US Pat. No. 10,111,681

HAND HELD DERMAPLANING DEVICE AND DERMAPLANING PROCESS

DD Karma LLC, Highland P...

1. A blade assembly for use with a hand-held skin treatment device, the skin treatment device including first and second rails for detachably coupling the blade assembly thereto, the blade assembly comprising:an elongated blade holder configured to be slidably attached to the skin treatment device in a longitudinal direction, the blade holder including first and second ends and first and second sides extending in the longitudinal direction between the first and second ends;
first and second slots extending in the longitudinal direction between the first and second ends of the blade holder, the first slot extending along the first side and the second slot extending along the second side, the first and second slots configured to slidably receive the first and second rails of the skin treatment device;
an elongated blade supported by the blade holder, the blade extending in the longitudinal direction and including a cutting edge; and
at least one first notch located on the first side of the blade holder and at least one second notch located on the second side of the blade holder, the at least one first and second notches located between the first and second slots and the blade edge, each of the at least one first and second notches configured to cooperate with a blade retainer to hold the blade holder in position on the blade retainer for slidably attaching the blade assembly to the skin treatment device when the blade assembly is held by the blade retainer, wherein the at least one first notch extends directly from the first slot and the at least one second notch extends directly from the second slot, each notch extending in a lateral direction toward the cutting edge.

US Pat. No. 10,111,672

SURGICAL CLOSURE DEVICES INCLUDING A STAPLING MEMBER

BOSTON SCIENTIFIC SCIMED,...

1. A medical device for delivery of a surgical closure member, comprising:an elongate tubular member having a proximal end, a distal end and a lumen extending therein, wherein the elongate tubular member is adapted to be delivered through the working channel of an endoscope, and wherein the lumen is adapted to receive a surgical closure member;
a tissue support extending from the distal end of the elongate tubular member, wherein the tissue support includes a support surface, and wherein the support surface is adapted to support tissue as a surgical closure member engages the tissue thereon; and
an orienting member coupled to the distal end of the elongate tubular member, the orienting member being rotatable to rotate the surgical closure member to a desired direction.

US Pat. No. 10,111,671

IMPLANT DELIVERY SYSTEM

COOK MEDICAL TECHNOLOGIES...

1. A delivery system for a detachable medical device, the system comprising the detachable medical device having a first release portion, a deployment member having a second release portion, and a releasing element comprising a wire coil having a proximal end and a pull release wire attached to the proximal end, wherein the first and second release portions each having a helical element having windings defining a respective helical wound path therebetween, the wire coil of the releasing element and the windings of the first and second release portions having substantially the same diameter and pitch, such that the wire coil of the releasing element engages both of the helical wound paths between the windings of the first and second release portions to hold the first and second release portions together, the releasing element being detachable from the first and second release portions by a pull on the release wire, the pull allowing the proximal end of the wire coil to move slightly radially inwardly and then axially in the proximal direction, whereby to detach the first and second release portions from each other.

US Pat. No. 10,111,658

DISPLAY SCREENS FOR MEDICAL DEVICES

Covidien LP, Mansfield, ...

1. An electromechanical handheld surgical device, comprising:a housing enclosing and including:
a processor;
a memory coupled to the processor and storing instructions; and
an orientation detector configured to detect orientation of the electromechanical handheld surgical device with respect to a reference direction; and
a non-planar display screen fixedly attached around a portion of the housing and configured to display information, wherein the display screen has more than one display portion, wherein the non-planar display screen covers an upper surface of the housing by at least 15 degrees to the left side and to the right side of the housing, from a top of the upper surface of the housing,
wherein the instructions, when executed by the processor, cause the non-planar display screen to display the information on a portion of the non-planar display screen,
wherein the instructions, when executed by the processor, move the information from a first display portion of the non-planar display screen to a second display portion, which is determined only based on a change in the detected orientation, and
wherein a starting location for displaying the information is determined based on a display direction setting entered by a user of the electromechanical handheld surgical device, wherein the starting location is at least one of a right side of the housing or a left side of the housing.

US Pat. No. 10,111,560

VERTICAL BATHTUB CLOSURE SYSTEMS AND METHODS

Safeway Safety Step, LLC,...

1. A bathtub closure system comprising:(a) a step, the step comprising;
(i) a first side panel,
(ii) a second side panel, and
(iii) an elongated platform defining a cavity, wherein the cavity is configured to facilitate ingress and egress into a bathtub;
(b) a closure, wherein the closure is coupled with the step and cooperates with the step to form a substantially watertight seal when the closure is in a closed position, the closure further comprising a lateral projection dimensioned to engage a cavity defined by the second side panel of the step;
(c) a hinge, the hinge coupling the closure with the first side panel of the step such that the closure is rotatable in a substantially vertical direction about the hinge from the closed positon to an open position; and
(d) a fastener to engage the lateral projection of the closure and the second side panel of the step such that the closure is retained in the closed position further comprising, wherein the fastener is a threaded fastener that is inserted through an aperture defined by the lateral projection.

US Pat. No. 10,111,533

CONTINUOUS POCKETED SPRING UNIT AND METHOD OF MANUFACTURE

Harrison Spinks Beds Limi...

8. A pocketed spring unit comprising a substantially continuous coil encased in a substantially continuous pocket, and comprising a plurality of folds wherein the folds define a plurality of individual pocketed spring portions in a row, each of the individual pocketed spring portions comprising a spring portion having only one axis extending substantially transverse to the row and being encased in its own pocket portion.

US Pat. No. 10,111,530

ADJUSTABLE MATTRESS FOUNDATION AND PROCESS OF USE

DREAMWELL LTD, Atlanta, ...

1. An adjustable foundation and mattress assembly, comprising:a mattress having a top surface, a bottom surface, and an inner core between the top surface and the bottom surface, wherein the mattress has a width and a length; and
an adjustable foundation for supporting the bottom surface of the mattress, the adjustable foundation comprising a foundation frame and an oversized deck attached to the foundation frame, wherein the deck has a width and a length that is substantially identical to the width and the length of the mattress and the foundation frame has a width that is less than the width of the mattress and a length that is substantially identical to the length of the mattress,
wherein the oversized deck comprises a mattress support surface including a head and back section hingedly connected to an intermediate seat section at one end and a leg and foot section hingedly connected to the intermediate seat section at another end, wherein the intermediate seat section includes a separate first portion and a separate second portion, wherein the first portion is hingedly connected to the head and back section and the second portion is hingedly connected to the leg and foot section.

US Pat. No. 10,111,525

SEAT, IN PARTICULAR AN OFFICE CHAIR

Haworth, Inc., Holland, ...

1. A seat, in particular an office chair, comprising:a seat support for a seating surface;
a backrest support coupled with the seat support, the backrest support comprising two support arms having upper ends connected by a connecting element, the support arms and connecting element defining a central opening;
a backrest cover; and
a flexible shell extending outwardly from the support arms and the connecting element, the flexible shell defining at least a right peripheral side, a left peripheral side, and a top peripheral side, which collectively define a peripheral edge, the flexible shell extending from the support arms and the connecting element in the direction of the seat support, such that the peripheral edge is spaced forwardly from the backrest support in a direction adapted to engage or at least partially surround a user sitting in the seat;
wherein the backrest cover is supported on the peripheral edge of the shell, the backrest cover extending in the manner of a secant relative to the shell, wherein when the cover is loaded in a direction toward the flexible shell, a bending of at least a portion of the flexible shell is altered and at least one of the lateral sides of the shell bends toward the seating surface.

US Pat. No. 10,111,524

FURNITURE FITTING

JULIUS BLUM GMBH, Hoechs...

1. A furniture fitting comprising:a housing;
a plunger moveable linearly in relation to the housing, the plunger including a first plunger part having an internal thread and a second plunger part having an external thread interacting with the internal thread, the plunger being configured to allow adjustment of a length of the plunger by subjecting the external thread of the second plunger part to screwing action relative to the internal thread of the first plunger part; and
a securing element configured to prevent the external thread from being unscrewed all the way out of the internal thread,
wherein the internal thread is arranged on an inner lateral surface of the first plunger part, and the securing element is arranged at the inner lateral surface of the first plunger part.

US Pat. No. 10,111,481

SIGNAL-ACTIVATED LINGERIE

BIOMETRIC LINGERIE, INC.

1. A lingerie comprising:(a) an upper panel that is generally oriented horizontally with respect to a wearer's body, said upper panel including a first strap and a second strap;
(b) a lower panel that is generally oriented vertically with respect to the wearer's body, said lower panel including one or more frontal straps and a back strap; and
(c) a signal-activated fastener;
wherein the signal-activated fastener is coupled with one end of the first strap and one end of the second strap, wherein the first ends of the one or more frontal straps are coupled with the upper panel, wherein one end of the back strap is coupled with one the first strap and second strap, and wherein the signal-activated fastener is responsive to a signal and operative to unfasten causing the lingerie to fall off from the wearer's body.

US Pat. No. 10,111,478

SLIP RESISTANT HEADBAND

Teamzila LLC, McSherryst...

1. A headband comprisinga piece of fabric material and
at least one piece of anti-slip polymeric foam material, attached to the fabric material in a position to bear against the forehead or hairline of a user,
said anti-slip polymeric foam material being selected so as to have a greater coefficient of friction against the forehead than does said fabric material,
said anti-slip material having a surface facing the forehead, said forehead facing surface being provided with a tread pattern to improve headband retention when the forehead is wet,
wherein the tread is formed by grooves having a depth of at least 0.02 inch and
wherein the grooves are arranged in two set of grooves which cross one another so as to form an array of peaks.

US Pat. No. 10,111,462

VAPORIZER PROTECTIVE CASE

1. A protective electronic cigarette case housing an electronic cigarette comprising:an elongate boxy forming an interior chamber and having a longitudinal length defined by a proximal end and a distal end;
a cylindrical, deformable, transparent region of the body located between the proximal end and the distal end and having an intake valve that is opened when the deformable, transparent region is squeezed;
cylindrical interior padding within the interior chamber and located between the cylindrical, deformable, transparent region and the distal end of the body, wherein the cylindrical interior padding limits transverse movement of the electronic cigarette housed inside the case;
an interior piston at the distal end of the interior chamber and a spring giving a first proximal bias to the interior piston;
a removable top removably affixable to a collar at the proximal end of the body, wherein the removable top has a removable top mouthpiece at a proximal end and an interior annular shoulder at a distal end;
wherein the removable top mouthpiece at the proximal end of the removable top includes a proximal valve that is opened when an operator bites down on it;
wherein the electronic cigarette housed within the protective case has a distal end and a proximal end, the proximal end of the electronic cigarette having an electronic cigarette mouthpiece that extends proximally from a top of the electronic cigarette;
wherein the first proximal bias of the interior piston imparts a second proximal bias to the electronic cigarette, thereby pushing the electronic cigarette mouthpiece against the interior annular shoulder of the removable top and creating a seal between the removable top and the body of the case; and
wherein the electronic cigarette has an actuating button, visible through the transparent region of the body, and capable of being actuated by deforming the transparent region of the body.

US Pat. No. 10,111,444

MEAT GRINDING RECLAMATION SYSTEM

ROME, LTD, Sheldon, IA (...

1. A meat grinding assembly, comprising:a. a first meat grinder, comprising:
i. a first inlet;
ii. a first outlet;
iii. a second outlet;
b. a second meat grinder, comprising:
i. a second inlet;
ii. a third outlet;
iii. a fourth outlet;
c. a drive shaft provided at least partially within the first meat grinder and at least partially within the second meat grinder;
d. wherein at least a portion of the drive shaft comprises at least two separate flights, and wherein the at least two separate flights are wrapped about the drive shaft, and wherein the separate flights comprise an outer diameter that is generally conical in shape;
e. wherein the second outlet is in fluid communication with the second inlet; and
f. wherein the first meat grinder is oriented coaxially with the second meat grinder;
g. wherein the first outlet and second outlet are provided in a first perforated plate, wherein the first perforated plate is provided at least partially within the first meat grinder, and wherein the drive shaft passes the first perforated plate; and
h. wherein the third outlet and fourth outlet are provided in a second perforated plate, wherein the second perforated plate is provided at least partially within the second meat grinder.

US Pat. No. 10,111,442

DOUGH MIXER

Housoen Electric Manufact...

1. A dough mixer, comprising:a main unit, wherein a motor is arranged in the main unit; and
a dough mixing assembly mounted on the main unit, comprising:
a dough mixing bowl;
a top cover;
a transmission shaft connected to the motor, wherein the transmission shaft is arranged in the dough mixing bowl;
a dough mixing unit connected to the transmission shaft and comprising an upper end; and
a scraper unit detachably connected to the upper end of the dough mixing unit, comprising:
a first bowl wall scraper, comprising a first blade fitted to an inner wall of the dough mixing bowl;
a second bowl wall scraper, comprising a second blade fitted to the inner wall of the dough mixing bowl, wherein the second bowl wall scraper is arranged opposite to the first bowl wall scraper; and
a central scraper, comprising a third blade matched with an outer wall of the transmission shaft, wherein the first and second bowl wall scrapers and the central scraper are configured to scrap off adhering material on the dough mixing assembly.

US Pat. No. 10,111,433

FUNGICIDAL COMPOSITIONS

SYNGENTA PARTICIPATIONS A...

1. A composition suitable for control of diseases caused by phytopathogens comprising(A) a compound of formula I

wherein R1 is difluoromethyl and R2 is difluoromethyl; and
(B) at least one compound selected from the group consisting of azoxystrobin, mefenoxam (metalaxyl-M), dimethomorph, iprovalicarb, mandipropamid, ametoctradin, amisulbrom, chlorothalonil, cymoxanil, dithianon, famoxadone, fenamidone, fluazinam, flupicolide, folpet, fosetyl-Al, mancozeb and zoxamid.

US Pat. No. 10,111,417

WATERFOWL DECOY DEPLOYMENT SYSTEMS

QUICKCOYS OUTDOOR PRODUCT...

1. A waterfowl decoy deployment system comprising:a hub subsystem comprising:
a casing defining a plurality of apertures therein, said casing comprising an upper flange; and
a plurality of arm suspension mechanisms, wherein each aperture of said plurality of apertures is configured to receive one arm suspension mechanism of said plurality of arm suspension mechanisms, each arm suspension mechanism of said plurality of arm suspension mechanisms comprising:
a biasing device inserted into one aperture of said plurality of apertures;
a collet coupled to said biasing device; and
a collet nut coupled to said collet;
a hub cap comprising a top surface and an outer lip extending from said top surface, wherein said outer lip engages said upper flange to space said top surface from said upper flange; and
a plurality of arms extending radially outward from said casing, each arm of said plurality of arms coupled to said one arm suspension mechanism of said plurality of arm suspension mechanisms; and
a plurality of waterfowl decoys, wherein at least one waterfowl decoy of said plurality of waterfowl decoys is coupled to said each arm; and
a plurality of decoy tethers coupled to said plurality of waterfowl decoys, wherein said at least one waterfowl decoy of said plurality of waterfowl decoys is coupled to a respective decoy tether of said plurality of decoy tethers; and
a decoy tether guide subsystem comprising said hub cap, said hub cap defining a plurality of tether guides therein, wherein said plurality of hub cap tether guides are substantially circular openings defined in said hub cap, said plurality of hub cap tether guides configured to receive at least a decoy tether of the plurality of decoy tethers and to reduce a potential for tether entanglement.

US Pat. No. 10,111,410

LEASH ATTACHABLE PORTAGE AND STORAGE APPARATUS

1. A leash attachable portage and storage apparatus comprising:a graspable upper portion;
an attachment member disposed upon the upper portion, said attachment member having an eyelet adapted for linking engagement with an existing leash;
a closable reservoir portion disposed for nesting engagement into the upper portion; and
at least one bowl member disposed for nesting engagement around the reservoir portion and securable to the upper portion;
wherein the at least one bowl member secures the reservoir portion into the upper portion and the upper portion securely attaches to an existing leash whereby portage and storage of fluids in the reservoir portion, and dry goods in the at least one bowl member, is effective when walking a pet attached to the attachment member.
US Pat. No. 10,111,835

MICROPARTICLES FOR ENCAPSULATING PROBIOTICS, PRODUCTION AND USES THEREOF

UNIVERSIDAD DE NAVARRA, ...

1. A microparticle comprising a matrix and a probiotic bacterium, wherein said matrix consists of casein and chitosan, wherein the chitosan:casein by weight ratio is 1:14 to 1:40, and wherein the microparticle has a mean diameter between 1 ?m and 40 ?m and the molecular weight of chitosan ranges from 40 kDa to 200 kDa.
US Pat. No. 10,111,845

VALPROIC ACID FOR THE TREATMENT OR PREVENTION OF PATHOLOGICAL CONDITIONS ASSOCIATED WITH EXCESS FIBRIN DEPOSITION AND/OR THROMBUS FORMATION

Cereno Scientific AB, Go...

1. A method of treating or reducing the risk of a pathological condition associated with excess fibrin deposition and/or thrombus formation in a subject in need thereof, comprising administering to the subject at least one dose of a therapeutically effective amount of valproic acid, or a pharmaceutically acceptable salt thereof, wherein the maximum plasma concentration (Cmax) of the valproic acid, or salt and/or metabolite thereof in the subject after administration occurs during a time period that is from four hours before to one hour after the Cmax of PAI-1 in the subject.
US Pat. No. 10,112,883

PRODUCTION OF PRODUCTS FROM NATURAL RESOURCES

Saudi Basic Industries Co...

1. A method of producing acrylic acid and acetic acid comprising the steps of:a) providing a feedstream comprising syngas;
b) a step consisting of contacting the feedstream with a first catalyst to produce a first product stream comprising C2-C3 olefins and/or C2-C3 paraffins; and
c) contacting the first product stream with oxygen gas and a second catalyst, thereby producing a second product stream comprising acrylic acid and acetic acid,
wherein there is no step for separating the components of the first product stream before the first product stream is contacted with the second catalyst,
wherein the first catalyst is a catalyst composition comprising cobalt; manganese; hydrophilic silica; and at least one element comprising lanthanum, phosphorus, Fe, Zr, or Zn, wherein the relative molar ratios of the elements comprised in said composition are represented by the formula
Coa1Mnb1Siz1Xy1M1d1Of1,
wherein a1 is 1;
wherein b1 is from 0.8 to 1.2;
wherein Si is in the form of a hydrophilic silica;
wherein z1 is from 0.1 to 1;
wherein X is La, P, Fe, Zr, or Zn, or a mixture thereof;
wherein y1 is greater than 0 to 0.005;
wherein M1 is one or more elements selected from the group consisting of alkali metal, alkaline earth metal and transition metal,
wherein d1 is 0 to 0.005; and
wherein f1 is a number determined by the valence requirements of elements of the other elements present in the catalyst.
US Pat. No. 10,111,608

METHOD AND APPARATUS FOR PROVIDING DATA PROCESSING AND CONTROL IN MEDICAL COMMUNICATION SYSTEM

ABBOTT DIABETES CARE INC....

1. A method for notifying a user about an alarm condition without causing interruption to a predetermined routine, the method comprising:executing a concurrent passive notification routine on an analyte monitoring device, the concurrent passive notification routine comprising monitoring analyte levels received from a sensor for the alarm condition;
executing the predetermined routine comprising one or more of performing a finger stick blood glucose test, calibrating a sensor unit, configuring a device setting, reviewing historical glucose data, reviewing historical alarms, events, or entries in a data log, managing a data communication setting, transferring data to a data processing terminal, or reviewing a higher priority alarm condition;
in response to detecting the alarm condition by the concurrent passive notification routine during the execution of the predetermined routine, outputting to a user interface a first indication associated with the alarm condition, wherein the first indication is outputted during the execution of and without interruption to the predetermined routine; and
in response to a termination or a completion of the predetermined routine, outputting to the user interface by the concurrent passive notification routine a second indication for the alarm condition associated with the first indication.
US Pat. No. 10,113,147

METHOD FOR PRODUCING MEGAKARYOCYTES, PLATELETS AND/OR THROMBOPOIETIN USING MESENCHYMAL CELLS

AdipoSeeds, Inc., Tokyo ...

1. A method for producing a megakaryocyte and/or platelet, comprising culturing a mesenchymal cell in a mesenchymal cell culturing basic medium containing an iron ion and an iron transporter so that the mesenchymal cell differentiates into a megakaryocyte and/or platelet, and collecting the megakaryocyte and/or platelet from a culture,wherein the mesenchymal cell is a CD31 negative and CD71 positive mesenchymal cell and wherein the medium does not contain exogenous thrombopoietin.
US Pat. No. 10,113,156

STABILIZED REVERSE TRANSCRIPTASE FUSION PROTEINS

BOARD OF REGENTS, THE UNI...

1. A stabilized reverse transcriptase fusion protein comprising a thermostable group-II intron-derived reverse transcriptase connected at its N-terminus by a linker peptide to the C-terminus of a stabilizer protein including 50 or more amino acids, wherein the fusion protein exhibits increased solubility and stability in solution.
US Pat. No. 10,111,879

ADRENOCEPTORS ANTAGONISTS FOR THE PREVENTION AND TREATMENT OF NEURODEGENERATIVE CONDITIONS

Cedars-Sinai Medical Cent...

1. A method for determining whether or not a non-motor symptom phase of idiopathic Parkinson's disease (iPD) is progressing in a human subject who has not been diagnosed with iPD based on motor symptoms, and who does not exhibit a motor symptom of iPD, but is exhibiting a non-motor symptom of iPD, comprising:performing an initial assay to measure cardiac uptake of iodine-123-metaiodobenzylguanidine (123I-MIBG) in the subject;
administering a composition comprising one or more adrenoceptor antagonist selected from the group consisting of: acebutolol, betaxolol, bisopropolol, bopindolol, carvedilol, metoprolol, oxprenolol, propranolol, and timolol;
subsequently performing an additional assay to measure cardiac uptake of 123I-MIBG in the subject, wherein it is determined iPD is progressing in the subject if the cardiac uptake of 123I-MIBG has decreased in the additional assay, compared to the initial assay; and wherein it is determined iPD is not progressing in the subject if the cardiac uptake of 123I-MIBG has not decreased in the additional assay, compared to the initial assay; and
continuing to administering the adrenoceptor antagonist if iPD is not progressing or providing an additional or alterative iPD treatment if iPD is progressing.
US Pat. No. 10,111,918

METHOD OF PREPARING BIOLOGICALLY ACTIVE DERIVATIVES FROM CALOTROPIS GIGANTEA FLOWERS

KING SAUD UNIVERSITY, Ri...

1. A method of preparing biologically active derivatives from Calotropis gigantea flowers, comprising:obtaining Calotropis gigantea flowers;
drying the Calotropis gigantea flowers to provide dried flowers;
soaking the dried flowers in an oil to provide oil-soaked flowers; and
burning the oil-soaked flowers at a temperature of at least about 600° C., to provide flower ash, the flower ash including biologically active derivatives.
US Pat. No. 10,111,423

MICROBIAL PESTICIDE COMPOSITION OF DRIED BACILLUS

SDS BIOTECH K.K., Tokyo ...

1. A microbial pesticide composition, comprising: a bacterial cell dried product of a Bacillus sp. bacterium; and calcium chloride and/or magnesium sulfate, wherein the content of calcium chloride and/or magnesium sulfate in said composition is from 1 mass % to 5 mass %.
US Pat. No. 10,112,985

TOLL-LIKE RECEPTORS

Intervet Inc., Madison, ...

1. An immunostimulatory non-methylated phosphorothioate (PTO) oligodeoxynucleotide consisting of the general formula selected from the group consisting of:(i) [tcgN1]n, wherein N1=c or g and n?6 and ?100;
(ii) [N1cgt]n, wherein N1=g or c or a or t and n?6 and ?100;
(iii) [gacgtt]n, wherein n?4 and ?100;
(iv) [gacgatcgtc]n, [SEQ ID NO: 214] wherein n?3 and ?100;
(v) [tcgtcgttttcg]n, [SEQ ID NO: 215] wherein n?3 and ?100,
(vi) [tcgtcgttgtcgttttgtcgtt]n, [SEQ ID NO: 216] wherein n?2 and ?100;
(vii) (tx[ttcgtt]ty)n, wherein n?5 and ?100, x=0-5 and y=0-5;
(viii) [ttcgtN1]n, wherein N1=t or c and wherein n?5 and ?100;
(ix) [N1tcgtc]n, wherein N1=t or c and wherein n?5 and ?100;
(x) [gN1cgtt]n, wherein n?4 and ?100 and N1=a or t; and
(xi) [acga]n, and wherein n?6 and ?100.
US Pat. No. 10,113,001

FC VARIANTS WITH INCREASED AFFINITY FOR FCYRIIC

Xencor, Inc., Monrovia, ...

1. A nucleic acid encoding a protein, wherein said protein comprises an Fc variant of a parent IgG Fc polypeptide, said Fc variant comprising an amino acid substitution at position 243 in the Fc region of said parent IgG Fc polypeptide, wherein numbering is according to the EU index.
US Pat. No. 10,113,015

CATALYST FOR THE POLYMERIZATION OF OLEFINS

Basell Poliolefine Italia...

1. A catalyst system for the (co)polymerization of ethylene, comprising (A) a solid catalyst component comprising Ti, Mg, and a halogen, (B) an aluminum alkyl compound, and (C) a halogenated cyclic ether selected from the group consisting of 2-chloro-tetrahydrofuran, 3-chloro-tetrahydrofuran, 2,3-dichloro-tetrahydrofuran and 2,3-dichloro-tetrahydropyran,wherein the catalyst system has a molar ratio of component (C)/Ti ranging from 1 to 25, and wherein the molar amount of Ti is based on the amount of Ti present in component (A).
US Pat. No. 10,113,035

CURABLE POLYSILSESQUIOXANE COMPOUND, PRODUCTION METHOD THEREFOR, CURABLE COMPOSITION, CURED PRODUCT AND USE METHOD OF CURABLE COMPOSITION

LINTEC CORPORATION, Toky...

1. A method for producing a curable polysilsesquioxane compound comprising one structural unit or two or more structural units represented by R1SiO3/2,the curable polysilsesquioxane compound having a 29Si nuclear magnetic resonance spectrum that
has a first peak top within a range of ?60 ppm or more and less than ?54 ppm, and
has a second peak top within a range of ?70 ppm or more and less than ?61 ppm, and
a peak is not observed within the range of ?53 ppm or more and less than ?45 ppm, or, the ratio of the integral value of the peak within the range of ?53 ppm or more and less than ?45 ppm to the integral value of the peak within the range of ?60 ppm or more and less than ?54 ppm is less than 0.5% in the 29Si nuclear magnetic resonance spectrum,
the method comprising a step (I) that subjects one compound or two or more compounds represented by a formula (1) to polycondensation in the presence of an acid catalyst, and
R1Si(OR2)3  (1)
a step (II) that adds an organic solvent to a reaction mixture obtained by the step (I) to dissolve a polycondensate of the compound represented by the formula (1) to obtain a solution, adds a base to the solution in a molar equivalent equal to or larger than that of the acid catalyst, and then effects polycondensation,
wherein R1 is an alkyl group having 1 to 10 carbon atoms, and R2 is a hydrogen atom or an alkyl group having 1 to 10 carbon atoms, provided that a plurality of R2 are either identical to or different from each other.
US Pat. No. 10,113,056

COMPOSITE WITH IMPROVED MECHANICAL PROPERTIES AND MOLDED ARTICLE INCLUDING THE SAME

LG CHEM, LTD., Seoul (KR...

1. A composite obtained by processing a resin composition comprising a thermoplastic resin, multi-walled carbon nanotubes, and a reinforcing material,wherein the average diameter of the multi-walled carbon nanotubes is 10 nm-30 nm, walls of the multi-walled carbon nanotubes have 10-50 layers of graphene, an Id/Ig of the multi-walled carbon nanotubes is 0.6-1.0, and
the rate of residual length of the multi-walled carbon nanotubes present in the composite is 40%-99%, the rate of residual length being defined by Equation 1:
Rate of residual length (%)=(Content of ?500 nm long multi-walled carbon nanotubes in the composite)/(Content of all multi-walled carbon nanotubes in the composite)×100.
US Pat. No. 10,113,064

WATER SOLUBLE INK-JET COMPOSITION FOR 3D PRINTING

STRATASYS LTD., Rehovot ...

1. A material composition for three-dimensional inkjet printing comprising:polyethylene glycol (PEG) having a molecular weight between about 1000 and about 6000; and
dimethyl hexanediol, wherein the composition has a melting point between 70° C.-85° C. and solidifies upon cooling.
US Pat. No. 10,113,067

TRANSPARENT HYDROPHOBIC COATING MATERIALS WITH IMPROVED DURABILITY AND METHODS OF MAKING SAME

LUNA INNOVATIONS INCORPOR...

1. A hydrophobic coating material which comprises an acid catalyzed condensation reaction product comprised of:an organic polymeric silane selected from the group consisting of polycaprolactone polyols having 2 to 4 hydroxyl groups reacted with an isocyanate-terminated silane and polyurea silanes;
an inorganic metal alkoxide; and
a fluorinated silane.
US Pat. No. 10,112,829

PRODUCTION OF PURE HYDROGEN FROM AMMONIA RICH SOUR WATER STRIPPER OVERHEAD

Fluor Technologies Corpor...

1. A method of producing hydrogen comprising:(a) receiving a sour gas from a sour water stripper, wherein the sour gas comprises carbon dioxide, hydrogen sulfide, and ammonia;
(b) introducing the sour gas to a solvent based, absorption system to produce an ammonia rich gas and a sulfide rich gas, wherein the ammonia rich gas comprises ammonia and carbon dioxide, and wherein the sulfide rich gas comprises hydrogen sulfide and carbon dioxide;
(c) compressing at least a portion of the ammonia rich gas in a compressing unit to a pressure of from about 400 psig to about 600 psig to produce a compressed ammonia rich gas;
(d) introducing at least a portion of the compressed ammonia rich gas to an ammonia cracker unit to produce a cracked gas, wherein the ammonia cracker unit comprises a catalyst, wherein the ammonia cracker unit is characterized by a cracking temperature of from about 450° C. to about 550° C., wherein the cracked gas comprises hydrogen, nitrogen, and carbon dioxide, wherein the ammonia rich gas is heated in the compressing unit, and wherein the cracked gas exchanges heat with the compressing unit to produce a cooled cracked gas; and
(e) introducing a gas stream consisting of the cooled cracked gas to a pressure swing adsorption (PSA) unit to produce hydrogen and a PSA tail gas, wherein the PSA tail gas comprises nitrogen and carbon dioxide.
US Pat. No. 10,113,090

ADHESIVE COMPOSITION

HITACHI CHEMICAL COMPANY,...

1. An adhesive composition comprising:15 to 25 parts by weight of a 1-butene homopolymer;
12 to 22 parts by weight of an ?-olefin copolymer having a melting point of 90° C. or higher;
30 to 50 parts by weight of a tackifier resin having a softening point of 125° C. or higher;
6 to 22 parts by weight of a polypropylene-based wax; and
4 to 20 parts by weight of a liquid hydrocarbon.
US Pat. No. 10,111,823

SHAVE CREAM FORMULATION

GETCO LLC, Windsor, CO (...

1. A shaving cream composition comprising:water, carbomer, ethylhexyl palmitate, glycerin, glyceryl acrylate/acrylic acid, isododecane, stearic acid, butylene glycol, ethyl alcohol, cetearyl alcohol, ceteareth-20, propanediol, Brassica Campestris, phenoxyethanol, ethylhexyl glycerin, tetrahydroxypropyl ethylenediamine, Aloe Barbadensis, carboxymethyl hydroxyehylcellulose, bisabolol, PEG-45M, and tocopheryl acetate, wherein the carbomer is about 2% of the total weight, the ethylhexyl palmitate is about 5% of the total weight, the cetearyl alcohol and the ceteareth-20 are about 2.9% of the total weight, wherein the propanediol is about 2.5% of the total weight, the tetrahydroxypropyl ethylenediamine is from about 0.5% of the total weight, the butylene glycol is from about 3.5% to about 5% of the total weight, the isododecane is from about 3% to about 4% of the total weight, the stearic acid is from about 3% to about 3.5% of the total weight, the ethyl alcohol is from about 3% to about 4.5% of the total weight, the phenoxyethanol and the ethylhexylglycerin are from about 0.95% to about 0.97% of the total weight, the carboxymethyl hydroxyethylcellulose is from about 0.30% to about 0.35% of the total weight, the bisabolol is about 0.08% of the total weight, and the tocopheryl acetate is from about 0.1% to about 0.2% of the total weight.
US Pat. No. 10,111,829

PROBIOTIC-CONTAINING ANIMAL SHAMPOO AND METHODS OF USE

Alpha Pet Tech, Inc., Li...

1. A method of orally administering probiotics to an animal comprising contacting the animal's fur or hair with a shampoo that comprises at least one probiotic, wherein the animal subsequently orally self-grooms its fur or hair and thereby orally ingests the probiotic deposited by the shampoo.

US Pat. No. 10,117,196

DYNAMICALLY CONFIGURABLE APPARATUS FOR OPERATING WITHIN THE CURRENT CAPABILITIES OF THE POWER SOURCE

QUALCOMM Incorporated, S...

1. An apparatus, comprising:a load including a processor having a plurality of cores;
a power management circuit configured to manage power supplied by a power source to the load and provide to the load one or more parameters relating to the power source, the one or more parameters comprising instantaneous peak current drawn from the power source and a voltage indicator responsive to voltage supplied by the power source to the load; and
a power monitor circuit including:
a current detector coupled to the power source;
a voltage detector coupled to the power source; and
a memory coupled to the current detector and the voltage detector, wherein the power monitor circuit generates the instantaneous peak current value and stores the instantaneous peak current value in the memory and wherein the power monitor circuit generates the voltage indicator, the voltage indicator comprising an interrupt, and
wherein the load is dynamically configurable to operate within a current capability of the power source based on the one or more parameters and to apply one or more current limiting schemes to operate within the current capability of the power source, based on a type of the power source coupled to the power management circuit.

US Pat. No. 10,117,186

APPARATUSES AND METHODS FOR CONTROLLING ALWAYS-ON DISPLAYS FOR MOBILE DEVICES

Motorola Mobility LLC, C...

1. A method comprising:receiving, at a processor of a mobile device, a first notification;
in response to the first notification, displaying, on a display device coupled to the processor, a first set of information related to the first notification, the first set of information displayed at a first frequency for a first time period associated with the first notification, wherein the first time period associated with the first notification commences when the first notification is received;
the processor of the mobile device determining based at least upon data from one or more sensors of the mobile device that a user interaction indicative of a presence of a mobile device user has not occurred or is not occurring yet within the first time period;
in response to receiving a subsequent notification, displaying, on the display device, an updated set of information related to the subsequent notification, the second set of information displayed at a second frequency during a second time period associated with the subsequent notification that commences upon receipt of the subsequent notification;
further the processor of the mobile device determining, subsequent to the receiving of the subsequent notification, a first to occur of: (i) the first time period associated with the first notification ending, and (ii) based at least upon data from the one or more sensors of the mobile device that the user interaction indicative of the presence of the mobile device user has occurred; and
in response to determining the first to occur, the processor of the mobile device ending the displaying of the updated set of information related to the subsequent notification on the display device upon the first to occur of: (i) the first time period associated with the first notification ending, and (ii) the user interaction indicative of the presence of the mobile device user has occurred.

US Pat. No. 10,117,151

METHOD AND DEVICE FOR PROCESSING INFORMATION INTERACTION, OFFLOADING PROCESSING METHOD AND DEVICE, BASE STATION, RNC AND UE

ZTE CORPORATION, Shenzhe...

1. A method for processing an information interaction, comprising:receiving, by a target side network element for handover of User Equipment (UE) at least one of following source side information sent by a source side network element: Wireless Local Area Network (WLAN) auxiliary information, offloading rule information, and information indicating a capability in supporting interoperation with a WLAN; and/or,
sending, by a target side network element, at least one of following target side information to the source side network element: WLAN auxiliary information, load information, offloading rule information, measurement configuration information, offloading decision information and information indicating a capability in supporting interoperation with the WLAN;
wherein the WLAN auxiliary information comprises at least one of: maximum resource allocation which is able be provided for the UE by a Radio Access Network (RAN), WLAN threshold information and RAN threshold information, wherein the WLAN threshold is a signal threshold of the WLAN or a load threshold of the WLAN;
wherein the offloading rule information comprises at least one of: a method for using a WLAN threshold and a method for using a RAN threshold, wherein the method for using WLAN threshold refers to that the RAN provides the WLAN threshold for the UE in the WLAN auxiliary information.

US Pat. No. 10,117,119

REDUNDANT LINKS FOR RELIABLE COMMUNICATION

1. A transmitting electronic device, comprising:an input port configured to receive information associated with a data stream;
a first interface circuit configured to communicatively couple to a first antenna and to communicate first packets between the transmitting electronic device and a receiving electronic device via a first channel using a wireless-local-area-network (WLAN) communication protocol, wherein the first packets include the information associated with the data stream;
a second interface circuit configured to communicatively couple to a second antenna and to communicate second packets between transmitting electronic device and the receiving electronic device via a second channel using the WLAN communication protocol, wherein the second packets include the information associated with the data stream and the second channel is different than the first channel;
wherein, in a first operating mode, the second packets are communicated concurrently with the first packets; and
wherein, in a second operating mode, the transmitting electronic device is configured to determine a distance to the receiving electronic device and an associated phase distortion for one of the first channel and the second channel, including determining a first estimate of the distance based on a received signal strength and refining the first estimate of the distance using one or more of an angle of arrival (AOA), a round trip time (RTT) and a time of arrival (TOA), while the information is communicated using the other of the first channel and the second channel.

US Pat. No. 10,117,116

SYSTEM AND METHOD SUPPORTING DELIVERY OF NETWORK ACCESSIBLE SERVICES TO CONNECTED DEVICES OF A LOCAL ENVIRONMENT

1. A system, comprising:a processing system including a processor; and
a memory that stores executable instructions that, when executed by the processing system, facilitate performance of operations, comprising:
monitoring, on-premises, a control channel of a service provider network, wherein the control channel comprises control messages that facilitate network access by a plurality of connected devices to a plurality of subscribed service functions that facilitate a delivery of subscribed services to the plurality of connected devices by way of a core portion of the service provider network, wherein the plurality of connected devices are on-premises equipment;
monitoring, on-premises, a data channel managed by the service provider network and separate from the control channel, wherein the data channel facilitates an exchange of user data between the plurality of connected devices, the core portion of the service provider network and the plurality of subscribed service functions;
discovering the on-premises equipment based on the monitoring of the control channel;
facilitating establishing local network connectivity between the processing system and the on-premises equipment; and
facilitating establishing a common communication channel between the processing system and the core portion of the service provider network, wherein the delivery of subscribed services is based on the exchange of the user data via the common communication channel.

US Pat. No. 10,117,110

STRUCTURING AND METHOD FOR WIRELESS RADIO ACCESS NETWORK DEPLOYMENT

1. A radio access network system comprising one or more radio access network elements communicatively linked to form at least a portion of a radio access network, the one or more radio access network elements each comprising one or more processors, the system further comprising:one or more reconfigurable connection points comprising one or more processors executable to provide all or a subset of radio transmission functions for one or more radio access technologies, the radio transmission functions linking user equipment operating on the radio access technology to the radio access network; and
one or more reconfigurable radio access network functional elements each executable on at least one of the radio access network elements, each of the radio access network functional elements linked directly or indirectly to one or more of the reconfigurable connection points, each radio access network functional element configurable to provide one or more non-radio transmission functions for enabling communication between the user equipment and a core network linked to the radio access network, each of the radio access network functional elements reconfigurable to permit introduction and removal of non-radio transmission functions.

US Pat. No. 10,117,106

BACKOFF MECHANISM TECHNIQUES FOR SPATIAL REUSE

QUALCOMM Incorporated, S...

1. A method for wireless communication, comprising:receiving, at a first device, a packet;
decoding at least a portion of a preamble of the packet to determine whether the packet is sent by a member of an overlapping basic service set (OBSS), wherein the decoding comprises:
identifying a sequence in the preamble of the packet;
determining whether the sequence matches a sequence for packets intended for members of a BSS associated with the first device; and
determining that the packet is sent by the member of the OBSS in response to a determination that the match fails;
deferring a backoff operation in response to a start of the decoding; and
resuming the backoff operation in response to the determination that the packet is sent by the member of the OBSS, wherein the backoff operation is resumed before an end of the packet.

US Pat. No. 10,117,102

MULTIMEDIA MESSAGE SERVICE METHOD AND SYSTEM

Samsung Electronics Co., ...

1. A server for sharing multimedia content, the server comprising:a transceiver; and
a controller configured to:
receive, via the transceiver from a terminal, a first message including first information for requesting to share multimedia content stored in the server with at least one specified user and second information related to expiration of time for sharing the multimedia content, and
based on the received first message:
establish a condition for sharing the multimedia content, and
transmit, via the transceiver to the at least one specified user, a second message notifying that the at least one specified user is allowed to access the multimedia content.

US Pat. No. 10,117,099

COMMUNICATION APPARATUS, METHOD FOR CONTROLLING THE SAME, AND PROGRAM

Canon Kabushiki Kaisha, ...

1. A communication apparatus comprising:one or more processors; and
one or more memories including instructions that, when executed by the one or more processors, cause the communication apparatus to:
transmit an authentication request signal to another communication apparatus in a case where the communication apparatus provides the another communication apparatus with a communication parameter to be used for connecting to a wireless network;
receive an error notification from the another communication apparatus in a case where the authentication request signal is transmitted by unicast and authentication processing based on the authentication request signal fails in the another communication apparatus,
wherein in a case where the authentication request signal is transmitted by broadcast or multicast, the communication apparatus does not receive an error notification from the another communication apparatus even in a case where the authentication processing based on the authentication request signal fails in the another communication apparatus; and
provide the another communication apparatus with the communication parameter in a case where a notification that the authentication processing based on the authentication request signal has succeeded in the another communication apparatus is received.

US Pat. No. 10,117,095

QUANTIFIED IDENTITY

Cable Television Laborato...

1. A method for determining a quantified identity for a device comprising:receiving a quantified identity (QI) request from an identity requester, the QI request indicating an identity determined by the identity requester as being associated with the device proximate in time to issuance of the QI request;
determining a certificate uniquely associated with the identity;
identifying a predetermined set of identity elements associated with the identity, the predetermined set of identity elements each having been previously provided the certificate;
determining from a calculation table or a calculation algorithm a plurality of weight values to represent whether the predetermined set of identity elements are operating in a manner consistent with how the device associated with the identity would interact with the predetermined set of identity elements proximate in time to receipt of the QI request;
determining a quantified identity for the device as a function of the plurality of weight values, the quantified identity indicating whether the identity associated with the QI request is likely to be that of the device or another device posing as the device; and
determining a location of the device proximate in time to receipt of the QI request, including increasing one or more of the plurality of weight values used in determining the quantified identity if the location is within a wireless range of the identity requester and decreasing one or more of the plurality of weighted values used in determining the quantified identity if the location is beyond the wireless range of the identity requester.

US Pat. No. 10,117,090

MULTIPLE DEVICE ASSOCIATION WITH A SINGLE TELEPHONE NUMBER

T-Mobile USA, Inc., Bell...

1. A computer-implemented method, comprising: receiving an input at a service portal of a mobile telecommunication network, the input for configuring a call session control function (CSCF) node to concurrently register multiple user devices to use a common telephone number to initiate and receive communications via the mobile telecommunication network; storing the input as a device association profile in a device association data store that is accessible by the CSCF node of the mobile telecommunication network, the device association profile including multiple IP Multimedia Private Identities (IMPIs) of the multiple user devices that are permitted to use the common telephone number; receiving the device association profile at the CSCF node from the device association data store; determining at the CSCF node based at least on the device association profile whether a user device is eligible to use the common telephone number to initiate and receive communications via the mobile telecommunication network; and in response to determining that the device association profile indicates that an IMPI of the user device is permitted to use the common telephone number, registering the user device to initiate and receive communications through the common telephone number via the CSCF node.

US Pat. No. 10,117,079

INFORMATION PROCESSING APPARATUS AND RECORDING MEDIUM

Ricoh Company, Ltd., Tok...

1. An information processing apparatus, comprising:a communication interface configured to perform communication with a short-distance wireless communication tag;
processing circuitry configured to determine whether an establishing signal for establishing the communication is received from the short-distance wireless communication tag, and in response to determining that the establishing signal is not received, display position information of the communication interface on a display; and
a sensor configured to detect whether the information processing apparatus is inclined,
wherein the communication interface is configured to perform the communication with the short-distance wireless communication tag in response to the processing circuitry determining that the establishing signal is received, and
when it is determined that the information processing apparatus is held near the short-distance wireless communication tag based on a detection result of the sensor, the processing circuitry displays position information of the communication interface.

US Pat. No. 10,117,078

MEDICAL INFORMATION COMMUNICATION METHOD

1. A method for providing a third party with medical information associated with a user, the method comprising steps of:obtaining a user's cellular telephone, the cellular telephone including a microprocessor, a non-transient memory device in signal communication with the microprocessor, and a data entry device, the user's cellular telephone containing an emergency/non-emergency events application stored in the non-transient memory device;
providing medical information to the user's cellular telephone;
encoding the medical information using the emergency/non-emergency events application, the emergency/non-emergency events application running using the microprocessor;
storing the encoded medical information in the non-transient memory device;
providing the user's medical information to a third party using the emergency/non-emergency events application.

US Pat. No. 10,117,076

DESTINATION SELECTION FOR AN OFFLINE CHARGING SYSTEM TO AVOID REVERSION

Alcatel-Lucent USA Inc., ...

1. A system comprising:a distributor unit configured to connect to a plurality of Charging Data Functions (CDFs) of an Offline Charging System (OFCS) through an interface, and to receive information from the CDFs for registering queues associated with the CDFs;
the distributor unit comprising a processor configured to receive an initial accounting request from a Charging Trigger Function (CTF) for a session through the interface, to generate a prioritized list of the queues for the session based on a distribution algorithm, to select a destination queue from the prioritized list for the session, and to transmit the initial accounting request to the destination queue through the interface;
the processor is configured to receive a subsequent accounting request from the CTF for the session through the interface, to extract a first identifier from a parameter of the subsequent accounting request indicating the destination queue previously selected for the session, and to determine a status of the destination queue;
when the status of the destination queue indicates that the destination queue is not accepting new sessions or ongoing sessions, the processor is configured to:
identify the prioritized list for the session;
identify a position of the destination queue in the prioritized list;
search the prioritized list for a first alternate queue having a lower priority than the destination queue, and having a status indicating that the first alternate queue is accepting new sessions;
select the first alternate queue as an alternate destination queue for the session; and
transmit the subsequent accounting request to the alternate destination queue through the interface.

US Pat. No. 10,117,073

NETWORK SOLUTIONS FOR BUILDING AND LEVERAGING CLUSTERS OF USER EQUIPMENT ASSOCIATED WITH A TELECOMMUNICATIONS SERVICE PROVIDER

Sprint Communications Com...

1. A system for determining clusters of telecommunications service provider subscribers, comprising:a plurality of enhanced node B (eNB) stations;
a server associated with a content provider;
a server comprising an application stored in a non-transitory memory and executable by a processor;
a data store in communication with the server and configured to receive pluralities of data at periodic intervals from a plurality of user equipments (UEs), wherein each UE of the plurality of UEs is in communication with at least one enhanced node B of the plurality of eNBs and the pluralities of data are associated with the plurality of UEs performance and activity;
wherein the application, when executed by the processor:
analyzes a first plurality of data from the data store based upon a UE location and a timestamp, wherein the timestamp is associated with a duration of time in the UE location;
forms, in response to the analysis, a plurality of clusters, wherein a first portion of the UEs of the plurality of UEs are members of a first formed cluster based on a determination that the first portion was associated with a first UE location and a first duration of time in the first UE location, wherein a second portion of UEs of the plurality of UEs are members of a second formed cluster based on a determination that the second portion of UEs of the plurality of UEs was associated with a second UE location for a second duration of time in the second UE location, wherein the first cluster further includes a third portion of UEs of the plurality of UEs when the third portion of UEs are determined to be outside of a first distance radius with respect to the first location, within a second distance radius with respect to the first location, and present outside of the first distance but within the second distance radius for a specified period of time with respect to a time threshold, and wherein the second distance radius is at least partially determined according to an error distance associated with determining the first location;
determines, subsequent to the parsing, a plurality of attributes of the members of the first formed cluster;
generates and stores a profile for the first formed cluster in the data store based on the determined plurality of attributes;
receives a request from the content provider server to transmit content to UEs of the plurality of UEs associated with a set of attributes;
analyzes, in response to receiving the request, at least some of the plurality of clusters based on a profile associated with each cluster;
determines a subset of clusters of the plurality of clusters associated with the set of attributes in the request; and
transmits the content to the UEs associated with the subset of clusters.

US Pat. No. 10,117,071

COMMUNICATION METHOD

SHARP KABUSHIKI KAISHA, ...

1. A communication method of using a communication terminal to communicate to a server and another apparatus via a network, the method comprising:accepting an operation instruction by said communication terminal;
requesting said server of contents according to said operation instruction by said communication terminal;
receiving said contents from said network according to said request from said communication terminal, by said communication terminal;
causing a first display to show said contents by said communication terminal;
determining whether connection with said another apparatus is established or not by said communication terminal;
transmitting said contents to said another apparatus after a determination is made that connection with said another apparatus is established by said communication terminal;
receiving said contents from said communication terminal by said another apparatus; and
changing said contents by said another apparatus so as to transmit to another server.

US Pat. No. 10,117,069

METHODS AND APPARATUS FOR PROVIDING SELECTIVE ACCESS TO WIRELESS NETWORK RESOURCES USING DETAILED INFORMATION

APPLE INC., Cupertino, C...

1. A method, comprising:at a user terminal that is connected to a public cellular network via a dedicated connection to a base station;
receiving an indication of a plurality of services offered by a femtocell of a private network, wherein;
the private network comprises a group of user terminals approved for access to the femtocell; and
the user terminal is not a member of the private network; and
receiving, from the femtocell, at least one service from the plurality of services offered by the femtocell, wherein the dedicated connection between the user terminal and the base station is maintained and a connection to the femtocell is not established during the receiving of the at least one service from the femtocell and wherein the receiving the at least one service improves at least one aspect of service quality for the user terminal over that when the services are provided by the base station.

US Pat. No. 10,117,060

DETECTING HANDLING OF A DEVICE IN A VEHICLE

Allstate Insurance Compan...

1. A method comprising:determining, by a computing device, a change of an elevation of an apparatus;
determining, based on the change of the elevation of the apparatus, a time period;
determining, during the time period and based on acceleration measurements made by an accelerometer of the apparatus, an axis of gravity of the apparatus;
determining, based on orientation measurements made by a gyroscope of the apparatus, a rotation vector of the apparatus;
determining, based on the axis of gravity of the apparatus and the rotation vector of the apparatus, a rate of rotation of the apparatus perpendicular to the axis of gravity; and
responsive to a determination that the rate of rotation of the apparatus perpendicular to the axis of gravity exceeds a rotation rate threshold, determining, a frequency of handling events in which the apparatus is being used within a vehicle to adjust an insurance policy of the vehicle.

US Pat. No. 10,117,056

METHOD AND SYSTEM FOR PROVIDING LOCATION-BASED SERVICE

Naver Business Platform C...

1. A location-based service providing method for determining a current location of a user terminal in conjunction with a server, the method comprising:receiving a request to provide a location-based service;
requesting the server for first information about a wireless access point associated with a first building in which the user terminal is located in response to the request;
receiving the first information from the server;
collecting second information about a wireless access point located around the user terminal;
determining the current location of the user terminal based on the first information received from the server and the second information,
receiving cell information corresponding to a cell in which the user terminal is located from a base station;
providing a service corresponding to a service application in response to the service application executed on the user terminal being an application supporting a country in which the user terminal is located based on the cell information; and
suspending execution of the service application in response to the application executed on the user terminal not being an application supporting the country in which the user terminal is located based on the cell information.

US Pat. No. 10,117,049

METHODS CIRCUITS SYSTEMS AND ASSOCIATED COMPUTER EXECUTABLE CODE FOR LOCALIZING AND MESSAGING A WIRELESS COMMUNICATION DEVICE

LOYALBLOCKS LTD., Tel Av...

6. A localization server, comprising:a first database for storing records indicative of physical locations of each of a set of retailer stations;
a second database for storing correlations of unique identifiers of mobile devices within a first Client Device Access Network (CDAN) to unique identifiers of the mobile devices in a second communication network;
a communication module for receiving a message from a target device including a coarse location indicator of a coarse location of the target device and a first unique identifier of the target device associated with the CDAN; and
a controller adapted to:
(i) compare the coarse location to locations stored in the first database and identify a retailer station within the set in proximity to the coarse location; and
(ii) retrieve from said second database a second unique identifier of the target device associated with the second communication network;
(iii) automatically trigger direct communication, based on the retrieved second unique identifier, over the second network, between the identified retailer station and the target devicewherein said localization server communicates with the identified retailer station over a third network, distinct from the second communication network.

US Pat. No. 10,117,032

HEARING AID SYSTEM, METHOD, AND RECORDING MEDIUM

INTERNATIONAL BUSINESS MA...

1. A hearing aid system, comprising:a processor; and
a memory, the memory storing instructions to cause the processor to perform:
a cognitive state analysis circuit configured to analyze a cognitive state of a user;
a context analysis circuit configured to analyze a context of the user; and
an audio characteristic controller configured to control an audio characteristic of a hearing aid based on a joint assessment of a combined factor calculated by weighing together the cognitive state of the user and the context of the user,
wherein the context of the user and the cognitive state of the user are independent of each other, and
wherein the cognitive state includes at least one of:
a cohort condition; and
a cognitive level.

US Pat. No. 10,117,026

BONE CONDUCTION SPEAKER AND COMPOUND VIBRATION DEVICE THEREOF

SHENZHEN VOXTECH CO., LTD...

1. A vibration device in a bone conduction speaker, comprising:a first vibrating plate connected to a magnetic component; and
a second vibrating plate, at least a part of the first vibrating plate physically attaching to at least a part of the second vibrating plate, the first vibrating plate and the second vibrating plate being configured to generate vibrations having two different resonance peaks, sounds being generated by the vibrations transferred through a human bone.

US Pat. No. 10,117,007

ROUTING NODE, OPTICAL SWITCHING NETWORK, AND OPTICAL SIGNAL TRANSMISSION METHOD

Huawei Technologies Co..,...

1. A routing node comprises:a transmission waveguide;
an optical buffer that includes an optical buffer output end and configured to:
receive an optical signal; and
parse the optical signal to obtain an identifier of a destination routing node; and
a switching node that includes a switching node output end coupled to the transmission waveguide and a switching node input end coupled to the optical buffer output end, the switching node further includes a switch and an arbiter, the switch including a switch first end coupled to the optical buffer output end and a switch second end coupled to the transmission waveguide, and the arbiter including an arbiter input end coupled to the optical buffer output end and an arbiter output end coupled to the switch first end, the arbiter configured to:
receive the identifier from the optical buffer;
determine, according to the identifier, whether an output port required by the destination routing node is in an idle state or a busy state;
control the optical buffer to store the optical signal when the output port is in a busy state; and
send the optical signal to the destination routing node using the transmission waveguide when the output port is in an idle state,
wherein the transmission waveguide corresponds to the output port.

US Pat. No. 10,117,004

METHOD FOR SIMULTANEOUSLY DETECTING A PLURALITY OF RFID TAGS USING MULTIUSER DETECTION

Collision Communications,...

1. A method for distinguishing responses received by an RFID detector from a plurality of simultaneously queried RFID tags, the method comprising:querying the plurality of RFID tags;
receiving an aggregated RF response from the plurality of RFID tags; and
applying multiuser detection including jointly demodulating a plurality of colliding RFID tag responses included in the aggregated RF response according to at least one estimated parameter so as to distinguish each of the RFID tag responses included in the aggregated RF response.

US Pat. No. 10,116,999

METHOD FOR ADVERTISERS TO SPONSOR BROADCASTS WITHOUT COMMERCIALS

Firtiva Corporation, Cup...

1. A computer-implemented method comprising:receiving a transmission of a broadcast, the transmission including embedded information and content, the embedded information including data associated with the content, the data comprising at least one of a TV channel, content name, timestamp, time slice, and sponsor identification;
determining if there is any embedded information in the broadcast;
extracting the content from the broadcast by use of a decoder to split the extracted content from the embedded information, the embedded information being one or more data packets inserted in the broadcast with a frame of content;
sending the extracted content to a display;
examining the embedded information for an end-of-slice marker that signals the end of a time slice;
maintaining viewing counters to keep track of how much time a viewer spent viewing the content corresponding to the time slice;
recording the viewing counters as viewing information when the end of a time slice is detected, the time slice corresponding to the sponsor identification;
storing the embedded information on a storage device of a computer;
transmitting a user identifier and the viewing information to a remote server; and
receiving an enticement based on the embedded information, the viewing information, user information retrieved based on the user identifier, and a sponsor of the time slice corresponding to the sponsor identification.

US Pat. No. 10,116,982

SYSTEMS AND METHODS FOR AUTOMATED EXTRACTION OF CLOSED CAPTIONS IN REAL TIME OR NEAR REAL-TIME AND TAGGING OF STREAMING DATA FOR ADVERTISEMENTS

CROSSBAR MEDIA GROUP, INC...

1. A method for finding target content, comprising:providing at least one device and a cloud-based platform, wherein the cloud-based platform comprises at least one server and at least one database; wherein the at least one device communicates with the cloud-based platform over the Internet;
the at least one device receiving a live broadcast and/or streaming audio and video content;
the at least one device extracting captions of the live broadcast and/or the audio and video content in real time;
the cloud-based platform receiving extracted captions from the at least one device and storing the extracted captions in the at least one database;
the cloud-based platform searching the extracted captions for at least one keyword relating to the target content, thereby creating search result data;
the cloud-based platform harvesting social media data relevant to the target content in a predetermined period of time from the Internet; and
the cloud-based platform determining an impact of the target content by correlating the search result data with the social media data.

US Pat. No. 10,116,977

DYNAMIC DELAY EQUALIZATION FOR MEDIA TRANSPORT

BIAMP SYSTEMS CORPORATION...

1. A method, comprising:receiving a plurality of related media signals along different media paths by a media transport system;
determining an uncorrected propagation delay for each media path and determining a longest propagation delay that is a maximum of the uncorrected propagation delays;
delaying each of the related media signals by an amount related to a difference between an uncorrected propagation delay for each media path and a longest propagation delay that is a maximum of the uncorrected propagation delays of that related media signal;
in response to a change to a propagation delay of at least one of the related media signals while transporting the related media signals, determining a revised uncorrected propagation delay for each media path and determining a revised longest propagation delay that is a maximum of the revised uncorrected propagation delays; and
delaying each of the related media signals by an amount related to a difference between the revised longest propagation delay and the revised uncorrected propagation delay of that related media signal.

US Pat. No. 10,116,963

VECTOR-BASED ENCODING TECHNIQUE FOR LOW-BANDWIDTH DELIVERY OR STREAMING OF VECTORIZABLE VIDEOS

DOT LEARN INC., Edison, ...

1. A method of encoding a media file, the method comprising:receiving a video stream depicting a drawing including at least one object being drawn on a drawing surface;
detecting, in the video stream, at least one path included in the drawing and representing the at least one object;
storing a plurality of coordinate sets representing the at least one path;
identifying a first coordinate set of the plurality of coordinate sets;
executing an interpolation function to determine an interpolated path represented by a subset of the plurality of coordinate sets, the subset of the plurality of coordinate sets not including the first coordinate set;
determining a path length of the interpolated path;
determining that the interpolated path represents the at least one path to a degree of accuracy exceeding a defined threshold;
and
storing the subset of the plurality of coordinate sets in a text file format.

US Pat. No. 10,116,913

3D VIRTUAL REALITY MODEL SHARING AND MONETIZATION ELECTRONIC PLATFORM SYSTEM

DOUBLEME, INC, San Jose,...

1. A three-dimensional body double-generating, social sharing, and monetization electronic system comprising:a HoloPortal electronic system that incorporates a dedicated physical studio space including a center stage, a plurality of stationary cameras surrounding the center stage, and a 3D reconstruction electronic system, which is configured to capture, calculate, reconstruct, and generate graphical transformation of a target object to create a 3D body double model from pre-calibrated image sources from the plurality of stationary cameras;
a HoloCloud electronic system comprising uncalibrated portable video recording devices positioned at multiple-angle views around the target object to generate uncalibrated raw multiple-angle video data streams, a cloud computing resource containing a scalable number of graphics processing units (GPU's) that receive the uncalibrated raw multiple-angle video data streams from the uncalibrated portable video recording devices, a pre-processing module in the cloud computing resource that calibrates temporal, spatial, and photometrical variables deduced from the uncalibrated raw multiple angle video data streams as a post-capture process, which in turn generates background 3D geometry and 360-degree virtual reality videos, and a 3D reconstruction module in the cloud computing resource for providing depth map computations, voxel grid reconstructions, and deformed mesh generations for creation of another 3D body double model that resembles the target object;
a 3D model and content database configured to store the 3D body double model created from the HoloPortal electronic system or the HoloCloud electronic system;
an electronic 3D content sharing software executed on a computer server connected to the 3D model and content database, wherein the electronic 3D content sharing software configures the computer server to upload, list, transmit, and share 3D model animations and 3D contents that are created from the HoloPortal electronic system and the HoloCloud electronic system; and
a client-side 3D content viewer and management user interface executed on a notebook computer, a desktop computer, a mobile communication device, or a web server, wherein the client-side 3D content viewer and management user interface is configured to purchase, sell, transmit, receive, or playback a 3D content incorporating the 3D body double model via the electronic 3D content sharing software and the 3D model and content database.

US Pat. No. 10,116,898

INTERFACE FOR A VIDEO CALL

FACEBOOK, INC., Menlo Pa...

1. A method, comprising:displaying a full-sized interface for a video call on a display associated with a participant in the video call, wherein the display is a touch interface;
displaying a reduced-size interface for the video call on a portion of the display associated with the first participant in the video call, the portion being smaller than an entirety of the display, the interface comprising a main window displaying a current relevant video communication in the video call and a roster of additional participants in the video call;
registering a haptic contact initiation signal at a first location on the display in the portion of the display comprising the interface;
registering a haptic contact release signal at a second location on the display; and
moving the interface for the video call based on a difference between the first location and the second location;
receiving an instruction to display a second video communication associated with a second participant that is identified as a previous relevant video communication in the video call while a first video communication associated with the first participant is flagged as the current relevant video communication; and
displaying the second video communication in the main window of the interface.

US Pat. No. 10,116,897

PHOTOMETRIC STABILIZATION FOR TIME-COMPRESSED VIDEO

Adobe Systems Incorporate...

1. In a digital medium environment to reduce at least some photometric characteristic changes of time-compressed video, a method implemented by a computing device, the method comprising:determining, by the computing device, correspondences of pixels in adjacent frames of a time-compressed video;
determining, by the computing device, photometric transformations between the adjacent frames of the time-compressed video, the photometric transformations describing how photometric characteristics of the correspondences change between the adjacent frames;
computing, by the computing device, a measure of photometric similarity between the adjacent frames based on the photometric characteristics of the correspondences;
computing, by the computing device, filters for smoothing photometric characteristic changes across the time-compressed video as combinations of the determined photometric transformations by combining the determined photometric transformations according to weights indicating that photometric transformations between similar frames of the time-compressed video, as indicated by the measure of photometric similarity, influence the filters more than the photometric transformations between less similar frames; and
generating, by the computing device, digital content comprising photometrically stabilized time-compressed video, in part, by using the computed filters to smooth the photometric characteristic changes.

US Pat. No. 10,116,887

SOLID-STATE IMAGING DEVICE AND CAMERA

PANASONIC INTELLECTUAL PR...

1. A solid-state imaging device, comprising:a plurality of pixel circuits arranged in rows and columns;
a plurality of unit power supply circuits that generate a second power supply voltage from a first power supply voltage based on a reference voltage and supply the second power supply voltage to amplifier transistors provided in the plurality of pixel circuits; and
a regulator circuit that generates the reference voltage that is constant,
wherein each of the plurality of unit power supply circuits is provided for a corresponding one of the columns of the plurality of pixel circuits or for a corresponding one of the pixel circuits, and supplies the second power supply voltage to the amplifier transistors in the pixel circuits that belong to the corresponding one of the columns or to the amplifier transistor in the corresponding one of the pixel circuits.

US Pat. No. 10,116,865

IMAGE PROCESSING APPARATUS AND IMAGE PROCESSING METHOD FOR CALCULATING MOTION VECTOR BETWEEN IMAGES WITH DIFFERENT IN-FOCUS POSITIONS

Canon Kabushiki Kaisha, ...

1. An electronic device having a function based on a motion vector, comprising:one or more processors;
a memory that stores a program, which is executable by the one or more processors and causes, when executed by the one or more processors, the one or more processors to function as:
a detection unit configured to detect a plurality of motion vectors between a first image and a second image based on a correlation between the first image and the second image;
a determination unit configured to determine a degree of reliability for each of the plurality of motion vectors based on a corresponding evaluation value regarding the correlation; and
a control unit configured to control the function based on a motion vector the degree of reliability of which is evaluated as being high, from among the plurality of motion vectors,
wherein the determination unit determines the degree of reliability for each of the plurality of motion of vectors further based on a corresponding difference in amount of bokeh between the first image and the second image, and
wherein the function includes at least one of an image stabilization function and a subject tracking function.

US Pat. No. 10,116,800

TECHNIQUES FOR BEHAVIORAL PAIRING IN A CONTACT CENTER SYSTEM

Afiniti Europe Technologi...

1. A method for behavioral pairing in a contact center system comprising:determining, by at least one computer processor communicatively coupled to and configured to perform behavioral pairing operations in the contact center system, a plurality of agents available for connection to a contact;
determining, by the at least one computer processor, a plurality of preferred contact-agent pairings among possible pairings between the contact and the plurality of agents;
selecting, by the at least one computer processor, one of the plurality of preferred contact-agent pairings according to a probabilistic network flow model that is constrained by agent skills and contact skill needs, wherein the probabilistic network flow model is adjusted to minimize agent utilization imbalance according to the constraints of the agent skills and the contact skill needs and to optimize performance of the contact center system, wherein the optimized performance of the contact center system is attributable to the probabilistic network flow model; and
outputting, by the at least one computer processor, the selected one of the plurality of preferred contact-agent pairings for connection in the contact center system.

US Pat. No. 10,116,797

TECHNIQUES FOR BENCHMARKING PAIRING STRATEGIES IN A CONTACT CENTER SYSTEM

Afiniti Europe Technologi...

1. A method for benchmarking pairing strategies in a contact center system comprising:cycling, by at least one computer processor communicatively coupled to and configured to operate in the contact center system, among at least two pairing strategies, wherein the cycling comprises establishing, by a routing engine of the contact center system, a connection between communication equipment of a contact and communication equipment of an agent based upon at least one pairing strategy of the at least two pairing strategies;
determining, by the at least one computer processor, a differential value attributable to the at least one pairing strategy of the at least two pairing strategies;
determining, by the at least one computer processor, a difference in performance between the at least two pairing strategies, wherein the difference in performance provides an indication that pairing contacts and agents using a first pairing strategy of the at least two pairing strategies results in a performance gain for the contact center system attributable to the first pairing strategy, wherein the difference in performance also provides an indication that optimizing performance of the contact center system is realized using the first pairing strategy instead of another of the at least two pairing strategies; and
outputting, by the at least one computer processor, the difference in performance between the at least two pairing strategies for benchmarking the at least two pairing strategies.

US Pat. No. 10,116,795

TECHNIQUES FOR ESTIMATING EXPECTED PERFORMANCE IN A TASK ASSIGNMENT SYSTEM

Afiniti Europe Technologi...

1. A method comprising:receiving, by at least one computer processor communicatively coupled to and configured to perform task assignment operations in a task assignment system, a first plurality of historical agent-task assignments;
determining, by the at least one computer processor, a closeness of fit for each of the first plurality of historical agent-task assignments to a preferred task assignment strategy for validating the preferred task assignment strategy;
determining, by the at least one computer processor, a threshold closeness of fit for each of the first plurality of historical agent-task assignments to the preferred task assignment strategy;
determining, by the at least one computer processor, an expected performance of the task assignment system using the preferred task assignment strategy based on a subset of the first plurality of historical agent-task assignments that are within the threshold closeness of fit;
outputting, by the at least one computer processor, the expected performance for use in pairing agents with tasks in the task assignment system based upon the preferred task assignment strategy; and
establishing, by the at least one computer processor, in a switch of the task assignment system, a connection between an agent and a task based upon the expected performance to realize a first amount of performance gain for the task assignment system attributable to the preferred task assignment strategy, wherein actual performance of the task assignment system is optimized by using the validated preferred task assignment strategy based on the expected performance.

US Pat. No. 10,116,785

SYSTEM AND METHOD FOR SUPPORTING MOVABLE OBJECT APPLICATION DEVELOPMENT

SZ DJI TECHNOLOGY CO., LT...

1. A method for supporting application development in a movable object environment, comprising:establishing, via a movable object manager, a connection with a movable object configured to process commands for controlling at least one hardware module on the movable object;
receiving, via said movable object manager, one or more data packets from the movable object, wherein the data packets include information corresponding to the at least one hardware module on the movable object;
providing, via said movable object manager, the information in said one or more data packets to an application on a user terminal; and
providing, via said movable object manager, one or more commands from the application to the movable object, wherein the commands include information corresponding to the at least one hardware module on the movable object.

US Pat. No. 10,116,767

SCALING CLOUD RENDEZVOUS POINTS IN A HIERARCHICAL AND DISTRIBUTED MANNER

Furturewei Technologies, ...

1. A service provider (SP) cloud rendezvous point (CRP-SP) in a fixed cloud rendezvous point (CRP) hierarchy, the CRP-SP comprising:a memory comprising a cloudcasting information base (CCIB);
a receiver configured to receive a Register request from a first site CRP (CRP Site) in an SP network, the Register request indicating a first portion of a virtual extensible network (VXN) is reachable by the SP network at the first CRP Site;
a processor coupled to the receiver and the memory, the processor configured to query the CCIB to determine that a second portion of the VXN is reachable by the SP network at a second CRP Site; and
a transmitter coupled to the processor and configured to transmit Report messages to both the first CRP Site and the second CRP Site, the Report messages indicating the VXN is reachable at both the first CRP Site and the second CRP Site.

US Pat. No. 10,116,758

DELIVERING NOTIFICATIONS BASED ON PREDICTION OF USER ACTIVITY

Facebook, Inc., Menlo Pa...

1. A method comprising:storing, by an online system, activity data describing activity performed on the online system by a user of the online system;
receiving one or more content items from users of the online system;
identifying a future time interval associated with the user for delivery of notifications associated with the received content items;
extracting, from the activity data, features associated with the future time interval for the user, wherein extracting the features comprises:
identifying a preceding time period comprising one or more sub-intervals;
for each of the one or more sub-intervals, determining whether the user was active during the sub-interval at least once;
generating an activity metric representing a count of sub-intervals during which the user was active at least once; and
providing the extracted features as input to a model generated based on machine learning;
obtaining, as an output from the model, a score indicative of a likelihood that the user will be active on the online system at least once during the future time interval;
responsive to the score exceeding a threshold value, selecting one or more notifications, the selection comprising:
identifying a plurality of candidate notifications, each candidate notification associated with a content object;
for each of the plurality of candidate notifications generating an interaction score, the generating comprising:
determining a base score using the number of user actions performed with the content object, and
decaying the base score based on time elapsed since the content object was added to the online system; and
identifying the one or more candidate notifications based on the interaction scores;
during a delay period following the selection and prior to the future time interval, withholding a selected notification associated with a content object and monitoring whether the user has viewed the content object; and
responsive to determining that the user did not view the content object during the delay period, delivering the selected notification to the user prior to the future time interval, wherein the delivering of the selected notification is initiated at the online system.

US Pat. No. 10,116,753

SYSTEM AND METHOD FOR SUPPORTING DATA COMMUNICATION IN A HETEROGENEOUS ENVIRONMENT

SZ DJI TECHNOLOGY CO., LT...

1. A method for supporting data communication in a heterogeneous environment, comprising:establishing a connection between a first device and a second device, wherein the connection is based on a protocol, which associates a host mode or an accessory mode with one or more connected devices;
determining, via a controller on the first device, a device type associated with the second device based on a mobile device platform installed on the second device, wherein determining the device type comprises:
detecting an identifier value associated with the mobile device platform installed on the second device;
identifying the mobile device platform installed on the second device based on whether the detected identifier value matches a predetermined value corresponding to the mobile device platform; and
determining the device type based on the identified mobile device platform;
configuring the first device to be in either the host mode or the accessory mode, based on the determined device type associated with the second device, to handle data communication between the first device and the second device; and
exchanging data between the first device and an application running on the second device via a communication interface associated with the mobile device platform installed on the second device.

US Pat. No. 10,116,752

SYSTEM AND METHOD FOR BRIDGING DIVERGENT INFORMATION NETWORKS

KAROS HEALTH INCORPORATED...

1. A computer network implemented system for managing network communication in a health information exchange environment comprising:one or more computers that include at least one memory and at least one processor, the one or more computers implementing one or more bridge utilities, the one or more bridge utilities creating and maintaining a network overlay including at least one network layer layered over communication protocols of divergent network infrastructures in the health information exchange environment, each bridge utility, executed by the at least one processor, comprising:
a first anchor component connected behind a firewall of a first health information communication network of a first healthcare enterprise, the first anchor component providing an outbound proxy for devices on the first health information communication network; and
a second anchor component connected behind a second firewall of a second health information communication network of a second healthcare enterprise, the second anchor component providing an outbound proxy for devices on the second health information communication network;
the first anchor component and the second anchor component configured for network communication with each other though their respective firewalls and via at least one span utility;
the first anchor component configured to:
detect clinical devices on the first health information communication network;
maintain, in a first device registry, a first set of clinical device communication protocol parameters for the detected clinical devices on the first health information communication network; and
communicate, to the at least one span utility, device identifiers identifying the detected clinical devices on the first health information communication network;
the second anchor component configured to:
detect clinical devices on the second health information communication network;
maintain, in a second device registry, a second set of clinical device communication protocol parameters for the detected clinical devices on the second health information communication network; and
communicate, to the at least one span utility, device identifiers identifying the detected clinical devices on the second health information communication network;
the first and second anchor components and the at least one span utility configured to: send and receive signaling communications between them for configuring anchor to anchor connections and for sharing the device identifiers for the detected devices on the first and second health information communication networks; and
the second anchor component configured to:
upon receiving a data connection request from a first clinical device on the first health information communication network via the first anchor component, the data connection request including a device identifier associated with a second clinical device detected on the second health information communication network, establishing a first data connection with the first anchor component; and
bridging the first data connection to the second clinical device using the second set of clinical device communication protocol parameters in the second device registry;
wherein the signaling communications between the first and second anchor components for sharing the device identifiers and for configuring the anchor to anchor connections are routed via a connection management layer via the at least one span utility; and
wherein the first data connection enables transmission of data between the second anchor component and the first anchor component outside the connection management layer, and wherein the data transmitted over the first data connection is not routed via the at least one span utility.

US Pat. No. 10,116,747

ELECTRICITY PROVIDER CONTENT PLATFORM

TXU ENERGY RETAIL COMPANY...

1. A system for providing access to a content platform of an electricity provider, comprising:an interface operable to:
receive a request to access content of a content platform of an electricity provider from a communication device;
receive a proposed change in electricity consumption of an appliance from the communication device;
one or more processors communicatively coupled to the interface, the one or more processors operable to:
determine, based on the received request, a display format for the communication device from a plurality of display formats;
convert content from the content platform in the determined display format of the communication device;
determine a predicted change in electricity charges based on the proposed change; and
the interface further operable to:
communicate the content in the determined display format to the communication device; and
communicate the predicted change in electricity charges to the communication device.

US Pat. No. 10,116,678

SYSTEM FOR DETECTING FRAUDULENT ELECTRONIC COMMUNICATIONS IMPERSONATION, INSIDER THREATS AND ATTACKS

Verrafid LLC, Celebratio...

1. An apparatus for characterizing communications going to and from a first domain, the apparatus comprising:a processor; and
a memory containing program instructions that when executed by the processor cause the processor to manage a fraudulent communications detection system and to, for a predetermined time period, obtain each communication going to and from the first domain and, for each obtained communication:
analyze one or more parameters of the obtained communication;
store the analyzed one or more parameters of the obtained communication with respect to a sender of the obtained communication and one or more recipients of the obtained communication;
extrapolate and characterize each of one or more relationships among the sender and the one or more recipients of the obtained communication as a function of the analyzed one or more parameters;
update a store of extrapolated relationships and associated characterizations of communications among the sender and the one or more recipients of the obtained communication; and
associate a direction value with each stored relationship and characterization, wherein the direction value indicates a respective relationship or characterization is directed to or coming from the first domain,
wherein the store of extrapolated relationships and associated characterizations and direction values of communications among the sender and the one or more recipients is operative to improve operation of the fraudulent communications detection system associated with the processor.

US Pat. No. 10,116,659

SYSTEM FOR REGULATING ACCESS TO AND DISTRIBUTING CONTENT IN A NETWORK

MULTIMEDIA CONTENT MANAGE...

1. A method for providing protected media access, comprising:producing, by a controller node that manages access to protected content, instructions for accessing the protected content;
transmitting, by the controller node, the produced instructions over the Internet for receipt by a plurality of client devices that are remote from the controller node;
receiving, by the controller node, requests for access to the protected content originating at specific client devices within the plurality of client devices, the requests transmitted in accordance with the produced instructions; and
selectively transmitting, by the controller node, the requested protected content to the specific client devices via the Internet.

US Pat. No. 10,116,651

TECHNOLOGIES FOR ENHANCING COMPUTER SECURITY

KARA PARTNERS LLC, Midlo...

1. A method of securely transmitting data, comprising:receiving, at at least one processor, an unencrypted data stream comprising a first sequence of values;
segmenting, by the at least one processor, the first sequence of values into words having a word-length equal to either a first variable or a second variable different from the first variable based on a mode of a switch configured to switch between a first mode and a second mode, said plurality of words including an original first word having a word-length equal to the first variable based on the switch being in the first mode and an original second word having a word-length equal to the second variable based on the switch being in the second mode;
inserting random values, by the at least one processor, at predetermined locations in the original first and second words to generate modified first and second words, the modified first and second words having a word-length equal to a third variable different than the first and second variables; and
combining, by the at least one processor, the modified first and second words into a second sequence of values defining an encrypted data stream,
wherein a value of the first variable does not equal a value of the second variable, the value of the first variable does not equal a value of the third variable, and the value of the second variable does not equal the value of the third variable.

US Pat. No. 10,116,650

METHODS AND SYSTEMS FOR CONTACT IMPORTING USING A MOBILE DEVICE

Facebook, Inc., Menlo Pa...

1. A method comprising:by one or more computing devices of a social-networking system, providing to a user of a wireless service provider a reference code identifying the user, wherein the user is associated with the social-networking system;
by the one or more computing devices, upon receiving the reference code by a mobile computing device of the user, providing an indication for the user to log in to the wireless service provider;
by the one or more computing devices, receiving first contact information for contacts of the user from the wireless service provider based on at least the reference code, wherein the first contact information is maintained by the wireless service provider;
by the one or more computing devices, identifying differences between the first contact information and second contact information maintained by the social network system; and
by the one or more computing devices, updating the second contact information maintained by the social network system based on the identified differences, synchronizing the contact information maintained by the wireless service provider and the contact information maintained by the social-networking system, identifying new contact information including new contacts based on the synchronizing, requesting a selection of the new contacts to be added to a social network of the user, and providing invitations to the selection of the new contacts to join the social network of the user.

US Pat. No. 10,116,627

METHODS AND SYSTEMS FOR IDENTIFYING TARGETED CONTENT ITEM FOR USER

CONDUENT BUSINESS SERVICE...

1. A method for identifying a targeted content item for a user, the method comprising:receiving, by one or more processors, one or more encrypted first attributes associated with said user, and a first key, wherein said one or more encrypted first attributes are generated by encrypting one or more first attributes of said user using said first key;
encrypting, by said one or more processors, one or more content items using said first key, wherein said one or more content items are stored in a data structure such that said one or more content items are indexed in said data structure according to respective bit-strings representing one or more second attributes associated with each of said one or more content items;
determining, by said one or more processors, at least one encrypted content item from said data structure that corresponds with said one or more first attributes without decrypting said one or more encrypted first attributes, wherein determining said at least one encrypted content item comprises:
performing an iterative Homomorphic cryptographic process on said data structure using said one or more encrypted content items in said data structure, said respective bit-strings representing the one or more second attributes of said indexed one or more content items, and said one or more encrypted first attributes; and
providing said at least one encrypted content item to said user, wherein said at least one encrypted content item is decrypted to generate said targeted content item and wherein performing said iterative Homomorphic cryptographic process prevents release of said one or more second attributes to said user.

US Pat. No. 10,116,624

INTELLIGENT SORTING FOR N-WAY SECURE SPLIT TUNNEL

Aerohive Networks, Inc., ...

1. A method comprising:sorting outgoing datagrams into one of at least three categories, wherein the at least three categories include a first category of datagrams addressed to a central network location, a second category of datagrams addressed to destinations on a white list, and a third category of datagrams addressed to other destinations absent from the white list;
sending datagrams in the first category to the central network location along an N-way split virtual private network tunnel, wherein N is an integer greater than or equal to three;
sending datagrams in the second category to the destinations on the white list along the N-way split virtual private network tunnel;
sending datagrams in the third category to a scanning service website along the N-way split virtual private network tunnel, the scanning service website configured to provide a first scrubbing service for HTTP datagrams and a second scrubbing service for SMTP, POP, and IMAP datagrams.

US Pat. No. 10,116,615

METHOD AND SYSTEM OF MANAGING EPHEMERAL POST IN A SOCIAL NETWORKING SYSTEM

FACEBOOK, INC., Menlo Pa...

1. A method comprising:receiving, from a first client device associated with a first user, a request to post selected content as a part of an ephemeral post;
identifying physical location information for the first client device at a time of the request;
determining an ephemeral count variable by correlating the physical location information for the first client device at the time of the request to a plurality of default ephemeral values;
setting the ephemeral count variable for the ephemeral post, wherein the ephemeral post is blocked when the ephemeral count variable is satisfied;
providing, to one or more additional client devices associated with one or more additional users, access to the selected content within the ephemeral post;
detecting that the ephemeral count variable is satisfied; and
blocking, the one or more additional client devices, access to the selected content and the ephemeral post upon detecting that the ephemeral count variable is satisfied.

US Pat. No. 10,116,610

AUTOMOTIVE WHEEL OVERLAY ATTACHMENT SYSTEM

Keystone Automotive Opera...

1. A vehicle wheel center cap assembly comprising:a center cap that engages a center recess of a vehicle wheel; and
a mechanism for securing a vehicle wheel overlay to the center cap, the vehicle wheel overlay including a plurality of lug nut engaging areas;
wherein the vehicle wheel includes a plurality of recesses into which a lug nut is inserted; and
wherein each lug nut engaging area includes at least one extension configured to engage a portion of a lug nut after the lug nut has been tightened.

US Pat. No. 10,116,599

TOPIC CATEGORIZED INSTANT MESSAGE COMMUNICATION

Cisco Technology, Inc., ...

1. A computer-implemented method comprising:defining, for an online conference session, a plurality of pages based on information received from a moderating participant having administrative privileges for the conference session, each page corresponding to a discussion topic of a text-based communication;
selecting, by a request received from the moderating participant, one of the plurality of pages;
synchronizing the selected page, such that the selected page is displayed to the moderating participant and each of one or more other participants in the online conference session;
after selecting one of the plurality of pages, chronologically displaying, in the display of the selected page, an entirety of the text-based communication that is generated while the selected page remains selected until another page of the plurality of pages is selected; and
receiving, from the moderating participant, commands to manage the online conference session, the commands including a command to add a new page corresponding to a new discussion topic, a command to delete at least one page of the plurality of pages, a command to modify the selected page, a command to search for a specific page of the plurality of pages, and a command to close the selected page.

US Pat. No. 10,116,557

DIRECTIONAL TWO-DIMENSIONAL ROUTER AND INTERCONNECTION NETWORK FOR FIELD PROGRAMMABLE GATE ARRAYS, AND OTHER CIRCUITS AND APPLICATIONS OF THE ROUTER AND NETWORK

Gray Research LLC, Belle...

1. A signal router, comprising:a first input node configured to receive a first input signal;
a second input node configured to receive a second input signal;
a first output node;
a second output node;
a switch circuit coupled to the first and second input nodes and to the first and second output nodes; and
a routing circuit configured
to cause the switch circuit
to couple the first input signal to the first output node in response to the first input signal being valid,
to couple the second input signal to the second output node in response to the second input signal being valid, and
to couple the first input signal to the second output node in response to the first input signal being valid and the second input signal being invalid.

US Pat. No. 10,116,528

DIRECT NETWORK TRAFFIC MONITORING WITHIN VM PLATFORMS IN VIRTUAL PROCESSING ENVIRONMENTS

Keysight Technologies Sin...

1. A method to monitor packet traffic, comprising:generating network packets using one or more client applications operating within each of a plurality of client virtual machine (VM) platforms operating within a first VM host server;
at each of a plurality of client packet monitor applications, at least one client packet monitor application operating within each of the plurality of client VM platforms:
obtaining copies of network packets for the one or more client applications operating within that client VM platform to generate network packet copies;
encapsulating the network packet copies with encapsulation headers to form encapsulated network packet copies for an encapsulation tunnel; and
forwarding the encapsulated network packet copies through the encapsulation tunnel to at least one tool VM platform operating within a second VM host server;
wherein each of the plurality of client packet monitor applications uses a separate encapsulation tunnel to forward its encapsulated network packet copies.

US Pat. No. 10,116,520

APPARATUS AND METHOD FOR GENERATING A NETWORK ON CHIP IN AN ELECTRONIC DEVICE

Samsung Electronics Co., ...

1. A method of generating a network-on-chip (NoC) in an electronic device, the method comprising:clustering a plurality of cores based on total communication energy comprising first communication energy among a plurality of voltage-frequency-islands (VFIs) and second communication energy inside the plurality of VFIs;
generating at least one router based on a pre-determined value corresponding to a number of ports of the at least one router;
selecting one pair of cores having a maximum number of communications among the plurality of cores for performing a communication inside the plurality of VFIs; and
connecting the selected one pair of cores to one of the at least one router.

US Pat. No. 10,116,519

PROGRAMMABLE DISTRIBUTED MANAGEMENT SYSTEM OF INTERCONNECTED THINGS AND APPLICATIONS

YODIWO AB, Stockholm (SE...

1. A system that controls and interfaces with one or more Internet of Things devices comprising:at least one gateway;
at least one Internet of Things device connected to the gateway;
a cloud computing based system in communication with the device;
a user story interpreter that converts a master graph into one or more virtual graphs; and
a processor executing a rule processing application process which parses a set of user rules generated from a user story into a number of decision making algorithms which will be distributed from the cloud computing based system to the at least one gateway to control the at least one Internet of Things device.

US Pat. No. 10,116,461

CONTROL INFRASTRUCTURE

SYSTECH CORPORATION, San...

1. A system comprising:a script execution module comprising
a compiler that compiles scripts, represented in a base scripting language, into virtual-machine programs, wherein the scripts comprise instructions that reference device properties,
a virtual machine that executes virtual-machine programs, and
a script manager that stores scripts in a script registry, retrieves scripts from the script registry, and loads scripts into the compiler; and
one or more gateways, wherein each of the one or more gateways is communicatively connected to one or more physical devices, and wherein each of the one or more gateways comprises
at least one hardware processor,
one or more drivers, wherein each of the one or more drivers communicates with at least one of the one or more physical devices using a communication protocol to read, write, or read and write device properties of the physical device, and
a device manager that, when executed by the at least one hardware processor, maps device properties referenced in the virtual-machine programs to device properties used by the one or more drivers, according to a mapping.

US Pat. No. 10,116,451

FILE BACKUPS USING A TRUSTED STORAGE REGION

Intel Corporation, Santa...

1. A system for using a trusted storage region to back up files, the system comprising:a processor and a memory coupled to the processor, the memory comprising instructions which, when executed by the processor, cause the processor to:
execute a backup recovery process in a secure enclave provided by the processor, backup recovery process causing the processor to:
generate a public/private key pair;
provide the public key to a storage device comprising a standard storage region (SSR) a trusted storage region (TSR), the TSR not being writable by an instruction that is not signed using the private key;
detect a trigger to back up a file in the SSR to the TSR;
send a write instruction to the storage device to perform the backup, the write instruction signed using the private key;
cause the storage device to verily the private key signature, of the write instruction, using the public key; and
write a backup of the file to the TSR based on the private key signature being verified, wherein the TSR cannot be formatted by an operating system (OS) on the storage device, the memory further comprising instructions which, when executed by the processor, cause the processor to:
detect a trigger to recover the file from the TSR;
format the storage device using the OS;
install a new operating system on the formatted storage device; and
write the backup of the file from the TSR to the SSR.

US Pat. No. 10,116,450

MERKLE SIGNATURE SCHEME USING SUBTREES

ISARA Corporation, Water...

1. A method for cryptographic communications in a distributed computing system comprising multiple computational units, the method comprising:generating a cryptographic hash tree comprising multiple subtrees and storing the cryptographic hash tree in non-volatile memory, wherein generating the cryptographic hash tree comprises:
based on a cut-off level below a root node of the cryptographic hash tree, generating a plurality of subtree data units in the non-volatile memory, each subtree data unit representing nodes of a respective subtree of the cryptographic hash tree and a first authentication path portion comprising nodes outside the subtree, the subtrees of the cryptographic hash tree each comprising a respective subtree root node at the cut-off level below the root node of the cryptographic hash tree and lowest-level nodes of the cryptographic hash tree, the lowest-level nodes being based on respective verification keys for a one-time signature (OTS) scheme,
loading a first subtree data unit of the plurality of subtree data units from the non-volatile memory into a volatile memory of a first computational unit in the distributed computing system;
based on the first subtree data unit in the volatile memory of the first computational unit, by operation of one or more processors coupled to the volatile memory of the first computational unit, generating a first OTS using a first signing key associated with a first verification key, the first verification key being associated with a lowest-level node in a first subtree represented by the first subtree data unit;
generating a first digital signature of a message based on the first subtree data unit, the first digital signature comprising: the first OTS, the first verification key, the first authentication path portion associated with the first subtree, and a second authentication path portion comprising one or more nodes of the first subtree; and
transmitting the first digital signature based on the first subtree data unit, over a communication network, from the first computational unit to a recipient node, wherein the first digital signature based on the first subtree data unit is used by the recipient node to verify the sender of the message.

US Pat. No. 10,116,448

TRANSACTION AUTHORIZATION METHOD AND SYSTEM

Meontrust Inc, (FI)

1. A method for authorizing a transaction, the method comprising the following acts performed by a telecommunications server configured to act as an authentication provider:at least one preparatory phase; and
at least one authorization phase;
wherein the at least one preparatory phase comprises for each of several user accounts:
registering a user account via a user terminal;
registering a plurality of personal devices with the registered user account, wherein registering of a personal device comprises registering an authentication application installed in that personal device;
wherein the authentication application in the registered personal device is configured to:
indicate at least a subset of received transaction-specific details via a user interface;
receive transaction-specific instructions via the user interface; and
digitally sign the transaction-specific instructions by using a cryptographic private key assigned to the user account;
wherein the at least one authorization phase performed by the telecommunications server comprises for each of several transactions related to one of the several user accounts:
receiving knowledge of a transaction relating to a user of a user terminal;
determining, in response to receiving the knowledge, a user account related to the transaction;
receiving a request for details specific to the transaction from at least one personal device;
checking, whether the at least one personal device wherefrom the request is received belongs to the plurality of personal devices registered with the user account determined to relate to the transaction;
providing, in response to the at least one personal device wherefrom the request is received belonging to the plurality of personal devices registered with the user account determined to relate to the transaction, the requested details specific to the transaction to the authentication application in the at least one personal device wherefrom the request for details specific to the transaction were received;
receiving, after the providing, from the authentication application in the at least one personal device a digitally signed transmission which indicates transaction-specific instructions received via the user interface by the authentication application in the at least one personal device; and
authorizing or denying the transaction based on the received transaction-specific instructions.

US Pat. No. 10,116,443

PAIRING VERIFICATION IN SUPERSINGULAR ISOGENY-BASED CRYPTOGRAPHIC PROTOCOLS

ISARA Corporation, Water...

1. A supersingular isogeny-based cryptography method, comprising:obtaining a secret integer of a first entity;
obtaining a public key of a second entity, the public key comprising a first image curve and a first pair of elliptic curve points;
obtaining a first pairing value based on a second pair of elliptic curve points defined by a supersingular isogeny-based cryptosystem;
computing, by operation of one or more processors, a second pairing value based on the first pair of elliptic curve points;
validating the public key, wherein validating the public key comprises verifying whether the first pairing value matches the second pairing value;
computing, by operation of one or more processors, a second image curve based on the secret integer and the first pair of elliptic curve points;
computing, by operation of one or more processors, a shared secret value based on the second image curve, wherein the shared secret value is shared by the first entity and the second entity; and
executing a cryptographic correspondence in a communication network between the first entity and the second entity.

US Pat. No. 10,116,429

SYSTEM AND METHOD FOR ADAPTIVE CLOCK/TIME SYNCHRONIZATION BETWEEN DEVICES IN A NETWORK

WIPRO LIMITED, Bangalore...

1. A method for functionality-specific system time synchronization over a network, wherein the method is implemented by a processor of a first device and comprises:determining whether functionality-specific system time information is available from a first server, wherein a functionality-specific system time to be synchronized is associated with an application running on the first device and is offset from a global system time of the first device;
if the functionality-specific system time information is available from the first server:
transmitting a first request for functionality-specific system time information to the first server,
receiving a first functionality-specific system time from the first server, and
generating a second functionality-specific system time based on the first functionality-specific system time;
if the functionality-specific system time information is not available from the first server:
after receiving a second request for functionality-specific system time information from a second device, determining whether to provide the functionality-specific system time to the second device, wherein the functionality-specific system time is not provided to the second device if a first number satisfies a predetermined condition, wherein the first number represents a number of timer interrupts at a third device, the timer interrupts being applied to update a free running counter that measures time elapsed from a starting time, and wherein the first number is included in a third request received for providing the functionality-specific system time information from the third device; and
updating the functionality-specific system time without updating the global system time.

US Pat. No. 10,116,426

METHODS AND SYSTEMS FOR FULL DUPLEX WIRELESS COMMUNICATIONS

The Regents fo the Univer...

1. A method useful for full duplex radio communications, comprising:transmitting a training signal by a node in a radio network;
extracting a waveform from a version of the training signal obtained from a receive chain of the node;
generating a cancellation signal using the waveform;
applying the cancellation signal to the receive chain of the node; and
iteratively:
transmitting the training signal, at increased power compared to prior transmissions of the training signal, by the node in the radio network,
extracting a further waveform from a version of the training signal transmitted at increasing power obtained from the receive chain of the node,
generating a further cancellation signal using the further waveform and the cancellation signal, and
applying the further cancellation signal to the receive chain of the node.

US Pat. No. 10,116,419

METHOD AND APPARATUS FOR DETERMINING FORWARD ERROR CORRECTION FRAME BOUNDARY, AND DECODING SYSTEM

Huawei Technologies Co., ...

1. A method comprising:receiving data, by a frame boundary determining circuit, wherein the data comprises N+P consecutive symbols having a first symbol as a starting point, wherein N is a quantity of symbols in a forward error correction (FEC) frame, N is a positive integer multiple of P, and N is greater than P, wherein a first data block comprises N consecutive symbols having a first starting point of the first symbol, wherein the first data block is in the N+P consecutive symbols, wherein a second data block comprises N consecutive symbols having a second starting point of a second symbol, wherein the second data block is in the N+P consecutive symbols, and wherein an offset of the second symbol relative to the first symbol is P symbols;
obtaining s parameter values corresponding to the first data block;
determining a first iterative item and a second iterative item of the second data block, wherein the first iterative item of the second data block is obtained according to first P consecutive symbols in the first data block, and the second iterative item of the second data block is obtained according to last P consecutive symbols in the second data block;
determining, according to the s parameter values corresponding to the first data block, and the first iterative item and the second iterative item of the second data block, s parameter values corresponding to the second data block;
determining, according to the s parameter values corresponding to the second data block, whether the second symbol is a frame boundary of an FEC frame; and
in response to the determining that the second symbol is a frame boundary of the FEC frame, performing decoding.

US Pat. No. 10,116,413

DETERMINING A HIGH DATA RATE FOR BACKCHANNEL COMMUNICATIONS FOR INITIALIZATION OF HIGH-SPEED NETWORKS

Intel Corporation, Santa...

1. A network controller, comprising:modulation circuitry to determine a first modulated high rate (HR) bit sequence, the first modulated HR bit sequence including a first low rate (LR) bit stream modulated onto a first HR bit sequence and the first LR bit stream including at least first backchannel information;
physical interface (PHY) circuitry including transmitter circuitry to transmit the first modulated HR bit sequence to a link partner over a channel link;
link speed cycling circuitry to, upon initialization of the PHY circuitry, cause the transmitter circuitry to transmit the first modulated HR bit sequence to the link partner over the channel link using at least one high rate link speed; and
equalization presets cycling circuitry to apply at least one equalization preset setting to the transmitter circuitry based in part on the first modulated HR bit sequence while the transmitter circuitry is transmitting the first modulated HR bit sequence to the link partner.

US Pat. No. 10,116,384

REMOTE PROGRAMMING AND TROUBLESHOOTING OF PLUGGABLE OPTICAL TRANSCEIVERS

Integra Optics, Inc., La...

1. A method for remotely programming an optical pluggable module (OPM), the method performed by a computing device remote from the OPM, the method comprising:connecting to a network-enabled programmer, wherein the network-enabled programmer has an OPM coupled to the network-enabled programmer;
retrieving an OPM configuration from the OPM that is coupled to the network-enabled programmer;
performing a remote diagnostics process on the OPM;
downloading a configuration from the remote computing device to the network-enabled programmer; and
programming, via the network-enabled programmer, the configuration into the coupled OPM, wherein the programming the configuration includes selecting an OPM platform or selecting an optical channel.

US Pat. No. 10,116,379

SCHEDULING BEAMS OF A SATELITE ANTENNA

Aireon LLC, McLean, VA (...

1. A computer-implemented method for scheduling beams of an antenna on board a satellite for receiving Automatic Dependent Surveillance Broadcast (ADS-B messages) during a defined time period comprising:for each beam of the antenna, calculating a beam score based, at least in part, on the expected gain of the beam during the defined time period;
determining a number of beams of the antenna having non-zero beam scores during the defined time period;
comparing the number of beams of the antenna having non-zero beam scores during the defined time period to a threshold value;
determining, based on having compared the number of beams of the antenna having non-zero beam scores during the defined time period to the threshold value, that the number of beams of the antenna having non-zero beam scores during the defined time period is less than the threshold value;
as a consequence of having determined that the number of beams of the antenna having non-zero beam scores during the defined time period is less than the threshold value:
accessing a set of beam weights for each of multiple different candidate beam patterns, each set of beam weights having a weight corresponding to each of the antenna's beams;
for each set of weights:
multiplying individual beam weights by corresponding beam scores for beams of the antenna during the defined time period, and
generating a candidate beam pattern score by calculating a sum of the products of the beam weights and corresponding beam scores;
comparing the candidate beam pattern scores for the different candidate beam patterns;
selecting, based on having compared the candidate beam pattern scores for the different candidate beam patterns, a particular one of the candidate beam patterns; and
scheduling the selected beam pattern for the beams of the antenna for the defined time period.

US Pat. No. 10,116,367

METHOD AND SYSTEM FOR MULTIPLE-HOP RELAYED DIRECTIONAL WIRELESS COMMUNICATION

SONY CORPORATION, Tokyo ...

1. An apparatus for wireless communication between stations (STAs) using directional transmission/reception, comprising:(a) a wireless communication station (STA) configured for mm-wave communication, in which said STA, and nearby STA instances of the apparatus are configured for performing sector sweep and feedback signaling to exchange antenna sector information;
(b) a transmitter of said wireless communication station (STA) configured for generating directional radio transmissions to other wireless radio communication devices which are in range;
(c) a receiver of said wireless communication station (STA) configured for receiving radio transmissions from other wireless radio communication devices;
(d) a computer processor coupled to said transmitter and said receiver for controlling communications between itself and other wireless radio communication devices;
(e) a non-transitory computer-readable memory storing instructions executable by the computer processor;
(f) wherein said instructions, when executed by the computer processor, perform steps comprising:
(i) exchanging quantized channel gain, or path loss, information of each antenna sector with one or more neighboring stations;
(ii) recording received quantized channel gain information from communication with neighboring stations;
(iii) generating route discovery messages to neighboring stations when establishing a multiple hop routing path from an originating station to a destination station; and
(iv) processing received route discovery messages by (A) determining link metrics with a neighboring station that generated the route discovery message, (B) considering interference impact when determining transmit antenna sector to a neighboring station as a potential next hop in the routing path; (C) propagating the route discovery message to a neighbor station if the station is not the destination station;
(v) wherein channel time utilization and impact to ongoing traffic at neighboring stations are utilized in determining interference impact when establishing the multiple hop routing path.

US Pat. No. 10,116,361

METHODS FOR UPLINK MULTIUSER SIGNALING AND TRANSMISSION

NEWRACOM, INC., Irvine, ...

1. A method implemented by an Access Point (AP) in a Wireless Local Area Network (WLAN) to initiate an uplink (UL) multi-user (MU) simultaneous transmission, the method comprising:generating a trigger frame that initiates the UL MU simultaneous transmission, wherein the trigger frame includes (1) a UL MU Physical Layer Convergence Protocol (PLCP) Protocol Data Unit (PPDU) attributes field to indicate attributes pertaining to a UL MU PPDU transmitted to the AP during the UL MU simultaneous transmission that are common to a plurality of stations (STAs) that are scheduled to participate in the UL MU simultaneous transmission and (2) a STA Physical Layer Service Data Unit (PSDU) attributes field for a particular STA from the plurality of STAs to indicate attributes pertaining to the UL MU PPDU that are specific to the particular STA,
wherein the UL MU PPDU attributes field includes a guard interval subfield to indicate a guard interval that the plurality of STAs are to apply to one or more portions of the UL MU PPDU and wherein the STA PSDU attributes field for the particular STA includes an assignment subfield to indicate a transmission resource unit that the particular STA is to use to transmit a set of Media Access Control (MAC) Protocol Data Units (MPDUs) within the UL MU PPDU to the AP during the UL MU simultaneous transmission; and
transmitting the trigger frame through a wireless medium.

US Pat. No. 10,116,346

ELECTRONIC DEVICE AND ANTENNA USING COMPONENTS OF ELECTRONIC DEVICE

Samsung Electronics Co., ...

1. An electronic device comprising:a housing;
a circuit board positioned inside the housing; and
an antenna radiator positioned inside the housing,
wherein the antenna radiator is fed from the circuit board, and comprises a plurality of conductive components, each of the plurality of conductive components being disposed on a portion of a respective one of a plurality of electronic components of the electronic device, and the plurality of conductive components being connected by at least one connection component,
wherein at least one of the conductive components includes a ground area that is configured to connect to a supporting unit for supporting a Flexible Printed Circuit (FPC) corresponding to the at least one connection component.

US Pat. No. 10,116,334

REED-SOLOMON CODE ENCODER AND DECODER

XILINX, INC., San Jose, ...

1. An integrated circuit (IC), comprising:an encoder circuit includes:
an encoding input configured to receive an input message including one or more data symbols, each data symbol having a data symbol width of N bits, wherein N is a positive integer;
an encoding unit configured to perform Reed-Solomon encoding to the one or more data symbols to generate one or more coding symbols, wherein the Reed-Solomon encoding uses a Galois field having an order that is less than 2N, the encoding unit comprising a first Galois field arithmetic operator configured to perform multiplication operations and division operations on field elements of the Galois field by retrieving pre-computed values from a storage; and
an encoding output configured to provide a coded message including the one or more data symbols and the one or more coding symbols,
wherein the order of the Galois field is equal to 2M,
wherein M is greater than two and less than N,
wherein the storage comprises:
a multiplication lookup table to store pre-computed values for the multiplication operations; and
a division lookup table to store pre-computed values for the division operations;
wherein each of the multiplication lookup table and the division lookup table has a size of less than M*2M*2 bits.

US Pat. No. 10,116,329

METHOD AND SYSTEM FOR COMPRESSION BASED TIERING

EMC IP HOLDING COMPANY LL...

1. A method comprising:evaluating a level of activity of a data set, wherein the evaluating the level of activity for a data set comprises evaluating a first lower level of activity for a first data set; and evaluating a second higher level of activity for a second data set;
selecting a compression algorithm according to the level of activity of the data set, wherein the selecting the compression algorithm according to the level of activity of the data set comprises selecting a first compression algorithm having a first higher compression ratio according to the first lower level of activity of the first data set; and selecting a second compression algorithm having a second lower compression ratio according to the second higher level of activity of the second data set;
compressing data of the data set according to the selected compression algorithm; and
storing the compressed data in a data storage system.

US Pat. No. 10,116,323

ANALOG-TO-DIGITAL CONVERTER

MEDIATEK INC., Hsin-Chu ...

1. An analog-to-digital converter (ADC) converting an input signal to an output signal; the ADC comprising:a main circuit for: scaling the input signal by a first factor, filtering an error signal by a loop filter, and forming a combined signal combining the scaled input signal and the filtered error signal; and
a comparator coupled to the main circuit, for quantizing the combined signal to provide the output signal;
wherein the error signal reflects a difference between the combined signal and the output signal;
the loop filter comprises a first delay unit and at least a loop scaling unit, for delaying and scaling the error signal by a second factor; and
a sum of the first factor and the second factor equals one.

US Pat. No. 10,116,321

INBUILT THRESHOLD COMPARATOR

TEXAS INSTRUMENTS INCORPO...

1. A comparator comprising:a first input stage coupled to a first signal input and a first reference input, the first input stage coupled between a first node and a second node;
wherein the first input stage comprises:
a first transistor coupled between the first node and the second node, the gate of the first transistor being coupled to the first signal input; and
a second transistor coupled between the first node and the second node, the gate of the second transistor coupled to one of the first reference input;
a second input stage coupled to a second signal input and a second reference input, the second input stage coupled between a third node and the second node;
an output stage for generating at least one output signal in response to signals at the first and second signal inputs;
first switching circuitry coupled between the first node and the output stage, the first switching circuitry for coupling the first node to a fourth node in response to a reset signal;
second switching circuitry coupled between the third node and the output stage, the second switching circuitry for coupling the third node to a fifth node in response to the reset signal; and
a threshold voltage wherein the threshold voltage is proportional to a first value multiplied by a second value wherein the first value is equal to a width of the first transistor divided by a width of the second transistor and the second value is equal to a voltage of the first reference input minus a voltage of the second reference input.

US Pat. No. 10,116,308

ROTATION OPERATION DEVICE

DENSO CORPORATION, Kariy...

1. A rotation operation device comprising:a rotation operation section having a cylindrical shape and rotationally operable by an operator around an axis of the cylindrical shape;
a plurality of recessed and projecting sections arranged on an axial end surface or a peripheral surface of the rotation operation section and having recesses and projections in a circumferential direction of the rotation operation section;
a conductive section made of a conductive material, having a protruding section protruding toward each of the recessed and projecting sections and an elastic section that biases the protruding section by elasticity to each of the recessed and projecting sections, and movable in a recess-and-projection direction by each of the recessed and projecting sections when the rotation operation section rotates;
an electrode section disposed so as to face the conductive section and changing a capacitance in accordance with a movement of the conductive section; and
a detecting section detecting the change in the capacitance, wherein:
three or more sets of combination of the recessed and projecting sections, the conductive section, and the electrode section are provided;
the conductive section in each set is moved in turn by a respective recessed and projecting section in the recess-and-projection direction at a different timing with regular intervals; and
the detecting section detects a rotation direction and a rotation quantity of the rotation operation section by means of a combination pattern of the change in the capacitance provided by the electrode section,
wherein the recessed and projecting sections, the conductive section, and the electrode section in each set of the combination are arranged in a concentric manner.

US Pat. No. 10,116,304

GATE TRANSISTOR CONTROL CIRCUIT

1. A device for controlling a first control gate transistor, comprising:a second transistor and a third transistor series-connected between first and second terminals of application of a power supply voltage, the junction point of these transistors being connected to the gate of the first transistor,
a terminal of application of a digital control signal;
a circuit for generating an analog signal according to variations of the power supply voltage; and
for each of the second and third transistors, a circuit of selection of a control signal of the first transistor representative of said digital signal or of said analog signal, wherein the selection circuit selects a signal among said digital control signal and said analog signal such that one of the second and third transistors is controlled in a linear state while the other one of the second and third transistors is controlled in a saturated state.

US Pat. No. 10,116,302

SEMICONDUCTOR DEVICE

Mitsubishi Electric Corpo...

1. A semiconductor device, comprising:a low-side terminal having a low-side potential;
a high-side terminal having a high-side potential different from the low-side potential;
a main output terminal having an intermediate potential;
a low-side switching element being provided between the main output terminal and the low-side terminal;
a low-side drive circuit which drives the low-side switching element and operates using the low-side potential as a reference potential and using a supply potential regulated by an offset voltage from the low-side potential as a power source potential;
a high-side switching element being provided between the main output terminal and the high-side terminal;
a high-side drive circuit which drives the high-side switching element and operates using the intermediate potential as a reference potential and using a floating potential regulated by an offset voltage from the intermediate potential as a power source potential;
a detection circuit using the intermediate potential as a reference potential and detecting condition information of the high-side switching element, thereby outputting a detection signal;
a conversion circuit using the intermediate potential as a reference potential and outputting a conversion signal corresponding to the detection signal from the detection circuit, and
a signal transmission circuit outputting a signal corresponding to the conversion signal from the conversion circuit as a voltage signal using the low-side potential as a reference potential, wherein
the signal transmission circuit includes:
a first point to which the intermediate potential is applied;
a second point to which a referred potential between the low-side potential and the high-side potential is applied, the referred potential being different from the low-side potential and the high-side potential;
a signal switching element having a first end connected to the first point and a second end, and being switched in accordance with the conversion signal; and
a diode being provided between the second point and the second end of the signal switching element and having a direction with which a forward current can flow by a voltage between the first point and the second point in a case where the intermediate potential is the low-side potential.

US Pat. No. 10,116,270

TUNABLE POWER AMPLIFIER WITH WIDE FREQUENCY RANGE

TEXAS INSTRUMENTS INCORPO...

1. A circuit comprising:an amplifier to amplify an input signal and generate an output signal; and
a tuning network to tune a frequency response of the amplifier, the tuning network comprising at least one tunable microelectromechanical system (MEMS) capacitor, the at least one tunable MEMS capacitor comprising a MEMS superstructure disposed over a control structure, the control structure being arranged to control the MEMS superstructure and tune a capacitance of the at least one tunable MEMS capacitor, the control structure comprising an electrode, and the MEMS superstructure comprising at least one substantially planar membrane positioned parallel to the electrode.

US Pat. No. 10,116,268

OPERATIONAL AMPLIFIER

Analog Devices Global, H...

1. An amplifier circuit that generates an output voltage comprising a relatively constant offset voltage, the amplifier circuit comprising:an output stage configured to generate the output voltage;
first and second differential input stages coupled to the output stage, wherein the first differential input stage includes a pair of first input transistors and the second differential input stage includes a pair of second input transistors complementary in type to the first input transistors;
a switching network configured to couple a differential input signal to the first differential input stage and a reference voltage to the second differential input stage in response to a control signal having a first state, and to couple the differential input signal to the second differential input stage and the reference voltage to the first differential input stage in response to the control signal having a second state; and
a comparator configured to generate the control signal based on comparing a signal level of the differential input signal to a threshold signal.

US Pat. No. 10,116,262

FRONT-END AMPLIFIER CIRCUITS FOR BIOMEDICAL ELECTRONICS

WINBOND ELECTRONICS CORP....

1. A front-end amplifier circuit for receiving a biological signal, comprising:a signal channel, amplifying the biological signal to generate a detection current, wherein the signal channel comprises:
a capacitive-coupled transconductance amplifier, amplifying the biological signal with a transconductance gain to generate a first current; and
a band-pass filtering amplifier, filtering noise in the first current outside a bandwidth and amplifying the first current with a first current gain to generate a second current;
a programmable-gain amplifier, amplifying the second current with a second current gain to generate the detection current on a programmable-gain output node, wherein the second current gain is programmable; and
an offset cancellation circuit, configured to cancel output offset currents of the capacitive-coupled transconductance amplifier, the band-pass filtering amplifier, and the programmable-gain amplifier.

US Pat. No. 10,116,248

METHOD AND DEVICE FOR OPERATING A BRUSHLESS MOTOR

Continental Automotive Gm...

1. A method for operating a brushless electric motor with an AC converter comprising three outputs that are allocated to the windings (U, V, W) of the electric motor, a respective power semiconductor switch arranged between each output of the AC converter and the windings (U, V, W) of the brushless electric motor, a plurality of supply voltage switches, a detection unit, a measuring unit, a motor position angle sensor, and a switch driver circuit connected to an output of the motor position angle sensor, the method comprising:detecting, by the detection unit, a defective switch of the plurality of supply voltage switches,
measuring, by the measuring unit, the voltage at the outputs of the AC converter,
determining, by the motor position angle sensor, the motor position angle (?), and
performing the following steps sequentially:
controlling all of the plurality of supply voltage switches to switch off following the detection of the defective switch so that power is no longer introduced into the windings (U, V, W) of the electric motor, and then
while all of the plurality of supply voltage switches are switched off, generating and directly applying, by the switch driver circuit in response to an output signal of the motor position angle sensor, control signals to control the power semiconductor switches to individually switch off in succession at previously defined motor position angles (?U, ?V, ?W) respectively, the previously defined motor position angles (?U, ?V, ?W) are defined to prevent electric current generated by rotation of the electric motor from flowing to the plurality of supply voltage switches.

US Pat. No. 10,116,233

HYBRID FULL BRIDGE-VOLTAGE DOUBLER RECTIFIER AND SINGLE STAGE LLC CONVERTER THEREOF

1. A hybrid full bridge-voltage doubler (FB-VD) rectifier, comprising:first and second AC input terminals;
first and second DC output terminals;
a plurality of diodes;
one switch having a first terminal connected to the second AC input terminal;
first and second capacitors connected in series between the first and second DC output terminals, a common point between the first and second capacitors being connected to a second terminal of the switch, the second capacitor being connected in parallel with one of the diodes;
wherein the hybrid FB-VD rectifier operates according to at least first and second working modes corresponding to positive and negative portions, respectively, of a low AC input voltage, the first working mode including the switch conducting in a first direction, the first capacitor charging, and the second capacitor discharging to supply a load, and the second working mode including the switch conducting in a second direction, the second capacitor charging, and the first capacitor discharging to supply the load;
wherein, for a high AC input voltage, the switch is not active and only a body diode of the switch conducts during a positive half cycle of the high AC input voltage to charge the first capacitor;
wherein the high AC input voltage is twice the low AC input voltage.

US Pat. No. 10,116,224

SWITCHING POWER CONVERTER CIRCUIT

Northrop Grumman Systems ...

1. A switching power converter circuit comprising:a gate driver configured to generate at least one switching signal in response to a feedback signal;
a feedback stage configured to generate the feedback signal based on an amplitude of an output voltage at an output; and
a power stage comprising at least one switch and a transformer, the at least one switch being controlled via the respective at least one switching signal to provide a primary current through a primary winding of the transformer to induce a secondary current through a secondary winding of the transformer to generate the output voltage, the power stage further comprising a self-driven synchronous rectifier stage coupled to the secondary winding to conduct the secondary current from a low voltage rail through the secondary winding, the self-driven synchronous rectifier stage comprises:
a first transistor interconnecting a first end of the secondary winding and the low voltage rail and being configured to conduct the secondary current from the low voltage rail through a first portion of the secondary winding when activated during a first switching phase; and
a second transistor interconnecting a second end of the secondary winding and the low voltage rail and being configured to conduct the secondary current from the low voltage rail through a second portion of the secondary winding when activated during a second switching phase.

US Pat. No. 10,116,222

SOFT SWITCHING FLYBACK CONVERTER WITH PRIMARY CONTROL

TEXAS INSTRUMENTS INCORPO...

1. A flyback converter, comprising:a transformer, including:
a primary winding, including a first end to receive an input voltage signal, and a second end, and
a secondary winding, including a first end to provide an output voltage signal, and a second end;
a first switch, including a first terminal coupled with the second end of the primary winding, a second terminal coupled with a first constant voltage node, and a first control terminal to receive a first switching control signal;
a second switch, including a first terminal coupled with the second end of the secondary winding, a second terminal coupled with a second constant voltage node, and a second control terminal to receive a second switching control signal;
a first control circuit to provide the first switching control signal to turn on the first switch for a non-zero first time period in a converter cycle to allow current to flow in a first direction in the primary winding in response to a first switch voltage across the first switch transitioning below a first threshold; and
a second control circuit to provide the second switching control signal to turn on the second switch for a non-zero second time period following the first time period in the converter cycle, the second control circuit operative to provide the second switching control signal to again turn on the second switch for a non-zero third time period in the converter cycle in response to a second switch voltage across the second switch transitioning below a second threshold to cause current flow in a second direction in the primary winding to at least partially discharge a capacitance of the first switch to cause the first switch voltage to transition below the first threshold to initiate a subsequent converter cycle and allow the first switch to operate at or near a zero-voltage switching (ZVS) condition.

US Pat. No. 10,116,204

DISTRIBUTION TRANSFORMER INTERFACE APPARATUS AND METHODS

Gridbridge, Inc., Raleig...

1. An apparatus comprising:at least one external source terminal configured to be connected to at least one secondary terminal of a distribution transformer;
at least one external load terminal configured to be connected to a load;
a shunt converter circuit having a first port coupled to the at least one external source terminal to provide parallel connection to a secondary winding of the distribution transformer, wherein the distribution transformer is not coupled to the at least one external source terminal via a shunt transformer;
a series converter circuit having a first port coupled to the at least one external load terminal and a second port coupled to a second port of the shunt converter circuit, and
wherein the apparatus is independent of the distribution transformer.

US Pat. No. 10,116,200

DC/DC CONVERTER DEVICE

Mitsubishi Electric Corpo...

1. A DC/DC converter device, comprising:a DC/DC converter including a power conversion unit configured to step up or step down an input voltage supplied from a DC power source to output an output voltage, and a reactor connected between the power conversion unit and the DC power source; and
a control unit configured to generate an output voltage target value in accordance with an output voltage command value to control the power conversion unit such that the output voltage follows the output voltage target value,
wherein the control unit includes a rate-of-change limiting value setting unit configured to set a rate-of-change limiting value for the output voltage target value, and is configured to limit the output voltage command value by using the rate-of-change limiting value, to thereby generate the output voltage target value, and
wherein the rate-of-change limiting value setting unit is configured to obtain an index value for quantitatively evaluating an amount of fluctuation in the input voltage supplied to the DC/DC converter, to thereby change a setting of the rate-of-change limiting value in such a direction as to narrow a rate-of-change limiting range when the index value is within a predetermined specific range.

US Pat. No. 10,116,189

ROTATING ELECTRICAL MACHINE EQUIPPED WITH ROTOR WITH OIL CONTAINERS

DENSO CORPORATION, Kariy...

1. A rotating electrical machine comprising:a housing:
a stator comprising a stator core, the stator core comprising a coil end, the stator being fixed to the housing, the coil end of the stator core protruding toward an end surface of the stator; and
a rotor comprising a rotor core, a rotor shaft and a pair of rotor side plates, both end surfaces of the rotor core being arranged between the rotor side plates, the rotor shaft of the rotor being rotatably supported by the housing, the rotor core comprising core sheets stacked in a direction of a rotary axis of the rotor shaft, the rotor core being arranged to have a specified gap between the end surfaces of the rotor core and the stator so as to rotate the rotor core around the stator while keeping the specific gap,
wherein one or more oil containers are arranged on at least one surface of each of the rotor side plates, each of the oil containers comprises a scoop-up part and an exhaust outlet formed at end sections of the oil container,
when the rotor is rotating, the scoop-up part of each of the oil containers scoops up an oil stored in the housing, inside air in the oil container are compressed, and the exhaust outlet of the oil container exhausts the oil and the compressed air together, and
the oil is stored in a lowermost side of the housing so that the scoop-up part and the exhaust outlet in each of the oil containers are immersed and the scoop-up part of each of the oil containers scoops up the oil in the lowermost side of the housing when the rotor is rotating, and
the scoop-up part in each of the oil containers has a U shape formed at a corner of the oil container so that an upper surface, a short side surface and a long side surface at the corner of the oil container are connected together.

US Pat. No. 10,116,182

ELECTRIC MOTOR STORING DEVICE FOR HYBRID VEHICLE

TOYOTA JIDOSHA KABUSHIKI ...

1. An electric motor storing device for a hybrid vehicle, the hybrid vehicle includingan electric motor, the electric motor including a rotor shaft and an inner circumferential side rotational shaft disposed on an inner circumferential side of the rotor shaft in a manner to penetrate the rotor shaft, and
a case configured to store the electric motor, the electric motor storing device comprising:
a support member configured to rotatably support the inner circumferential side rotational shaft and the rotor shaft, the support member being fixed to the case; and
an insulating section configured to electrically insulate between the support member and the case to which the support is fixed.

US Pat. No. 10,116,170

METHODS AND SYSTEMS FOR MAXIMUM POWER POINT TRANSFER IN RECEIVERS

Energous Corporation, Sa...

1. A wireless power receiver comprising:a first rectifier coupled to a first antenna, and configured to rectify a first power received at the first antenna and generate a first rectified power;
a second rectifier coupled to a second antenna, and configured to rectify a second power received at the second antenna and generate a second rectified power;
a controller configured to transmit an operational instruction to an input boost converter to adjust the first rectified power in response to determining that the power extracted by the receiver is less than a global power maximum based upon the first rectified power and the second rectified power; and
an output boost converter configured to adjust the power provided to a load associated with the receiver,
wherein the controller is configured to:
determine load requirements for the load associated with the receiver; and
transmit one or more operational instructions to at least one of the input boost converter and the output boost converter based upon the load requirements for the load associated with the receiver.

US Pat. No. 10,116,169

WIRELESS POWER TRANSMITTER AND METHOD FOR CONTROLLING RESONANCE FREQUENCY USING THE SAME

Samsung Electro-Mechanics...

1. A wireless power transmitter, comprising:resonators electrically connected to each other; and
a resonance frequency varying unit configured to vary resonance frequencies of the resonators based on a change in an amount of power to be sent to a wireless power receiver from the wireless power transmitter,
wherein upon the amount of power to be sent to the wireless power receiver being an amount greater than or equal to a first threshold value, the resonance frequency varying unit is configured to increase the resonance frequencies of the resonators, and upon the amount of power to be sent to the wireless power receiver being an amount less than or equal to a second threshold value which is smaller than the first threshold value, the resonance frequency varying unit is configured to decrease the resonance frequencies of the resonators.

US Pat. No. 10,116,166

AUTONOMOUS APPARATUS AND SYSTEM COMPRISING SUCH AN APPARATUS

Phlox, Aix en Provence (...

1. Apparatus (40) comprising an inductor (14), a rectifier (16) coupled to the inductor, a load (13) coupled to the rectifier, and a control member (29) for controlling power supply to the load (13), the apparatus being characterized in that it further comprises:a DC voltage converter (19 to 22) coupled to the rectifier (16);
a battery (12) coupled to the voltage converter; and
measurement means (26) for measuring the output voltage of the rectifier (16);
a priming circuit (18) coupled to the rectifier and to the programmable control unit and presenting sufficient capacitance to be capable of powering the control unit temporarily in the absence of a DC voltage being delivered to the rectifier or by the battery;
the load (13) being coupled to the voltage converter, and the apparatus (40) further comprising a control unit (10) coupled to the voltage converter, connected to the control member (29) and to the voltage measurement means (26), and arranged to cause either the battery to be charged by the rectifier, or the load (13) to be powered by the rectifier, or the load (13) to be powered by the battery, as a function of the state of the control member (29) and of the output voltage of the rectifier (16).

US Pat. No. 10,116,161

LINE RIPPLE COMPENSATION FOR SWITCHING POWER CONVERTERS

DIALOG SEMICONDUCTOR INC....

1. A controller for a switching power converter, comprising:a peak voltage compensation circuit configured to determine a peak voltage adjustment factor responsive to a function of a difference between a desired switching period for a power switch and an actual switching period for the power switch, a desired peak voltage, and the desired switching period; and
a constant voltage control circuit including an adder configured to add the desired peak voltage with the peak voltage adjustment factor to provide a compensated peak voltage, wherein the constant voltage control circuit is further configured to command the power switch to be cycled off in a current cycle of the power switch responsive to a sense voltage equaling the compensated peak voltage.

US Pat. No. 10,116,159

FAMILY OF ISOLATED BATTERY ENERGY STORAGE SYSTEM (BESS) WITH MULTIPLE FUNCTIONS FOR DC GRID APPLICATION

The Florida State Univers...

1. A battery energy storage system (BESS) for direct current (DC) grid applications, the BESS comprising:an alternating current (AC) transformer having a primary side and a secondary side;
at least one primary side arm coupled to the primary side of the AC transformer, the at least one primary side arm comprising a plurality of cascade connected voltage source converter sub-modules and each of the plurality of cascade connected voltage source converter sub-modules comprising one or more direct current (DC) energy storage units, each of the plurality of cascade connected voltage source converter sub-modules for converting a direct current (DC) voltage of the one or more DC energy storage units to an AC voltage and the at least one primary side arm for providing a sum of the AC voltages from each of the plurality of cascade connected voltage source converter sub-modules to the primary side of the AC transformer; and
at least one secondary side arm coupled between the secondary side of the AC transformer and a DC grid voltage bus, the at least one secondary side arm comprising a plurality of cascade connected voltage source converter sub-modules, wherein the at least one second side arm converts an AC voltage at the secondary side of the AC transformer to a DC voltage on the DC grid voltage bus.

US Pat. No. 10,116,151

BATTERY CHARGER RENTAL KIOSK SYSTEM

BSENG, LLC, Satellite Be...

1. A battery pack device comprising:a housing having a chamfered edge;
a plurality of electrical contacts carried by an outer surface of the housing;
a plurality of electrical connectors carried within the housing;
a moveable control device adapted to position at least one of the plurality of electrical connectors through an aperture located in the housing when activated; and
a battery contained within the housing and in electrical communication with each of the plurality of electrical connectors and the plurality of electrical contacts.

US Pat. No. 10,116,129

EOS EVENT DETECTION CIRCUIT FOR DETECTING EOS EVENT ON SUPPLY VOLTAGE RAIL COUPLED TO POWER SUPPLY

WESTERN DIGITAL TECHNOLOG...

1. An EOS event detection circuit coupled to a power supply via a supply voltage rail, the EOS event detection circuit comprising:a plurality of sub-circuits coupled to the supply voltage rail, each sub-circuit comprising:
a first transistor;
a Zener diode coupled between the supply voltage rail and a first terminal of the first transistor; and
a fusible element coupled between a second terminal of the first transistor and the supply voltage rail;
wherein the first transistor is configured to cause the fusible element to open when an EOS event occurring on the supply voltage rail exceeds a reverse breakdown voltage of the Zener diode; and
wherein the Zener diode in each sub-circuit has a different reverse breakdown voltage.

US Pat. No. 10,116,115

INTEGRATED CIRCUIT IMPLEMENTING A VCSEL ARRAY OR VCSEL DEVICE

Geoff W. Taylor, Wilton,...

1. A semiconductor device comprising:a plurality of vertical-cavity surface-emitting laser (VCSEL) devices arranged in a two-dimensional array, wherein the plurality of VCSEL devices is formed from a layer structure that includes at least one bottom n-type layer, at least one intermediate p-type layer formed above the at least one bottom n-type layer, an n-type modulation doped quantum well structure formed above the at least one intermediate p-type layer, at least one spacer layer formed between the at least one intermediate p-type layer and the n-type modulation doped quantum well structure, and at least one top p-type layer formed above the n-type modulation doped quantum well structure;
an annealed oxygen implant region disposed vertically in the layer structure within the at least one spacer layer and configured to surround and extend laterally in a continuous manner between the plurality of VCSEL devices;
an annealed n-type ion implant region disposed vertically in the layer structure within the top p-type spacer layer and configured to overlie the annealed oxygen implant region and surround and extend laterally in a continuous manner between the plurality of VCSEL devices;
a common anode that contacts the at least one top p-type layer; and
a common cathode that contacts the at least one bottom n-type layer;
wherein the at least one intermediate p-type layer has a built-in hole charge Qp, the at least one bottom n-type layer has a built-in electron charge Qn, and the built-in hole charge Qp relative to the built-in electron charge Qn is configured for diode current-voltage characteristics of the plurality of VCSEL devices based on voltages applied to the common anode and the common cathode.

US Pat. No. 10,116,112

LASER OSCILLATOR

VIA MECHANICS, LTD., Kan...

1. A laser oscillator in which a pair of electrodes is disposed in a housing into which a gas is sealed, a waveguide is formed by the pair of electrodes, and a laser beam is configured to be extracted from an end of the housing, the laser oscillator comprising:a mirror holder directly attached to an end of one of the pair of electrodes, the end serving as an end of the waveguide, so that the mirror holder is capable of sliding on a surface of the end of the one of the pair of electrodes in a vertical direction with respect to a direction of the laser beam; and
a reflection mirror attached to the mirror holder and reflecting a laser beam generated in the waveguide,
wherein a passage through which a cooling medium is passed is formed inside each of the pair of electrodes.

US Pat. No. 10,116,108

TRACK-LIGHTING ADAPTER WITH UNIVERSAL HOUSING

Green Creative Ltd., Hon...

1. A track-light system comprising a universal housing for connecting to a light engine, the universal housing including at least two different sets of spaced electrical contacts that electrically couple to different configurations of matched electrical contacts on at least two different track-light adapter cap styles to form at least two different track-light adapter power units, wherein the at least two different track-light adapter cap styles have track studs with slide contacts that are electrically coupled to the matched electrical contacts and that slidably and electrically engage different power track styles to power the light engine.

US Pat. No. 10,116,091

CONNECTOR POSITION ASSURANCE DEVICE, CONNECTOR BOX AND ELECTRICAL CONNECTOR SYSTEM

TE Connectivity German Gm...

1. A connector position assurance device, comprising:a body having a body recess; and
a locking lance extending along a length of the body, the locking lance having a fixed end fixed to the body and a lance head opposite the fixed end, the lance head aligned with the body recess, resiliently deflecting from an undeformed position into the body recess, and having a lance recess and a locking stop aligned with the lance recess, the lance recess locking to a plug connector having a locking arm, the locking stop and the locking arm locking to a locking surface of a receptacle connector matable with the plug connector.

US Pat. No. 10,116,045

ANTENNA DEVICE

HARADA INDUSTRY CO., LTD....

1. An antenna device comprising:an antenna element including a plate with a first opening, the plate including a first main surface and a second main surface opposed to each other; and
a case in which the antenna element is stored,wherein the case comprises:a first projection projecting toward an inside of the case and passing through the first opening;
a first head provided to a tip end of the first projection, the first head being in contact with the first main surface; and
a first supporter in contact with the second main surface,
wherein a first protrusion protruding from the first main surface or a first depression recessed from the first main surface is provided on an edge of the first opening of the plate, and
wherein the first head covers the first protrusion and is in contact with at least a part of the first protrusion, or covers the first depression and is in contact with at least a part of the first depression.

US Pat. No. 10,116,033

RFID TAG ASSEMBLY METHODS

Impinj, Inc., Seattle, W...

1. A method for assembling a Radio Frequency Identification (RFID) tag, the method comprising:providing an antenna;
providing an integrated circuit (IC) that includes a first electrical bus and electrical circuitry, the electrical circuitry comprising one or more of a rectifier circuit, a demodulator circuit, and a modulator circuit of the IC, wherein providing the IC comprises:
coupling the first electrical bus to the one or more of a rectifier circuit, a demodulator circuit, and a modulator circuit of the IC;
disposing a plurality of conductive patches on a surface of the IC, wherein the plurality of distinct conductive patches covers a substantial portion of the surface of the IC;
capacitively coupling at least a first one of the plurality of distinct conductive patches to the first electrical bus; and
coupling the antenna to the plurality of distinct conductive patches on the surface of the IC to form the RFID tag, wherein at least one of the antenna-to-conductive-patch and the first-electrical-bus-to-conductive-patch couplings is through a dielectric material and the dielectric material includes at least one of a covering layer of the antenna and a covering layer of the IC.

US Pat. No. 10,116,024

MICROSTRIP NOTCH FILTER WITH TWO-PRONGED FORK-SHAPED EMBEDDED RESONATOR

KING ABDULAZIZ CITY FOR S...

1. A notch filter comprising:a dielectric substrate;
a microstrip transmission line on the dielectric substrate; and
a fork-shaped open-circuited stub embedded in the microstrip transmission line,
wherein for a signal transmitted via the microstrip transmission line, the fork-shaped open-circuited stub causes a second spurious harmonic in the signal to be at approximately eight times a center frequency in which a first spurious harmonic is present.

US Pat. No. 10,116,021

STABLE ELECTROLYTE MATERIALS FOR LI-AIR BATTERY SYSTEMS

Robert Bosch GmbH, Stutt...

1. A method of producing a Li-ion battery displaying increased resistance to nucleophilic attack, the method comprising:a. providing a first electrode,
b. providing a second electrode spaced apart from the first electrode,
c. providing an electrolyte composition for the Li-ion battery, each chemical of the electrolyte composition having an electrophilicity index below 0.8 eV.

US Pat. No. 10,116,013

ELECTRONIC TRANSPORT-RESISTANT BATTERY LAYER

Apple Inc., Cupertino, C...

1. A battery, comprising:an electrical terminal;
a first foil layer positioned between a first electrode of the battery and the electrical terminal of the battery;
a first protection layer applied to a first surface of the first foil layer and configured to, in response to exposure of the first protection layer to one or more particular physical conditions, at least partially inhibit electrical transmission within the battery; and
a second protection layer applied to a second surface of the first foil layer and configured to, in response to exposure of the second protection layer to one or more particular physical conditions, at least partially inhibit electrical transmission within the battery.

US Pat. No. 10,115,995

BATTERIES INCLUDING A FLAT PLATE DESIGN

Cardiac Pacemakers, Inc.,...

1. A battery comprising:a battery stack;
a battery case having a backfill hole, wherein the battery stack is located within the battery case; and
a terminal having a first end extending away from the case and a second end mounted within the backfill hole and coupled to the case, wherein the second end includes an upper cap portion and a lower widened portion with a narrow waist between the upper cap portion and the lower widened portion, wherein the lower widened portion is physically attached to the case at an inner surface of the backfill hole and the upper cap portion is connected to an outer surface of the case.

US Pat. No. 10,115,982

FUEL CELL SYSTEM AND FUEL CELL SYSTEM MODULE

Panasonic Corporation, O...

1. A fuel cell system comprising:a plurality of cell units, including a first cell unit and a second cell unit located below the first cell unit along a vertical direction; and
at least one connecting section including a first connecting section to connect the first cell unit and the second cell unit,
each of the plurality of cell units including:
a treatment bath having a flow path through which a liquid to be treated is allowed to flow;
a liquid intake port through which the liquid to be treated is supplied to the flow path and a liquid discharge port through which the liquid to be treated is discharged from the flow path; and
at least one electrode cell, the at least one electrode cell including a negative electrode, a positive electrode at least a portion of which is a porous body, and an ion-permeable membrane disposed between the positive electrode and the negative electrode, the ion-permeable membrane being electrically non-conductive, the at least one electrode cell being disposed so that the negative electrode is in contact with the liquid to be treated flowing through the flow path, and that the positive electrode is exposed to a gas phase, and
the first connecting section including:
an input connected to the liquid discharge port of the first cell unit;
an output connected to the liquid intake port of the second cell unit;
a connection path through which the liquid to be treated having been discharged from the liquid discharge port of the first cell unit and through the input of the first connecting section is allowed to flow through the output of the first connecting section and to the liquid intake port of the second cell unit; and
a pneumatic adjustment section to suppress pneumatic fluctuations within the connection path that are associated with movements of the liquid to be treated, wherein the pneumatic adjustment section has an orifice different than the input and the output of the first connecting section through which the connection path is allowed to communicate with an external space different than the treatment bath of the first cell unit and the treatment bath of the second cell unit, the external space having a volume that is equal to or greater than the volume of an internal space of the connection path.

US Pat. No. 10,115,980

COOLING MODULE FOR A FUEL CELL

Volkswagen AG, Wolfsburg...

1. A cooling module for a fuel cell comprising:a cooling circuit for conducting a coolant; and
a treatment unit for the coolant, the treatment unit situated in the cooling circuit in such a way that the coolant flowing in the cooling circuit flows through the treatment unit,
the treatment unit includes a filter medium for removing metal ions from the coolant which includes a polymer having amidoxime or hydroxamic acid groups and is in contact with the coolant, an entirety of the coolant in the cooling circuit flowing through the filter medium.

US Pat. No. 10,115,975

WATER-ACTIVATED PERMANGANATE ELECTROCHEMICAL CELL

Massachusetts Institute o...

1. A water-activated permanganate electrochemical cell comprising:at least one anode;
a solid cathode configured to be electrically coupled to the at least one anode, the cathode comprising a porous NiC matrix material;
an electrolyte between the at least one anode and the cathode, the electrolyte including water and a permanganate salt and;
wherein the electrolyte permanganate is configured to be reduced within the cell in at least a two-step reduction process,
the electrolyte includes an amount of water sufficient to support both steps of the two-step reduction process,
the permanganate produces a first reaction product in step one of the reduction process, and
the cathode includes a high-porosity region in the upper section of the cathode and a low-porosity catchment region toward the bottom section of the cathode that is configured to hold the first reaction product from step one in contact with the cathode in order to facilitate step two in the reduction process;
a housing configured to hold the at least one anode, the cathode, and the electrolyte, the housing comprises an injection port configured to introduce water into the housing so that the water flows through the cathode.

US Pat. No. 10,115,959

METHOD OF MANUFACTURING NON-AQUEOUS LIQUID ELECTROLYTE SECONDARY BATTERY

TOYOTA JIDOSHA KABUSHIKI ...

1. A method of manufacturing a non-aqueous liquid electrolyte secondary battery including a positive electrode mixture layer containing a lithium-containing transition metal oxide as a positive electrode active material, the method comprising:mixing the positive electrode active material and an aromatic nitrile compound such that a mass ratio of the aromatic nitrile compound to the positive electrode active material is not less than 0.1% by mass and not more than 4% by mass, to prepare a mixture;
mixing the mixture, a conductive material, a binder, and a solvent to prepare a granular body; and
disposing the granular body on a surface of a positive electrode collector to form at least a part of the positive electrode mixture layer, wherein
the positive electrode mixture layer is formed so as to extend along the surface of the positive electrode collector in a longitudinal direction,
in a width direction orthogonal to the longitudinal direction,
the positive electrode mixture layer includes a center portion, and a first end and a second end with the center portion interposed therebetween,
the center portion does not contain the aromatic nitrile compound,
the first end and the second end each contain the granular body, and
in a case where a total width of the positive electrode mixture layer is defined as W0, a width of the first end is defined as W1 and a width of the second end is defined as W2, the positive electrode mixture layer is formed so as to satisfy an equation (I) below:
0. 33%?{(W1+W2)/W0}×100?9.56%  (I).

US Pat. No. 10,115,956

ELECTRICITY STORAGE DEVICE

KABUSHIKI KAISHA TOYOTA J...

1. An electricity storage device comprising:an electrode assembly, in which one or more first electrodes and one or more second electrodes, which are electrodes, are stacked alternately with one or more separators in between;
a case, which accommodates the electrode assembly;
a first terminal and a second terminal, which are exposed to an outside from a wall portion of the case, a part of each terminal protruding toward the electrode assembly, wherein
each first electrode has a first tab, which has a shape protruding from an end of the first electrode,
each second electrode has a second tab, which has a shape protruding from an end of the second electrode, and
the electrode assembly has an end face on which the first and second tabs are located, the end face facing the wall portion,
a circuit breaker, which is arranged between the second terminal and the electrode assembly and is joined to the second terminal;
a first conductor, which is joined to the first tabs and the first terminal; and
a second conductor, which is joined to the circuit breaker and the second tabs, wherein
the first conductor has a first bend portion, which is bent into a shape of a crank when viewed along a stacking direction of the electrodes,
the second conductor has a second bend portion, which is bent into a shape of a crank when viewed along a stacking direction of the electrodes,
a direction that is perpendicular to both the stacking direction of the electrodes and a direction along which the wall portion and the end face face each other is defined as a width direction of the electrode assembly,
a part of the first terminal and the first tabs are arranged along the width direction of the electrode assembly,
the circuit breaker and the second tabs are arranged along the width direction of the electrode assembly,
the first conductor includes
a terminal joint portion, which is joined to the first terminal, and
a first tab joint portion, which is arranged closer to the wall portion than the terminal joint portion and includes a first tab joint face joined to the first tabs and a first opposed face facing the wall portion,
the second conductor includes
a breaker joint portion, which is joined to the circuit breaker, and
a second tab joint portion, which is arranged closer to the wall portion than the breaker joint portion and includes a second tab joint face joined to the second tabs and a second opposed face facing the wall portion,
the breaker joint portion and the terminal joint portion are displaced from each other along the facing direction,
the first bend portion and the second bend portion are bent such that the first opposed face and the second opposed face approach each other along the facing direction, and
the second bend portion of the second conductor is narrower than the first bend portion of the first conductor in the stacking direction of the electrodes.

US Pat. No. 10,115,947

SEPARATOR ROLL, METHOD FOR PRODUCING BATTERY, AND METHOD FOR PRODUCING SEPARATOR ROLL

SUMITOMO CHEMICAL COMPANY...

1. A separator roll comprising:a porous battery separator; and
a core around which the battery separator is wound,
the core having an outer circumferential surface whose root mean square roughness is not less than 4.0 ?m, the outer circumferential surface being in contact with the battery separator.

US Pat. No. 10,115,944

BATTERY USED FOR UNMANNED AERIAL VEHICLE AND AN UNMANNED AERIAL VEHICLE

AUTEL ROBOTICS USA LLC, ...

1. A battery assembly configured to power a multi-rotor unmanned aerial vehicle having a battery compartment, comprising:a shell;
a battery body substantially disposed within the shell;
a clamp button, a first part of the clamp button being mounted directly or indirectly to the shell and a second part of the clamp button being configured to be detachably coupled to the battery compartment; and
a restorable elastic piece;
wherein a first end of the restorable elastic piece is disposed to the shell and a second end of the restorable elastic piece is fixed with the clamp button; and
wherein the battery assembly is capable of being removed from the battery compartment in a state where the clamp button is pressed down.

US Pat. No. 10,115,918

DOPING ENGINEERED HOLE TRANSPORT LAYER FOR PEROVSKITE-BASED DEVICE

OKINAWA INSTITUTE OF SCIE...

7. A method of fabricating an optoelectronic device comprising:forming an active layer comprising organometal halide perovskite; and
forming by vacuum evaporation a hole transport layer (HTL) for use for transporting hole carriers, wherein the forming the HTL comprises:
forming a first sublayer adjacent to the active layer and comprising a hole transport material (HTM) doped with an n-dopant by co-evaporating the HTM and the n-dopant;
forming a second sublayer adjacent to the first sublayer and comprising the HTM that is undoped by evaporating the HTM; and
forming a third sublayer adjacent to the second sublayer and comprising the HTM doped with a p-dopant by co-evaporating the HTM and the p-dopant.

US Pat. No. 10,115,914

DISPLAY DEVICE

Japan Display Inc., Mina...

1. A display device comprising:a display panel including a display area and a peripheral area outside the display area;
a wiring located in the peripheral area;
a first organic insulating film under the wiring and in contact with the wiring; and
a second organic insulating film on the wiring and in contact with the wiring,
wherein the display panel has a first surface which is an opposite side of the wiring from the second organic insulating film,
a distance between the first surface and the wiring includes a first distance at a first portion and a second distance at a second portion, the first and second portions being located in the peripheral area,
the second portion is between the first portion and the display area, and
the first distance is smaller than the second distance.

US Pat. No. 10,115,909

ORGANIC ELECTROLUMINESCENT DEVICE, MANUFACTURING METHOD THEREOF AND ELECTRONIC EQUIPMENT

BOE TECHNOLOGY GROUP CO.,...

1. An organic electroluminescent device, comprising:an anode layer, a hole transport layer, a first light emitting layer, a second light emitting layer, an electron transport layer, and a cathode layer stacked in sequence;
wherein the first light emitting layer and the second light emitting layer are in direct contact with each other and comprise the same substrate material; and wherein at least one of the first light emitting layer and the second light emitting layer are doped such that a hole mobility of the first light emitting layer is equal to an electron mobility of the second light emitting layer.

US Pat. No. 10,115,901

MASK ASSEMBLY, APPARATUS, AND METHOD OF MANUFACTURING DISPLAY DEVICE USING THE MASK ASSEMBLY

Samsung Display Co., Ltd....

1. A mask assembly, comprising:a mask substrate configured to deposit a deposition material on a first pixel disposed on a device substrate comprising the first pixel and a second pixel;
a molding layer stacked on the mask substrate and comprising a hole corresponding to a position of the second pixel disposed on the device substrate; and
a blocking plate detachably mounted in the hole and configured to block the second pixel from the deposition material by covering the second pixel when the blocking plate is detached from the hole.

US Pat. No. 10,115,895

VERTICAL FIELD EFFECT TRANSISITORS HAVING A RECTANGULAR SURROUND GATE AND METHOD OF MAKING THE SAME

SANDISK TECHNOLOGIES LLC,...

1. A semiconductor structure comprising a two-dimensional array of vertical field effect transistors, wherein the two-dimensional array of vertical field effect transistors comprises:a one-dimensional array of gate electrode rail pairs, wherein each of the gate electrode rail pairs comprises a pair of gate electrode rails that laterally extend along a first horizontal direction and spaced among one another along a second horizontal direction;
a two-dimensional array of tubular gate electrode portions, wherein each of the tubular gate electrode portions includes a pair of outer sidewalls that contact sidewalls of a respective pair of gate electrode rails;
a gate dielectric located inside each of the tubular gate electrode portions; and
a vertical semiconductor channel extending along a vertical direction and located inside each of the tubular gate electrode portions and laterally surrounded by the gate dielectric.

US Pat. No. 10,115,888

METHOD FOR MANUFACTURING CRYSTAL FILM

Advanced Material Technol...

1. A method for manufacturing a crystal film, comprising the steps of:forming a Zr film on a substrate heated to 700° C. or more by a vapor deposition method using a vapor deposition material having a Zr single crystal;
forming a ZrO2 film on said Zr film on a substrate heated to 700° C. or more, by a vapor deposition method using said vapor deposition material having a Zr single crystal, and oxygen; and
forming a Y2O3 film on said ZrO2 film on a substrate heated to 700° C. or more, by a vapor deposition method using a vapor deposition material having Y, and oxygen.

US Pat. No. 10,115,853

ELECTRONIC POWER CELL MEMORY BACK-UP BATTERY

Colossus EPC Inc., Gilbe...

1. An electronic power cell memory back-up battery comprising:a light source, wherein the light source emits light in response to receiving light source input power;
a photovoltaic device, wherein the photovoltaic device outputs photovoltaic-generated electrical power in response to receiving light from the light source;
power modulation circuitry electrically coupled to the light source and photovoltaic device;
wherein a first portion of the photovoltaic-generated electrical power output by the photovoltaic device is the light source input power;
wherein the power modulation circuitry receives the light source input power, alters the light source input power to provide a periodic light source input power, and provides the periodic light source input power to the light source;
wherein a second portion of the photovoltaic-generated electrical power output by the photovoltaic device is a power source output power; and
wherein the light source comprises:
a light-emitting device, wherein the light emitting device emits light of a first peak wavelength in response to receiving light source input power; and
a light photon releaser (LPR) material, wherein the LPR material emits light of a second peak wavelength in response to receiving light of the first peak wavelength from the light-emitting device, wherein the LPR material comprises a compound doped with phosphorus, europium, and/or elements from the Lanthanide series; and
a block of optical coupling material, wherein the light-emitting device and the LPR material are embedded in the block of optical coupling material;
wherein the battery further comprises at least one mirror having an interior surface facing the light source and coated with LPR material, wherein the LPR material coating is in contact with the optical coupling material.

US Pat. No. 10,115,842

SEMICONDUCTOR OPTICAL PACKAGE AND METHOD

STMICROELECTRONICS PTE LT...

1. A device, comprising:a first substrate;
a second semiconductor substrate having a first surface on the first substrate and a second surface opposite the first surface, the semiconductor substrate including a first optical device and a second optical device that receive light from the second surface;
a first sidewall on the first substrate;
a second sidewall on the first substrate, the second semiconductor substrate being between the first and second sidewall;
a transparent layer extending between the first and second sidewall and overlapping the second surface of the semiconductor substrate;
a first light protection coating on the transparent layer, the transparent layer being between the first light protection coating and the second surface of the semiconductor substrate;
a first opening in the first light protection coating; and
a second opening in the first light protection coating.

US Pat. No. 10,115,637

METHOD FOR FABRICATING AUTO-ALIGNED INTERCONNECTION ELEMENTS FOR A 3D INTEGRATED CIRCUIT

1. Method for fabricating transistors for an integrated circuit equipped with several superimposed levels of transistors, comprising the following steps:a) forming, on a given level equipped with one or more transistors made at least partially in a first semiconductor layer: a stack comprising at least one first region of a second semiconductor layer suitable for receiving an N-type transistor channel and at least one second region of the second semiconductor zone suitable for receiving a P-type transistor channel of a level above the given level, where the stack moreover comprises a continuous layer made of conductive or doped semiconductor material and called the ground plane, as well as an insulating layer between the ground plane and the second semiconductor layer, then
b) carrying out at least one thermal annealing for activation of source and drain region of said N type transistor and of said P type transistor by exposure to a laser, said source and drain regions being in the form of one or more doped zones of the second semiconductor layer and/or doped semiconductor blocks formed on the second semiconductor layer, where the source and drain regions exposed to the laser are located on the side of an upper face of the ground plane continuous layer, where the ground plane continuous layer is configured so as to protect from the laser a part of the circuit located on the side of a lower face of the ground plane continuous layer, then
c) cutting up of the ground plane continuous layer into at least one first portion and at least one second portion separated from the first portion, where the first portion is configured to allow biasing of the first region, where the second portion is configured to allow biasing of the second region.

US Pat. No. 10,115,635

METHOD FOR FILLING A WAFER VIA WITH SOLDER

KOREA INSTITUTE OF INDUST...

1. A wafer via solder filling method using a wafer via solder filling device comprising a solder bath comprising an accommodation space for accommodating a molten solder, with an open top, and an air outlet for exhausting air from the accommodation space; a fixing unit for fixing the wafer having a via formed in one surface in the accommodation space to seal the accommodation space airtight; and a pressing unit for pressing a bottom of the molten solder arranged in the solder bath and moving the molten solder upward, to fill the molten solder in the via, the wafer via solder filling method comprising:a fixing step of fixing the wafer in the accommodation space, using the fixing unit, and sealing the accommodation space airtight;
an exhausting step of exhausting air inside the sealed accommodation space through the air outlet; and
a filling step of filling the molten solder in the via as pressing the bottom of the molten solder and moving the molten solder upward, using the pressing unit.

US Pat. No. 10,115,625

METHODS FOR REMOVAL OF HARD MASK

GLOBALFOUNDRIES SINGAPORE...

1. A method of forming a device comprising:providing a substrate prepared with isolation regions, the substrate having a non-planar substrate surface topology created by the isolation regions, wherein the substrate comprises at least first and second regions, the first region comprises a memory region and the second region comprises a logic region;
forming a hard mask layer covering the substrate and the isolation regions with a non-planar surface topology, wherein the hard mask layer comprises a pad layer and a first hard mask layer on the pad layer, the hard mask layer includes a non-planar hard mask surface topology which tracks the underlying non-planar substrate surface topology; and
selectively removing a select portion of the hard mask layer over a select region, which is one of the first and second regions, while leaving a non-select portion of the hard mask layer over a non-select region, which is other of the first and second regions, for processing of the select region of the substrate.

US Pat. No. 10,115,608

METHOD AND APPARATUS FOR RAPID PUMP-DOWN OF A HIGH-VACUUM LOADLOCK

Novellus Systems, Inc., ...

1. An apparatus configured to be installed as part of a semiconductor processing tool, the semiconductor processing tool selected from the group consisting of: a semiconductor processing tool having one or more process chambers and a loadlock with a loadlock volume, and a semiconductor processing tool having one or more process chambers, a loadlock with a loadlock volume, and one or more transfer chambers, the apparatus comprising:a housing having internal surfaces defining a gas expansion volume, wherein the gas expansion volume is at least one and a half times larger than the loadlock volume;
a gas expansion volume valve, wherein:
the housing is configured to connect with the loadlock such that the gas expansion volume valve is interposed between the loadlock volume and the gas expansion volume when so connected,
the gas expansion volume is configured to be separate from the one or more process chambers and separate from any transfer chamber of the semiconductor processing tool,
the gas expansion volume valve is configured to be movable between an open state and a closed state,
the gas expansion volume valve permits fluidic communication between the loadlock volume and the gas expansion volume when in the open state and when the apparatus is connected with the loadlock, and
the gas expansion volume valve prevents fluidic communication between the loadlock volume and the gas expansion volume when in the closed state and when the apparatus is connected with the loadlock;
a first mechanism that comprises a high-vacuum pump configured to evacuate gas from the housing regardless of whether the gas expansion volume valve is in the open state or the closed state; and
a controller with at least one processor and a memory, the memory storing computer-executable instructions for controlling the at least one processor to:
a) control the gas expansion volume valve to enter the closed state;
b) cause the loadlock to be fluidically isolated from the one or more process chambers;
c) control a roughing pump to, after (a) and (b), evacuate gas from within the loadlock volume to reach a first lower-than-atmospheric pressure when the gas expansion volume valve is in the closed state;
d) control, after (a), the high-vacuum pump to evacuate gas from within the housing to reach a second lower-than-atmospheric pressure, wherein the second lower-than-atmospheric pressure is lower than the first lower-than-atmospheric pressure; and
e) control, after (c) and (d), the gas expansion valve to enter the open state thereby allowing gas in the gas expansion volume to mix with gas from the loadlock volume and reach equilibrium, wherein:
the first mechanism is fluidically connected with the gas expansion volume,
the first mechanism is configured to control gas pressure within the housing and to cause the pressure in the housing to be reducible to lower than 10E-3 Torr, and
the first mechanism is fluidically isolated from the loadlock volume when the gas expansion volume valve is in the closed state and when the apparatus is connected with the loadlock.

US Pat. No. 10,115,605

VACUUM ASSISTED SEALING PROCESSES AND SYSTEMS FOR INCREASING AIR CAVITY PACKAGE MANUFACTURING RATES

RJR Technologies, Inc., ...

1. A sealing process for air cavity electronic packages comprising the steps of:providing a base and a lid, at least one of the base and the lid having a mating surface coated with an adhesive;
maintaining an air gap between the base and the lid;
generating a vacuum around the base, the lid, and the adhesive;
mating the base and the lid together after the vacuum has been generated to create a mated package assembly with a vacuum therein; and
heating the mated package assembly to a curing temperature to cure the adhesive.

US Pat. No. 10,115,580

METHOD FOR MANUFACTURING AN SOI WAFER

SHIN-ETSU HANDOTAI CO., L...

1. A method for manufacturing an SOI wafer having an SOI layer including a thinning step to adjust an SOI film thickness of the SOI wafer, comprising the steps of:(A1) measuring the S01 film thickness of the SOI wafer having the SOT layer before the thinning step;
(A2) determining a rotational position of the SOI wafer by rotating the SOI wafer before the thinning step on the basis of a radial SOI film thickness distribution obtained in the measuring of the film thickness of the step (A1) and a previously determined radial stock removal distribution in the thinning step, and rotating the SOI wafer around the central axis thereof so as to bring the SOI wafer to the determined rotational position; and
(A3) thinning the SOI layer of the SOI wafer after being rotated in the step (A2), wherein the wafer is not rotated during the thinning step.

US Pat. No. 10,115,569

PLASMA GENERATOR

JEHARA CORPORATION, Gyeo...

1. A plasma generator which includes a source electrode unit and a bias electrode unit disposed to face each other in a vacuum chamber and an RF power unit and a bias RF power unit supplying RF power to the source electrode unit and the bias electrode unit, respectively, the plasma generator comprising:a common contact point which is connected with a plurality of contact points disposed along the edge of the source electrode unit; and
an impedance controller which is connected with the common contact point to control the impedance.

US Pat. No. 10,115,553

GROUND FAULT CIRCUIT INTERRUPTER AND RESET MECHANISM THEREOF

ZHANGJIAGANG CITY BAREP E...

1. A reset mechanism of a ground fault circuit interrupter (GFCI), comprising: a reset button and a reset lever disposed at a bottom of the reset button, wherein the reset mechanism further comprises: an electromagnet, a slide rocker, a rotary lifting block, and a reset mounting bracket, wherein rotating shafts are separately disposed at two sides of the rotary lifting block; the rotary lifting block is disposed on the reset mounting bracket in a movable manner by using the pair of rotating shafts; lifting parts protruding outwards are separately disposed at two sides of one end of the rotary lifting block; a clamping hook facing inwards is disposed on a bottom surface of another end of the rotary lifting block; a lifting block spring used for resetting the rotary lifting block is disposed on one side of the lifting part of the rotary lifting block; a bottom of the lifting block spring abuts against the rotary lifting block; a position-limiting block matched with one side of the lifting part of the rotary lifting block is disposed on the reset mounting bracket; the reset mounting bracket is provided with a rocker insertion hole matched with the slide rocker below the rotary lifting block; the slide rocker penetrates the rocker insertion hole in a movable manner; the slide rocker is provided with a rocker bending part on an end part of one side of the lifting part of the rotary lifting block; an end part of the rocker bending part is provided with a rocker bayonet; the electromagnet is disposed at one side of the rocker bending part of the slide rocker; an iron core of the electromagnet is provided with an iron core card slot matched with the rocker bayonet; the rocker bayonet is clamped to the iron core card slot of the iron core; the reset lever is disposed above one side of the clamping hook of the rotary lifting block in a movable manner; and a reset lever spring used for resetting the reset button is sleeved on the reset lever.

US Pat. No. 10,115,552

RETROFIT CAFI/GFI REMOTE CONTROL MODULE

Schneider Electric USA, I...

1. A retrofit remote control module providing a simple thermal-magnetic circuit breaker with arc fault or ground fault, or both, sensing and interruption capabilities for a branch circuit, comprising:a case housing a current path with neutral and line conductors,
line sensors for sensing current flow within the current path,
electronics connected to the line sensors to determine anomalies in the sensed current flow, and
a bistable relay in the current path between the simple thermal-magnetic circuit breaker and the load, the relay being operated by said electronics to open the branch circuit; and
connectors for attaching the neutral and line conductors to a branch circuit on a downstream side of the module, and attaching the neutral and line conductors to the load side of the simple thermal-magnetic circuit breaker on an upstream side of the module.

US Pat. No. 10,115,545

ACTUATING METHOD AND DEVICE FOR A HELICOIDAL SWITCH

GORLAN TEAM, S.L.U., (ES...

1. An actuating device for mechanically converting rotational movement into helicoidal movement, the actuating device comprising:a fixed body having a through cavity extending along an axis, said fixed body being provided with two guiding surfaces parallel to one another and arranged in an inclined manner,
a moving rod housed such that it has the capacity for movement in said through cavity, the moving rod being provided with a lug emerging radially with respect to an axial axis of the rod,
wherein said lug is arranged tightly between said guiding surfaces, such that it can slide over them, making contact with both surfaces; and
wherein the guiding surfaces comprise an annular shape arranged around the through cavity, and where the guiding surfaces are accessible from outside the fixed body.

US Pat. No. 10,115,538

LIGHT-PERVIOUS BICOLOR KEY CAP

TAIWAN TAI-HAO ENTERPRISE...

1. A light-pervious bicolor key cap, including:a key frame, having a first color and formed with a plurality of thin ribs, wherein front ends of said plural thin ribs are formed with at least one letter or one punctuation, and said letter or said punctuation is formed in a continuous status without any notch; and
a cap cover, having a second color, wherein said letter or said punctuation is formed on a surface of said cap cover so as to form a bicolor key cap, an outer side of said cap cover is formed with a material filling protrusion allowing a plastic having said second color to be filled in, and an inner surface of said cap cover is formed with at least one convex piece located below said letter or said punctuation, and said plastic having said second color is allowed to pass two sides defined at a bottom end of said convex piece for enabling said convex piece having said second color to be formed, and said convex piece is not fixedly combined with said key frame; so that through removing said convex piece, said letter or said punctuation of said cap cover is prevented from being formed with any notch and capable of allowing light to fully permeate.

US Pat. No. 10,115,531

ENERGY STORAGE DEVICE HAVING IMPROVED HEAT-DISSIPATION CHARACTERISTIC

LS MITRON LTD., Anyang-s...

1. An energy storage device, comprising:a cell assembly formed by connecting at least two cylindrical energy storage cells in series;
a case having an accommodation portion shaped corresponding to an outer surface of the energy storage cells to accommodate the cell assembly; and
a heat-dissipating pad installed between the outer surface of the energy storage cells of the cell assembly and an inner surface of the accommodation portion,
wherein the case includes at least two case blocks,
wherein the accommodation portion is formed by coupling the case blocks,
wherein the heat-dissipating pad has elasticity, and
wherein an interval between the accommodation portion and the energy storage cells is smaller than a thickness of the heat-dissipating pad before being compressed and greater than a diameter tolerance of the energy storage cells.

US Pat. No. 10,115,509

ULTRAFINE-CRYSTALLINE ALLOY RIBBON, FINE-CRYSTALLINE, SOFT-MAGNETIC ALLOY RIBBON, AND MAGNETIC DEVICE COMPRISING IT

HITACHI METALS, LTD., To...

1. An ultrafine-crystalline alloy ribbon having a structure, in which more than 0% and less than 30% by volume of ultrafine crystal grains having an average particle size of 30 nm or less are dispersed in an amorphous matrix; an ultrafine crystal grains-depleted region having a smaller number density of ultrafine crystal grains than in a center portion of said ribbon being formed in a region of 0.2 mm in width from each edge of the ribbon along a longitudinal direction; and the number density of ultrafine crystal grains having particle sizes of 3 nm or more being 300/?m2 or less in said ultrafine crystal grains-depleted region, and 500/?m2 or more in the center portion of said ribbon,wherein a distance between said edge and a position at which a number density of ultrafine crystal grains is 1/2 of a number density of ultrafine crystal grains in said center portion is 0.5 to 0.6 mm, the distance being 1 to 2.4% of the entire width of said ultrafine-crystalline alloy ribbon,
wherein the total width of both ultrafine crystal grains-depleted regions is 5% or less of the entire width of said ultrafine-crystalline alloy ribbon, and
wherein said ultrafine-crystalline alloy ribbon is made of a magnetic alloy having a composition represented by the general formula of Fe100-x-y-zAxByXz, wherein A is Cu and/or Au, X is at least one element selected from the group consisting of Si, S, C, P, Al, Ge, Ga and Be, part of Fe may be substituted by at least one element D selected from the group consisting of Ni, Mn, Co, V, Cr, Ti, Zr, Nb, Mo, Hf, Ta, and W, part of Fe may be substituted by at least one element selected from the group consisting of Re, Y, Zn, As, Ag, In, Sn, Sb, platinum-group elements, Bi, N, O, and rare earth elements, and x, y and z are numbers meeting the conditions of 0

US Pat. No. 10,115,498

HYBRID CABLE, METHOD FOR ITS MANUFACTURE AND USE OF SUCH A HYBRID CABLE

LEONI Kabel Holding GmbH,...

1. An electric lead, comprising:at least three conductors, each having a line being surrounded by a conductor sheath;
two of said conductors are signal conductors;
a common partial lead sheath surrounding said signal conductors, said common partial lead sheath and said signal conductors forming a first partial lead;
another of said conductors is a power conductor forming a second partial lead;
a separating sleeve directly surrounding said first partial lead and said second partial lead, said separating sleeve being formed from a synthetic non-woven fabric or a plastic film; and
a common sheath surrounding said separating sleeve.

US Pat. No. 10,115,497

COMPRESSIVE GRAPHENE HYDROGEL AND PREPARATION METHOD THEREFOR

FUZHOU UNIVERSITY, Fuzho...

1. A process of preparing a compressive graphene hydrogel by using a hydrothermal method, the process comprising:using oxidized graphene as precursor;
adding water into said oxidized graphene to make an aqueous solution;
placing said aqueous solution in a reactor, lining,
doping said aqueous solution with phytic acid, and carrying out a reaction after mixing;
freeze-drying the reaction product to get said compressive graphene hydrogel.

US Pat. No. 10,115,495

TRANSPARENT CONDUCTOR AND OPTICAL DISPLAY INCLUDING THE SAME

SAMSUNG SDI CO., LTD., Y...

1. A transparent conductor comprising:a base layer; and
a conductive layer on the base layer, the conductive layer comprising metal nanowires and a matrix, the matrix comprising a mixture of a first dye having a maximum absorption wavelength of about 450 nm to about 550 nm and a second dye having a maximum absorption wavelength of about 350 nm to 449 nm,
wherein the transparent conductor has a reflective a* value of about ?0.3 to about +0.3.

US Pat. No. 10,115,487

SHUTDOWN SYSTEM FOR A NUCLEAR STEAM SUPPLY SYSTEM

SMR INVENTEC, LLC

1. A nuclear steam supply system with shutdown cooling system, the nuclear steam supply system comprising:a reactor vessel having an internal cavity;
a reactor core comprising nuclear fuel disposed within the internal cavity and operable to heat a primary coolant;
a steam generating vessel fluidly coupled to the reactor vessel;
a riser pipe positioned within the steam generating vessel and fluidly coupled to the reactor vessel;
a primary coolant loop formed within the reactor vessel and the steam generating vessel, the primary coolant loop being configured for circulating primary coolant through the reactor vessel and steam generating vessel; and
a primary coolant cooling system comprising:
an intake conduit having an inlet fluidly coupled to the primary coolant loop;
a pump fluidly coupled to the intake conduit, the pump configured and operable to extract and pressurize primary coolant from the primary coolant loop and discharge the pressurized primary coolant through an injection conduit;
a Venturi injection nozzle having an inlet fluidly coupled to the injection conduit and an outlet positioned within the riser pipe to inject pressurized primary coolant into the riser pipe from the pump; and
a heat exchanger configured and operable to cool the extracted primary coolant.

US Pat. No. 10,115,409

ADAPTIVE PROCESSING OF SOUND DATA

Samsung Electronics Co., ...

1. An electronic device comprising:a speaker;
a communication module configured to communicate with an external electronic device; and
a processor connected to the communication module,
wherein the processor is configured to:
receive data and additional data from the external electronic device using the communication module, the additional data indicating attributes of the data;
when the attributes of the data are determined to be speech according to the additional data, decode the data using a first decoding scheme and change the quality of the decoded data using a first signal processing scheme, which is at least one of a plurality of first signal post-processing schemes;
when the attributes of the data are determined to be music according to the additional data, decode the data using a second decoding scheme, which is different than the first decoding scheme, and change the quality of the decoded data by using a second signal processing scheme, which is at least one of a plurality of second signal post-processing schemes, wherein the second signal processing scheme is different than the first signal processing scheme; and
output, through the speaker, an audio signal corresponding to the data changed using the first signal processing scheme or the second signal processing scheme,
wherein the plurality of first signal post-processing schemes includes a scheme for reducing or removing noise from the decoded data, a scheme for removing a low-band portion of the frequency domain of the decoded data, and a scheme for adjusting dynamics of the decoded data.

US Pat. No. 10,115,407

METHOD AND APPARATUS FOR ENCODING AND DECODING HIGH FREQUENCY SIGNAL

SAMSUNG ELECTRONICS CO., ...

1. A method of encoding a high band signal in an encoding device, the method comprising:extracting, performed by at least one processor, a coefficient from linear prediction of a high band signal;
encoding the extracted coefficient;
generating a signal based on a low band signal and the extracted coefficient;
obtaining a gain from an energy value of the high band signal and an energy value of the generated signal;
adjusting, by the encoding device, the gain in consideration of reducing noise in a reconstructed signal at a decoding device;
encoding the adjusted gain; and
transmitting a bitstream including the encoded coefficient and the encoded gain to the decoding device,
wherein the encoding the extracted coefficient comprises performing an interpolation process on the extracted coefficient, and
wherein the high band signal has at least one of audio characteristic and speech characteristic.