRHR1 antagonist to the patient in need thereof,
wherein the patient's genome has a polymorphic variant in the AVPR1B gene, the polymorphic variant is SNP rs28373064 which is represented by a single polymorphic change at position 27 of SEQ ID NO: 1, wherein in one or two alleles of the wild-type nucleotide A is replaced by indicator nucleotide G, and
wherein the patient's genome excluding the AVPR1B gene has at least one polymorphic variant selected from the group of biomarkers consisting of:
SNP rs9880583 which is represented by a single polymorphic change at position 27 of SEQ ID NO: 2, wherein in one or two alleles the wild-type nucleotide C is replaced by indicator nucleotide G,
SNP rs13099050 which is represented by a single polymorphic change at position 27 of SEQ ID NO: 3, wherein in one or two alleles the wild-type nucleotide A is replaced by indicator nucleotide C,
SNP rs7441352 which is represented by a single polymorphic change at position 27 of SEQ ID NO: 4, wherein in one or two alleles the wild-type nucleotide A is replaced by indicator nucleotide G,
SNP rs730258 which is represented by a single polymorphic change at position 27 of SEQ ID NO: 5, wherein in one or two alleles the wild-type nucleotide C is replaced by indicator nucleotide T,
SNP rs12654236 which is represented by a single polymorphic change at position 27 of SEQ ID NO: 6, wherein in one or two alleles the wild-type nucleotide A is replaced by indicator nucleotide G,
SNP rs17091872 which is represented by a single polymorphic change at position 27 of SEQ ID NO: 7, wherein in one or two alleles the wild-type nucleotide A is replaced by indicator nucleotide G,
SNP rs12254219 which is represented by a single polymorphic change at position 27 of SEQ ID NO: 8, wherein in one or two alleles the wild-type nucleotide C is replaced by indicator nucleotide T,
SNP rs11575663 which is represented by a single polymorphic change at position 27 of SEQ ID NO: 9, wherein in one or two alleles the wild-type nucleotide A is replaced by indicator nucleotide G,
SNP rs7080276 which is represented by a single polymorphic change at position 27 of SEQ ID NO: 10, wherein in one or two alleles the wild-type nucleotide A is replaced by indicator nucleotide G,
SNP rs7416 which is represented by a single polymorphic change at position 27 of SEQ ID NO: 11, wherein in one or two alleles the wild-type nucleotide A is replaced by indicator nucleotide G,
SNP rs12424513 which is represented by a single polymorphic change at position 27 of SEQ ID NO: 12, wherein in one or two alleles the wild-type nucleotide C is replaced by indicator nucleotide T,
SNP rs1035050 which is represented by a single polymorphic change at position 27 of SEQ ID NO: 13, wherein in one or two alleles the wild-type nucleotide C is replaced by indicator nucleotide T,
SNP rs9959162 which is represented by a single polymorphic change at position 27 of SEQ ID NO: 14, wherein in one or two alleles the wild-type nucleotide A is replaced by indicator nucleotide C, and
SNP rs8088242 which is represented by a single polymorphic change at position 27 of SEQ ID NO: 15, wherein in one or two alleles the wild-type nucleotide A is replaced by indicator nucleotide G.
US Pat. No. 10,189,914

COUPLED DIENE ELASTOMER HAVING A SILANOL FUNCTION IN THE MIDDLE OF THE CHAIN AND HAVING AN AMINE FUNCTION AT THE CHAIN END, AND RUBBER COMPOSITION COMPRISING SAME

COMPAGNIE GENERALE DES ET...

1. A modified diene elastomer comprising: from 80% to 100% by weight, with respect to the modified diene elastomer, of an entity functionalized in the middle of the chain by a silanol group, the silicon atom of which bonds the two pieces of the chain, the chain ends of the modified diene elastomer being functionalized to at least 70 mol %, with respect to the number of moles of chain end, by an amine functional group, and an overall content of Si functional group T, which is the ratio Ns/Np, in which Ns represents the number of moles of silicon bonded to the coupled polymer, determined by 1H nuclear magnetic resonance NMR and expressed in mmol/kg, and Np represents the number of mmoles of polymer before coupling per kilogram of polymer, ranging from 0.36 to 0.60, a content of silanol (SiOH) functional group in the middle of the chain T1 which is the ratio corresponding to the number of moles of SiOH functional groups to the number of moles of silicon (Si), determined by 1H-29Si 2D nuclear magnetic resonance NMR, ranging from 80 to 100% and a monomodal distribution of the number-average molecular weights of the coupled polymer chains.
US Pat. No. 10,188,123

METHODS OF MAKING REDUCED SODIUM FOOD PRODUCTS FORMED OF POTASSIUM-CONTAINING EMULSIFYING SALT MIXTURES

1. A method of preparing a dairy product comprising:combining a dairy ingredient with an emulsifying salt mixture of one or more of liquid sodium potassium hydrogen phosphate or liquid sodium dipotassium phosphate to form the dairy product,
wherein the liquid sodium potassium hydrogen phosphate, the liquid sodium dipotassium phosphate or a combination thereof accounts for at least 50 percent of the emulsifying salt mixture, and
wherein any sodium hydroxide in the emulsifying salt mixture is less than 0.05 percent by weight of the emulsifying salt mixture.
US Pat. No. 10,188,125

COFFEE CONCENTRATE COMPOSITION

KAO CORPORATION, Tokyo (...

1. A concentrated coffee composition, comprising:components (A), (B) and (C);
(A) at least one chlorogenic acid,
(B) total sugar, and
(C) caffeine,
wherein a mass ratio of the component (A) and the component (B), [(B)/(A)], is from 2.9 to 5,
wherein a mass ratio of the component (A) and the component (C), [(C)/(A)], is 0.17 or less, and
wherein a (F) Brix value of the concentrated coffee composition is 5% or more.

US Pat. No. 10,194,484

APPARATUS AND METHOD FOR INITIATING AN EMERGENCY CALL USING A PERSONAL COMMUNICATION DEVICE

FORD GLOBAL TECHNOLOGIES,...

1. A vehicle system comprising: a controller configured to: responsive to a vehicle being in an emergency state, initiate a timer after determining whether a previously connected personal communication device (PCD) is within a predetermined signal range of the vehicle; repeatedly transmit a request including a unique identifier of the vehicle, via Bluetooth Low Energy (BLE), to a non-previously connected PCD to contact an emergency provider; and stop transmitting the request responsive to an acknowledgement from the PCD including the identifier that the emergency provider was contacted.

US Pat. No. 10,194,429

MOBILE STATION APPARATUS THAT CONTROLS AN UPLINK TRANSMISSION, AND A METHOD FOR CONTROLLING AN UPLINK TRANSMISSION

SHARP KABUSHIKI KAISHA, ...

1. A mobile station apparatus comprising:a memory and a processor in electrical communication with the memory, the processor executing instructions stored in the memory to:
configure a first timer related to a first group and a second timer related to a second group, wherein a first group of one or more cells uses a first uplink transmission timing, the one or more cells includes a primary cell, and a second group of one or more secondary cells uses a second uplink transmission timing,
in a case where the first timer for the first group is expired, consider the second timer is expired, and stop an uplink transmission on any cells except random access preamble transmission on the primary cell; and
in a case where the second timer for the second group expired, stop uplink transmission on any cells in the second group except random access preamble transmission on the any cells in the second group.

US Pat. No. 10,194,428

TERMINAL, BASE STATION, TRANSMISSION METHOD, AND RECEPTION METHOD

Panasonic Intellectual Pr...

1. A terminal comprising:a receiver, which, in operation, receives repetitions of a control signal across a plurality of first subframes and a data signal allocated to a resource indicated by the control signal;
a generator, which, in operation, performs repetition of a response signal for the data signal across a plurality of second subframes and generates a transmission signal by multiplying the response signals in the plurality of second subframes by respective components of an inter-subframe orthogonal code sequence which is associated with one of the plurality of first subframes, the inter-subframe orthogonal code sequence being one of a plurality of sequences which are orthogonal to one another; and
a transmitter, which, in operation, transmits the transmission signal.

US Pat. No. 10,194,397

POWER SUPPLY CONTROL METHOD AND WIRELESS TERMINAL

HUAWEI DEVICE CO., LTD., ...

1. A power supply control method, comprising:simultaneously performing discontinuous transmission (DTX) and discontinuous reception (DRX) by a wireless terminal, the DTX comprising a DTX dormant time period and a DTX awake time period, and the DRX comprising a DRX dormant time period and a DRX awake time period;
stop supplying power to at least some circuits of a radio frequency circuit in the wireless terminal in only a part of a time period during which the wireless terminal is in a dormant state, the dormant state comprising the wireless terminal being in both the DTX dormant time period and the DRX dormant time period, the DTX dormant time period comprising an entire DTX period, and the DRX dormant time period comprising a fraction of a DRX period; and
resume supplying power to the at least some circuits of the radio frequency circuit in the wireless terminal when the wireless terminal is in the DTX awake time period or the DRX awake time period.

US Pat. No. 10,194,396

MANAGING MULTIPLE RADIO ACCESS BEARERS IN A SINGLE HANDSET

1. A device comprising:a display;
a processor communicatively coupled to the display; and
memory comprising executable instructions that cause the processor to effectuate operations comprising:
concurrently performing a voice call and executing a data application on the device;
detecting an indication that the data application is not in a foreground of the display; and
responsive to the indication, maintaining performance of the voice call and suspending data transfer supporting the data application without suspending the data application.

US Pat. No. 10,194,394

INTEGRATION OF WAKE UP RADIO WITH EXISTING POWER SAVE PROTOCOL

Intel IP Corporation, Sa...

1. An apparatus of a station (STA), the apparatus comprising: processing circuitry, and memory, configured to:encode, for transmission to an access point (AP), a request frame to enable a power save protocol between the AP and the STA, the request frame including one or more wake-up radio (WUR) parameters defining the power save protocol, including an indication for the AP to refrain from transmitting data packets to the STA and to transmit wake-up packets to the STA when the STA is in a WUR mode;
decode a response frame from the AP, the response frame including an acknowledgment of the request frame; and
initiate the power save protocol, including:
encode for transmission to the AP, a WUR frame that includes one or more WUR parameters to indicate to the AP that the STA is entering the WUR mode, and enable a WUR mode, wherein during the WUR mode, a low-power wake-up radio (LP-WUR) of the STA is configured to receive wake-up packets from the AP.

US Pat. No. 10,194,393

MOBILE RADIO COMMUNICATIONS DEVICE, NETWORK DEVICE AND METHOD FOR EMPLOYING POWER SAVING MODE

NEC Corporation, Tokyo (...

1. A mobile radio communications device for communication with a mobile radio communications network, the mobile radio communications device comprising:a transmission and reception unit configured to send non-access stratum or access stratum signalling to the network, the non-access stratum or access stratum including a preference indication of a preference of the mobile radio communications device to use a plurality of possible power saving modes, and to receive a confirmation, returned by the network, of a selected power-saving mode of the plurality of power saving modes indicated by the preference indication, the confirmed selected power saving mode to be employed by the mobile radio communications device; and
a controller configured to initiate operation of the confirmed selected power saving mode.

US Pat. No. 10,194,389

DATA PROCESSING DEVICE, DATA PROCESSING METHOD, AND PROGRAM FOR SAMPLING RATE CONTROL OF SENSORS

SONY CORPORATION, Tokyo ...

1. A data processing apparatus comprising:a first processor configured to
receive a request from an application program executed by a second processor, the request being to acquire sensor data at a plurality of sampling cycles which are predetermined multiples of a predetermined reference cycle;
acquire, at timings corresponding to the plurality of sampling cycles, the sensor data from at least one sensor in response to receiving the request;
employ, as information indicating the plurality of sampling cycles, series of indices;
generate cycle information comprising information indicating the plurality of sampling cycles corresponding to the timings at which the sensor data is acquired by compressing the series of indices; and
provide the acquired sensor data and the generated cycle information to the second processor at a specific timing requested by the second processor, wherein
the series of indices is comprised entirely of indices which are integer powers of two,
the cycle information comprising a 1-bit-on-bit string, each of the bits corresponding to a different one of the sampling cycles, and
the 1-bit-on-bit string represents a Boolean sum logic value bit string of one or more timing requests.

US Pat. No. 10,194,385

DETERMINING MULTI-USER OR SINGLE USER TRANSMISSION FOR ACCESS POINT ACKNOWLEDGEMENT IN A MULTI-USER ENVIRONMENT

Marvell International Ltd...

1. An access point implemented for wireless communication, the access point comprising:a transmitter component configured to communicate transmissions to a plurality of station devices;
a receiver component configured to receive association requests from the plurality of station devices;
a management entity configured to:
communicate, via the transmitter component, a downlink multi-user transmission to a first station device and a second station device, the downlink multi-user transmission soliciting acknowledgement from the first station device and second station device;
receive, via the receiver component and in response to the downlink multi-user transmission, a first association request from the first station device and a second association request from the second station device;
determine a single user transmission mode for the first station device based on the first association request;
determine a multi-user transmission mode for the second station device based on the second association request;
communicate, in the single user transmission mode using a polled uplink single user sequential transmission mode, to the first station device; and
communicate, in the multi-user transmission mode using a polled uplink single user transmission mode with a multi-user block acknowledgment request, to the second station device, the multi-user block acknowledgement request being used to solicit acknowledgment in a form of an uplink orthogonal frequency-division multiple access message from the second station device.

US Pat. No. 10,194,383

APPARATUS, SYSTEM, AND METHOD FOR RADIO INTERFACE SELECTION FOR IMS CONNECTION BASED ON POWER CONSIDERATIONS

Apple Inc., Cupertino, C...

1. A method for selecting a connection for a real time application, comprising:at a mobile device:
establishing a cellular connection with a cellular network;
establishing a wireless local area network (WLAN) connection with a WLAN network;
after establishing the cellular connection with the cellular network, determining a first one or more current network parameters of the cellular network, wherein the one or more current network parameters affect power consumption of the mobile device while communicating over the cellular connection;
after establishing the WLAN connection with the WLAN network, determining a second one or more current network parameters of the WLAN network, wherein the second one or more current network parameters affect power consumption of the mobile device while communicating over the WLAN connection;
based on the first one or more current network parameters and the second one or more current network parameters, dynamically determining whether to use the WLAN connection or the cellular connection in a real-time application of the mobile device, wherein said determining is based on the power consumption of the mobile device using the first one or more current network parameters while communicating over the cellular connection and the power consumption of the mobile device using the second one or more current network parameters while using the WLAN connection.

US Pat. No. 10,194,381

METHOD AND APPARATUS FOR PERFORMING DISCOVERY USING MDNS IN WIRELESS COMMUNICATION SYSTEM

LG ELECTRONICS INC., Seo...

1. A method of performing service discovery at a first user equipment (UE) in a wireless communication system, the method comprising:performing a service discovery procedure with a second UE using a multicast domain name system (mDNS) based on an application service platform (ASP); and
setting up session connection with the second UE based on P2P connection,
wherein the service discovery procedure includes a step of exchanging a pointer (PTR) query message based on the mDNS and a step of exchanging a service (SRV) and text (TXT) query messages,
wherein a TXT record of the SRV and TXT query message mandatorily includes Advertisement ID information of a service,
wherein the session is set up when the first UE transmits a provision discovery (PD) request message to the second UE after the service discovery procedure and receives a PD response message from the second UE, and
wherein band information and time information necessary for exchange of the PD request message and the PD response message are further included in the TXT record.

US Pat. No. 10,194,379

DISCOVERY AND SECURITY IN LWA COMMUNICATION

ARRIS Enterprises LLC, S...

17. A method for establishing a secure-communication pathway, comprising:by an access point:
providing, from an interface circuit in the access point, messages that include one or more identifiers of one or more cellular-telephone networks that are supported by the access point, wherein a given identifier specifies a given supported cellular-telephone network;
receiving, at the interface circuit, information specifying a radio node associated with a cellular-telephone network, wherein the information is included in communication associated with a wireless-local-area-network (WLAN) controller; and
establishing, via the interface circuit, the secure-communication pathway with the radio node based on the information, wherein the interface circuit communicates via the secure-communication pathway by taking data associated with frames for a cellular-telephone communication protocol that include second information that specifies the radio node and encapsulating the data in frames for an IEEE 802.11 communication protocol that include third information that specifies an electronic device.

US Pat. No. 10,194,376

SYSTEM AND METHOD FOR WIRELESS NETWORK ACCESS CONTROL

Telefonaktiebolaget LM Er...

1. A method, in a radio access controller in a first radio access network arranged to operate according to a first radio access technology, for providing access control in a wireless network comprising the first radio access network and a second radio access network, the second radio access network being arranged to operate according to a second radio access technology, the method comprising:receiving an access request originating from a wireless device, the access request comprising wireless device related information including information related to a global cell identity;
assessing the access request based on the received wireless device related information, a throughput related value for the first radio access technology and a throughput related value for the second radio access technology, wherein assessing the access request comprises:
transmitting a request for secondary radio access network information from the secondary access network; and
receiving a response to the request for secondary radio access network information from the secondary access network, wherein said secondary radio access network information comprises the throughput related value for the second radio access technology; and
responding to the access request based on the assessment.

US Pat. No. 10,194,375

SYSTEM AND METHOD FOR CONTROLLING NETWORK SIGNALING LOADS IN A WIRELESS NETWORK

Futurewei Technologies, I...

1. A method for controlling network signaling loads in a wireless network, comprising:receiving, by an access point, a probe request from a device comprising a reference turnover activity value;
generating, by the access point, a current turnover activity value based on a mean residence times of devices in a coverage area of the access point and a standard deviation of the devices in the coverage area of the access point, with the current turnover activity value indicating a degree of turnover activity;
determining, by the access point, that-the current turnover activity value is less than the reference turnover activity value;
sending, by the access point, a probe response to the device.

US Pat. No. 10,194,374

NETWORK JOIN METHOD AND NETWORK DEVICE USING THE NETWORK JOIN METHOD

ELECTRONICS AND TELECOMMU...

1. A network join method, comprising:transmitting a long beacon message including transmission timing information of a first short beacon message to a child node network device;
transmitting the first short beacon message to the child node network device according to a transmission timing of the first short beacon message, the first short beacon message indicating an interval allocated to the child node network device;
receiving a slot allocation request message from the child node network device according to the interval allocated to the child node network device; and
checking whether the child node network device joins a network, and transmitting a slot allocation confirmation message to the child node network device,
wherein an interval between the long beacon message and the first short beacon message is determined based on a quality of service (QoS) of the network, and
wherein the interval between the long beacon message and the first short beacon message has a first length when a number of devices requesting to join the network is greater than a threshold number, and the interval between the long beacon message and the first short beacon message has a second length when the number of devices requesting to join the network is lower than the threshold number, the second length being longer than the first length.

US Pat. No. 10,194,369

ROUTING DATA PACKETS IN WIRELESS NETWORKS WITH DIRECTIONAL TRANSMISSIONS

SONY CORPORATION, Tokyo ...

1. An apparatus for communicating via a routing protocol in a wireless network having directional transmission, comprising:(a) a transceiver configured for communicating over a wireless network with peer stations;
(b) a computer processor coupled to said transceiver; and
(c) a non-transitory computer-readable memory storing instructions executable by the computer processor;
(d) wherein said instructions, when executed by the computer processor, perform steps comprising:
(i) identifying reliable peer stations utilizing Beamforming (BF) training feedback metrics among the neighboring wireless device;
(ii) transmitting routing discovery messages to reliable peer stations in a unicast transmission mode;
(iii) disseminating neighborhood discovery lists among peer station on the network in a unicast transmission mode; and
(iv) constructing routing tables that extract best route between a source and a destination station, wherein messages can be routed using said routing table from a source peer station, through intermediate peer stations, to a destination peer station, and wherein said routing table comprises: (A) source station address; (B) destination station address; (C) source station sequence number; (D) destination station sequence number; (E) partial forward routing paths; (F) partial reverse routing path and corresponding metric; (G) time of routing path creation; (H) expiration time for route table entry.

US Pat. No. 10,194,367

SYSTEMS, DEVICES, AND METHODS FOR LONG TERM EVOLUTION AND WIRELESS LOCAL AREA INTERWORKING

Intel IP Corporation, Sa...

1. One or more computer-readable media having instructions that, when executed, cause an evolved Node B (“eNB”) to:generate a radio resource control (“RRC”) connection reconfiguration message or a system information block message to include radio access network (“RAN”) assistance parameters for access network selection and traffic steering between an evolved universal terrestrial radio access network (“EUTRAN”) and a wireless local area network (“WLAN”), wherein the RAN assistance parameters include:
a WLAN beacon received signal strength indicator (“RSSI”) threshold;
an EUTRAN reference signal received power (“RSRP”) threshold or an EUTRAN reference signal received quality (“RSRQ”) threshold; and
a timer parameter to provide a predetermined time interval that a plurality of steering conditions are to be met before user equipment (“UE”) traffic is to be steered to the WLAN; and
cause the RRC connection reconfiguration message or the system information block message to be transmitted,
wherein, at least one of:
the RAN assistance parameters further include a WLAN downlink backhaul rate threshold and the plurality of steering conditions further include an available downlink bandwidth of the WLAN being greater than the WLAN downlink backhaul rate threshold, or
the RAN assistance parameters further include a WLAN uplink backhaul rate threshold and the plurality of steering conditions further include an available uplink bandwidth of the WLAN being greater than the WLAN uplink backhaul rate threshold.

US Pat. No. 10,194,365

SYSTEM AND METHOD FOR INTERFERENCE MANAGEMENT IN CELLULAR NETWORKS

Futurewei Technologies, I...

1. A method for operating a first network controller, the method comprising:transmitting, by the first network controller, at least one indicator to a served user equipment (UE), wherein the at least one indicator specifies a cell-specific reference signal (CRS) port count associated with CRS symbols transmitted by a second network controller and a CRS frequency shift of the CRS symbols transmitted by the second network controller.

US Pat. No. 10,194,364

METHOD OF ENHANCING TRANSMISSION OPPORTUNITY AND WIRELESS DEVICE USING THE SAME

MEDIATEK INC., Hsin-Chu ...

11. A wireless device, configured to enhance a transmission opportunity, wherein the wireless device communicates with a second wireless system and attempts to interoperate with a first wireless system, and the first wireless system is configured with a first interframe space duration, the wireless device comprising:a processing unit; and
a storage unit, coupled to the processing unit, configured to store a program code, the program code instructing the processing unit to perform following steps:
sensing a wireless medium;
Determine whether the wireless medium is occupied by the first wireless system or occupied by the second wireless system;
when the wireless medium is occupied by the first wireless system, determine the interframe space duration corresponding to the wireless device to be shorter than the second interframe space duration,
When the wireless medium is occupied by the second wireless system, Determine the interframe space duration corresponding to the wireless device to be equal to the second interframe space duration,
and transmitting a data frame of the wireless device after the wireless medium is idle for at least the interframe space duration, wherein the data frame complies with the standard corresponding to the second wireless system.

US Pat. No. 10,194,363

DYNAMIC RADIO COVERAGE AREA TRANSITION MANAGEMENT

Kyocera Corporation, Kyo...

18. A method comprising:transmitting a cell state change request message from an energy saving communication station to a compensation communication station, the cell state change request message at least requesting deactivation of an energy saving service area provided by the energy saving communication station;
transmitting a cell state change response message from the compensation communication station to the energy saving communication station, the cell state change response message indicating that the energy saving service area should be deactivated;
transferring a user equipment device (UE device from the energy saving communication station to a transition radio head, the transferring comprising assigning to the UE device an uplink/downlink frequency pair for communication with the transition radio head and not used by the energy saving communication station, the transition radio head and the energy saving communication station operating in accordance with a same communication specification;
deactivating the energy saving service area such that the energy saving communication station does not provide wireless service within the energy saving service area;
transmitting a cell state change update message from the energy saving communication station to the compensation communication station, the cell state change update message at least indicating that no UE devices are receiving wireless service from the energy saving communication station;
expanding, at least partially in response to receiving the cell state change update message at the compensation communication station, a compensation service area of the compensation communication station to cover at least a portion of the energy saving service area of the energy saving communication station; and
transferring the UE device from the transition radio head to a compensation radio head of the compensation communication station that provides the compensation service area.

US Pat. No. 10,194,361

APPARATUS SYSTEM AND METHOD OF CELLULAR NETWORK COMMUNICATIONS CORRESPONDING TO A NON-CELLULAR NETWORK

INTEL CORPORATION, Santa...

1. An apparatus comprising:a processor configured to cause an evolved Node B (eNB) to:
transmit a Radio Resource Control (RRC) message in a radio transmission to a User Equipment (UE), the RRC message comprising a measurement configuration information element to configure one or more measurements to be performed by the UE, the measurement configuration information element comprising a Wireless Local Area Network (WLAN) measurement object (MeasObjectWLAN) comprising information of at least one WLAN, the WLAN measurement object comprises at least one WLAN identifier to identify the at least one WLAN, the WLAN measurement object comprising WLAN band information to indicate a WLAN band, and the WLAN measurement object comprising WLAN channel information to indicate one or more WLAN channels, the measurement configuration information element comprising reporting criterion information and reporting format information, the reporting criterion information to indicate a criterion to trigger the UE to send a measurement report, the reporting format information to indicate measurement results corresponding to the WLAN to be included in the measurement report; and
process a measurement report from the UE, the measurement report comprising the measurement results corresponding to the WLAN, the measurement report comprising the at least one WLAN identifier; anda memory to store the measurement report.

US Pat. No. 10,194,360

APPARATUS, SYSTEM AND METHOD OF CELLULAR NETWORK COMMUNICATIONS CORRESPONDING TO A NON-CELLULAR NETWORK

INTEL CORPORATION, Santa...

1. An apparatus comprising:a processor configured to cause a User Equipment (UE) to:
receive a Radio Resource Control (RRC) message in a radio transmission from an evolved Node B (eNB), the RRC message comprising a measurement configuration information element to configure one or more measurements to be performed by the UE, the measurement configuration information element comprising a Wireless Local Area Network (WLAN) measurement object (MeasObjectWLAN) comprising information of at least one WLAN, the WLAN measurement object comprises at least one WLAN identifier to identify the at least one WLAN, the WLAN measurement object comprising WLAN band information to indicate a WLAN band, and the WLAN measurement object comprising WLAN channel information to indicate one or more WLAN channels, the measurement configuration information element comprising reporting criterion information and reporting format information, the reporting criterion information to indicate a criterion to trigger the UE to send a measurement report, the reporting format information to indicate measurement results corresponding to the WLAN to be included in the measurement report;
perform measurements on the WLAN based at least on the WLAN measurement object; and
transmit the measurement report to the eNB, the measurement report comprising the measurement results corresponding to the WLAN, the measurement report comprising the at least one WLAN identifier; and
a memory to store at least part of the measurement results corresponding to the WLAN.

US Pat. No. 10,194,357

METHOD AND APPARATUS FOR APPLYING ASSISTANCE INFORMATION FOR TRAFFIC STEERING IN WIRELESS COMMUNICATION SYSTEM

LG ELECTRONICS INC., Seo...

1. A Method for applying assistance information for traffic steering between a 3rd generation partnership project (3GPP) access network and a non-3GPP access network by a user equipment (UE) in a wireless communication system, the method comprising:while in a radio resource control (RRC) connected mode:
receiving first assistance information for traffic steering via a dedicated signaling from an eNodeB (eNB);
applying the first assistance information for traffic steering;
transiting from the RRC connected mode to a RRC idle mode;
while in the RRC idle mode:
keeping applying the first assistance information for traffic steering;
performing a cell reselection while the first assistance information is valid; and
clearing the first assistance information,
wherein the first assistance information includes thresholds regarding the 3GPP access network and thresholds regarding the non-3GPP access network.

US Pat. No. 10,194,353

DATA TRANSMISSION METHOD AND APPARATUS

Huawei Technologies Co., ...

1. A method, comprising:pre-allocating, by an evolved NodeB (eNB), M uplink shared resources to a user equipment (UE) that is within a preset area, according to a preset rule, wherein the M uplink shared resources are uplink shared resources that the UE is allowed to use without needing to request a grant of uplink shared resources from the eNB, and wherein M is an integer greater than or equal to 1; and
sending, by the eNB, uplink shared resource information to the UE, wherein the uplink shared resource information comprises location information of the M uplink shared resources that are pre-allocated to the UE.

US Pat. No. 10,194,352

WIRELESS BROADBAND COMMUNICATION METHOD, DEVICE, AND SYSTEM, FOR ESTABLISHING A USER PLANE CONNECTION BETWEEN A SMALL CELL AND A USER EQUIPMENT

Huawei Technologies Co., ...

1. A method, comprising:receiving, by a first base station, a configuration message from a second base station through a wired or wireless interface, wherein the configuration message comprises user plane protocol configuration information;
configuring, by the first base station, a radio resource and a measurement parameter according to the configuration message; and
establishing, by the first base station, a connection that carries user traffic between the first base station and a user equipment (UE) based on the user plane protocol configuration information, the radio resource and the measurement parameter, wherein the connection comprises one or more data bearers between the first base station and the UE, wherein the one or more data bearers transmit user data between the UE and a core network (CN) element.

US Pat. No. 10,194,349

HEADER COMPRESSION OPTIMIZATION METHOD DURING AND AFTER HANDOVERS IN CELLULAR COMMUNICATION NETWORK

NEC Corporation, Tokyo (...

1. A method in a mobile station which communicates with a communication apparatus, the method comprising:receiving an indication about Serving Radio Network Subsystem (SRNS) relocation being performed;
upon reception of the indication about SRNS relocation being performed, and when a compressor of the mobile station is operating in an optimistic ‘O’ mode, for Window-based Least Significant Bit (W-LSB) encoding, updating a set of candidate reference values used by a decompressor of the communication apparatus by adding newly transmitted reference values but not removing old reference values until SRNS relocation is completed; and
compressing and transmitting, when the compressor of the mobile station is operating in the optimistic ‘O’ mode, uplink packets to the communication apparatus.

US Pat. No. 10,194,347

METHOD FOR MANAGING OVERLOAD IN A MOBILE COMMUNICATION NETWORK

NEC CORPORATION, Tokyo (...

1. A method for managing overload in a mobile communication network including a radio access network and a core network connected to the radio access network, wherein a plurality of non-MTC user devices and/or MTC user devices is connected to one or more base stations of the radio access network, the method comprising:a) detecting a presence of a network overload in the mobile communication network;
b) generating an overload report according to the detected network overload having one or more resource identifiers of the resources of the mobile communication network on which the network overload was detected;
c) identifying one or more user devices and/or applications affected by the network overload based on the overload report; and
d) informing one or more serving entities serving identified user devices for temporarily suppressing communication requests.

US Pat. No. 10,194,342

COLLECTING CHARACTERISTICS FOR A PATH BETWEEN IP END-POINTS ASSOCIATED WITH A RADIO ACCESS TRANSPORT NETWORK

Telefonaktiebolaget LM Er...

1. A method, performed in a first radio base station in a radio access network, of collecting characteristics for a path between two IP end-points associated with a radio access transport network, the method comprising:receiving an IP address of at least one IP end-point associated with the radio access transport network to which the first radio base station is connected;
sending a query to a node in the radio access transport network for at least one characteristic for a path between the two IP end-points, wherein the two IP end-points comprise the at least one IP end-point, and the node routes traffic between the two IP end-points;
receiving the at least one characteristic for the path between the two IP end-points;
comparing the at least one characteristic for a path between the two IP end points with at least one characteristic for a path between a second radio base station and an IP end point that is one of the two IP end points; and
determining, based on the comparison, which of the first radio base station and the second radio base station should serve as a master base station that decides whether radio coordination features should be used.

US Pat. No. 10,194,338

NETWORK OPTIMIZATION METHOD AND APPARATUS, AND BASE STATION

HUAWEI TECHNOLOGIES CO., ...

1. A network optimization method, wherein the method comprises:collecting statistics on a load index of a cell within a coverage area;
determining a load level of the cell according to the load index of the cell;
obtaining a network key performance indicator of the cell;
determining a performance status of the cell according to the load index and the network key performance indicator of the cell;
determining a cause for overload of the cell according to the performance status of the cell when the load level of the cell is overload; and
sending a message to a self-organized network (SON) entity, wherein the message carries an identifier that is used to indicate the cause for overload of the cell;
wherein the network key performance indicator comprises a cell average efficiency (CAE), which is used to indicate a resource usage capability of the cell; and

wherein MCS is a modulation and coding scheme used for a resource block according to channel quality of a scheduled user; and N is a quantity of users within the cell.

US Pat. No. 10,194,336

ACTIVATION OF CELLS

Telefonaktiebolaget LM Er...

1. A method performed in a wireless device served by a network node of a radio communications system, the wireless device being capable of carrier aggregation and being configured by the network node with a primary cell, PCell, and a first secondary cell, SCell, the method comprising:receiving an activation command for activating the first SCell, the first SCell operating on a carrier for contention-based transmission; and
activating the first SCell in response to the activation command within a variable time period, the variable timer period increasing with a number of times that a discovery reference signal occasion of the first SCell is not available at the wireless device during the activation, the discovery reference signal occasion of the first SCell is not available when at least one of a quality and a strength of a signal received in the discovery reference signal occasion is below a respective threshold.

US Pat. No. 10,194,335

WIRELESS COMMUNICATION METHOD USING HYBRID BEAMFORMING AND APPARATUS THEREFORE

SK TELECOM CO., LTD., Se...

1. A method of connecting a wireless backhaul, the method comprising:receiving, by a small-cell base station (BS), a plurality of beamforming signals from a macro-cell BS to form a wireless backhaul between the macro-cell BS and the small-cell base BS, wherein the plurality of the beamforming signals have different directivities respectively;
generating, by a small-cell base station BS, reception status information on each of the plurality of beamforming signals;
collecting, by the small-cell BS, from a terminal connected to the small-cell BS, interference information on each of the plurality of beamforming signals or location information of the terminal; and
performing, by the small-cell BS, one of:
(i) selecting, by the small-cell BS, a beamforming signal used for forming the wireless backhaul from among the plurality of the beamforming signals based on the generated reception status information and the collected interference information or the location information; or
(ii) transmitting, by the small-cell BS, the generated reception status information and the collected interference information or location information to the macro-cell BS such that the macro-cell BS selects the beamforming signal used for forming the wireless backhaul from among the plurality of the beamforming signals, based on the generated reception status information and the collected interference information or information.

US Pat. No. 10,194,334

METHODS AND NODES IN A WIRELESS COMMUNICATION NETWORK

Huawei Technologies Co., ...

1. A Base Transceiver Station (BTS), wherein the BTS comprises:a Multiple Input Multiple Output (MIMO) antenna array configured for beamforming and MIMO transmission, wherein the BTS is configured for wireless communication with a User Equipment (UE) in a wireless communication system;
a processing circuit, configured to implement a plurality of downlink pre-coders, wherein the plurality of downlink pre-coders are configurable to provide a remotely configurable downlink cell pattern, at least one of the plurality of downlink pre-coders is configured to provide downlink pre-coding for a UE dedicated channel corresponding to the UE, and at least one of the plurality of downlink pre-coders is configured to provide downlink pre-coding for a control plane, and wherein the downlink pre-coding that is provided by the plurality of downlink pre-coders is used to modify phase excitation of the MIMO antenna array, to cause a transceiver to create an antenna beam by providing a different phase for each antenna element of the MIMO antenna array; and
the transceiver, configured to transmit a signal in the antenna beam via the MIMO antenna array to the UE.

US Pat. No. 10,194,333

TERMINAL APPARATUS, BASE STATION, AND PROGRAM

SONY CORPORATION, Tokyo ...

1. A terminal apparatus comprising:a wireless communication transceiver configured to perform wireless communication with a base station; and
controller circuitry configured to receive a transmitted reference signal from the base station and perform measurement of the transmitted reference signal, a plurality of transmission weights being applied by the base station to the transmitted reference signal for beamforming, the plurality of transmission weights stored at the base station, wherein the base station applies the plurality of transmission weights to the transmitted reference signal by multiplying the transmitted reference signal with the plurality of transmission weights,
wherein the controller circuitry performs the measurement by calculating the sum of the plurality of transmission weights for beamforming, and multiplying a channel for the reference signal before application by the sum of the plurality of transmission weights for beamforming, and thereby calculating received power which occurs when the reference signal after application of the plurality of transmission weights for beamforming is received by the wireless communication transceiver,
wherein the terminal apparatus communicates with a base station which has been selected based on the measurement of the transmitted reference signal.

US Pat. No. 10,194,331

REMOTE RADIO UNIT HUB (RHUB), INDOOR COMMUNICATIONS SYSTEM, AND SIGNAL TRANSMISSION METHOD

Huawei Technologies Co., ...

1. An indoor communications system comprising a first remote radio unit hub (RHUB), comprising:a first processor; and
a first non-transitory computer readable storage medium storing a first program for execution by the first processor, the first program including instructions to:
connect to a baseband unit (BBU) in a wired manner;
receive a first communications signal sent by the BBU;
connect to a second RHUB in a wired manner;
connect to a first radio resource unit (RRU) in a wired manner;
determine whether to send a second communications signal to the second RHUB or to the first RRU, according to the first communications signal; and
send the second communications signal to the second RHUB, when it is determined to send the second communications signal to the second RHUB instead of the first RRU;
wherein the second RHUB is connected to the first RRU in a wired manner, or to a second RRU in a wired manner.

US Pat. No. 10,194,329

SITE POSITION PRIORITY DETERMINATION DEVICE AND METHOD

NEC CORPORATION, Minato-...

1. A site position priority order determination device, comprising:a radio communication apparatus that is capable of measuring a reception level and reception quality of a radio signal in communication with a radio base station existing at a periphery;
a site position priority calculation unit for actually measuring service quality at a site position at which a new radio base station is to be installed by:
transmitting and receiving data to and from the radio base station existing at the periphery using the radio communication apparatus, and calculating a nonattainment degree of target service quality based on the measured value of the service quality and, in conjunction therewith;
calculating an estimated attainment degree of the target service quality as a result of installing the new radio base station,
further calculating a tightness degree of cell load at the site position and a cell capacity supply degree to demand traffic and a competing company degree of dominance regarding the service quality at the site position, and
using a parameter set supplied from an outside party or person as a site position priority, determining weighted values of the nonattainment degree of target service quality, the estimated attainment degree of target service quality, the tightness degree of cell load, the cell capacity supply degree to demand traffic, and the competing company degree of dominance regarding the service quality at the site position, and calculating and outputting a weighted sum of the weighted values;
a site position priority storage unit for storing the site position priority with respect to each of the site positions, which is output from the site position priority calculation unit; and
a site position priority order determination unit for reading out the site position priority with respect to each of the site positions, which is stored in the site position priority storage unit, determining priority orders of the site positions based on the site position priorities, and outputting a site position priority order list indicating the determined priority orders of the site positions.