US Pat. No. 9,058,461

TRANSFERRING HEAT THROUGH AN OPTICAL LAYER OF INTEGRATED CIRCUITRY

INTERNATIONAL BUSINESS MA...

1. A method in a computer-aided design system for generating a functional design model of an integrated circuitry structure,
the method comprising:
generating a functional representation of a thermal zone and a non-thermal zone of the integrated circuitry structure, the
thermal zone having high thermal activity needing greater heat transfer than the non-thermal zone having low thermal activity;

generating a functional representation of an optical layer comprising optical waveguides within a first material having a
first thermal conductivity, the optical waveguides bundled into a plurality of sets of closely spaced optical waveguides substantially
throughout the thermal zone and individually spaced further apart substantially throughout the non-thermal zone; and

generating a functional representation of a heat-conductive material having a second thermal conductivity greater than the
first thermal conductivity, disposed between the sets of bundled optical waveguides in the first material of the thermal zone,
for transferring heat from at least the thermal zone through the optical layer to a heat sink.

US Pat. No. 9,056,821

PROMOTER CATALYST SYSTEM WITH SOLVENT PURIFICATION

SABIC Global Technologies...

1. Listing A process for a chemical condensation reaction comprising contacting at least two chemical reagents comprising
at least one of a phenol and a ketone with an attached promoter ion exchange resin catalyst system to produce an effluent
stream, and then subjecting the effluent stream to a solvent crystallization step, wherein the attached promoter is an ion
exchange resin catalyst system that comprises a cross-linked, sulfonated ion exchange resin having sulfonic groups, wherein
the solvent used in the crystallization step comprises an aromatic solvent that comprises one or more of toluene, benzene,
and xylene, and wherein the solvent crystallization step removes at least a portion of one or more bisphenol-A byproducts.

US Pat. No. 9,058,750

FLIGHT SIMULATOR VIBRATION SYSTEM

Airbus Helicopters Deutsc...

1. A flight simulator vibration system for an aircraft, the system defining three coordinate axes, the system comprising:
a crew seat with a first predefined momentum weight driven by a first electric motor, a second predefined momentum weight
driven by a second electric motor, and a third predefined momentum weight driven by a third electric motor, each respective
electric motor being disposed within a respective motor casing removably retained by a respective flexible stripe,

a flight control stick with a fourth momentum weight driven by a fourth electric motor,
a panel vibration system with a fifth momentum weight driven by a fifth electric motor, and
at least one electronic control circuit configured to individually control the electric motors to provide vibrations about
all three coordinate axes, wherein when the respective flexible stripes are removed the respective motors may be rotated for
tuning and the respective momentum weights may be adjusted or replaced for tuning.

US Pat. No. 9,058,799

SOUND DIFFUSER INSPIRED BY CYMATICS PHENOMENON

University of Dammam, Da...

1. A sound diffuser comprising:
a panel that have an irregular outer surface with a plurality of wells formed therein in a cymatic organization, wherein
each of the plurality of wells are arranged relative to one another in a predetermined cymatic pattern, and a depth set according
to well position?2 mod N,

where N is a number of wells and is also a prime number.
US Pat. No. 9,057,069

COMPOSITIONS AND METHODS FOR INHIBITING EXPRESSION OF EG5 GENE

Alnylam Pharmaceuticals, ...

1. A composition comprising a double-stranded ribonucleic acid (dsRNA) for inhibiting expression of a human kinesin family
member 11 (Eg5) gene in a cell, wherein the dsRNA comprises a sense strand comprising a first sequence and an antisense strand
comprising a second sequence complementary to 19-24 nucleotides of nucleotides 1066-1101 of NM—004523 (5? UUCCUUAUCGAGAAUCUAAACUAACUAGAAUCCUCC 3? SEQ ID NO:1534), wherein the first sequence is complementary to the second
sequence and wherein the dsRNA is between 19 and 30 base pairs in length.

US Pat. No. 9,056,210

PUBLIC BUILDING AND SCHOOL EVACUATION SYSTEM

1. An emergency escape system in a building, said emergency escape system comprises;
a) a linkage assembly having an actuator, a spring bob, a spring and a linking element, said linkage assembly configured to
move from an engaged position to a disengaged position, said engaged position being when the actuator is directly connected
to the spring bob, said disengaged position being when the actuator is disconnected from the spring bob;

b) a latched window hingedly attached in an exterior wall of the building, said window incorporating part of said linkage
assembly, said actuator positioned proximate said latched window, said linkage assembly configured to allow the window to
be unlatched and opened when said linkage assembly is moved to said disengaged position, said linkage assembly configured
to prevent the window from opening when in said engaged position;

c) a housing enclosing an inflatable chute, said housing fixedly attached beneath said latched window;
d) an alarm circuit incorporating an alarm within said building, said alarm configured and arranged to notify occupants of
said building that an emergency exit has been activated as a result of said actuator moving said linkage assembly to the disengaged
position, and said alarm configured and arranged to transmit a telephonic communication to civil authorities that the emergency
exit for a specified location has been activated as a result of said actuator moving said linkage assembly to the disengaged
position; and

e) said spring bob mechanically linked to a valve, said valve configured to open to release gas propellant that inflates said
chute upon movement from said engaged position to said disengaged position, so that said emergency escape system is configured
to inflate said chute as a result of moving the actuator which causes said linkage assembly to move to the disengaged position
which causes the spring to move the spring bob which causes the linking element to open the valve and inflate said chute.

US Pat. No. 9,059,037

METHODS FOR OVERLAY IMPROVEMENT THROUGH FEED FORWARD CORRECTION

GLOBALFOUNDRIES Inc., Gr...

1. A method, comprising:
obtaining a device after at least one laser annealing process is completed, the device including a substrate surface and at
least one layer over the substrate surface;

performing lithography on the at least one layer;
positioning a first contact-to-gate layer over the at least one layer;
checking alignment of electrical connections between the substrate surface and the first contact-to-gate layer;
determining if an overlay error is present;
adjusting at least one subsequent fabrication process;and
determining a rework threshold for use in adjusting the at least one subsequent fabrication process;
wherein the overlay error and the rework threshold are used to determine an overlay correction.

US Pat. No. 9,056,564

ADJUSTING DEVICE, PARTICULARLY FOR A VEHICLE SEAT

Johnson Controls Technolo...

1. An adjusting device for performing at least one adjusting function, particularly for adjusting a motor vehicle seat comprising:
a drive, which has a drive device, an actuator, a plurality of planetary gears rotatably coupled to the actuator, and an output,
wherein the drive device provides torque to the output via the plurality of planetary gears;

a braking device configured to interact with the actuator, wherein the braking device at least partially blocks torque of
the output from acting on the drive device; and

at least one spring device arranged between the drive and the braking device, wherein the braking device comprises a braking
part, the at least one spring device is arranged between the actuator and the braking device, the actuator comprises a first
recess, the braking part comprises a second recess, the at least one spring device is disposed within the first recess and
the second recess, and the adjusting device does not include a rolling contact element arranged between the drive and the
braking device;

wherein while a torque is exerted on the actuator, the at least one spring device is deformed elastically until a first engagement
device of the actuator rests against a second engagement device of the braking part, and while the torque is not exerted on
the actuator, the first engagement device is in a starting position and does not rest against the second engagement device
and the at least one spring device is not deformed elastically.

US Pat. No. 9,056,812

PROCESS FOR PREPARING 4-CYCLOHEXYL-2-METHYL-2-BUTANOL

BASF SE, (DE)

1. A process for preparing 4-cyclohexyl-2-methyl-2-butanol, comprising:
a) reaction of styrene with isopropanol at a temperature in the range from 250 500 ° C. to obtain 2-methyl-4-phenyl-2-butanol,
and

b) heterogeneously catalyzed hydrogenation of 2-methyl-4-phenyl-2-butanol over a catalyst suitable for ring hydrogenation
of aromatics,

where the molar ratio of the styrene used in step a) to the isopropanol used in step a) is in the range from 1:below 5 to
1:0.5.

US Pat. No. 9,056,499

IMAGE RECORDING APPARATUS

SCREEN HOLDINGS CO., LTD....

1. An image recording apparatus comprising:
a holding part having a holding surface for sucking and holding a sheet-shaped recording medium by negative pressure;
an ejection part for ejecting an ink droplet to the recording medium held on said holding surface; and
a moving part for moving said holding part relative to said ejection part, in a first direction extending along said holding
surface;

said ejection part including:
a housing having an opposing surface opposed to said holding surface;
an upstream ejection port and a downstream ejection port provided on said opposing surface and arranged at an interval in
said first direction; and

a central bypass passage opened in a region of said opposing surface of said housing between said upstream ejection port and
said downstream ejection port, wherein

a distance between said opposing surface and the recording medium held on said holding part is 0.5 mm or more and 2 mm or
less.

US Pat. No. 9,057,590

ENHANCED RELIABILITY MINIATURE PISTON ACTUATOR FOR AN ELECTRONIC THERMAL BATTERY INITIATOR

BAE Systems Information a...

1. A method for manufacturing a miniature piston actuator, said method comprising the steps of:
providing a header electrode assembly comprising a header and an electrode, said header having a first end and a second end,
said first end comprising a planar surface, said planar surface having a shoulder cut-out around perimeter of said first end,
said header defining an aperture through a center portion of said header extending from said first end to said second end,
said header size corresponding to an M100 designation, an outer diameter of said header being approximately 0.100 inch, and
there not being more than one electrode having a first end and a second end, said first end of said electrode extending within
said aperture of said header, said first end of said electrode being flush with said planar surface of said first end of said
header, and there is a glass insulator within said aperture of said header, said glass insulator providing a glass fill seal
between said electrode and said aperture of said header, and said glass insulator being flush with said planar surface of
said first end of said header;

welding a bridgewire to the electrode of said header electrode assembly, said bridgewire forming a circuit between said header
and said electrode, said header and said bridgewire comprising a header/bridgewire assembly, wherein resistance of said bridgewire
is controlled to ensure that a minimum all-fire energy of said device is available from a firing circuit;

installing a ferrule, said ferrule comprising a ring having a first end and a second end, and dimensions of said second end
of said ferrule corresponding to said shoulder cut of said header, said second end of said ferrule being located in said shoulder
cut of said first end of said header;

applying charge material within said ferrule, said charge material being filled to be plane with said first end of said ferrule,
said charge material adapted to be activated by a current through said bridgewire, and reliability of said piston actuator
activation exceeding approximately 99.5 percent of said activated charge material becoming an expanding gas;

installing a piston, said piston proximate said charge material, said piston being moved to provide mechanical output by said
charge material expanding gas, said piston, said header, said ferrule, and said bridgewire comprising a piston header ferrule/bridgewire
assembly; and
installing a discrete housing around said piston header ferrule/bridgewire assembly, said housing having a first end and a
second end, said first end of said housing defining an opening having a diameter through which said second end of said single
electrode extends, and said diameter of said opening of said first end of said housing being less than said diameter of said
header, said housing having a cylindrical inner diameter larger than said diameter of said header, and said header, ferrule,
and the piston sliding Iv fitting within said housing, and said second end of said housing open to receive said piston header
ferrule/bridgewire assembly, such that said piston provides said mechanical output to initiate said electronic thermal battery
by striking, said electronic thermal battery.

US Pat. No. 9,057,307

EXHAUST GAS AFTERTREATMENT INSTALLATION AND METHOD

Daimler AG, Stuttgart (D...

1. An installation for aftertreatment of exhaust gas generated by a combustion device of a motor vehicle, said installation
comprising:
a nitrogen oxide storage catalytic converter arranged in an exhaust gas line of the motor vehicle to receive the exhaust gas
generated by the combustion device;

a particulate filter arranged in the exhaust gas line downstream of and separated from the nitrogen oxide storage catalytic
converter, wherein the particulate filter includes an SCR catalyst catalytic coating; and

an SCR catalytic converter arranged in the exhaust gas line downstream of and separated from the particulate filter.
US Pat. No. 9,056,948

MICROCAPSULES AND PRODUCTION THEREOF

1. Microcapsules whose capsule walls comprise a resin which is obtained by reacting
a) at least one compound selected from the group consisting of
a1) amines, and
a2) aromatic or heteroaromatic compounds which are unsubstituted or substituted by one or more substituents selected from
the group consisting of C1-C20 alkyl, OH, OR, COOH, SH, SR, NHCOR, OCOR, halogen and aromatic, where R represents a C1-C10 alkyl group,

with,
b) at least one aldehydic component which has at least two C atoms per molecule, in the presence of
c) at least one copolymer which comprises units of 2-acrylamido-2-methylpropanesulfonic acid or its salts (AMPS) and/or 2-acrylamido-2-methylpropanephosphonic
acid or its salts (AMPP) and units of one or more (meth)acrylates,

wherein, the use of formaldehyde is excluded.

US Pat. No. 9,056,383

PATH FOR PROBE OF SPECTROGRAPHIC METROLOGY SYSTEM

Applied Materials, Inc., ...

1. A method of operating a polishing system, comprising:
polishing a substrate at a polishing station, the substrate held by a carrier head during polishing;
transporting the substrate to an in-sequence optical metrology system positioned between the polishing station and another
polishing station or a transfer station;

measuring a plurality of spectra reflected from the substrate with a probe of the optical metrology system while moving the
carrier head to cause the probe to traverse a path across the substrate and while the probe remains stationary, the path across
the substrate comprising either a plurality of concentric circles or a plurality of substantially radially aligned arcuate
segments; and

adjusting a polishing endpoint or a polishing parameter of the polishing system based on one or more characterizing values
generated based on at least some of the plurality of spectra.

US Pat. No. 9,058,480

DIRECTIONAL TOUCH UNLOCKING FOR ELECTRONIC DEVICES

Google Inc., Mountain Vi...

1. A computer implemented method, comprising:
receiving, by one or more processors, an input pattern from a touch based input device, the input pattern comprising one or
more directional changes corresponding to directional changes of user gestures made on the input device, wherein the directional
changes are based on an end movement of each of the user gestures, and wherein a first portion of the input pattern is formed
with one finger and a second portion of the input pattern is formed with a plurality of fingers;

determining, by one or more processors, if the directional changes of the input pattern match directional changes of a security
pattern associated with a user's security profile, wherein the determining does not compare a size or a specific location
of the input pattern on the touch based input device with the security pattern; and

providing an unlock signal if the directional changes of the input pattern match the directional changes of the security pattern,
the unlock signal granting user access to a user device or a user account.

US Pat. No. 9,058,922

METHOD OF MANUFACTURING CHAIN EXTENDED FOAM INSULATION COAXIAL CABLE

CommScope Technologies LL...

1. A method for manufacturing a coaxial cable, comprising the steps of:
irradiating a polymer;
extruding the polymer around an inner conductor; and
surrounding the foamed polymer with an outer conductor.

US Pat. No. 9,057,483

THREADED INSERT FOR COMPACT CRYOGENIC-CAPABLE PRESSURE VESSELS

Lawrence Livermore Nation...

1. An apparatus consisting of:
a pressure container having an interior cavity fabricated from a cavity material and an outer surface spaced away from said
interior cavity;

a cryogenic gas in said interior cavity,
external components outside of said pressure container;
an internally threaded opening in said pressure container connecting said interior cavity to said external components, said
opening having an end interfacing with said outer surface of said pressure container; and

an insert threaded into said opening;
a weld proximate said end of said internally threaded opening extending circumferentially around said insert, said weld located
between said outer surface of said pressure container and said insert providing a seal between said outer surface of said
pressure container and said insert;

an inlet port tube connecting the external components with said interior cavity;
an inlet port tube opening in said insert with said inlet port tube positioned in said inlet port tube opening;
a circumferential inlet port tube weld connecting said inlet port tube to said insert that provides a seal between said inlet
port tube and said insert;

an outlet port tube connecting said interior cavity with the external components;
an outlet port tube opening in said insert with said outlet port tube positioned in said outlet port tube opening; and
a circumferential outlet port tube weld connecting said outlet port tube to said insert that provides a seal between said
outlet port tube and said insert;

wherein said circumferential inlet port tube weld is directly exposed to said cryogenic gas in said interior cavity and said
circumferential outlet port tube weld is directly exposed to said cryogenic gas in said interior cavity.

US Pat. No. 9,056,578

LAMP FOR VEHICLE

HONDA MOTOR CO., LTD, To...

1. A lamp for a vehicle, comprising: a plurality of LED light sources; a board having a plurality of mounting portions on
which said LED light sources are mounted; and a reflector member covering said LED light sources, said reflector member reflecting
light emitted from said LED light sources with directivity, wherein said plurality of mounting portions are arranged at least
in one direction among the vehicle longitudinal direction and the vehicle lateral direction, such that said LED light sources
are mountable can be disposed in plural configurations on said board, wherein a number of said plurality of mounting portions
exceeds a number of said plurality of LED light sources, and wherein said reflector member is detachably attached to said
board wherein said reflector member includes a reflecting portion which reflects the light emitted from said LED light sources
and an attaching portion attached to said board, wherein said attaching portion is attached to said board such that said attaching
portion covers a mounting surface of said board on which said LED light sources are mounted, wherein said attaching portion
has an opening portion for exposing said LED light sources: and wherein each of said plurality of LED light sources is disposed
between said attaching portion and a corresponding reflecting portion.

US Pat. No. 9,055,877

SYSTEM AND METHOD FOR RECONSTRUCTING CARDIAC ACTIVATION INFORMATION

The Regents of the Univer...

1. A method of processing cardiac activation information, the method comprising:
accessing a first cardiac signal and a second cardiac signal obtained from a patient;
processing the first cardiac signal and the second cardiac signal to identify a point of change in the first cardiac signal
at which a derivative of the first cardiac signal diverges with respect to a derivative of the second cardiac signal; and

assigning an activation onset time in the first cardiac signal at the point of change to define a cardiac activation.

US Pat. No. 9,060,441

ELECTRONIC DEVICE AND POWER SUPPLY POSITIOINING APPARATUS THEREOF

HONG FU JIN PRECISION IND...

1. A power supply positioning apparatus, comprising:
a bracket defining a receiving slot for receiving a power supply unit; and
a circuit board mounted in the bracket and comprising a connector mounted on the
circuit board and aligning with the receiving slot;
wherein a first end of the bracket is operable of being rotatably connected to a chassis of an electronic device and a second
end of the bracket is operable of being detachably latched to the chassis, the bracket faces outside of the chassis;

wherein the bracket further comprises a cage, a first end of the cage is rotatably connected to the chassis, the fastener
is rotatably connected to a second end of the cage;

wherein the cage comprises a front plate, a top plate and a bottom plate extending rearward from top and bottom sides of the
front plate, and a rear plate connected between rear sides of the top plate and the bottom plate, wherein the front plate,
the to plate, the bottom plate, and the rear plate cooperatively bound the receiving slot;

wherein the first end of the cage defines a cutout, the circuit board is received in the cutout and mounted to the rear plate
of the cage, the bracket further comprises a cover mounted to the cage to cover the cutout, the cover comprises a front plate
defining a plurality of vents and a side plate defining a through slot, an end of a cable is electrically coupled to the circuit
board, an opposite end of the cable extends out of the cage through the through slot.

US Pat. No. 9,056,671

FIXED WING OF AN AIRCRAFT

Airbus Operations GmbH, ...

1. A wing of an aircraft that exhibits a main wing extending over a half-span,
wherein a wing chord of the main wing (M) at a location of an outermost rib (R5) of the main wing (M) viewed from the wing root measures 5% to 15% of the half-span of the main wing (M),

wherein the main wing (M) is comprised of a wing base area (10) and a wing adapter section (20), that forms the outer end area of the main wing (M), as viewed from the wing root, and is designed to secure a wing tip
device (W1, W2, W3),

wherein the wing adapter section (20) extends from an outer rib (R3) of the wing base area (10) and over 2% to 10% of the half-span of the main wing (M) up to an outer rib (R5) of the wing adapter section (20) forming the outermost rib (R5) of the main wing (M),

characterized in that the dihedral angle of the wing adapter section (20) that refers to the respective local spanwise direction continuously increases by between 10 and 60 degrees from the outer
rib (R3) of the wing base area (10) up to the outermost rib (R5) of the wing adapter section (20).

US Pat. No. 9,057,401

HIGH STRENGTH FOIL JOURNAL BEARING RETAINER

HONEYWELL INTERNATIONAL I...

1. An apparatus forming a foil journal bearing comprising:
a retainer member having an inner surface that defines an opening, said opening configured to receive a rotatable member;
a top foil trailing edge tab slot extending into said retainer member;
a top foil leading edge tab slot extending into said retainer member;
a top foil having a trailing edge tab and a leading edge tab;
wherein the trailing edge tab is disposed in the trailing edge tab slot;
wherein the leading edge tab is disposed in the leading edge tab slot;
a backup support structure positioned between and at least partially defined by said top foil trailing edge tab slot and said
top foil leading edge tab slot, and said backup support structure integral to said retainer member;

whereupon, in the absence of rotation of the rotatable member, the trailing edge tab is not in contact with the backup support;
whereupon, during rotation of the rotatable member, the trailing edge tab is urged into contact with the backup support.

US Pat. No. 9,058,824

DEVICES INCLUDING A GAS BARRIER LAYER

Seagate Technology LLC, ...

1. A device comprising:
a near field transducer (NFT);
a gas barrier layer positioned on at least a portion of the NFT; and
a wear resistance layer positioned on at least a portion of the gas barrier layer wherein the gas barrier layer comprises:
a) tantalum oxide (TaO), titanium oxide (TiO), chromium oxide (CrO), silicon oxide (SiO), aluminum oxide (AlO), titanium oxide
(TiO), zirconium oxide (ZrO), yttrium oxide (YO), magnesium oxide (MgO), beryllium oxide (BeO), niobium oxide (NbO), hafnium
oxide (Hf), vanadium oxide (VO), strontium oxide (SrO), or combinations thereof;

b) silicon nitride (SiN), aluminum nitride (Al), boron nitride (BN), titanium nitride (TiN), zirconium nitride (ZrN), niobioum
nitride (NbN), hafnium nitride (HfN), chromium nitride (CrN), or combinations thereof;

c) silicon carbide (SiC), titanium carbide (TiC), zirconium carbide (ZrC), niobioum carbide (NbC), chromium carbide (CrC),
vanadium carbide (VC), boron carbide (BC), or combinations thereof; or

d) combinations of any of a), b), and c).

US Pat. No. 9,058,687

TWO-DIMENSIONAL IMAGE CAPTURE FOR AN AUGMENTED REALITY REPRESENTATION

Empire Technology Develop...

1. A method, comprising:
determining, by an electronic image capturing device, an augmented reality representation of an object based at least in part
on an analysis of one or more two-dimensional images of the object, wherein the augmented reality representation includes
a plurality of surface hypotheses;

determining one or more reliability values associated with individual surface hypotheses;
comparing the one or more reliability values with one or more threshold reliability criteria to identify one or more surface
areas of interest from the plurality of surface hypotheses; and

displaying guidance regarding capturing one or more additional two-dimensional images of the object via a display of the electronic
image capturing device, wherein the guidance is based at least in part on the identified surface areas of interest;

wherein the guidance indicates the one or more reliability values associated with individual surface hypotheses of the one
or more surface hypotheses and wherein the one or more reliability values are calculated for the individual surface hypotheses
based on an area proportion comprising a point density below an average point density and a surface mean error.

US Pat. No. 9,058,471

AUTHORIZATION SYSTEM FOR HETEROGENEOUS ENTERPRISE ENVIRONMENTS

Oracle International Corp...

1. A computer-implemented method comprising:
storing, in a policy store that is stored within a computer-readable storage memory and utilized by a plurality of applications
in an enterprise, a first authorization policy that specifies features that are used within a first type of authorization
environment;

storing, in the policy store, a second authorization policy that specifies features that are used within a second type of
authorization environment that differs from the first type of authorization environment;

determining that the first authorization policy and the second authorization policy in the policy store are relevant to a
request from an application of the plurality of applications;

performing a union of the first authorization policy, configured for use within the first type of authorization environment,
and the second authorization policy, configured for use within the second type of authorization environment, wherein the second
type of authorization environment is an Oracle Access Manager (OAM) environment, in response to the determining, wherein the
first authorization policy specifies features of a role-based access control (RBAC) model including a role category to which
multiple roles belong, and wherein the second authorization policy specifies features of a discretionary access control (DAC)
model;

evaluating the union of the first policy and the second policy within a policy engine that evaluates both features that are
used within the first type of authorization environment and features that are used within the second type of authorization
environment wherein evaluating the features that are used within the first type of authorization policy comprises determining
whether an access-requesting subject is associated with a particular role that belongs to the role category; and

granting access to at least one resource within the enterprise based on a result of the evaluating.

US Pat. No. 9,056,767

DYNAMIC ACCESS POINT BASED POSITIONING

TEXAS INSTRUMENTS INCORPO...

1. A wireless device, comprising:
an access point (AP) scanner configured to scan wireless network channels utilized by one or more APs to transmit data packets,
probe responses, and beacons;

a transceiver configured to transmit one or more probe requests to the one or more APs and receive one or more probe responses
and beacons from the one or more APs; and

a controller coupled to the AP scanner and transceiver configured to:
determine a proximate geographic position of the wireless device based on a signal strength of the one or more probe responses
and beacons received from the one or more APs;

determine a ratio of probe responses received from the one or more APs to probe requests transmitted to the one or more APs;
and

cause the transceiver to lower the frequency of probe requests based on the ratio being higher than a preset threshold value
and raise the frequency of probe requests based on the ratio being lower than a preset threshold value,

wherein the controller dynamically adapts a parameter utilized in determining the proximate geographic position of the wireless
device.

US Pat. No. 9,056,957

PROCESS FOR IMPROVING CARBON BLACK DISPERSION

BAYER MATERIALSCIENCE AG,...

1. An injection molded article produced by a process comprising preparing a coloured polymer composition by melt-mixing,
the process comprising using a masterbatch, wherein the masterbatch consists of at least one pigment and at least one demoulding
agent in compounding,

wherein the demoulding agent is at least one selected from the group consisting of pentaerythritol tetrastearate, glycerol
monostearate and stearyl stearate,

wherein the pigment is a carbon-based pigment and the content of pigment in the masterbatch is from 40 to 60 wt. %, based
on the total weight of the masterbatch,

wherein the carbon-based pigment is selected from the group consisting of: a) carbon black; b) graphite; c) fullerene; d)
graphene; e) activated charcoal; and f) carbon nanotubes

wherein the process additionally comprises preparing the masterbatch by using a shear and mixing unit in a single-shaft extruder,
multi-shaft extruder, internal mixer, co-kneader or a shear roller device,

wherein the pigment is homogeneously distributed and present in finely dispersed form in the polymer composition,
wherein the produced coloured polymer composition is a polycarbonate composition comprising
a) from 40 to 99.96 wt. % of at least one thermoplastic polymer (a), wherein polymer (a) is at least one selected from the
group consisting of aromatic polycarbonates and aromatic polyester carbonates, wherein the polymer has a weight average molecular
weight of 15,000 to 80,000 g/mol and is a homopolycarbonate or copolycarbonate containing bisphenol A

b) from 0.1 to 3 wt. % of at least one pigment component (b),
c) from 0.1 to 3 wt. % of at least one demoulding agent (c) selected from the group consisting of pentaerythritol tetrastearate,
glycerol monostearate and stearyl stearate,

d) from 0 to 60 wt. % of one or more thermoplastic polyesters (d),
e) from 0 to 40 wt. % of one or more elastomers (e) other than component f,
f) from 0 to 40 wt. % of one or more optionally rubber-modified vinyl (co)polymers (f), and
g) from 0 to 10 wt. % one or more further additives.

US Pat. No. 9,056,428

MANUFACTURING METHOD FOR HOLLOW COMPONENTS MADE OF FIBER COMPOSITE MATERIALS IN TUBULAR DESIGN, TUBULAR FILM AND MANUFACTURING METHOD FOR A TUBULAR FILM

Airbus Helicopters Deutsc...

1. A manufacturing method for manufacturing a hollow component for an aerospace element, the aerospace element having a variable
cross section and corners and being manufactured by conforming a plastic material preform, the method using a tubular film
and a mould having inner surfaces with corresponding variable cross sections and corners, the method having the following
steps:
a) feeding a plastic material preform in the area of the inner surfaces of the mould, the plastic material preform having
a first fiber layer and a second fiber layer;

b) conforming the plastic material preform to mechanically conform to the inner surfaces of the mould;
c) feeding a tubular film into the mould so that the plastic material preform is positioned between an outer surface of the
tubular film and the mould, the tubular film being unwound from a roll, expanded by pressure and/or a vacuum, and then contoured
by a guide tool before it is fed into the mould in step c) such that its contour in a sectional plane perpendicular to its
longitudinal extension is furnished with an outer contour with a plurality of recesses alternating with a plurality of protuberances
distributed about its circumference and extending in the direction of its longitudinal extension, the tubular film being fed
from an endless roll;

d) expanding the contoured tubular film using pressure and/or a vacuum when the inner surfaces of the mould are joined together,
the expanding of the contoured tubular film being performed without the contoured tubular film having to move along the plastic
material preform, the protuberances contacting the plastic material preform prior to the recesses; and

e) applying a pressure above atmospheric pressure in the contoured tubular film and heating the mould so that the plastic
material preform is adapted to fuse the fiber layers and conform the fiber layers to an inner contour of the mould and an
outer contour of the expanded tubular film.

US Pat. No. 9,056,344

METHOD FOR PRODUCING HOT ROLLED HOLLOW SECTIONS HAVING A RECTANGULAR CROSS-SECTION AND SMALL EDGE RADII

1. A method for producing a hot rolled hollow section made of steel and having a rectangular or square cross section, comprising:
producing a substantially round pipe blank having a defined nominal outer diameter by seamless hot-rolling or cold-finishing
and welding;

forming the pipe blank in a rolling mill at a forming temperature into a hollow section having visible edges defined by a
value of ?1.5×t, wherein t is a wall thickness of the hollow section; and

determining the nominal outer diameter of the pipe blank as a function of a reduction ratio to be achieved of the pipe blank
and dimensions to be achieved of the hollow section, wherein the reduction ratio lies within a range of ?2% to ?13% and is
determined by the formula:

Reduction ratio R [%]=[(2×(H+B))??×D]×100%/[2×(H+B)],

wherein
H is a height of the hollow section,
B is a width of the hollow section,
D is an outer diameter of the pipe blank at the forming temperature and before the forming step.

US Pat. No. 9,057,131

SEPARATING DEVICE FOR PROCESS CHAMBERS OF VACUUM COATING INSTALLATIONS AND VACUUM COATING INSTALLATION

VON ARDENNE GmbH, Dresde...

1. Vacuum chamber of a vacuum coating installation for coating two-dimensional substrates, said vacuum chamber having a first
connecting wall at one end, a second connecting wall at an opposite end, and a bottom base plate, a top cover, and two opposing
outer side walls extending between the first and second connecting walls, and further comprising a separating device disposed
inside the vacuum chamber including a separating element intermediate said first and second connecting walls and extending
between the base plate and the top cover, the separating element having a double-walled region, fitted between two chamber
segments, wherein the double-walled region of the separating element comprises first and second separating chamber walls each
extending upwardly from the base plate transversely in relation to a transporting direction of the substrates and separated
from each other in the transporting direction, each separating chamber wall having a separate respective aligned through-opening
forming a passage for the substrates, the passage being disposed in a region of a transporting plane of the substrates, said
separating device further including at least one closure, optionally closing or opening each respective through-opening in
the first and second separating chamber walls from outside the double-walled region.

US Pat. No. 9,056,820

ALICYCLIC ALCOHOL

Mitsubishi Gas Chemical C...

1. An alicyclic alcohol compound of formula (1):

US Pat. No. 9,057,680

PORTABLE INDUSTRIAL LIMITED ANGLE GAMMA-RAY TOMOGRAPHY SCANNING SYSTEM

Korea Atomic Energy Resea...

1. A portable industrial limited angle gamma-ray tomography scanning system comprising:
a scanning part for tomography scanning; and
a clamping part for attaching the scanning part to an object to be measured,
an image reconstructing part for performing cross-sectional reconstruction using an image reconstruction program to perform
cross-sectional reconstruction of limited angle data on the basis of measured data,

wherein the scanning part includes:
a source assembly generating radiation of gamma-ray;
a driving device rotating the source assembly; and
a detector assembly detecting the radiation generated from the radiation source,
and the source assembly includes:
a source moving slide comprises two parts, a first part being disposed along a base plate having a C-shaped structure and
a second part being detachable from the first part and filling an open part of the base plate;

a source moving track that is coupled to the source moving slide; and
a source collimator that is coupled to the source moving track,
wherein said two parts of the source moving slide forms a closed circular structure.

US Pat. No. 9,058,291

MULTIPLE ERASURE CORRECTING CODES FOR STORAGE ARRAYS

International Business Ma...

1. A method for correcting erasures in a storage array, the method comprising:
receiving a read stripe from a plurality of storage devices, the read stripe comprising a block of pages arranged in rows
and columns with each column corresponding to one of the storage devices, the pages comprising data pages and parity pages
and wherein at least one of the columns or one of the rows contains only parity pages such that the number of parity pages
are greater than a total number of rows, and the number of parity pages are less than twice of the number of rows and all
the rows contain at least one parity page;

determining whether the read stripe comprises at least one erased page and whether the number of erased pages is less than
or equal to the number of parity pages; and

reconstructing the at least one erased page in response to determining that the read stripe comprises at least one erased
page and that the number of erased pages is less than or equal to the number of parity pages, the reconstructing responsive
to a multiple erasure correcting code and to the block of pages caused by detection of at least one error, and the reconstructing
also resulting in a recovered read stripe.

US Pat. No. 9,056,927

REACTIVE SYSTEMS

ELANTAS GMBH, Wesel (DE)...

1. A reactive formulation, wherein the formulation consists of (A) at least one compound having at least one C—C-labile bond,
(B) a solvent or solvent mixture in which (A) is not soluble and which comprises one or more solvents selected from aromatics-containing
distillation cuts, aromatics-free hydrocarbyl mixtures, esters, ethers, styrene, vinyltoluene, butyl acrylate, butyl methacrylate,
and combinations thereof and, optionally, (C) one or more dispersants for (A), (A) being present in (B) as a dispersed solid
having a particle size of from 5 nm to 500 ?m.

US Pat. No. 9,059,911

DIAGNOSTICS IN A DISTRIBUTED FABRIC SYSTEM

International Business Ma...

1. A method for managing a distributed fabric system in which at least one scaled-out fabric coupler (SFC) chassis is connected
to at least one distributed line card (DLC) chassis over fabric communication links, each fabric communication link connecting
one fabric port of the at least one SFC chassis to one fabric port of the at least one DLC chassis, each fabric communication
link including a plurality of lanes by which to carry cells, the method comprising:
collecting, by each fabric element chip of each SFC chassis, per-lane statistics for each SFC fabric port of that SFC chassis;
gathering the per-lane statistics collected by each fabric element chip of each SFC chassis by a central agent; and
integrating the per-lane statistics gathered by the central agent into a topology of the entire distributed fabric system
for presentation by a user interface.

US Pat. No. 9,060,253

IDENTIFYING AND BLOCKING MOBILE MESSAGING SERVICE SPAM

Cellco Partnership, Bask...

1. A method comprising steps of:
receiving a first mobile messaging service message from a messaging source in a node of a mobile communication network, the
first mobile messaging service message being addressed to a destination mobile device, the messaging source not currently
identified as a spam source;

forwarding the first mobile messaging service message through the mobile communication network for delivery to the destination
mobile device;

determining whether or not the first mobile messaging service message meets a spam messaging criterion, wherein determining
whether or not the first mobile messaging service message meets the spam messaging criterion occurs in parallel with the forwarding
of the first mobile messaging service message through the mobile communication network for delivery to the destination mobile
device; and

storing information identifying the messaging source as a spam source, upon determining that the first mobile messaging service
message meets the spam messaging criterions;

wherein at least one of:
(i) the method further comprises steps of:
receiving a second mobile messaging service message from the messaging source in a node of the mobile communication network;
upon determining, using the stored information, that the second mobile messaging service message originated from a spam source,
analyzing the second mobile messaging service message to determine whether or not the second mobile messaging service message
is a spam message;

blocking delivery of the second mobile messaging service message through the mobile communication network in response to the
determination that the second mobile messaging service message is a spam message; and

transmitting a message to the messaging source indicating successful transmission of the second mobile messaging service message
through the mobile communication network; and

(ii) determining whether or not the first mobile messaging service message meets the spam messaging criterion is based on
analyzing a set of factors comprising one or more of: content of a payload of the first messaging service message, velocity
or volume of messaging service messages received through the mobile communication network from the messaging source and presence
of a malicious link in the first mobile messaging service message, and determining whether or not the first mobile messaging
service message meets the spam messaging criterion is completed using an adaptive threshold computed using the set of factors,
the adaptive threshold being based on whether the messaging source has been previously identified as a spam source or on whether
the messaging source has never been identified as a spam source.

US Pat. No. 9,058,589

SUBJECTIVE USER INTERFACE

SAP SE, Walldorf (DE)

1. A method for networking among data objects of a business enterprise comprising operating a computer system to perform steps
of:
receiving, at a computing device, input from a worknet creator to define an initial worknet including receiving input indicative
of a plurality of data objects of a business enterprise as members of the initial worknet, including data objects representative
of persons in the business enterprise and at least one data object representative of a first worknet subset;

receiving input from the worknet creator that identifies one or more members of the initial worknet to create a second worknet
subset (“worknet subset”), including the computing device:

instantiating the worknet subset;
updating the initial worknet by adding the worknet subset as a data object in the initial worknet;
displaying a representation of the updated initial worknet including displaying a representation of the worknet subset along
with a representation of the members of the initial worknet;

displaying a representation of the worknet subset in worknets of other users who are members of the worknet subset; and
sending a notification to the members of the worknet subset,
wherein the worknet subset becomes a data object of the business enterprise and is included in a global view of the data objects
of the business enterprise;

displaying a first feed viewer associated with the members of the worknet, the first feed viewer presenting communications
to and from the members of the worknet;

displaying a second feed viewer, separate from the first feed viewer, associated with members of the worknet subset, the second
feed viewer presenting communications to and from the members of the worknet subset; and

defining an activity space, separate from the first feed viewer and the second feed viewer, that is associated with the worknet
subset, the activity space comprising a subset of the members of the worknet subset as members of the activity space, and
one or more collaboration tools to facilitate activities among the members of the activity space.

US Pat. No. 9,059,951

METHOD AND APPARATUS FOR SPAM MESSAGE DETECTION

International Business Ma...

1. A method for detecting a spam message, the method comprising:
computing a frequency domain transmission characteristic of a message source using a time domain transmission characteristic
of the message source; and

identifying the message source as being a spammer based on the frequency domain transmission characteristic;
wherein the steps of the method are carried out using a computer device.

US Pat. No. 9,059,715

VOLTAGE LEVEL SHIFT WITH INTERIM-VOLTAGE-CONTROLLED CONTENTION INTERRUPT

Intel Corporation, Santa...

1. A system, comprising:
a voltage level shift circuit to shift input logical states from an input voltage swing to an output voltage swing;
a controllable contention interrupter to selectively interrupt contention within the voltage level shift circuit; and
an interrupt controller to shift the input logical states from the input voltage swing to an interim voltage swing, and control
the contention interrupter with the logical states having the interim voltage swing;

wherein a lower limit of the interim voltage swing is equal to a lower limit of the output voltage swing; and
wherein an upper limit of the interim voltage swing is equal to an upper limit of the input voltage swing.

US Pat. No. 9,060,372

METHOD AND APPARATUS FOR USE IN A COMMUNICATIONS NETWORK

Telefonaktiebolaget LM Er...

1. A method, implemented on a mobile terminal operative in a communications network in which a plurality of accesses are available
to the mobile terminal for accessing a network resource, comprising:
determining, by the mobile terminal, a set of active rules, each rule specifying respective preferences, at least relatively,
for at least some of the plurality of accesses, the rules of the set being potentially in conflict between each other concerning
which access is most preferred, and each rule being assigned a rule-based priority value;

deriving, by the mobile terminal, from the set of active rules a new rule specifying respective preferences, at least relatively,
for at least some of the plurality of accesses by selecting, as the new rule, the active rule having the most preferred rule-based
priority value; and

selecting an access of the plurality of accesses for use by the mobile terminal based on the new rule.

US Pat. No. 9,060,202

CONTROLLING DISPLAY OF CONTENT ON NETWORKED PASSENGER CONTROLLERS AND VIDEO DISPLAY UNITS

Thales Avionics, Inc., I...

1. A controller for controlling an entertainment system that includes a video display unit that is separate from the controller,
the controller comprising:
a network interface for communicating with the video display unit via at least one data network, wherein the network interface
comprises:

a first transceiver to communicate with a remote first transceiver connected to the video display unit, wherein the first
transceiver and the remote first transceiver are near field transceivers that wirelessly communicate with each other using
radio frequency signals, and

a second transceiver to wirelessly communicate through radio frequency signals with a remote second transceiver connected
to the video display unit;

a display device; and
a processing device to:
control the first transceiver to establish a first communication link with the remote first transceiver and receive an identifier
for the video display unit without performing pairing of the first transceiver and the remote first transceiver;

control the second transceiver to use the identifier for the video display unit to perform pairing to the remote second transceiver
to establish a second communication link with the remote second transceiver, wherein prior to performing the pairing the processing
device cannot transmit a command through the second transceiver to the remote second transceiver and cannot receive content
through the second transceiver from the remote second transceiver;

after performing the pairing, communicate a first command through the second transceiver and the second communication link
to the remote second transceiver to control a display of first content on the video display unit;

after performing the pairing, receive second content through the second transceiver via the second communication link from
the remote second transceiver; and

control a display of the second content on the display device of the controller, wherein the second content is displayed on
the display device of the controller concurrently with the first content displayed on the video display unit.

US Pat. No. 9,056,895

METHODS OF ISOLATING PEPTIDES USING SURFACE-FREE AFFINITY PURIFICATION

WELLSPRING CLINICAL LAB, ...

1. A method of eluting target ligand molecules bound to receptor molecules comprising:
providing a sample solution containing target peptide ligand molecules bound to receptor molecules in the absence of immobilizing
surfaces, where the receptor molecules are substantially larger than the target peptide ligand molecules;

adding excess amounts of labeled ligand molecules to the sample to compete with the target peptide ligand molecules and bind
to the receptor molecules in place of the target peptide ligand molecules, releasing the target peptide ligand molecules;
and

separating and eluting the released target peptide ligand molecules from the remaining receptor molecules bound to labeled
ligand molecules based on the presence or absence of a label on the ligands in the sample solution using a combination of
surface-free isolation, specific competition elution and dual epitope isolation.

US Pat. No. 9,059,002

NON-MERGED EPITAXIALLY GROWN MOSFET DEVICES

INTERNATIONAL BUSINESS MA...

1. A method for forming semiconductor devices, comprising:
forming fins on a substrate;
forming a dummy gate over the fins, leaving a source and drain region exposed;
forming an insulator layer around the fins after forming the dummy gate;
etching the fins below a surface level of the insulator layer; and
epitaxially growing fin extensions from the etched fins that extend vertically and laterally beyond the etched fins.

US Pat. No. 9,060,357

METHOD AND APPARATUS FOR TRANSMITTING UPLINK AND DOWNLINK DATA IN TDD SYSTEM

Samsung Electronics Co., ...

1. A method in a wireless communication system, the method comprising:
receiving, by a terminal, a first message including a first uplink/downlink (UL/DL) configuration for a primary cell (PCell)
from a base station;

receiving, by the terminal, a second message including a second UL/DL configuration for a secondary cell (SCell) from the
base station;

receiving, by the terminal, a physical downlink shared channel (PDSCH) on a first subframe of the SCell from the base station;
and

transmitting, by the terminal, a hybrid automatic repeat request-acknowledge (HARQ-ACK) corresponding to the PDSCH on a second
subframe to the base station,

wherein the second subframe is determined based on a scheduling type for the terminal and a relationship between the first
UL/DL configuration and the second UL/DL configuration, if the first UL/DL configuration is different from the second UL/DL
configuration.

US Pat. No. 9,058,746

INFORMATION PROCESSING DEVICE ASSOCIATED WITH VEHICLE TRAVELING

Hitachi Automotive System...

5. The information processing device according to claim 4, wherein the obstacle detected by the first version includes a pedestrian.
US Pat. No. 9,056,066

AGENT FOR SUPPRESSING ELEVATION OF BLOOD GIP LEVEL, AGENT FOR SUPPRESSING ELEVATION OF BLOOD INSULIN LEVEL, AGENT FOR LOWERING BLOOD TRIGLYCERIDE LEVEL AFTER MEAL INGESTION, AND AGENT FOR SUPPRESSING ELEVATION OF BLOOD GLUCOSE LEV

Kao Corporation, Tokyo (...

1. A method for suppressing elevation of blood GIP level, the method comprising administering a potassium polyglutamate to
a subject, wherein the potassium polyglutamate suppresses elevation of blood GIP level, and wherein the weight-average molecular
weight of the potassium polyglutamate is from 500 to 5,000,000.

US Pat. No. 9,055,878

SYSTEM AND METHOD FOR RECONSTRUCTING CARDIAC ACTIVATION INFORMATION

The Regents of the Univer...

1. A method of reconstructing cardiac activation information, the method comprising:
accessing pairs of cardiac signals out of a plurality of cardiac signals obtained from a patient, the pairs having a first
cardiac signal that is common among the pairs and second cardiac signals that are different among the pairs;

processing the first cardiac signal and the second cardiac signals of the pairs to determine whether there are points of change
in the first cardiac signal at which a derivative of the first cardiac signal diverges with respect to derivatives of the
second cardiac signals above a threshold; and

assigning an activation onset time at a point in the first cardiac signal based on correspondence of the points of change
to define a cardiac activation indicating a beat if the points of change are in the first signal.

US Pat. No. 9,057,964

IMAGING OPTICS AND PROJECTION EXPOSURE INSTALLATION FOR MICROLITHOGRAPHY WITH AN IMAGING OPTICS

Carl Zeiss SMT GmbH, Obe...

1. An imaging optics, comprising:
a plurality of mirrors configured to guide imaging light along an imaging beam path from an object field in an object plane
to an image field in an image plane to image the object field into the image field,

wherein:
a reflection surface of one of the plurality of mirrors is a static free form surface which cannot be described by a rotationally
symmetrical function;

during use of the imaging optics, a region of the static free form mirror is in the imaging beam path;
the region of the static free form surface comprises a plurality of surface elements;
the static free form surface differs from a best fit aspherical surface;
the best fit aspherical surface is describable by a rotationally symmetrical function;
the best fit aspherical surface comprises a plurality of surface elements;
for each surface element of the static free form surface, there is a corresponding surface element of the best fit aspherical
surface; and

a normal to each surface element of the region of the static free form surface has a maximum of angle 70 ?rad with respect
to a normal to the corresponding surface element of the best fit aspherical surface.

US Pat. No. 9,055,876

SYSTEM AND METHOD FOR RECONSTRUCTING CARDIAC ACTIVATION INFORMATION

The Regents of the Univer...

1. A method of processing cardiac activation information, the method comprising:
accessing a first cardiac signal and a second cardiac signal obtained from a patient;
processing the first cardiac signal and the second cardiac signal to determine whether there is a point of change in the first
cardiac signal at which a derivative of the first cardiac signal diverges with respect to a derivative of the second cardiac
signal above a threshold; and

assigning an activation onset time in the first cardiac signal at the point of change to define a cardiac activation if the
point of change is in the first cardiac signal.

US Pat. No. 9,057,305

RESERVOIR TANK FOR A REDUCING AGENT

Robert Bosch GmbH, Stutt...

1. A reservoir tank for a reducing agent (1), comprising an outer container (2) and a pot-shaped inner container (3) which limits a first partial volume (4) of a volume (5) of the outer container (2), a heating element (6) in the inner container (3) and an extraction device (7) for extracting the reducing agent (1), characterized in that the pot-shaped inner container (3) is surrounded in a floor region by an insulated collar (8) comprising a first limb (9) led to the outer circumferential surface (11) of said inner container (3) and a second limb (10) contacting a floor surface (12) of said outer container (2), such that the insulated collar (8) limits an additional second partial volume (13) of the volume (5) of said outer container (2).

US Pat. No. 9,060,328

METHOD AND APPARATUS FOR SMALL CELL DISCOVERY IN HETEROGENEOUS NETWORKS

InterDigital Patent Holdi...

1. A method comprising:
receiving offload area information at a Wireless Transmit-Receive Unit (WTRU) from a network, the offload area information
disclosing a location of a small cell;

making a coverage area determination, based on the offload area information, of whether the WTRU may be within a coverage
area of a small cell; and,

responsive to the coverage area determination meeting a condition and a mobility state of the WTRU being lower than a threshold,
transmitting an offload indication to the network indicating that the WTRU is a candidate for offload to the small cell.

US Pat. No. 9,059,088

ELECTRONIC COMPONENT BUILT-IN SUBSTRATE

SHINKO ELECTRIC INDUSTRIE...

1. An electronic component built-in substrate, comprising:
a lower wiring substrate;
an electronic component mounted on the lower wiring substrate;
an intermediate wiring substrate including an opening portion in which the electronic component is mounted, and arranged in
a periphery of the electronic component, and connected to the lower wiring substrate via a first conductive ball;

an upper wiring substrate arranged over the electronic component and the intermediate wiring substrate, and connected to the
intermediate wiring substrate via a second conductive ball; and

a resin filled into respective areas between the lower wiring substrate, the intermediate wiring substrate, and the upper
wiring substrate, and sealing the electronic component,

wherein the first conductive ball and the second conductive ball are arranged in displaced positions mutually, and
the first conductive ball and the second conductive ball are arranged in positions that are not overlapped mutually, when
viewed from a top.

US Pat. No. 9,058,174

WIRING WEB WIDGETS OF A WEB MASHUP

International Business Ma...

1. A computer-implemented method to facilitate mashup web application development, based on a web widget registry, the computer-implemented
method comprising:
selecting a plurality of web widgets based on user input and for inclusion in a mashup web application to be accessed by a
first computer, wherein each of the plurality of web widgets comprises an embeddable web application that retrieves data from
a respective computer other than the first computer, wherein each web widget is uniquely identifiable via a widget identifier;

accessing the web widget registry, which specifies: (i) dependencies between the plurality of web widgets; (ii) a mapping
between web widgets and semantic tags; and (iii) for each of a plurality of distinct resource types, a producer list of web
widgets producing the respective resource type, and a consumer list of web widgets consuming the respective resource type;

programmatically wiring the plurality of web widgets by operation of one or more computer processors, based on a plurality
of matches and without requiring any user input explicitly specifying which of the plurality of web widgets to wire together,
thereby facilitating development of the mashup web application, wherein the plurality of matches includes at least three of:
(i) a matching resource type; (ii) a matching semantic tag; (iii) a matching class; and (iv) a match between a producer and
a consumer of the matching resource type; and

upon determining that a cycle is present in the programmatically wired plurality of web widgets, resolving the determined
cycle and storing an indication that the cycle is resolved.

US Pat. No. 9,057,943

DIRECTIONAL SOUND CAPTURING

Sony Corporation, Tokyo ...

1. A sound recording arrangement comprising:
a sound recording unit configured to record sound arriving at the sound recording unit from objects in a field of view of
a user of the sound recording arrangement,

a first image recording unit configured to operatively record a first set of images of a head or eyes of the user,
a second image recording unit configured to operatively record a second set of images of an object located in a secondary
gaze direction of the user, and

a control unit configured to:
determine the secondary gaze direction of the user based on the first set of images,
determine a primary gaze direction of the user based on the first set of images and based on a correlation of the secondary
gaze direction and an object tracking of the object in the second set of images, and

amplify sounds arriving in the primary gaze direction compared to sounds arriving from other directions.

US Pat. No. 9,057,369

DEVICE FOR THE DOSED ADMINISTRATION OF A FLUID PRODUCT, ADAPTED FOR THE REPLACEMENT OF A CONTAINER

TecPharma Licensing AG, ...

1. A device for administering a fluid product, said device comprising:
a) a first casing part and a second casing part connected to each other;
b) a container accommodated in the first casing part;
c) a piston accommodated in the container and moveable in an advancing direction;
d) a piston rod with an outer thread and moveable in a delivery movement in the advancing direction, wherein the piston rod
and the piston comprise a conveying means;

e) a dosing member for setting a dosage by performing a dosing movement;
f) a drive member operable for moving the piston rod; and
g) a coupler comprising a coupler input member which couples the drive member to the piston rod in a coupler engagement and
transfers a drive force of the drive member to the piston rod to cause the delivery movement; wherein

h) the second casing part forms a linear guide for the drive member such that the drive member is linearly guided relative
to the second casing part and is moveable in and counter to the advancing direction;

i) the dosing member is coupled to the drive member and by the dosing movement the drive member is moved counter to the advancing
direction and extends out of the second casing part;

j) the drive member is sleeve-shaped and comprises a thread;
k) the coupler input member is sleeve-shaped and comprises a thread complementary to the thread of the drive member for threaded
engagement with the drive member;

l) a drive movement of the drive member causes a rotational movement of the coupler input member; and
m) wherein a rotational movement of the coupler input member causes the delivery movement of the piston rod.

US Pat. No. 9,059,397

NANO PIEZOELECTRIC DEVICE HAVING A NANOWIRE AND METHOD OF FORMING THE SAME

ELECTRONICS AND TELECOMMU...

1. A nano piezoelectric device comprising:
a lower electrode;
a nanowire extending upward from the lower electrode; and
an upper electrode on the nanowire;
wherein the nanowire includes a conductive wire core and a wire shell surrounding the wire core and including a piezoelectric
material; and

wherein the conductive wire core and the wire shell have a PN diode junction connected from the lower electrode to the upper
electrode, respectively, not forming a Schottky contact between the nanowire and the upper electrode.

US Pat. No. 9,059,113

ORGANIC LIGHT-EMITTING DEVICE

Samsung Display Co., Ltd....

1. An organic light-emitting device comprising:
a substrate;
a first electrode layer and a second electrode layer on the substrate and parallel to the substrate, the first and second
electrode layers facing each other;

an emission layer between the first electrode layer and the second electrode layer,
wherein the emission layer comprises a first emission region, a second emission region, and a third emission region,
wherein the emission layer comprises a first common emission layer in the first emission region, the second emission region,
and the third emission region; a second emission layer in the second emission region between the first common emission layer
and the second electrode layer; and a third emission layer in the third emission region between the first common emission
layer and the second electrode layer, and

wherein the first common emission layer comprises a first host, a first dopant, and a p-type dopant.
US Pat. No. 9,056,774

ALUMINUM NITRIDE POWDER AND METHOD OF PRODUCING THE SAME

TOKUYAMA CORPORATION, Sh...

1. A method of producing an aluminum nitride powder including following steps of:
preparing a powder of alumina or hydrated alumina having a primary grain size of 0.001 to 6 ?m as an Al source, a powder of
a rare earth metal compound having an average grain size (D50) in a range of 2 to 80 ?m, the average grain size (D50) thereof being not less than 6 times as great as the primary grain size of said Al source, and a carbon powder,

mixing the powder of said Al source, the powder of the rare earth metal compound and the carbon powder together, and
reducing and nitriding said Al source by holding the mixed powder in a nitrogen-containing atmosphere at a temperature of
1620 to 1900° C. for not less than 2 hours,

wherein the aluminum nitride powder that is produced comprises aluminum nitride particles having a sphericalness expressed
by the ratio (DS/DL) of the short diameter (DS) thereof and the long diameter (DL) thereof of not less than 0.75.

US Pat. No. 9,059,151

INTEGRATED CIRCUIT PACKAGING SYSTEM WITH ISLAND TERMINALS AND EMBEDDED PADDLE AND METHOD OF MANUFACTURE THEREOF

STATS ChipPAC Ltd., Sing...

1. A method of manufacture of an integrated circuit packaging system comprising:
providing a leadframe having an upper structure, upper protrusions, and a base side facing away from the upper structure and
the upper protrusions;

forming tie bars in the leadframe with an opening surrounding the upper structure, the tie bars connected to the upper structure
and exposed on the base side;

connecting an integrated circuit to the upper protrusions;
applying an encapsulant over the integrated circuit, over the upper structure, and in the opening with the base side exposed;
removing the tie bars exposing a first surface and a second surface of the encapsulant below the first surface, and forming
a die paddle from the upper structure and exposed from the second surface; and

removing the leadframe from the base side forming island terminals from the upper protrusions exposed from the second surface
and isolated from the die paddle.

US Pat. No. 9,059,986

METHOD AND APPARATUS TO FACILITATE USING A FEDERATION-BASED BENEFIT TO FACILITATE COMMUNICATIONS MOBILITY

Motorola Solutions, Inc.,...

1. A method comprising:
facilitating a call session for a participating entity having at least one federation-based benefit;
using the at least one federation-based benefit to facilitate communications mobility for the participating entity during
the call session, wherein facilitating communications mobility comprises moving at least a portion of the call session from
a first user device to a second user device and wherein the first user device and the second user device belong to different
service provider domains; and

wherein using the at least one federation-based benefit to facilitate moving at least a portion of the call session from a
first user device to a second user device during the call session further comprises, at least in part, using the at least
one federation-based benefit to facilitate moving at least a first portion of the call session from the first user device
to the second user device during the call session and moving at least a second portion of the call session from the first
user device to a third user device during the call session, and wherein the first user device, the second user device, and
the third user device are different user devices.

US Pat. No. 9,058,060

KEYBOARD MODULE AND METHOD FOR FABRICATING THE SAME

ACER INCORPORATED, Taipe...

1. A keyboard module, comprising:
a base;
a plurality of retaining members, respectively comprising:
a bottom portion, disposed on the base,
a bending portion, connected to the bottom portion and extending along a direction away from the bottom portion, and
an upper portion, connected to the bending portion;
a plurality of keycaps, respectively disposed on one of the upper portions corresponding thereto; and
a plurality of resilient members, wherein each of the resilient member is directly contact with one of the keycaps,
wherein after the keycaps are pressed by an external force, the upper portions are abutted by the keycaps, and the bending
portions are deformed;

wherein an opening is formed on the upper portion of each of the retaining members, wherein each of the resilient members
is disposed in a space defined by the bending portion and the upper portion of one of the retaining members and passes through
the corresponding opening to contact with the corresponding keycap.

US Pat. No. 9,060,456

PRODUCTION METHOD OF MULTILAYER PRINTED WIRING BOARD AND MULTILAYER PRINTED WIRING BOARD

AJINOMOTO CO., INC., Tok...

1. A multilayer printed wiring board, comprising:
an insulating layer formed by a prepreg comprised of a glass cloth impregnated with a thermosetting resin composition,
a via hole formed on the insulating layer,
a circuit containing a via formed by conductive layer in the via hole, and
a glass cloth protruding in a length of not more than 4 ?m from the sidewall of the aforementioned via hole,
wherein said via hole has a top diameter of not more than 75 ?m, and
wherein the protruding part of the glass cloth is embedded in the conductive layer forming the via.

US Pat. No. 9,059,736

METHODS, SOLID STATE DRIVE CONTROLLERS AND DATA STORAGE DEVICES HAVING A RUNTIME VARIABLE RAID PROTECTION SCHEME

Western Digital Technolog...

1. A solid state drive controller, comprising:
a processor, the processor being configured to couple to an array of flash memory devices, the array comprising a plurality
of dies, each die comprising a plurality of flash blocks (F-Blocks), each F-Block comprising a plurality of flash pages (F-Pages),
at least some of the F-Page comprising at least one error correcting code page (E-Page), and at least some of the E-Pages
comprising a variably-sized error correction code (ECC) portion and a corresponding variably-sized data portion, the variably-sized
data portions within one F-Page defining, in the aggregate, an F-Page data portion,

wherein the processor is configured to:
define an S-Page that comprises a plurality of F-Pages from one or more of the plurality of dies;
within the S-Page,
store an E-Page error correction code within the variably-sized ECC portion of each E-Page within the F-Pages to correct an
error within the corresponding variably-sized data portion;

designate at least one F-Page having a largest size F-Page data portion among the F-Pages in the S-Page as a Check Page; and
store a cross-F-Page error correction code within the at least one Check Page.

US Pat. No. 9,058,477

PROCESS FOR THE GRADUAL EXCHANGE OF PERSONAL INFORMATION IN NON-TRUSTED PEER-TO-PEER ENVIRONMENTS

KONINKLIJKE PHILIPS N.V.,...

1. A method of sharing risk of exchange of personal information between at least two wireless communication devices in a non-trusted
peer-to-peer environment, the method comprising acts of:
communicating between the two wireless communication devices to allow a first and second user to agree on a number of rows
and columns to segment a display, wherein the number of rows and columns are both greater than one;
on each of the at least two wireless communication devices
converting a text representation of the personal information into a graphics display;
segmenting the graphics display of the personal information into the agreed upon number of rows and columns; and
reciprocatingly exchanging corresponding segments of the graphics display one segment at a time between the wireless communication
devices, wherein the reciprocally exchanging further comprises acts of

receiving a selection on a first device of a single segment of first personal information to transmit from the first device
to the second device,

receiving the single segment with its identified row and column information at the second device,
extracting the row and column information of the received segment on the second device,
selecting by the second device a segment of second personal information identified by the extracted row and column information,
and

transmitting from the second device to the first device the selected segment of second personal information,
wherein the first user is able to select and transmit a second single segment of first personal information from the first
device only after receiving the selected segment of second personal information from the second device.

US Pat. No. 9,060,117

POINTS FROM FOCUS OPERATIONS USING MULTIPLE LIGHT SETTINGS IN A MACHINE VISION SYSTEM

Mitutoyo Corporation, Ka...

1. A method for operating a precision machine vision inspection system to determine a set of multi-point Z-height measurement
data comprising focus-based Z-height measurements in a particular region of interest on a workpiece, the precision machine
vision inspection system comprising:
an imaging portion including a camera;
a controllable lighting portion;
a focusing portion;
a control portion comprising an image processor;
a first measuring mode for performing multi-point focus-based Z-height measurements on a workpiece, comprising operations
that determine the multi-point focus-based Z-height measurements for a plurality of subregions within a region of interest
based on a single image stack acquired using the same lighting parameters for each image in that image stack;

a second measuring mode for performing multi-point focus-based Z-height measurements on a workpiece, comprising operations
that determine the multi-point focus-based Z-height measurements for a plurality of subregions within a region of interest
based on a plurality of image stacks, wherein a first image stack is acquired using darkness limiting lighting parameters
that satisfy a darkness limiting criterion for image pixels in the region of interest and that are the same for each image
in the first image stack, and a second image stack is acquired using brightness limiting lighting parameters that satisfy
a brightness limiting criterion for image pixels in the region of interest and that are the same for each image in the second
image stack;

a user interface including an image display and a graphical user interface (GUI); and
a multi-point Z-height measurement tool comprising:
the second measuring mode;
the brightness limiting criterion for image pixels in the region of interest;
the darkness limiting criterion for image pixels in the region of interest; and
a multi-point GUI element including a region of interest indicator; andthe method comprising:
performing operations of the machine vision inspection system comprising:
acquiring an image of the particular region of interest on a workpiece;
activating an instance of a multi-point Z-height measurement tool; and
defining a region of interest in the acquired image;
performing automatic operations of that instance of the multi-point Z-height measurement tool corresponding to the second
measuring mode, comprising:

(a) operations that automatically focus the imaging portion at a global best focus height for the region of interest, wherein
the global best focus height is determined based on an image stack acquired using a preliminary set of lighting parameters
and based on a focus metric that is determined based on the entire region of interest;

(b) operations that analyze images acquired at the global best focus height and adjust the lighting parameters to determine
brightness limiting lighting parameters that satisfy the brightness limiting criterion for image pixels in the region of interest,
and

(c) operations that analyze images acquired at the global best focus height and adjust the lighting parameters to determine
darkness limiting lighting parameters that satisfy the darkness limiting criterion for image pixels in the region of interest.

US Pat. No. 9,060,423

LAMINATED WIRING BOARD

Sony Corporation, Tokyo ...

1. A laminated wiring board comprising a plurality of wiring layers configured to be stacked with intermediary of an insulating
layer between the plurality of wiring layers and have a four-layer wiring unit obtained by disposing a power supply layer
to which a power supply voltage is supplied, a first ground layer to which a ground potential is supplied, a first signal
wiring layer, and a second signal wiring layer sequentially from one side of a layer stacking direction to the other side
of the layer stacking direction with intermediary of the insulating layer between the layers of the four-laver wiring unit,
wherein one of the first signal wiring layer and the second signal wiring layer includes a data signal line and the other
of the first signal wiring layer and the second signal wiring layer includes a clock signal line, and the data signal line
and the clock signal line are so disposed as to be prevented from overlapping with each other in a view perpendicular to the
layer stacking direction at least at a place where both the data signal line and the clock signal line are disposed as parallel
lines; wherein a first insulating layer, a second ground layer, a second insulating layer, and a third signal wiring layer
are disposed on an opposite side to the first ground layer of the power supply layer sequentially from a side closer to the
power supply layer.

US Pat. No. 9,060,392

LIGHTING NETWORK WITH AUTONOMOUS COMMISSIONING

ABL IP HOLDING LLC, Cony...

1. A system, comprising:
intelligent system elements, each respective intelligent system element comprising:
a communication interface configured to enable communication via a network link;
a memory;
configuration data stored in the memory to implement a logical network arrangement of the respective intelligent system element
with one or more others of the intelligent system elements to provide controlled lighting for a service area; and

a processor coupled to have access to the memory and to communicate via the communication interface and the network link intelligent
system element and configured to control operations of the respective intelligent system element, wherein:

each of a plurality of the intelligent system elements includes a light source and is configured to operate as a lighting
device,

at least one of the intelligent system elements either includes a user interface element and is configured for lighting control
or includes a detector and is configured as a sensor, and

the processor of the respective intelligent system element is configured to cause the respective intelligent system element
to implement functions, including functions to, upon a change impacting the logical network arrangement:

automatically exchange communications with one or more others of the intelligent system elements to autonomously establish
an updated logical network arrangement of the respective intelligent system element with one or more others of the intelligent
system elements;

store updated configuration data in the memory to implement the updated logical network arrangement of the respective intelligent
system element with one or more others of the intelligent system elements; and

automatically cooperate with one or more others of the intelligent system elements in the updated logical network arrangement
to provide the controlled lighting for the service area, based on the updated configuration data.

US Pat. No. 9,059,771

WIRELESS RELAY DEVICE AND WIRELESS RELAY METHOD

FUJITSU LIMITED, Kawasak...

1. A wireless relay device that relays relay signals from a transmitting device to a receiving device by wireless communication,
comprising:
a retransmission buffer that temporarily stores a part of the relay signals to retransmit the part of the relay signals according
to a retransmission request from the receiving device; and

a buffer control unit that compares priority of a first relay signal received from the transmitting device and priority of
a second relay signal stored in the retransmission buffer, and controls the buffer (i) to remove the second relay signal from
the retransmission buffer and to store the first relay signal in the retransmission buffer in a condition that the priority
of a first relay signal is higher than the second relay signal or (ii) not to store the first relay signal in the retransmission
buffer in a condition that the priority of a first relay signal is lower than the second relay signal.

US Pat. No. 9,057,593

DUAL-FUNCTION GAGE FOR MEASURING DIMENSIONS OF A FASTENER ASSEMBLY

The Boeing Company, Chic...

1. An apparatus comprising:
a gage body;
a shaft which is axially displaceable relative to said gage body;
a digital indicator coupled to said gage body and configured to measure axial displacement of said shaft relative to said
gage body;

a first contact member coupled to said shaft, said first contact member having a first contact surface;
a second contact member coupled to said shaft, said second contact member having a second contact surface offset from said
first contact surface; and

a gage plug insertable into an interior space bounded at least in part by said gage body and having a slot, said gage plug
being rotatable and axially displaceable relative to said gage body and said slot being parallel to said shaft when said gage
plug is inserted into said interior space,

wherein when said gage plug is in a first angular position relative to said gage body, said second contact member is aligned
with said slot, and when said gage plug is in a second angular position different than said first angular position, said second
contact member is not aligned with said slot.

US Pat. No. 9,059,875

METHOD AND APPARATUS FOR CREATING AN ENHANCED MEDIUM ACCESS CONTROL PACKET DATA UNIT FOR ENHANCED TRANSPORT FORMAT COMBINATION SELECTION IN WIRELESS COMMUNICATIONS

InterDigital Patent Holdi...

1. A method for creating an enhanced medium access control (MAC-e) packet data unit (PDU) associated with enhanced transport
format combination (E-TFC) selection, the method comprising:
determining that a segment of a first radio link control (RLC) PDU associated with a first logical channel is available for
transmission, wherein the segment is remaining from a previous transmission;

on a condition that the segment and an associated first header do not exceed a determined size, including the segment and
the associated first header in the enhanced MAC-e PDU;

on a condition that the segment and the associated first header are included in the enhanced MAC-e PDU, and a first size associated
with the segment and the associated first header does not exceed the determined size:

including at least a portion of a second RLC PDU and an associated second header in the enhanced MAC-e PDU; and
transmitting the enhanced MAC-e PDU.

US Pat. No. 9,059,554

DISCHARGE-PUMPED GAS LASER DEVICE

GIGAPHOTON INC., Tochigi...

1. A discharge-pumped gas laser device, comprising:
a laser chamber configured to generate laser light;
a pair of discharge electrodes provided in the laser chamber;
a fan with a magnetic bearing being provided in the laser chamber and configured to be capable of circulating a gas in the
laser chamber;

a magnetic bearing controller connected to the magnetic bearing electrically, and being capable of controlling the magnetic
bearing; and

a laser controller configured to control generation of the laser light,
wherein the fan includes a rotor and the magnetic bearing includes a magnetic floatation actuator configured to float the
rotor and a displacement sensor configured to detect a position of the rotor,

wherein the laser controller causes the magnetic bearing controller to execute calibration of the displacement sensor and
the magnetic floatation actuator and to calculate and set a control parameter necessary for a control of the magnetic bearing
by using the calibrated displacement sensor and magnetic floatation actuator,

wherein the laser controller causes the magnetic bearing controller to execute calculation and setting of the control parameter
in a case where at least one of installation of the laser chamber after replacement thereof, touchdown of the magnetic bearing,
and an error in the magnetic bearing controller is detected, and

wherein the laser controller causes the magnetic bearing controller to execute calculation and setting of the control parameter
in a case where at least one of a predetermined time course, a predetermined number of an output of the laser light, a predetermined
change of a predetermined gas pressure in the laser chamber, vibration of the laser chamber, a predetermined change of a wavelength
stability of the laser light, a predetermined change of an energy stability of the laser light, touchdown of the magnetic
bearing, and an error in the magnetic bearing controller is detected after replacement of the laser chamber.

US Pat. No. 9,059,011

EXPOSED INTERCONNECT FOR A PACKAGE ON PACKAGE SYSTEM

STATS ChipPAC Ltd., Sing...

11. A method for manufacturing an integrated circuit packaging system comprising:
providing a substrate;
mounting an integrated circuit above the substrate;
attaching an interposer to the integrated circuit with a wire-in-film adhesive;
connecting an exposed interconnect to the substrate on the same side of the substrate as the integrated circuit, the exposed
interconnect having a stacked internal structure and being physically separated from the interposer; and

encapsulating the integrated circuit, the exposed interconnect, and a portion of the interposer with an encapsulation, with
only an upper surface of the exposed interconnect exposed from the encapsulation, the interposer exposed from the encapsulation.

US Pat. No. 9,056,679

SYSTEM AND METHOD FOR AIRBORNE DEPLOYMENT OF OBJECT DESIGNED FOR WATERBORNE TASK

The United States of Amer...

1. An airborne deployment system, comprising:
a payload; and
an unmanned aerial vehicle (UAV) having
a controllable-throttle engine,
at least one control surface having a control surface actuator,
at least one clamp coupled to said payload and configured to hold said payload,
a clamp actuator coupled to each said at least one clamp,
a control system coupled to said engine, said at least one control surface actuator, and each said clamp actuator,
a radio receiver coupled to said control system and tuned to receive radio signals from a remote location, said radio signals
being indicative of instructions for implementation by said control system,

a global positioning system (GPS) receiver coupled to said control system;
at least one sensor coupled to said control system, said at least one sensor selected from the group consisting of an optical
sensor, a magnetic sensor, and a laser seeker; and

a submersion sensor coupled to said control system and exposed to an ambient environment external to said UAV;
wherein said control system comprises a memory device and computer processor programmed to
receive and store data indicative of an initial global position of an at-sea location,
receive said instructions from said radio receiver and responsively relay control signals derived from said instructions to
said engine, said at least one control surface actuator, and each said clamp actuator,

receive GPS data from said GPS receiver and responsively actuate said engine and said at least one control surface actuator
to pilot said UAV toward said initial global position when said instructions are not being received from said radio receiver,

receive data indicative of a target position from said at least one sensor when said UAV is within a predetermined distance
to said initial global position and responsively actuate said engine and said at least one control surface actuator to pilot
said UAV toward said target position when said instructions are not being received from said radio receiver, and

actuate each said clamp actuator to release its associated clamp in accordance with a hierarchy defined firstly by said instructions,
secondly by data collected by said at least one sensor, thirdly by said GPS data, and fourthly by data collected by said submersion
sensor that is indicative of water submersion.

US Pat. No. 9,059,766

SYSTEM AND METHOD FOR CONTROLLING CURRENT TO CERTAIN COMPONENTS OF A WIRELESS COMMUNICATION DEVICE

Intel IP Corporation, Sa...

1. A wireless communication receiver, comprising:
a receive path configured to receive a wireless communication signal and convert the wireless communication signal into a
digital signal based at least on an oscillator signal, the receive path comprising hardware including a downconverter, an
analog-to-digital converter and an equalization filter located after the analog-to-digital converter in the receive path;

a control path communicatively coupled to the receive path and configured to: determine a signal strength of a signal in the
receive path;

based at least on the signal strength, select a current mode from at least one of a first current mode and a second current
mode for the wireless communication receiver, wherein the receive path has a first receive path gain and a first receive path
delay in the first current mode and has a second receive path gain and a second receive path delay in the second current mode;
and

communicate a control signal to the receive path indicative of the current mode;
the receive path configured to:
in response to the switch from the first current mode to the second current mode as indicated by the control signal, modify
one or more operational parameters of the receive path such that the receive path consumes a lower amount of current than
it does in the first current mode; and

in response to the switch from the second current mode to the first current mode as indicated by the control signal, modify
one or more operational parameters of the receive path such that the receive path consumes a higher amount of current than
it does in the second current mode; and

the equalization filter configured to, in response to a switch from the first current mode to the second current mode or a
switch from the second current mode to the first current mode, modify a gain and a delay of the equalization filter to compensate
for a gain difference between the first receive path gain associated with the first current mode and the second receive path
gain associated with the second current mode, and to compensate for a delay difference between the first receive path delay
associated with the first current mode and the second receive path delay associated with the second current mode.

US Pat. No. 9,059,639

CONTROL CIRCUIT FOR POWER CONVERTER AND METHOD THEREOF

RICHTEK TECHNOLOGY CORPOR...

1. A control circuit for a power converter, for configuring a conduction status of a switch circuit of the power converter
for providing power to a load, comprising:
a current limiting signal generating circuit, configured to operably generate a current limiting signal;
a pulse width modulation (PWM) signal generating circuit, configured to operably generate a PWM signal according to a current
sense signal and the current limiting signal for configuring the conduction status of the switch circuit; and

a power estimation circuit, configured to operably generate a power estimation signal according to the PWM signal, the current
sense signal and the current limiting signal;

wherein the current limiting signal generating circuit compares the power estimation signal with a predetermined power signal
for generating the current limiting signal; the power estimation circuit generates the power estimation signal according to
the current sense signal at a third time point and according to a difference between the current sense signal at a fourth
time point and the current sense signal at a second time point; the second time point is configured to be a time point at
which the PWM signal is at a predetermined portion of the total time the PWM signal maintains active; the third time point
is later than the second time point with a predetermined delay time; and the fourth time point is a time point at which the
PWM signal turns from active to inactive.

US Pat. No. 9,059,226

SUBSTRATE TREATMENT APPARATUS

SCREEN Holdings Co., Ltd....

1. A substrate treatment apparatus comprising:
a first substrate transport robot having a first hand which holds a substrate;
a second substrate transport robot having a second hand which holds the substrate; and
said first and second robots being accessible to a substrate transport passage;
said substrate transport passage being defined between or outside treatment units;
a hand cleaning unit which is accessible by the first hand of the first substrate transport robot and the second hand of the
second substrate transport robot, wherein the hand cleaning unit is configured and disposed in a position within said substrate
transfer passage for cleaning the first hand and the second hand, being disposed above or below a substrate transfer unit
within said substrate transfer passage at which the substrate is transferred between the first hand and the second hand.

US Pat. No. 9,060,459

PRINTED WIRING BOARD AND METHOD FOR MANUFACTURING SAME

IBIDEN CO., LTD., Ogaki-...

1. A printed wiring board, comprising:
a plurality of conductive layers having a plurality of conductive circuits;
a plurality of resin insulation layers including an uppermost resin insulation layer positioned as an outermost layer of the
plurality of resin insulation layers;

a plurality of via conductors formed in the plurality of resin insulation layers, respectively, and connecting the plurality
of conductive circuits in the plurality of conductive layers; and

a plurality of component-loading pads each comprising a metal foil and positioned to load an electronic component,
wherein the resin insulation layers and the conductive layers are alternately laminated, and the component-loading pads are
formed on a roughened surface of the uppermost resin insulation layer and have top surfaces and side surfaces exposed over
the roughened surface of the uppermost resin insulation layer such that the top surfaces and side surfaces of the component-loading
pads are configured to mount a plurality of solder structures, respectively.

US Pat. No. 9,056,589

REAR WINDSHIELD COMPRISING ELECTRICS PROTECTION BOX

SAINT-GOBAIN GLASS FRANCE...

1. A rear windshield with protection box for electronic components, comprising:
a vehicle body connection fastened on a window pane,
the protection box fastened on the vehicle body connection comprising a protection box basic element and a protection box
cover, and

a foam encapsulation of the vehicle body connection, wherein the foam encapsulation seals and affixes the protection box basic
element on the vehicle body connection.

US Pat. No. 9,056,989

INSULATING SILICONE RUBBER COMPOSITION

SUMITOMO RIKO COMPANY LIM...

1. An insulating silicone rubber composition, comprising:
a silicone rubber; and
an ionic liquid compound that comprises a heterocycle that comprises a nitrogen cation, and has an —R2—Si(OR3)3 group bonded to the nitrogen atom, where R2 is a group comprising at least (CH2)n, wherein n represents an integer number; and R3 is an alkyl group.

US Pat. No. 9,057,845

MULTI-FERRULE OPTICAL FIBER CABLE ASSEMBLY

Molex Incorporated, Lisl...

1. An optical fiber cable assembly, the optical fiber cable assembly comprising:
an optical fiber cable, the cable including a plurality of optical fibers and a jacket, the jacket surrounding the optical
fibers, arrays of the optical fibers being interconnected to form a plurality of generally planar optical fiber ribbons;

an optical fiber connector, the connector including a housing, a rear end, at least two ferrules, a first mounting adapter
and a second mounting adapter, the housing including a mating end, each ferrule supporting at least two of the optical fiber
arrays therein; and

a strain relief member including a flexible corrugated conduit, the conduit being connected to a rear end of the connector
and a portion of the cable;

wherein the second mounting adapter includes a first portion, a second portion and a third portion, the first portion being
connected to the flexible corrugated conduit, the second portion being connected to the cable, the third portion securing
the first portion to the second portion.

US Pat. No. 9,060,446

PRINTED CIRCUIT BOARD

IBIDEN CO., LTD., Ogaki-...

1. A printed circuit board, comprising:
a resin substrate having a penetrating opening portion formed through the resin substrate;
a chip capacitor device accommodated in the penetrating opening portion of the resin substrate; and
a buildup structure formed on the resin substrate such that the buildup structure covers the chip capacitor device in the
penetrating opening portion of the resin substrate,

wherein the buildup structure is configured to mount an IC chip device on a surface of the buildup structure such that the
IC chip device is mounted directly over the chip capacitor device, the chip capacitor device has a dielectric body having
a surface facing the buildup structure, a first electrode formed on the dielectric body and extending on the surface of the
dielectric body, and a second electrode formed on the dielectric body and extending on the surface of the dielectric body,
the dielectric body is interposed between the first electrode and the second electrode, and the buildup structure has a stacked
via structure comprising a plurality of filled via structures formed directly on one another such that the stacked via structure
is connected to one of the first electrode and the second electrode of the chip capacitor through the buildup structure.

US Pat. No. 9,058,281

ALLOCATING MEMORY USAGE BASED ON QUALITY METRICS

SEAGATE TECHNOLOGY LLC, ...

1. A memory system, comprising:
a memory controller configured to
cause redundant data that is stored in other locations of a memory system to be stored in first memory locations of a non-volatile
secondary memory that serves as a cache for a non-volatile primary memory, the primary memory comprising a hard disk drive
(HDD) and the secondary memory comprising a solid state memory;

cause non-redundant data that is not stored in other locations of the memory system to be stored in second memory locations
of the secondary memory, the second memory locations having at least one of lower bit error rate and higher access speed than
the first memory locations; and

dynamically determine sizes for the first and second memory locations in response to an amount of time that the HDD is spinning
and commands to read from and write to the HDD are being serviced for a particular workload.

US Pat. No. 9,057,565

COOLING DEVICE AND ELECTRONIC DEVICE

Molex Incorporated, Lisl...

1. A cooling device, the cooling device comprising:
a base, the base including a recessed part in a first surface;
a plurality of heat radiating fins, the fins standing erect on a second surface, the second surface being the reverse side
of the first surface; and

a flat, plate-like thermal diffusion part housed in the recessed part, the upper surface of the thermal diffusion part making
thermal contact with the upper surface of the recessed part, the side surface of the thermal diffusion part making thermal
contact with the side surface of the recessed part;

wherein the thermal diffusion part diffuses, in the planar and orthogonal directions, heat from a heat generating element,
the heat generating element being arranged on the bottom surface of the thermal diffusion part by vaporizing and condensing
coolant sealed inside and making thermal contact with a part of the lower surface of the thermal diffusion part.

US Pat. No. 9,059,678

TCCT MATCH CIRCUIT FOR PLASMA ETCH CHAMBERS

Lam Research Corporation,...

1. A match circuit coupled between an RF source and a plasma chamber, the match circuit comprising:
a power input circuit, the power input circuit coupled to an RF source;
an inner coil input circuit coupled between the power input circuit and an input terminal of an inner coil, the inner coil
input circuit including an inductor and a first variable capacitor coupled in series to the inductor, the inductor connecting
to the power input circuit, and the capacitor connecting to the input terminal of the inner coil, a first node being defined
between the power input circuit and the inner coil input circuit, wherein the inductor has a value of 0.3 uH to 0.5 uH;

an inner coil output circuit coupled between an output terminal of the inner coil and ground, the inner coil output circuit
defining a direct pass-through connection that does not include an inductor or capacitor and is a direct connection to ground;

an outer coil input circuit coupled between the first node and an input terminal of an outer coil, the outer coil input circuit
having a second variable capacitor, the outer coil input circuit further coupled to the power input circuit via the first
node;

an outer coil output circuit coupled between an output terminal of the outer coil and ground, wherein the outer coil output
circuit includes a third capacitor having a value of about 80 pF to about 120 pF;

wherein the first node splits power from the power input circuit for distribution to the inner coil input circuit and the
outer coil input circuit, the first and second variable capacitors providing for tuning of a ratio of currents between the
inner coil and the outer coil.

US Pat. No. 9,060,025

CLOUD-BASED SECURITY POLICY CONFIGURATION

Fortinet, Inc., Sunnyval...

1. A method comprising:
logging into a cloud account by a first network appliance;
fetching from the cloud account, by the first network appliance, one or more security parameters shared by a second network
appliance to the cloud account;

automatically creating, by the first network appliance, a security policy that controls a connection between the first network
appliance and the second network appliance based at least in part on the one or more security parameters;

further comprising:
fetching from the cloud account, by the first network appliance, a modification of the one or more security parameters shared
by the second network appliance to the cloud account;

updating, by the first network appliance, the security policy based at least in part on the modification of the one or more
security parameters.

US Pat. No. 9,058,937

TOUCH PANEL

Molex Incorporated, Lisl...

1. A touch panel, the touch panel comprising:
a main panel, the main panel including a base, a plurality of side panels extending downward from the base, a plurality of
display patterns disposed on the base, and a singular opening disposed therein, the base and the side panels defining a chamber,
the opening being waterproof; and

a light-emitting touch module disposed underneath the main panel and within the chamber, the light-emitting touch module including:
a first circuit board, the first circuit board including a plurality of touch sensors, a plurality of light-emitting devices
and a plurality of light guiding parts, each light guiding part being attached to a side edge of one light-emitting device
to evenly project the light emitted from the light-emitting device upward;

a light reflecting part disposed underneath each light guiding part, each light reflecting part reflecting the light emitted
from the light guiding part back to the light guiding part, which is further projected upwards toward the display patterns
to improve the brightness of the display patterns; and

a spacer, the spacer being disposed between, and in contact with, the main panel and the first circuit board.

US Pat. No. 9,058,526

DATA COLLECTION MODULE AND SYSTEM

Hand Held Products, Inc.,...

1. A data collection module, comprising:
an illumination assembly and an imaging assembly;
a processor configured to operate the illumination and imaging assemblies;
at least one network interface configured to communicate with a terminal module;
at least one power supply;
a terminal module interface configured to communicate with a terminal module when the data collection module is mated with
the terminal module;

wherein the data collection module is configured so that when the data collection module is not mated to the terminal module,
the data collection module is operative so that the processor implements decode instructions to decode pixel data from the
imaging assembly, and wherein the data collection module is further configured so that when the data collection module is
mated to the terminal module, the data collection module is operative to transmit pixel data from the imaging assembly to
the terminal module for decoding by a processor of the terminal module.

US Pat. No. 9,059,108

INTEGRATED CIRCUIT PACKAGING SYSTEM WITH INTERCONNECTS

STATS ChipPAC Ltd., Sing...

1. An integrated circuit packaging system comprising:
a base substrate;
a base integrated circuit over the base substrate;
a lead attached to the base integrated circuit and the base substrate, the lead having a lead attachment portion over the
base integrated circuit, a device-lead attach layer is attached to the base integrated circuit and the lead attachment portion;
and

a base encapsulation over the lead, the base encapsulation having a cavity exposing top surface of the lead attachment portion
and a sidewall of a lead upper portion, wherein the top surface of the exposed lead attachment portion is lower than a top
surface of the base encapsulation.

US Pat. No. 9,059,221

SUBSTRATE PROCESSING METHOD AND SUBSTRATE PROCESSING APPARATUS

SCREEN Holdings Co., Ltd....

1. A substrate processing method in which a substrate is held in a horizontal posture and rotated about a vertical axis, and
while a cleaning solution is being continuously discharged to a surface of the substrate from an outlet of a discharge nozzle,
the outlet of said discharge nozzle is scanned from a position opposed to a center of the substrate to a position opposed
to a circumferential edge of the substrate, so as to allow a dried region to form at the center of the substrate;
wherein after the outlet of said discharge nozzle has started to move from the position opposed to the center of the substrate
toward the circumferential edge of the substrate, and before drying at the center of the substrate is started, the movement
of the outlet of said discharge nozzle is once stopped, and after drying has started, by a centrifugal force causing the cleaning
solution, which the surface of the substrate is covered with, to flow in a region inside a circumference defined by the center
of the substrate as the center and by a distance to a position on the substrate surface opposed to the outlet of said discharge
nozzle as the radius, the outlet of said discharge nozzle is moved again toward the circumferential edge of the substrate,
whereby only one dried core, which will be a starting point when the dried region is formed on the substrate, is produced,
and then the dried region of which said dried core is the starting point is spread all over the surface of the substrate,
to dry the substrate; and

during the process of scanning the outlet of the discharge nozzle to the position opposed to the circumferential edge of the
substrate, the rotation speed of the substrate is decreased.

US Pat. No. 9,058,823

PROTECTED TRANSDUCER FOR DEAD LAYER REDUCTION

Seagate Technology LLC, ...

1. A method of fabricating a transducer comprising:
obtaining a first intermediate structure including magnetic material formed on a substrate and a mask deposited on the magnetic
material;

performing a first shaping operation on the first intermediate structure to form a second intermediate structure, the shaped
magnetic material in the second intermediate structure including a trailing edge, a leading edge and a pair of sidewalls extending
between the trailing edge and the leading edge; and

redepositing material of the substrate on and in contact with the sidewalls of the shaped magnetic material in the second
intermediate structure to form a protective layer,

wherein the first shaping operation on the first intermediate structure is carried out using ion beam bombardment at a first
level of energy and the redepositing material of the substrate on and in contact with the sidewalls of the shaped magnetic
material in the second intermediate structure to form a protective layer is carried out using ion beam bombardment, and

performing a second shaping operation to the second intermediate structure using ion beam bombardment at a second level of
energy to form a third intermediate structure, the second level of energy being less than the first level of energy.

US Pat. No. 9,057,512

VEHICLE LIGHTING UNIT

Stanley Electric Co., Ltd...

1. A vehicle lighting unit comprising:
a light emitting device disposed below a predetermined light source position and having an excitation light source, a wavelength
conversion member disposed at a position spaced away from and above the excitation light source, a condensing lens disposed
between the excitation light source and the wavelength conversion member, and a holder configured to hold the excitation light
source, the wavelength conversion member, and the condensing lens;

a supporting member configured to support the light emitting device so as to allow the light emitting device to move horizontally;
a first fixing member configured to fix the light emitting device and the supporting member together in a state where the
wavelength conversion member is disposed on a vertical axis passing through the predetermined light source position;

a vertical guiding member in surface contact with the supporting member and having a vertical guiding face to allow the supporting
member to vertically slide in a state where the supporting member is in surface contact with the vertical guiding member;

a stopper configured to restrict vertical movement of the supporting member with respect to the vertical guiding member, thereby
positioning the wavelength conversion member in the predetermined light source position;

a second fixing member configured to fix the supporting member and the vertical guiding member together in a state where the
light emitting device is in contact with the stopper and the supporting member is in surface contact with the vertical guiding
face; and

a vehicle lighting unit main body configured to project light emitted from the light emitting device disposed below the predetermined
light source position in a forward direction.

US Pat. No. 9,059,423

ELECTRONIC COMPONENT AND ELECTRICAL CONTACT

OSRAM Opto Semiconductors...

1. An electronic component comprising:
a substrate;
a first electrode arranged on said substrate, said first electrode having two opposed surfaces facing toward and away from
said substrate, respectively; and

a growth layer arranged directly on the surface of said first electrode facing toward said substrate, said growth layer having
two opposed surfaces, one of which faces toward said substrate,

wherein said first electrode consists of a metal layer with a thickness of less than or equal to 30 nm,
wherein said growth layer has a thickness of less than or equal to 10 nm and consists of a transparent conductive oxide,
wherein the electronic component is an organic light emitting diode (OLED) that comprises a second electrode and at least
one organic functional layer, said at least one organic functional layer containing an emitter layer with at least one of
fluorescent and phosphorescent emitters and being arranged between said first electrode and said second electrode, wherein
the first and second electrodes are configured to supply current to the organic functional layer,

wherein said at least one organic functional layer is arranged directly on the surface of said growth layer facing toward
said substrate,

wherein a contribution of the growth layer to a lateral current conduction is negligible and the surface of the growth layer
facing the first electrode is configured to allow homogeneous deposition of the metal layer of the first electrode, and said
surface of the growth layer is an amorphous surface,

wherein a further functional layer is arranged directly on the surface of said first electrode facing away from said substrate,
and

wherein said further functional layer includes one of an antireflection layer, a scattering layer, a layer for a color conversion
of light, and a mechanical protection layer.

US Pat. No. 9,056,943

EPOXY RESIN COMPOSITION FOR OPTICAL SEMICONDUCTOR DEVICE AND OPTICAL SEMICONDUCTOR DEVICE USING THE SAME

NITTO DENKO CORPORATION, ...

1. An epoxy resin composition for an optical semiconductor device, comprising the following ingredients (A) to (E):
(A) an epoxy resin;
(B) an acid anhydride curing agent;
(C) a curing accelerator;
(D) a silicone resin where a siloxane unit constituting the silicone resin is represented by the following general formula
(1), the silicone resin has at least one hydroxyl group or alkoxy group bonded to a silicon atom in one molecule thereof,
and, among monovalent hydrocarbon groups (R) bonded to silicon atoms, 10% by mol or more thereof are substituted or unsubstituted
aromatic hydrocarbon groups;

Rm(OR1)nSiO(4-m-n)/2  (1)
wherein R is a substituted or unsubstituted saturated monovalent hydrocarbon group having 1 to 18 carbon atoms or an aromatic
hydrocarbon group and may be the same or different from each other; R1 is a hydrogen atom or an alkyl group having 1 to 6 carbon atoms and may be the same or different from each other; and m and
n are each an integer of 0 to 3; and
(E) an alcohol compound represented by the following general formula (2):
wherein X is a single bond or a divalent hydrocarbon group having 1 to 22 carbon atoms,
wherein a content of the alcohol compound as the ingredient (E) is 5 to 25% by mol based on the number of mol of the acid
anhydride curing agent as the ingredient (B).

US Pat. No. 9,059,912

TRAFFIC POLICING FOR MPLS-BASED NETWORK

VERIZON PATENT AND LICENS...

1. A method comprising: storing, by a network device, traffic policies pertaining to a label-based network, wherein the traffic
policies include color-aware traffic policies and the traffic policies are mapped to one or more types of labels of the label-based
network, wherein the one or more labels include at least one of a virtual private network label or a network label; using
a cascaded queuing system that filters traffic flows pertaining to a particular set of the traffic policies, wherein the cascaded
queuing system includes different queues corresponding to different labels of the label-based network, which are designated
for the particular set of the traffic policies;
receiving, by the network device, a traffic flow;
computing, by the network device, a route for the traffic flow;
identifying, by the network device, one or more labels associated with the traffic flow;
selecting, by the network device, one or more of the traffic policies in response to the identifying of the one or more labels;
and

transmitting, by the network device, the traffic flow along the route in the label-based network according to the selected
one or more of the traffic policies.

US Pat. No. 9,059,496

NANOPARTICLE-ENHANCED LIQUID CRYSTAL RADIO FREQUENCY PHASE SHIFTER

THE REGENTS OF THE UNIVER...

1. A liquid crystal phase shifter comprising:
at least one electrode attached to a first substrate layer;
a ground plane layer attached to a second substrate layer; and
a liquid crystal layer positioned between the ground plane layer and the first substrate layer,
wherein the liquid crystal layer comprises a suspension of a liquid crystal material and highly polarizable nanoparticles
having a permanent dipole moment value greater than a maximum value of an electric field induced polarization of the liquid
crystal material.

US Pat. No. 9,060,215

NETWORK SPECIFIC ROUTING AND WAVELENGTH ASSIGNMENT FOR OPTICAL COMMUNICATIONS NETWORKS

Ciena Corporation, Hanov...

1. A method for facilitating routing and wavelength assignment in an optical communications network having a given topology
of associated nodes and links, the method comprising:
determining a set of system characteristics associated with operating the optical communications network based on the topology
of associated nodes and links;

selecting a first set of values for one or more parameters of a routing and wavelength assignment algorithm defined for operating
a set of services on the optical communications network;

determining a first set of routes and wavelengths assigned to the set of services via the assignment algorithm in accordance
with the first set of values and the set of system characteristics;

selecting a second set of values for the one or more parameters of the routing and wavelength assignment algorithm;
determining a second set of routes and wavelengths assigned to the set of services via the assignment algorithm based on the
second set of values and the set of system characteristics;

comparing the first set of routes and wavelengths assigned to the set of services to the second set of routes and wavelengths
assigned to the set of services based on one or more fitness criteria;

selecting between the first and second sets of values based on the comparison; and
provisioning a path computation engine of the optical communications network with the selected set of values for the one or
more parameters to facilitate performing run-time routing and wavelength assignment operations by the path computation engine.

US Pat. No. 9,059,688

HIGH-PRECISION OSCILLATOR SYSTEMS WITH FEED FORWARD COMPENSATION FOR CCFL DRIVER SYSTEMS AND METHODS THEREOF

On-Bright Electronics (Sh...

1. A system for generating one or more ramp signals, the system comprising:
an oscillator configured to generate at least a clock signal; and
a ramp signal generator configured to receive at least the clock signal and generate a first ramp signal, the ramp signal
generator being coupled to a resistor including a first terminal and a second terminal;

wherein the resistor being configured to receive an input voltage at the first terminal and being coupled to the ramp signal
generator at the second terminal, the resistor being associated with a resistance value;

wherein:
the clock signal is associated with at least a predetermined frequency;
the predetermined frequency does not change if the input voltage changes from a first magnitude to a second magnitude, the
first magnitude being different from the second magnitude;

the first ramp signal is associated with at least the predetermined frequency and a first slope, the first slope being related
to an increase of the first ramp signal; and

the first slope changes if the input voltage changes from the first magnitude to the second magnitude.

US Pat. No. 9,058,900

SYSTEM, SEMICONDUCTOR MEMORY DEVICE AND OPERATING METHOD THEREOF

SK Hynix Inc., Gyeonggi-...

1. A method for operating a semiconductor memory device including a memory block-constituted by main memory cells and dummy
memory cells, the method comprising:
reading out an erase count of the memory block stored in the dummy memory cells, erasing the memory block, increasing the
read-out erase count, and storing the increased erase count in the dummy memory cells,

wherein the dummy memory cells are connected to at least one dummy word line,
wherein the main memory cells are divided into a main cell area and a flag cell area,
wherein the dummy memory cells are divided into a dummy main cell area and a dummy flag cell area,
wherein the erase count of the memory block is read out from the dummy flag cell area, and
wherein the increased erase count is stored in the dummy flag cell area.

US Pat. No. 9,058,829

MULTIPLE HEATERS INDEPENDENTLY CONTROLLING CLEARANCE OF TWO OR MORE READ TRANSDUCERS

Seagate Technology LLC, ...

1. An apparatus comprising:
first and second read transducers arranged on a media-facing surface and offset along a down-track direction and a cross-track
direction from one another along the media-facing surface, the read transducers detecting magnetic fields of a recording medium;
and

first and second heaters disposed proximate the respective first and second read transducers, the first and second heaters
offset from one another in the down-track direction and the cross-track direction, the first and second heaters independently
controlling respective first and second protrusions of the first and second read transducers from the media-facing surface
while the first and second readers are reading separate tracks of the recording medium.

US Pat. No. 9,056,866

[1,2,3]TRIAZOLO[4,5-D]PYRIMIDINE DERIVATIVES

Hoffmann-La Roche Inc., ...

30. A pharmaceutical composition, comprising a therapeutically effective amount of a compound according to claim 1 and a pharmaceutically acceptable carrier.

US Pat. No. 9,059,065

METHOD OF VARYING GAIN OF AMPLIFYING PHOTOELECTRIC CONVERSION DEVICE AND VARIABLE GAIN PHOTOELECTRIC CONVERSION DEVICE

National Institute of Adv...

1. A method of varying gain of an amplifying photoelectric conversion device which includes: an amplifying photoelectric conversion
part including a photoelectric conversion element and a plurality of transistors each having a collector, a base, and an emitter;
and a plurality of first field-effect transistors each having a source, a drain, and a gate, and in which
the sources and the drains of the first field-effect transistors are connected respectively between the emitters and the bases
of the plurality of transistors,

the photoelectric conversion element is connected to the base of a transistor selected from the plurality of transistors,
the photoelectric conversion element is a device which performs photoelectric conversion of light input information being
light intensity or light wavelength into an electric variable being electric current, electric charge, or voltage,

at least one of the collectors of the plurality of transistors is a first output part,
one of the emitters of the plurality of transistors is a second output part,
the emitters of the plurality of transistors other than the second output part are connected respectively to the bases of
the other transistors further excluding the selected transistor, to the base of which the photoelectric conversion element
is connected, and

the electric variable resulting from the photoelectric conversion is an electric signal in the form of an amplified current,
charge, or voltage obtained from the first output part or the second output part,

the method comprising: the step of applying gain control potentials to the gates to vary gain of the electric signal obtained
from the first output part or the second output part.

US Pat. No. 9,056,946

METHOD FOR PRODUCING POLYLACTIC ACID

HITACHI ZOSEN CORPORATION...

1. A method for producing stereocomplex polylactic acid, comprising:
(1) reacting glycerin with sodium hydroxide in high-temperature and high-pressure water to produce a racemic sodium lactate
aqueous solution;

(2) recovering racemic lactic acid by separating sodium from the racemic sodium lactate aqueous solution;
(3) dimerizing the racemic lactic acid to produce a lactide mixture containing meso lactide and racemic lactide;
(4) recovering racemic lactide by separating meso lactide from the mixture; and
(5) polymerizing the racemic lactide with a salen-metal complex as a catalyst to produce stereocomplex polylactic acid, wherein
the salen-metal complex is:


wherein R1 and R2 each represent hydrogen, an alkyl group having from 1 to 6 carbon atoms, an alkoxy group having from 1 to
6 carbon atoms, a halogen group, a silyl group, an aryl group having from 6 to 18 nuclear carbon atoms, or a methoxymethyl
group; R3 represents a divalent aliphatic hydrocarbon group having from 2 to 6 carbon atoms; and M represents Al, Fe, Ti or
Y.

US Pat. No. 9,060,444

SERVER AND FIXING ASSEMBLY THEREOF

INVENTEC (PUDONG) TECHNOL...

1. A server, comprising:
a storage module for storing data;
a processing module electrically connected with the storage module;
a motherboard where the processing module is located; and
a fixing assembly, comprising:
a carrier;
a stopper securely located on the carrier;
a tray having a bottom wall, wherein the storage module is located on the bottom wall and is securely fixed to the tray, wherein
the tray has a first position and a second position relative to the carrier, wherein the bottom wall has a fixing hole and
the stopper passes through the fixing hole, wherein when the tray is located at the second position, the stopper engages with
the tray through the fixing hole to make the tray securely attached to the carrier, wherein when the tray is located at the
first position, the stopper releases from engaging with the tray, allowing the tray to be removed from the carrier;

a first locking part having a first state and a second state and securely located on the tray, wherein the tray is able to
move between the first position and the second position when the first locking part is located at the first state, such that
the stopper is able to switch between engaging with the tray and releasing from engaging with the tray; and

a second locking part securely located on the carrier, wherein the first locking part cooperates with the second locking part
to lock the tray at the second position when the tray is located at the second position and the first locking part is located
at the second state.

US Pat. No. 9,059,074

INTEGRATED CIRCUIT PACKAGE SYSTEM WITH PLANAR INTERCONNECT

STATS ChipPAC Ltd., Sing...

1. A method of manufacture of an integrated circuit package system comprising:
mounting an integrated circuit die adjacent to a lead,
forming a first encapsulation in direct contact with the integrated circuit die and the lead, the first encapsulation exposing
an active side of the integrated circuit die and the lead;

forming a planar interconnect having an interconnect top side in direct contact with the active side of the integrated circuit
die, the lead bottom side of the lead, and the first encapsulation; and

forming a second encapsulation covering a non-horizontal side of the planar interconnect, the second encapsulation in direct
contact with the active side of the integrated circuit die, the lead bottom side of the lead, and the bottom side of the planar
interconnect opposite from the interconnect top side, and the second encapsulation is a transparent laminated epoxy layer,
a transparent screen printed epoxy layer, or a transparent stencil printed epoxy layer for image sensor applications and electromagnetic
wave activation applications, wherein a top surface of the second encapsulation coplanar with the lead bottom side of the
lead, the interconnect top side, and the active side of the integrated circuit die.

US Pat. No. 9,059,780

DEVICE AND METHOD FOR NODAL MULTIPLE ACCESS INTO COMMUNICATIONS CHANNELS

The DIRECTV Group, Inc., ...

1. A method for multiple access to a communications channel on a satellite comprising the steps of:
transmitting a first modulated signal from a first site to a transponder;
receiving, from the transponder, a composite signal, the composite signal comprising the first modulated signal and a second
modulated signal transmitted from at least a second site;

modulating the information bit stream with a modulating signal according to a frequency of a carrier of the received composite
signal, comprising the steps of:

converting said composite signal into in-phase (I) and quadrature (Q) components of the second modulated signal defining a
local I/Q coordinate space for signal processing at the first site, wherein said local I/Q coordinate space is determined
with respect to a local oscillator reference and the carrier of the received composite signal;

determining an location for the I and Q components of the modulated information bit stream according to a distance between
signals in said composite signal and a local signal; and

modulating the information bit stream according to the optimum I/Q location and the carrier;
transmitting the modulated information bit stream.

US Pat. No. 9,058,158

ELECTRONIC DEVICE

Inventec (Pudong) Technol...

1. An electronic device, comprising:
a motherboard;
a power module, being arranged on a front side of the motherboard along a longitudinal direction and having a power-supply
opening;

a hard disk module, being arranged on the front side of the motherboard along the longitudinal direction and further stacked
with the power module;

a fan module, being located on a rear side of the motherboard relative to the front side along transverse direction perpendicular
to the longitudinal direction and further providing airflows towards the power-supply opening of the power module;

a heating module, arranged on the motherboard and further located between the fan module and the power module; and
a power-supply wind scooper, being arranged to shield a part of the power-supply opening, so that a first airflow flowing
through the heating module is prevented by the power-supply wind scooper from flowing into the power module, and a second
airflow not flow through the heating module flows into the power module from the part of the power-supply opening not shielded
by the power-supply wind scooper.

US Pat. No. 9,058,144

IMAGE TRANSMISSION SYSTEM FACILITATING ADDRESS REGISTRATION

Kyocera Document Solution...

1. An image transmission system comprising:
an image transmission apparatus configured to transmit an image via a network; and
a client apparatus configured to perform an address information management service as an application for managing address
information that includes information on a transmission destination of the image, and connected to the image transmission
apparatus via the network,

wherein the image transmission apparatus includes:
an operation unit,
a display unit,
a search message distribution device configured to distribute, via the network, a Probe message as a search message for searching
for the client apparatus in which the address information management service is being activated, via User Datagram Protocol
(UDP) multicast, for searching for the client apparatus in which the address information management service is being activated
by using Web Services Dynamic Discovery (WS-Discovery), based on an instruction inputted via the operation unit,

an address information request device configured to transmit a request of the address information to the client apparatus
that has transmitted a Probe Match message based on the WS-Discovery as a reply message for replying to the search message,

an address display device configured to cause the display unit to display one or more addresses included in the address information
that has been transmitted from the client apparatus, and

an image transmission device configured to transmit the image to the address that has been selected based on the instruction
inputted via the operation unit, among the one or more addresses displayed on the display unit,

wherein the client apparatus includes:
an address information management device configured to manage the address information,
a reply message returning device configured to transmit the reply message to the image transmission apparatus that has transmitted
the search message, and

an address information transmission device configured to transmit, to the image transmission apparatus that has requested
the address information, the address information managed by the address information management device, and

wherein the search message includes identification information of the reply message returning device,
the reply message returning device is configured to return the reply message to the image transmission apparatus that has
transmitted the search message including the identification information of the reply message returning device, and

the address display device is configured to cause the display unit to display only one or more addresses included in the address
information that is managed by the client apparatus that is identified using the identification information included in the
search message, among the plurality of the client apparatuses in which the address information management service is being
activated.

US Pat. No. 9,060,277

MOBILE COMMUNICATION DEVICES, WIRELESS ACCESS POINTS, AND WIRELESS LOCAL AREA NETWORK (WLAN) AUTHENTICATION METHODS THEREOF

QUANTA COMPUTER INC., Gu...

1. A Wireless Access Point (WAP), comprising:
a Local Area Network (LAN) interface, configured to provide access to the Internet;
a first wireless module, configured to generate a plurality of security parameters associated with a Wireless LAN (WLAN) technology,
use the WLAN technology to perform an authentication procedure with a mobile communication device according to the security
parameters, and after completing the authentication procedure, provide a Hotspot service of the WLAN technology to the mobile
communication device via the LAN interface; and

a second wireless module, configured to use a cellular network technology to establish an encrypted connection with the mobile
communication device and transmit the security parameters to the mobile communication device via the encrypted connection.

US Pat. No. 9,059,856

PROVIDING SECURITY SERVICES ON THE CLOUD

Microsoft Technology Lice...

1. In a computer networking environment that includes a cloud computing environment accessed by plurality of computing systems
and at least one publisher computer system, a computer program product comprising at least one storage device having stored
computer-executable instructions which, when executed by one or more processors perform a computer-implemented method which,
when implemented by the publisher computer system, provides secure storage for a selected software package in the cloud computing
environment, the computer-implemented method comprising acts of:
generating at the publisher computing system a hash for a selected software package;
sending from the publisher computing system a signing request that includes the hash of the selected software package, the
signing request being sent to a keying and signing service located at the cloud computing environment and the signing request
requesting that the selected software package be signed;

receiving at the publisher computing system the digitally signed hash signed with a public key from a public/private key pair
generated for the selected software package of the publisher computing system at the keying and signing service;

attaching the digitally signed hash to the selected software package at the publisher computing system;
the publisher computing system encrypting the selected software package with a symmetric key; and
sending from the publisher computing system the symmetric key to the keying and signing service at the cloud computing environment,
wherein the symmetric key is encrypted and stored at a secure data store of the cloud computing environment with an encrypted
version of the private key from said public/private key pair generated for the selected software package.

US Pat. No. 9,059,454

LEAD TAB ASSEMBLY AND BATTERY MODULE WITH THE SAME

Samsung SDI Co., Ltd., Y...

1. A battery module comprising:
a plurality of rechargeable unit cells; and
a lead tab assembly that electrically connects the unit cells together, wherein the lead tab assembly comprises:
a first lead tab extending in a first direction and that is electrically connected to a first unit cell of the unit cells;
a second lead tab that extends in the first direction and that is electrically connected to a second unit cell of the unit
cells;

a temperature-sensing element that is located between the first lead tab and the second lead tab and is electrically connected
to the first lead tab and the second lead tab; and

an insulating member that accommodates at least a portion of the first lead tab, the second lead tab, and the temperature-sensing
element, wherein the insulating member is between a respective one of the unit cells and the first lead tab.

US Pat. No. 9,057,324

SIX-STROKE ENGINE SYSTEM WITH BLOWDOWN TURBOCHARGER

Caterpillar Inc., Peoria...

1. An internal combustion engine system operating on a six-stroke cycle comprising:
an engine including a combustion chamber including a piston reciprocally disposed in a cylinder to move between a top dead
center position and a bottom dead center position, the combustion chamber further including:

an exhaust valve adapted to open and close to selectively expel exhaust gasses from the combustion chamber during an exhaust
stroke;

a blowdown exhaust valve adapted to open and close to selectively expel blowdown exhaust gasses from the combustion chamber
during a recompression stroke;

an intake valve adapted to open and close to selectively introduce air into the combustion chamber during an intake stroke;
and

a blowdown compressor intake valve adapted to selectively open and close to introduce air into the combustion chamber;
an exhaust line communicating with the engine and a turbine, the exhaust line directing the exhaust gasses expelled from the
exhaust valve to drive the turbine;

a compressor adapted to be driven by the turbine;
an intake line communicating with the engine and the compressor, the intake line:
receiving compressed air from the compressor; and
directing a portion of the compressed air into the combustion chamber through the intake valve;
a blowdown exhaust line communicating with the engine and a blowdown turbine, the blowdown exhaust line directing blowdown
exhaust gasses expelled from the blowdown exhaust valve to drive the blowdown turbine, the blowdown exhaust line being separate
from the exhaust line connected to an inlet of the turbine;

a blowdown compressor adapted to be driven by the blowdown turbine; and
a blowdown compressor line communicating with the engine, the blowdown compressor, and the intake line downstream of the compressor,
the blowdown compressor line:

directing a portion of the compressed air from the intake line into the blowdown compressor; and
directing super-compressed air from the blowdown compressor into the engine through the blowdown compressor intake valve;
wherein the super-compressed air is introduced through the blowdown compressor intake valve into the combustion chamber during
the recompression stroke.

US Pat. No. 9,059,829

RECEIVER AND RECEIVED SIGNAL DECODING METHOD

Hitachi Kokusai Electric ...

1. A receiver receiving a sequence of symbols converted from given g bits (where g is an integer greater than zero),
wherein the sequence of symbols is generated in such a manner that, after the given bits are encoded, the encoded bits are
reordered by interleaving, thus generating information bits, every L bits of which are reduced to m bits (where m and L are
integers greater than zero which satisfy m
the receiver comprising:
a symbol demapper outputting one bit of first extrinsic information by using one received symbol and (m?1) bits of a priori
information;

a check node decoder outputting one bit of second extrinsic information by using m bits of the first extrinsic information
output by the symbol demapper with respect to each of m bits corresponding to the one received symbol and (L?1) bits of a
priori information;

a deinterleaver deinterleaving a plurality of bits of second extrinsic information corresponding to the sequence of symbols
in a manner inverse to the interleaving;

a variable node decoder outputting one bit of third extrinsic information by using a plurality of bits of second extrinsic
information output from the deinterleaver as a priori information;

an interleaver interleaving third extrinsic information output from the variable node decoder in a manner inverse to the deinterleaving;
and

a resequencer disposed in at least one stage preceding or following the interleaver and the deinterleaver,
wherein the check node decoder outputs m bits of fourth extrinsic information by using L bits of the third extrinsic information
output from the interleaver as a priori information,

wherein the fourth extrinsic information is used as a priori information by the symbol demapper,
wherein a plurality of modules of the deinterleaver and the interleaver are provided for parallel processing of each of interleaving
and deinterleaving,

wherein the resequencer, if disposed in the preceding stage, rearranges a sequence of bits of the second extrinsic information
to be input to the deinterleaver and rearranges a sequence of bits of the third extrinsic information output from the interleaver,
and

wherein the resequencer, if disposed in the following stage, rearranges a sequence of bits of the second extrinsic information
output from the deinterleaver and rearranges a sequence of bits of the third extrinsic information to be input to the interleaver.

US Pat. No. 9,059,541

ELECTRICAL CONNECTOR ASSEMBLY AND AN ELECTRONIC DEVICE INCORPORATING THE SAME

Quanta Computer Inc., Ta...

1. An electronic device adapted for receiving an electrical power signal, comprising:
a first control circuit capable of generating a control signal; and
an electrical connector assembly including
a first connector that includes a switch unit, a second control circuit, a first substrate and a first contact unit, said
first connector unit being disposed on said first substrate and including a first electrical power contact pad, and two first
detecting contact pads, two first control contact pads and two first grounding contact pads symmetrically arranged on opposite
sides of said first electrical power contact pad, said first detecting contact pads being electrically connected to each other,
said first grounding contact pads being grounded, said second control circuit being electrically connected to said first control
contact pads, said switch unit having a first terminal adapted for receiving the electrical power signal, a second terminal
connected electrically to said first electrical power contact pad, and a control terminal electrically connected to said second
control circuit, said switch unit being controlled by said second control circuit to switch between a conducting state, where
said first and second terminals are conducting, and a non-conducting state, where said first and second terminals are not-conducting;
and

a second connector that includes a detecting circuit, a second substrate and a second contact unit, said second contact unit
being disposed on said second substrate and including a second electrical power contact pad, a second detecting contact pad
and a third detecting contact pad symmetrically arranged on opposite sides of said second electrical power contact pad, a
second control contact pad and a third control contact pad symmetrically arranged on said opposite sides of said second electrical
power contact pad, and two second grounding contact pads symmetrically arranged on said opposite sides of said second electrical
power contact pad, said second detecting contact pad receiving a trigger signal, said second grounding contact pads being
grounded, said second electrical power contact pad and said second control contact pad being electrically connected to said
first control circuit, said detecting circuit being electrically connected to said third detecting contact pad and said third
control contact pad;

wherein in a process of connecting said first connector and said second connector, said electrical connector assembly is disposed
sequentially in a first state and a second state;

wherein in the first state, said first electrical power contact pad is in electrical contact with said second electrical power
contact pad, said first grounding contact pads are respectively in electrical contact with said second grounding contact pads,
and said first control contact pads are respectively in electrical contact with said second and third control contact pads,
such that said second control circuit is electrically connected to said first control circuit and said detecting circuit;

wherein in the second state, said first electrical power contact pad remains in electrical contact with said second electrical
power contact pad, said first grounding contact pads respectively remain in electrical contact with said second grounding
contact pads, and said first control contact pads respectively remain in electrical contact with said second and third control
contact pads such that said second control circuit remains electrically connected to said first control circuit and said detecting
circuit, and said second detecting contact pad forms a circuit loop with said first detecting contact pads and said third
detecting contact pad such that the trigger signal is transmitted from said second detecting contact pad through the loop
to said detecting circuit for said detecting circuit to generate a detecting signal based on the trigger signal and transmit
the detecting signal to said second control circuit through the electrical contact between said third control contact pad
and a respective one of said first control contact pads; and

wherein when said electrical connector assembly is in the second state, and when said first control circuit generates the
control signal, said second control signal receives the control signal from said first control circuit through the electrical
contact between said second control contact pad and a respective one of said first control contact pads, and controls said
switch unit to switch from the non-conducting state to the conducting state based on the control signal and the detecting
signal, wherein when said switch unit is in the conducting state, the electrical power signal is transmitted to said first
control circuit through the electrical contact between said first and second electrical power contact pads.

US Pat. No. 9,059,157

INTEGRATED CIRCUIT PACKAGING SYSTEM WITH SUBSTRATE AND METHOD OF MANUFACTURE THEREOF

STATS ChipPAC Ltd., Sing...

1. A method of manufacture of an integrated circuit packaging system comprising:
providing an integrated circuit die;
encapsulating in a package body the integrated circuit die;
applying an inter-react layer on the package body;
forming a substrate on the inter-react layer, the substrate having a top insulation layer and a top conductive layer;
forming a 3D via through the package body, the inter-react layer, and the top insulation layer for exposing the top conductive
layer in the 3D via; and

depositing a top solder bump in the 3D via on the top conductive layer.

US Pat. No. 9,058,215

INTEGRATION OF A CALCULATION ENGINE WITH A SOFTWARE COMPONENT

SAP SE, Walldorf (DE)

1. A computer system implementing software framework related to an in-memory database, the computer system comprising:
a memory storing computer instructions; and
a processor reading the instructions stored in the memory to generate the software framework comprising:
a user interface component in an application layer to schedule jobs and configure a calculation engine of an in-memory database;
an application level component comprising an operational unit and a control unit, wherein:
the control unit performs operations comprising:
triggering jobs to be processed by the operational unit; and
updating a log based on output of the calculation engine;
the operational unit performs operations comprising:
receiving a job trigger input from the control unit;
dividing a job workload into work packages based on one or more parameters, wherein the workload comprises data stored in
the in-memory database; and

sending the work packages to the calculation engine; and
the calculation engine in the in-memory database to perform operations on the work packages and generating the output.

US Pat. No. 9,058,261

SYSTEMS AND METHODS FOR DETAILED ERROR REPORTING IN DATA STORAGE SYSTEMS

Western Digital Technolog...

1. A method for reporting errors in a data storage system comprising a controller device and a bridge device coupled with
a non-volatile memory storage, the method comprising:
causing execution of a memory access operation spanning a plurality of memory elements in the non-volatile memory storage,
wherein execution of the memory access operation comprises: upon encountering a failure in a memory element, continuing executing
the memory access operation on one or more memory elements following the memory element where the failure has been encountered
until the memory access operation is completed; and

receiving an error report comprising, for each memory element on which the memory access operation has been executed, a status
of executing the memory access operation on the memory element, wherein the error report comprises a status of executing the
memory access operation on at least one memory element subsequent to the memory element where the failure has been encountered,

wherein the method is performed by the controller device.

US Pat. No. 9,056,676

SYSTEMS AND METHODS FOR UAV DOCKING

SZ DJI TECHNOLOGY CO., LT...

1. A controller for controlling operation of an unmanned aerial vehicle (UAV), said controller comprising:
one or more user input components, wherein the one or more user input components are in or on a vehicle that traverses land
or water; and

one or more processors individually or collectively configured to receive a signal from the user input components and generate
one or more commands to be transmitted to the UAV to control operation of the UAV, wherein the one or more commands include
(1) a take-off command to drive one or more propulsion units of the UAV during take-off from the vehicle, (2) a flight command
to control: (i) a flight path of the UAV relative to the vehicle, the land, or the water, or (ii) a destination of the UAV,
and (3) a landing command to automatically land the UAV while the vehicle is traversing the land or the water with aid of
an identifier of the vehicle, wherein said identifier is (a) detectable by the UAV, and (b) differentiates the vehicle from
other vehicles.

US Pat. No. 9,056,549

HAPTIC TRACKING REMOTE CONTROL FOR DRIVER INFORMATION CENTER SYSTEM

DENSO International Ameri...

1. A control interface system for a driver of a vehicle, comprising:
a touchscreen located proximate to the driver of the vehicle and, upon driver interaction therewith, operable to generate
a sensor signal;

a control module adapted to receive the sensor signal from the touchscreen and operable to initiate control of a vehicle function
and to generate a feedback signal in response thereto, wherein the touchscreen is adapted to receive the feedback signal from
the control module and is operable to provide a first and a second vibrational feedback to the driver of the vehicle in response
thereto, the control module determines touch coordinates based on the sensor signal from the touchscreen; and

a display embedded in an instrument panel of the vehicle remote from the touchscreen, the display displaying an indicia of
the vehicle function controlled by the touchscreen and, by driver interaction therewith, a surface of the display being a
virtual image of a surface of the touchscreen, wherein

the control module sets a search mode when the driver interaction includes touching the touchscreen with an applied force
greater than a minimum force;

the control module sets a select mode after selecting the search mode when the touch coordinates of the applied force is determined
to be located above a control icon of the indicia on the display;

the control module provides the first vibrational feedback to the driver after setting the select mode when the touch coordinates
of the applied force is determined to be located above the control icon of the indicia on the display;

the control module sets an execute mode after selecting the select mode when the driver interaction includes touching the
touchscreen with an applied force greater than a hard force, the hard force being greater than the minimum force;

the control module executes the control of the vehicle function when the applied force greater than the hard force is maintained
for a specific period of time;

the control module provides the second vibrational feedback, different from the first vibrational feedback, to the driver
after the applied force greater than the hard force is maintained for the specified period of time;

the control module, in the search mode, determines a touch area of the touchscreen in which the applied force is greater than
the minimum force and determines a virtual touch area on the virtual image corresponding to the touch area on the touchscreen,
and the display provides an image of the virtual touch area on the virtual image along with the indicia of the vehicle function
during the search mode;

the control module determines the feedback signal based on the touch coordinates when the touch coordinates are above the
control icon of the indicia on the display, and the control module provides different vibration feedbacks based on the touch
coordinates; and

the control module configures the feedback signal to include at least two of a haptic feedback, an audio feedback, and a visual
feedback, wherein the visual feedback includes an image to instruct the driver of the driver interaction.

US Pat. No. 9,059,544

ELECTRICAL CONNECTOR

Molex Incorporated, Lisl...

1. An electrical connector, comprising:
a housing including two fixing grooves;
a pair of terminals, each terminal respectively positioned in one of the two fixing grooves, the each terminal comprising
a base, an extending piece extending from the base and a resilient arm extending from the base, the base including a fixed
portion, wherein the fixed portion and the corresponding fixing groove forming an interference fit, the extending piece including
a first contact portion and the resilient arm including a second contact portion for electrically connecting an electronic
device; and

two first conductive traces corresponding to the pair of terminals, an end portion of the each first conductive trace being
electrically connected to the first contact portion of the corresponding terminal, and the other end portion of the each first
conductive trace being configured to be electrically connected to a circuit board.

US Pat. No. 9,058,653

ALIGNMENT OF VISIBLE LIGHT SOURCES BASED ON THERMAL IMAGES

FLIR Systems, Inc., Wils...

1. A system comprising:
an infrared imaging module comprising a focal plane array (FPA) configured to capture an unblurred thermal image of a scene
and an intentionally blurred image of the scene;

a processor configured to determine a plurality of non-uniform correction (NUC) terms based on the intentionally blurred thermal
image, apply the NUC terms to the unblurred thermal image to remove noise form the unblurred thermal image, and generate alignment
guide information from the unblurred thermal image; and

a visible light source configured to be selectively directed based on the alignment guide information to substantially align
the visible light source with a desired subject and project a visible light beam substantially on the subject.

US Pat. No. 9,058,527

APPARATUS HAVING HYBRID MONOCHROME AND COLOR IMAGE SENSOR ARRAY

Hand Held Products, Inc.,...

1. An apparatus comprising:
an image sensor array having a plurality monochrome pixels;
wherein the apparatus is configured to capture a gray scale image frame based on an intensity of light detected by at least
the plurality of monochrome pixels, and to transfer the gray scale image frame to an indicia decode circuit, wherein the indicia
decode circuit is configured to attempt to decode a decodable indicia represented by the gray scale image frame;

wherein the image sensor array is configured to obtain the grey scale image frame in a global shutter mode by simultaneously
exposing at least the plurality of monochrome pixels in response to a global exposure control timing pulse; and

wherein the plurality of monochrome pixels are distributed according to a distribution pattern such that a shape of the gray
scale image frame corresponds to a shape of the decodable indicia.

US Pat. No. 9,058,149

DISPLAY APPARATUS COMPRISING MULTIPLE DISPLAY PANELS WITH DIFFERENT RESOLUTIONS

E INK HOLDINGS INC., Hsi...

5. A display apparatus, comprising:
a plurality of display panels set in the display apparatus; and
a time controller electrically coupled to each of the display panels;
wherein each of the display panels has a fixed display resolution;
wherein the time controller is configured for sending out at least two priority control signals to each of the display panels
according to an image data with a fixed image resolution, for selecting a combination of one or more of said display panels
according to said fixed image resolution and said display resolutions, said combination of the selected display panels has
a sum of said fixed display resolutions equal to said fixed image resolution,

wherein the display panels comprise a main display panel and a subordinate display panel; and
wherein the resolution of the main display panel is different from that of the subordinate display panel.

US Pat. No. 9,055,929

LONG ULTRASONIC CUTTING BLADE FORMED OF LAMINATED SMALLER BLADES

Covidien LP, Mansfield, ...

1. An end effector of an ultrasonic surgical instrument, the end effector comprising:
an array of at least two resonant members, each resonant member including
a body defining a first cavity at a distal end of the body;
a resonant structure defining a distal end and a proximal end, the proximal end of the resonant structure received within
the first cavity, the distal end of the resonant structure extending longitudinally and distally beyond the first cavity,
the resonant structure defining a second cavity at the proximal end of the resonant structure; and

a transducer received within the second cavity, the transducer effecting vibrations along the length of the resonant member;
wherein the at least two resonant members are staggered longitudinally relative to each other, and wherein a displacement
curve associated with the vibrations of one of the at least two resonant members is offset relative to a displacement curve
associated with the vibrations of another of the at least two resonant members.

US Pat. No. 9,056,844

4-SUBSTITUTED-3-BENZYLOXY-BICYCLO[3.1.0]HEXANE COMPOUNDS AS MGLUR 2/3 ANTAGONISTS

Eli Lilly and Company, I...

1. A compound of the formula

where R1 and R2 are each independently hydrogen, C1-C3 alkoxycarbonyloxymethyl, C1-C3 alkylcarbonyloxymethyl, or C3-6 cycloalkylcarbonyloxymethyl;

R3 is independently at each occurance methyl, fluoro, or chloro;

R4 is hydroxyl, methylcarbonylamino, hydroxymethylcarbonylamino, methoxycarbonylamino, imidazol-2-ylsulfanyl, thiazol-2-ylsulfanyl,
1,2,4-triazolylsulfanyl, 1-methyl-1,2,4-triazol-3-ylsulfanyl, or 1-methyl-1,2,4-triazol-5-ylsulfanyl; and

n is 1 of 2;
or a pharmaceutically acceptable salt thereof.

US Pat. No. 9,060,284

METHOD AND DEVICE FOR ESTIMATING AP POSITION USING A MAP OF A WIRELESS LAN RADIO ENVIRONMENT

SK TELECOM CO., LTD., Se...

1. An apparatus for estimating an AP position by using a weighted average of signal strengths, comprising:
a filtering unit for generating a filtering radiowave map with data selected exclusively for having a common MAC address from
collected wireless LAN radiowave environment maps;

a grid cell division unit for generating a grid radiowave map with arbitrary grid cells from dividing the filtering radiowave
map;

a representative coordinate mapping unit for calculating a centroid of each of the grid cells constituting the grid radiowave
map, and mapping said each centroid as a representative coordinate to said each grid cell;

a representative signal strength mapping unit for calculating representative signal strengths based on data existing in said
each grid cell, and mapping each representative signal strength to said each grid cell;

a weight value sorting unit for sorting out a weight value corresponding to a range covering a received signal strength of
the representative signal strength; and

a position estimation unit for estimating positional information of access points (APs) having a common MAC address based
on one or more of the representative coordinate, the representative signal strength, and the weight value.

US Pat. No. 9,059,431

ORGANIC LIGHT EMITTING DISPLAY

LG Display Co., Ltd., Se...

1. An organic light emitting display comprising:
a first electrode and a second electrode facing each other on a substrate;
a red light emitting layer, a green light emitting layer and a blue light emitting layer formed between the first electrode
and the second electrode;

a hole-transporting layer between the first electrode and each of the red light emitting layer, the green light emitting layer
and the blue light emitting layer; and

an electron-transporting layer between the second electrode and each of the red light emitting layer, the green light emitting
layer and the blue light emitting layer,

wherein a gap between a photo-luminescence (PL) peak maximum of a red host of the red light emitting layer and a photo-luminescence
(PL) peak maximum of the electron-transporting layer contacting the red light emitting layer is within ±25 nm.

US Pat. No. 9,059,425

MULTILAYER ELECTRONIC DEVICE HAVING ONE OR MORE BARRIER STACKS

SAINT-GOBAIN GLASS FRANCE...

1. A multilayer electronic device, comprising:
an organic polymer layer;
an electrode positioned against the organic polymer layer, the electrode being constituted by a transparent stack of thin
layers comprising an alternation of n thin metallic layers and of (n+1) antireflection coatings, with n?1, where each thin
metallic layer is placed between two antireflection coatings, wherein the electrode comprises:

a first barrier stack, which is a barrier to moisture and to gases, in the end antireflection coating which is placed under
the n thin metallic layers in the direction of deposition of the constituent stack of the electrode, the first barrier stack
comprising at least four layers having alternately lower and higher densities,

and/or
a second barrier stack, which is a barrier to moisture and to gases, in the end antireflection coating which is placed on
top of the n thin metallic layers in the direction of deposition of the constituent stack of the electrode, the second barrier
stack comprising at least three layers having alternately lower and higher densities.

US Pat. No. 9,058,311

USER TIMEFRAME SELECTION FOR DELIVERY OF MEDIA RESOURCES

Sprint Communications Com...

1. A method of operating a user communication device having a graphical display, the method comprising:
displaying a Hypertext Transfer Protocol (HTTP) link associated with a media resource and responsively receiving a user selection
of the displayed HTTP link;

displaying a delivery time schedule menu for the media resource responsive to the user selection of the displayed HTTP link;
responsive to the displayed delivery time schedule menu, receiving a delivery time schedule instruction on the user communication
device indicating a user-acceptable time frame for receipt of the media resource in the user communication device;

generating and transferring an HTTP request packet with an HTTP header that indicates the user-acceptable time frame for receipt
of the media resource into the user communication device; and

receiving the media resource associated with the HTTP link according to the delivery time schedule instruction and responsive
to the HTTP header in the transferred HTTP request packet.

US Pat. No. 9,060,046

METHOD AND APPARATUS FOR TRANSFERRING MEDIA DATA BETWEEN DEVICES

Google Technology Holding...

1. A method comprising:
receiving media data transfer protocol data at a device;
splitting the media data transfer protocol data in the device into media data transfer protocol control data and a media data
transfer protocol bulk data;

transferring the media data transfer protocol control data over a first channel in the device to a media data transfer protocol
data synchronization application in the device; and

transferring the media data transfer protocol bulk data over a second channel in the device substantially directly to memory
substantially simultaneously with transferring the media data transfer protocol control data over the first channel.

US Pat. No. 9,058,834

POWER ARCHITECTURE FOR LOW POWER MODES IN STORAGE DEVICES

Western Digital Technolog...

1. A power control device comprising:
an always-on-domain (AOD) comprising:
control logic circuitry for controlling power from a power source;
a plurality of load switches; and
a plurality of bias current generators; and
a plurality of functional blocks,
wherein the control logic circuitry is configured to:
receive a signal to go into a lower power state;
initiate a shut-down sequence of the load switches and the bias current generators of the AOD, to disable circuitry outside
of the AOD, including the functional blocks of the power control device and loads controlled by the power control device;
and

operate in a low power state to detect a wake-up signal.

US Pat. No. 9,060,323

AGGREGATING MULTIPLE WIRELESS CHANNELS

ARUBA NETWORKS, INC., Su...

1. A computer implemented method, comprising:
receiving, at a wired network connection of a wireless network device, a network data packet, wherein the network data packet
identifies a destination MAC address (media access control address) and a source MAC address, and wherein the wireless network
device is associated with a wireless link;

determining a type of network data packet, wherein types of network data packets include unicast data packets and multicast
data packets;

applying a hash function on a MAC address of the network data packet, wherein the hash function is applied on the destination
MAC address when the network data packet is a unicast data packet, and wherein the hash function is applied on the source
MAC address when the network data packet is a multicast data packet;

transmitting the network data packet over the wireless link, wherein the unicast data packet is transmitted when the hash
function identifies the destination MAC address as native to the wireless link, and wherein the multicast data packet is transmitted
when the hash function identifies the source MAC address as native to the wireless link; and

discarding the network data packet, wherein the unicast data packet is discarded when the hash function identifies the destination
MAC address as non-native to the wireless link, and wherein the multicast data packet is discarded when the hash function
identifies the source MAC address as non-native to the wireless link.

US Pat. No. 9,060,190

ITERATIVELY LOCATING A POSITION CORRESPONDING TO A DESIRED SEEK TIME

Microsoft Technology Lice...

1. A method comprising:
receiving a request to seek to a desired time within a file, the desired time corresponding to a desired position within the
file; and

iteratively estimating the desired position within the file until a time between an estimated time and the desired time is
less than a tolerance zone or until an iteration threshold is reached, wherein the iteratively estimating the desired position
comprises:

calculating a head bitrate for a portion of the file between a currently estimated position and a first previously estimated
position, where the first previously estimated position is closest to the currently estimated position and closer to a beginning
of the file than the currently estimated position; and

calculating a tail bitrate for a portion of the file between a currently estimated position and a second previously estimated
position, where the second previously estimated position is closest to the currently estimated position and closer to an end
of the file than the currently estimated position.

US Pat. No. 9,060,149

IMAGE FORMING APPARATUS

KONICA MINOLTA, INC., (J...

1. An image forming apparatus, comprising:
an image forming unit which forms a toner image on an image carrier and transfers the formed toner image on a paper;
a color conversion process unit to carry out a color conversion process to convert inputted image data to image data of an
output color in the image forming unit; and

a control unit to make the color conversion process unit carry out a preparatory color conversion process to the inputted
image data, to determine whether a pixel value of each pixel constituting image data after the preparatory color conversion
process is greater than or equal to a threshold which is predetermined or not, to detect the number of pixels in which the
pixel value is greater than or equal to the threshold, to select a color conversion process condition for the color conversion
process unit based on the detected number of pixels in which the pixel value is greater than or equal to the threshold, and
to make the color conversion process unit carry out an actual color conversion process to the inputted image data according
to the selected color conversion process condition.

US Pat. No. 9,060,050

SYSTEM AND METHOD FOR DETERMINING AVAILABILITY STATUSES FOR USERS

RingCentral, Inc., Belmo...

1. A method comprising:
obtaining data identifying a plurality of availability status features for a user of a communication service provider system
and a respective weight for each of the availability status features, wherein the plurality of availability status features
includes an action pattern feature that identifies successive actions taken by the user with respect to a particular service
provided by the communication service provider system;

determining a respective current value of each of the availability status features, wherein determining a current value of
the action pattern feature comprises determining an availability status from the successive actions taken by the user with
respect to the particular service; and

determining an aggregate user availability status based at least in part on the current values of the availability status
features and on the weights for the availability status features.

US Pat. No. 9,057,831

OPTICAL WAVEGUIDE WITH LIGHT-EMITTING ELEMENT AND OPTICAL TOUCH PANEL WITH THE SAME

NITTO DENKO CORPORATION, ...

1. An optical waveguide with a light-emitting element comprising:
a light-emitting element; and
an optical waveguide including a core for guiding light emitted from the light-emitting element to generate a plurality of
light beams,

wherein the light-emitting element is one of a light-emitting diode and a semiconductor laser,
an end of a main path-side on the core is optically coupled to the light-emitting element,
the optical waveguide comprises: an under-cladding layer; and an over-cladding layer, the core comprises: a main path; and
a plurality of branched paths branched at a plurality of branched points from the main path,

the main path has a maximum width of 500 ?m to 10,000 ?m and a height of 30 ?m to 100 ?m,
the main path has two sides faced to each other, in which one side has a plurality of branched points and the other side does
not have any branched points,

the plurality of branched points are provided on a straight line substantially parallel to a light guiding direction of the
main path,

the width of the main path becomes narrower as the main path moves away from the light-emitting element,
an angle ? formed by the other side without a branched point and the light guiding direction of the main path is 0.3 to 1.7°.

US Pat. No. 9,056,320

CENTRIFUGE INCLUDING DEPRESSURIZATION UNIT AND COOLING UNIT THAT COOPERATE WITH EACH OTHER

HITACHI KOKI CO., LTD., ...

1. A centrifuge comprising:
a rotor holding a sample to be separated;
a rotor chamber in which the rotor is housed;
a cooling unit for cooling the rotor;
a driving unit for rotating the rotor;
a depressurization unit for depressurizing an inside of the rotor chamber;
a temperature sensor detecting a temperature of the rotor chamber or the rotor; and
a control unit for controlling the cooling unit, the driving unit and the depressurization unit, wherein the control unit
cools the inside of the rotor chamber without operating the depressurization unit until a predetermnined time elapses after
cooling by the cooling unit is started, operates the depressurization unit after the predetermined time has elapsed, and depressurizes
the inside of the rotor chamber in parallel with cooling by the cooling unit.

US Pat. No. 9,060,248

DYNAMIC PLACING AND UPDATING OF A GEOFENCE FOR A MOBILE BUSINESS

INTUIT INC., Mountain Vi...

1. A computer-implemented method for dynamically updating a geofence of a mobile device on a server, comprising:
establishing a first location and a first geofence for a mobile business device;
receiving a second location of the mobile business device different than the first location of the mobile business device;
generating an updated geofence for the mobile business device based on the second location of the mobile business device;
and

predicting an estimated time of arrival (ETA) of the mobile business device at a third location based at least on the second
location; and

notifying a set of one or more mobile client devices of the ETA of the mobile business device at the third location.

US Pat. No. 9,059,716

DIGITAL PVT COMPENSATION FOR DELAY CHAIN

Altera Corporation, San ...

1. A circuit for controlling delay in an input signal comprising:
a delay locked loop comprising a first plurality of first delay elements for producing a phase control signal, each first
delay element having a first delay that is controllable by the phase control signal;

a calibration circuit that determines a minimum number of second delay elements required to produce the first delay where
each second delay element produces a second delay that is less than the first delay; and

an output circuit that uses the minimum number to determine how many second delay elements to use to produce a desired delay
in the input signal.

US Pat. No. 9,059,378

LUMINOUS GLAZING UNIT

SAINT-GOBAIN GLASS FRANCE...

1. An illuminating glazing unit comprising:
a first glass substrate including a first side and a second side opposite said first side;
a light source arranged to illuminate an edge of the first glass substrate so that light emitted by the light source is guided
within a thickness of the first glass substrate; and

a fibrous structure arranged over said second side so that the light is extracted from the first side of the first glass substrate
by the fibrous structure, the fibrous structure comprising a plurality of fibers extending along different directions in the
fibrous structure.

US Pat. No. 9,057,273

SELF-TIGHTENING ROTOR

SZ DJI TECHNOLOGY CO., LT...

1. A multi-rotor self-propelled movable object, the movable object comprising:
(a) a first rotor assembly comprising:
a first hub coupled to a first plurality of blades and comprising a first fastening feature;
a first adapter coupled to the first hub and comprising a second fastening feature; and
a first drive shaft coupled to the first hub through the first adapter by a mating connection of the first and second fastening
features, wherein the first drive shaft is configured to cause rotation of the first hub in a first direction, and the mating
connection of the first and second fastening features is able to be tightened by the rotation in only the first direction,

wherein the first plurality of blades coupled to the first hub are configured to rotate therewith in the first direction to
generate a first propulsive force; and

(b) a second rotor assembly comprising:
a second hub coupled to a second plurality of blades and comprising a third fastening feature;
a second adapter coupled to the second hub and comprising a fourth fastening feature;
a second drive shaft coupled to the second hub through the second adapter by a mating connection of the third and fourth fastening
features, wherein the second drive shaft is configured to cause rotation of the second hub in a second direction that is opposite
to the first direction, and the mating connection of the third and fourth fastening features is able to be tightened by the
rotation in only the second direction,

wherein the second plurality of blades coupled to the second hub are configured to rotate therewith in the second direction
to generate a second propulsive force,

wherein the first fastening feature comprises a first aperture, a first pair of guides, and a first pair of stops, and wherein
the third fastening feature comprises a second aperture, a second pair of guides, and a second pair of stops,

wherein the second fastening feature comprises a first pair of protrusions, and wherein the fourth fastening feature comprises
a second pair of protrusions,

wherein the first propulsive force (1) includes a lift component that provides lift to the movable object, and (2) is imparted
via contact between the first hub and the first adapter; and wherein the second propulsive force (1) includes a lift component
that provides lift to the movable object, and (2) is imparted via contact between the second hub and the second adapter, and

wherein the rotation of the first hub in the first direction imparts a rotational force component that is transmitted from
the first drive shaft to the first hub via contact between the first pair of protrusions and the first pair of stops, and
wherein the rotation of the second hub in the second direction imparts a rotational force component that is transmitted from
the second drive shaft to the second hub via contact between the second pair of protrusions and the second pair of stops.

US Pat. No. 9,056,023

LIMB VOLUME ACCOMMODATION IN PEOPLE WITH LIMB AMPUTATION

UNIVERSITY OF WASHINGTON ...

1. A prosthetic sock for disposition over residual limb of a patient and insertion into a socket of a prosthesis associated
with the patient, the prosthetic sock comprising:
material shaped to fit over at least a portion of the residual limb of the patient and of a thickness adapted for inserting
the residual limb into the socket of the prosthesis while the sock is fitted over the residual limb;

a sock identification unit operable to identify at least one identifying characteristic of the prosthetic sock and communicate
the at least one identifying characteristic to a computing device separate from the prosthetic sock, the at least one identifying
characteristic being configured to distinguish the prosthetic sock from other prosthetic socks; and

a force sensing device operable to determine an amount of force applied to the force sensing device and communicate information
indicating the amount of force applied to the force sensing device to the computing device separate from the prosthetic sock,
and wherein the sock identification unit and the force sensing device are integrated into a single device;

wherein one or more of the sock identification unit and the force sensing device are provided at a predetermined location
on or in the material, the predetermined location being associated with the placement of an antenna located in the socket
of the prosthesis.

US Pat. No. 9,055,726

SOYBEAN CULTIVAR 32292803

Monsanto Technology LLC, ...

1. A plant of soybean cultivar 32292803, representative seed of said soybean cultivar having been deposited under ATCC Accession
No. PTA-121428.

US Pat. No. 9,060,363

METHOD, SYSTEM AND DEVICE FOR ADAPTIVE MODULATION AND CODING

CHINA ACADEMY OF TELECOMM...

1. An adaptive modulation and coding method, comprising:
selecting by a base station NodeB, special subframes for transmitting downlink data to user equipment UE, Physical Resource
Blocks PRBs in the special subframes being punctured PRBs;

scheduling and transmitting by the NodeB;
scheduling the downlink data based on a determined Transport Block Size TBS;
transmitting a first number representing quantity of the used punctured PRB pairs, and a Modulation and Coding Scheme MCS
sequence number to the UE;

converting by the UE the first number of the punctured PRB pairs to a second number representing quantity of normal PRB pairs;
determining by the UE, a modulation scheme and a TBS sequence number based on the MCS sequence number; and
determining by the UE, the TBS of the downlink data based on the second number of the normal PRB pairs and the TBS sequence
number.

US Pat. No. 9,058,851

INFORMATION-STORAGE DEVICE INCLUDING AN OXYGEN ABSORBING DEVICE

Western Digital Technolog...

1. An information-storage device, comprising:
an information-storage medium;
a transducer operable to write information in, and operable to read information from, said information-storage medium;
a sealed enclosure enclosing said information-storage medium and said transducer in an interior space of said enclosure containing
an atmosphere comprising a gas mixture including a substantially inert gas and oxygen gas having a molar concentration between
about 0% and about 10%, said enclosure including:

a base;
a cover; and,
a seal that joins said cover to said base; and,
an oxygen absorbing device operable to remove a substantial portion of said oxygen gas from said atmosphere, including an
oxygen absorbent material comprising oxygen-deficient cerium oxide, CeO2-x, where 0
US Pat. No. 9,059,405

FERROELECTRIC THIN FILM-FORMING SOL-GEL SOLUTION

MITSUBISHI MATERIALS CORP...

1. A ferroelectric thin film-forming sol-gel solution comprising:
a PZT-based raw material solution;
a viscosity-adjusting macromolecular compound including polyvinylpyrrolidone; and
an organic dopant including a formamide-based solvent,
wherein the PZT-based raw material solution is included at 17 mass % or more in terms of an oxide, a molar ratio of the polyvinylpyrrolidone
to the PZT-based raw material solution is PZT-based raw material solution:polyvinylpyrrolidone =1:0.1 to 0.5 in terms of a
monomer, and the formamide-based solvent is included at 3 mass % to 13 mass % of the sol-gel solution.

US Pat. No. 9,060,228

ACCESSORY DETECTION CIRCUIT WITH IMPROVED FUNCTIONALITY

Fairchild Semiconductor C...

1. An apparatus comprising:
an audio jack receptacle including a first connector and a second connector configured for electrical communication with first
conducting terminal and a last conducting terminal, respectively, of an audio jack plug, wherein the first conducting terminal
is a conducting terminal inserted first into the audio jack receptacle and the last conducting terminal is a conducting terminal
inserted last into the audio jack receptacle;

a detection circuit configured to:
apply a first value of current to the first connector; and
apply a second value of current to the second connector; and
a logic circuit configured to generate a signal that the audio jack plug is fully inserted when only electrical ground is
detected at the first connector and a logic level is detected at the second connector; wherein the audio jack plug is fully
inserted when the last conducting terminal of the audio jack plug is inserted into the audio jack receptacle.

US Pat. No. 9,060,071

BLUETOOTH LOCATION IDENTIFIER AND GENERAL INFORMATION BROADCASTER

Oracle America, Inc., Re...

1. A method comprising:
receiving a Bluetooth signal at a wireless device, the signal including a broadcaster request to convey a set of desired actions
to the wireless device and an authority rating, the authority rating comprising information included in the signal that indicates
one of a plurality of categories and one of a plurality of subcategories indicating a rating of an authority associated with
the broadcaster request;

for each action in the set of desired actions conveyed by the broadcaster request, determining at the wireless device whether
the action is allowable on the wireless device based on a comparison of both user preferences stored in the wireless device
and the authority rating, whichever has priority, wherein at least one possible user preference has priority over at least
one possible authority rating, and wherein at least one other possible authority rating has priority over at least one other
possible user preference; and

performing each of the actions which has been determined to be allowable on the wireless device.

US Pat. No. 9,059,432

ORGANIC LIGHT EMITTING DISPLAY DEVICE AND METHOD FOR FABRICATING THE SAME

LG Display Co., Ltd., Se...

1. An organic light emitting display device comprising:
a substrate
a light shield layer formed on the substrate;
a buffer layer formed on a surface of the substrate so as to cover the light shield layer;
an oxide semiconductor layer formed on the buffer layer, the oxide semiconductor layer having a source area, a drain area,
and a channel area between the source area and the drain area;

a first electrode formed on the buffer layer;
a reflective layer formed between the substrate and the buffer layer so as to overlap with the first electrode;
a gate insulation film formed on the channel area of the oxide semiconductor layer;
a gate electrode formed on the gate insulation film;
an interlayer insulation film covering the gate insulation film and the gate electrode;
a source electrode connected to the source area of the oxide semiconductor layer;
a drain electrode connected to the drain area of the oxide semiconductor layer and further connected to the first electrode;
and

a protective film formed to cover the source electrode and the drain electrode and exposing a region of the first electrode.

US Pat. No. 9,059,429

MANUFACTURING METHOD FOR ORGANIC ELECTROLUMINESCENT PANEL AND ORGANIC ELECTROLUMINESCENT PANEL MANUFACTURED USING THE SAME

KONICA MINOLTA HOLDINGS, ...

1. A manufacturing method for an organic electroluminescent panel, the organic electroluminescent panel comprising an organic
electroluminescent element including at least a first electrode, an organic functional layer containing a light-emitting layer,
and a second electrode on a substrate; and a sealing substrate having a heat-curable adhesive layer formed thereon, the organic
electroluminescent element and the sealing substrate being bonded and arranged via the heat-curable adhesive layer, wherein
the manufacturing method comprises, in this order:
preheating the heat-curable adhesive layer;
bonding the preheated heat-curable adhesive layer and the organic electroluminescent element; and
curing and heating the preheated heat-curable adhesive layer;
wherein, in the preheating, a curing degree of the heat-curable adhesive layer after preheating is at most 50%, and the preheating
and the bonding are performed in a same space and are continuously performed.

US Pat. No. 9,058,870

HASH FUNCTIONS USED TO TRACK VARIANCE PARAMETERS OF RESISTANCE-BASED MEMORY ELEMENTS

Seagate Technology LLC, ...

1. An apparatus comprising:
a controller coupled to a plurality of resistance-based memory elements, the controller configured to perform:
tracking parameter data indicative of resistance variance of the memory elements, the resistance variance affecting values
of data stored in the memory elements;

performing a hash function for each memory element, the hash function returning a reference to one of a plurality of counter
elements;

modifying a value of each counter element in response to the tracked parameter data of the associated memory element; and
adjusting read operations affecting the memory elements based on the values for the associated counter elements.

US Pat. No. 9,060,279

SYSTEM AND METHOD FOR COMPUTING COVERAGE SET AND RESOURCE ALLOCATIONS IN WIRELESS NETWORKS

ARUBA NETWORKS, INC., Su...

1. A method comprising:
determining, by a network device, one or more radio frequency subdomains based, at least in part, on path loss information
associated with a plurality of access nodes in a wireless network;

determining a coverage set for at least a first radio frequency subdomain of the one or more radio frequency subdomains based,
at least in part, on path loss information associated with a first subset of access nodes of the plurality of access nodes;

selecting one of a capacity mode and a coverage mode as an operating mode of the first radio frequency subdomain in response
to a measure of network activity satisfying a predetermined condition; and

performing radio resource management in the first radio frequency subdomain based on the selected operating mode.

US Pat. No. 9,059,210

ENHANCED STRESS MEMORIZATION TECHNIQUE FOR METAL GATE TRANSISTORS

Semiconductor Manufacturi...

1. A method of manufacturing a semiconductor device, comprising:
forming a dummy gate structure on a semiconductor substrate, the dummy gate structure including a sacrificial gate electrode
layer over a sacrificial gate dielectric layer;

forming sidewall spacers on both sides of the dummy gate structure;
performing a deep pre-amorphization implant;
performing an ion implantation to form heavily doped source/drain regions in the semiconductor substrate;
removing the sidewall spacers;
after removing the sidewall spacers, forming a stress material layer over the dummy gate structure;
performing an annealing process;
after the annealing process, removing the stress material layer;
forming an interlayer dielectric layer surrounding the dummy gate structure;
removing the dummy gate structure to form a groove in the interlayer dielectric layer;
forming a high-k dielectric layer and a metal gate structure in the groove;
forming contact holes that expose at least part of the heavily doped source/drain regions; and
forming a self-aligned silicide over exposed portions of the heavily doped source/drain regions.

US Pat. No. 9,058,921

ELECTRICAL CABLE WITH OPTICAL FIBER

Tyco Electronics Corporat...

1. An electrical cable comprising:
an outer cable jacket extending a length and having an internal passageway that extends along the length of the outer cable
jacket;

twisted pairs of insulated electrical conductors extending within the internal passageway along the length of the outer cable
jacket, each twisted pair comprising two insulated electrical conductors twisted together in a helical manner; and

at least two optical fibers extending within the internal passageway along the length of the outer cable jacket, wherein the
optical fibers are independently held within the internal passageway of the outer cable jacket relative to each other; and

an inner cable jacket extending within the internal passageway of the outer cable jacket, the inner cable jacket surrounding
the twisted pairs, the optical fibers extending between the inner and outer jackets.

US Pat. No. 9,056,152

MEDICAL DEVICE WITH CRYSTALLINE DRUG COATING

Boston Scientific Scimed,...

1. A method of forming a coating comprising a drug on at least a portion of an outer surface of a medical device, the drug
being a member of the group consisting of everolimus, tacrolimus, sirolimus, zotarolimus, biolimus, and rapamycin, the method
comprising the steps of:
providing a medical device;
applying a solution of the drug to said portion of the outer surface to form a coating of amorphous drug;
providing crystals of the drug;
grinding the crystals of the drug to form microcrystals of the drug having a maximum size of about 10 ?m or less;
applying the microcrystals of the drug to at least said portion of the outer surface of the device; and
vapor annealing the coating of amorphous drug with a solvent vapor to form crystalline drug; the solvent selected from the
group consisting of alcohols, acetonitrile, ethers, ketones solvents, halogenated solvents, aliphatic hydrocarbons, aromatic
hydrocarbons, and ester solvents,

wherein the microcrystals of the drug are applied before or after applying the drug solution, but prior to any vapor annealing
of the coating of amorphous coating.

US Pat. No. 9,056,071

COMPOUNDS AND METHODS FOR PREVENTING OR TREATING A VIRAL INFECTION

INSTITUT NATIONAL DE LA S...

1. A method for the treatment of an animal or human infected by a human immunodeficiency virus (HIV), comprising administration
to an animal or human in need thereof a Q-VD-Oph compound selected from the group consisting of N-(2-quinolyl)valyl-O-methyl-aspartyl-(2,6-difluorophenoxy)methyl
ketone and N-(2-quinolyl)valyl-aspartyl-(2,6-difluorophenoxy)methyl ketone.

US Pat. No. 9,059,667

CLASS D AUDIO AMPLIFIER WITH NOISE SUPPRESSION AND THE METHOD THEREOF

Chengdu Monolithic Power ...

1. A class D audio amplifier with noise suppression, comprising:
an audio control circuit having a first input terminal configured to receive an input signal, a second input terminal configured
to receive a reference signal, and a switching terminal configured to provide a switching signal based on the input signal
and the reference signal;

an input capacitor coupled between the input signal and the first input terminal of the audio control circuit;
an inductor having a first terminal and a second terminal, the first terminal coupled to the switching terminal of the audio
control circuit;

an output capacitor having a first terminal coupled to the second terminal of the inductor, and a second terminal coupled
to a load; and

a noise suppression circuit having a first terminal coupled to the first input terminal of the audio control circuit, and
a second terminal coupled to the switching terminal of the audio control circuit, wherein the noise suppression circuit charges
the input capacitor and the output capacitor to reach a preset value;

wherein the noise suppression circuit charges the input capacitor and the output capacitor with a current that is initially
increasing, then constant, and then decreasing in magnitude.

US Pat. No. 9,057,813

OPTICAL FIBER

FUJIKURA LTD., Tokyo (JP...

1. An optical fiber, comprising:
a core provided at a central portion;
an internal cladding coat provided around the core, having a refractive index less than a refractive index of the core;
a trench coating provided at a periphery of the internal cladding coat and constituted of two or more layers having different
refractive indices; and

an outermost cladding coat provided at a periphery of the trench coating, wherein
a layer having the highest refractive index in the trench coating configures an outermost layer of the trench coating,
?core>?ic>?tmax>?tmin, ?0.15%??tmax>?tmin??0.7%, and
0.45?(rtmax?rin)/(rout?rin)?0.9 are satisfied where a relative refractive index difference of the core is represented as ?core, a relative refractive index difference of the internal cladding coat is represented as ?ic, a relative refractive index difference of a layer having the highest refractive index in the trench coating is represented
as ?tmax, a relative refractive index difference of a layer having the lowest refractive index in the trench coating is represented
as ?tmin, a radius of an internal edge of the trench coating is represented as rin, a radius of an external edge of the trench coating is represented as rout, and a radius of an internal edge of a layer having the highest refractive index in the trench coating is represented as
rtmax and where the relative refractive index differences are based on a refractive index of the outermost cladding coat.

US Pat. No. 9,057,684

GAMMA RAY IMAGING SYSTEMS AND METHODS

The Arizona Board Of Rege...

1. A system for imaging at least one gamma source, comprising:
a pixelated Compton scattering layer for producing scattered gamma photons from Compton scattering of gamma photons emitted
by the gamma source; and

a non-pixelated full-energy detector for detecting at least a portion of the scattered gamma photons geometrically encoded
by a coded aperture located at a distance from the pixelated Compton scattering layer and positioned between the pixelated
Compton scattering layer and the full-energy detector.

US Pat. No. 9,059,522

WEDGE CONNECTOR ASSEMBLIES AND METHODS FOR CONNECTING ELECTRICAL CONDUCTORS USING SAME

Tyco Electronics Corporat...

1. A wedge connector assembly for forming an electrical connection with first and second electrical conductors, the wedge
connector assembly comprising:
a coupling portion;
first and second resilient spring sleeve portions located on the coupling portion, wherein:
the first spring sleeve portion defines a first sleeve cavity and a first conductor channel configured to receive the first
conductor;

the second spring sleeve portion defines a second sleeve cavity and a second conductor channel configured to receive the second
conductor; and

the first sleeve cavity tapers in a first direction away from the second spring sleeve portion and the second sleeve cavity
tapers in a second direction away from the first spring sleeve portion;

a first wedge member configured to be forcibly driven into the first sleeve cavity in the first direction to thereby capture
the first conductor in the first conductor channel between the first spring sleeve portion and the first wedge member; and

a second wedge member configured to be forcibly driven into the second sleeve cavity in the second direction to thereby capture
the second conductor in the second conductor channel between the second spring sleeve portion and the second wedge member.

US Pat. No. 9,060,028

METHOD AND APPARATUS FOR REJECTING UNTRUSTED NETWORK

Sprint Spectrum L.P., Ov...

1. A method of accessing a communication system comprising:
transmitting, by a communication device to a node of the communication system through a communication link between the communication
device and the node, a request to negotiate basic radio resource control (RRC) capabilities for communicating with the node;

receiving, at the communication device from the node, a response message to the request to negotiate basic radio resource
control capabilities, wherein the response message comprises a Non-access stratum (NAS) layer security mode command or an
RRC attach accept message;

determining, at the communication device, that the communication system does not support authentication based on the response
message, wherein the determination is made prior to receiving an authentication message; and

transmitting, by the communication device to the node, a request to disconnect the communication link, when the response message
indicates that the node does not support authentication.

US Pat. No. 9,057,768

LOCAL COIL FOR A MAGNETIC RESONANCE DEVICE

1. A local coil for a magnetic resonance device, the local coil comprising:
a double resonance conductor loop arrangement comprising at least one conductor loop;
a converter apparatus configured for converting operating energy received at a first resonance frequency into an operating
voltage; and

an electronics arrangement operated with the operating voltage, the electronics arrangement configured for processing magnetic
resonance signals received at a second resonance frequency,

wherein the at least one conductor loop includes at least one shorting capacitor, an additional capacitor and a frequency-dependent
additional impedance being connected in parallel with the at least one shorting capacitor, so as to generate a double resonance,
the frequency-dependent additional impedance having a barrier effect for one resonance frequency of the first resonance frequency
and the second resonance frequency.

US Pat. No. 9,057,761

SENSING SUPPLY VOLTAGE SWINGS WITHIN AN INTEGRATED CIRCUIT

ARM Limited, Cambridge (...

1. An integrated circuit comprising a plurality of sensors configured to sense variations in supply voltage levels at points
within said integrated circuit, said plurality of sensors being distributed across said integrated circuit;
said plurality of sensors comprising transistor devices such that local process variations in said transistor devices within
said sensors are such that a sensing result will have a random voltage offset that has a predetermined probability of lying
within a pre-defined voltage offset range; wherein

said integrated circuit is configured to transmit results from multiple ones of said plurality of sensors to processing circuitry.

US Pat. No. 9,060,395

LIGHT EMITTING DIODE DRIVING SYSTEM

SEMISILICON TECHNOLOGY CO...

1. A light emitting diode driving system applied to a rectifier and a plurality of light emitting diodes, the light emitting
diode driving system comprising:
a driving power and synchronous signal generation apparatus electrically connected to the rectifier;
a transmission line electrically connected to the driving power and synchronous signal generation apparatus; and
a plurality of light emitting diode driving apparatuses electrically connected to the transmission line, the driving power
and synchronous signal generation apparatus and the light emitting diodes,

wherein the light emitting diode driving apparatus comprises:
a power positive terminal electrically connected to the driving power and synchronous signal generation apparatus;
a voltage regulator electrically connected to the power positive terminal;
a power negative terminal electrically connected to the voltage regulator;
a signal detector electrically connected to the power positive terminal;
a synchronous control logic circuit electrically connected to the voltage regulator, the power negative terminal and the signal
detector; and

a light changing control circuit electrically connected to the voltage regulator, the power negative terminal and the synchronous
control logic circuit,

wherein the rectifier rectifies an alternating current power to obtain a direct current power; the rectifier sends the direct
current power to the driving power and synchronous signal generation apparatus; the driving power and synchronous signal generation
apparatus generates a driving power; the driving power and synchronous signal generation apparatus sends the driving power
through the transmission line to the light emitting diode driving apparatuses to drive the light emitting diodes;

wherein the driving power and synchronous signal generation apparatus generates a synchronous signal regularly according to
the direct current power; the driving power and synchronous signal generation apparatus sends the synchronous signal through
the transmission line to the light emitting diode driving apparatuses; the light emitting diode driving apparatuses drive
the light emitting diodes synchronously according to the synchronous signals.

US Pat. No. 9,059,392

PIEZOELECTRIC ACTUATOR OF A MULTILAYER DESIGN AND METHOD FOR FASTENING AN OUTER ELECTRODE IN A PIEZOELECTRIC ACTUATOR

EPCOS AG, Munich (DE)

1. A piezoelectric actuator comprising:
a stack of piezoelectric layers and electrode layers arranged between the piezoelectric layers;
an outer electrode that includes an upper side that faces away from the stack and having openings extending from the upper
side through the outer electrode to a lower side of the outer electrode opposite the upper side, wherein the lower side of
the outer electrode is bonded to an outer side of the stack of piezoelectric layers;

a bonding layer formed over the upper side of the outer electrode and extending through the openings to the lower side of
the outer electrode, the bonding layer configured to fasten the outer electrode to the outer side of the stack; and

a lead electrically connected to the outer electrode;
wherein the bonding layer extends contiguously from past a first edge of the outer electrode over the bonding layer and past
a second edge of the outer electrode opposite the first edge;

wherein the bonding layer extends past a third edge of the outer electrode at a first end of the outer electrode, wherein
the third edge is adjacent to the first edge and the second edge;

wherein a second end of the outer electrode opposite the first end extends past the bonding layer such a first portion of
the outer electrode is free of the bonding layer; and

wherein the lead is fastened to the upper side of the first portion of the outer electrode.

US Pat. No. 9,057,518

REHEAT BURNER

ALSTOM TECHNOLOGY LTD., ...

1. A reheat apparatus comprising:
a reheat burner comprising:
a lance;
a channel with an entry for a gas flow which flows in a downstream direction, the lance protruding into the channel, wherein
the lance is configured to inject a fuel over an injection plane perpendicular to a channel longitudinal axis;

wherein the channel and the lance define a vortex generation zone upstream of the injection plane and a mixing zone downstream
of the injection plane; and

wherein vortex generators project from each of the channel walls;
the mixing zone comprising:
a contracting area having a contracting cross section in the downstream direction; and
a diffusion area having an expanding cross section in the downstream direction,
a high speed area having a constant cross section, the constant cross section extending between the contracting area and the
diffusion area,

the high speed region being downstream of the contracting area and being upstream of the diffusion area.

US Pat. No. 9,059,861

SYSTEM AND METHOD FOR EXTENDING BATTERY LIFE

ARUBA NETWORKS, INC., Su...

1. A first device comprising:
one or more hardware processors;
the first device being configured for:
receiving a multicast message destined for a wireless receiving device;
determining whether the first device is operating in a power-saving mode;
responsive to determining that the first device is operating in a power-saving mode, converting the multicast message into
a unicast message for transmission by the first device to the wireless receiving device;

transmitting the unicast message to the wireless receiving device.

US Pat. No. 9,056,163

SAFETY DRUG DELIVERY SYSTEM

Becton, Dickinson and Com...

1. A drug delivery system comprising:
an actuator assembly including a distal end, a proximal end, a projection including one or more openings extending the length
of the projection, the projection attached at the distal end of the actuator assembly and extending in a proximal direction
from the distal end of the actuator assembly, a hub including a base having a plurality of inlets, the plurality of inlets
being in fluid communication with the one or more openings of the projection, said hub attached to the distal end of the actuator
assembly and disposed in a coaxial relationship with the projection, and a filter including an inlet that is integrally molded
to the actuator assembly and an outlet in fluid communication with the inlet and the opening, the filter comprises a housing
attached to the actuator assembly in a vertical alignment with respect to the actuator assembly; and

a conduit attached to the outlet of the filter for attachment of the drug delivery system to a delivery site.

US Pat. No. 9,060,334

WIRELESS COMMUNICATION DEVICE AND POWER SAVING METHOD THEREOF

MStar Semiconductor, Inc....

1. A method for reducing power consumption of a wireless communication device, employed in connection with a plurality of
base stations (BSs) and the wireless communication device, which selectively operates in an operating status and a sleep status,
the method comprising:
prompting the wireless communication device to enter the operating status; and
performing a base station measurement before the wireless communication device receives a paging message,
wherein the base station measurement is performed in a same frame in which the wireless communication device enters the operating
status and no paging message is received in the same frame, and

wherein an operation to prepare for receiving the paging message is performed only after the base station measurement is complete.

US Pat. No. 9,060,331

HOME VIRTUAL LOCAL AREA NETWORK IDENTIFICATION FOR ROAMING MOBILE CLIENTS

ARUBA NETWORKS, INC., Su...

1. A computer implemented method, comprising:
determining, by a network device, that a mobile client has roamed from a home network to a foreign network, wherein the home
network is associated with a home agent for the mobile client, wherein the foreign network is associated with a foreign agent
for the mobile client, and wherein the network device serves as the home agent;

establishing a tunnel associated with a data connection between the home agent and the foreign agent, wherein the tunnel corresponds
to a virtual local area network (VLAN) used for transmitting packets to or from the mobile client, and wherein the tunnel
has a tunnel identifier and the VLAN has a VLAN identifier;

maintaining a map between the mobile client and the tunnel, wherein the map is maintained in a bridge table that includes
the VLAN identifier, the tunnel identifier, and a Media Access Control (MAC) address corresponding to the mobile client;

receiving a packet;
using the map to associate the tunnel with the packet; and
forwarding the packet using the map.

US Pat. No. 9,060,275

INTERFACE FOR SYNCHRONIZING AUTOMATED REPLIES BETWEEN DIFFERENT MESSAGING SYSTEMS

Cellco Partnership, Bask...

1. A method, comprising:
registering, at a voicemail proxy server, user account information and an authentication key for a first messaging service
associated with a mobile device of a user and a second messaging service associated with a client of the second messaging
service, wherein:

the first messaging service is a voicemail service provided by an operator of the mobile communication network associated
with the user's mobile device;

the second messaging service is an electronic mail service associated with a third-party service provider;
the client is an electronic mail client associated with the electronic mail service of the third-party service provider;
in response to successfully registering the user account information and the authentication key for the first and second messaging
services, receiving at the voicemail proxy server, an automated reply request message requesting access to an automated reply
function of the first messaging service from the client of the second messaging service, the automated reply request message
including authentication information for the first and second messaging services and further specifying configuration information
for the automated reply function of the first messaging service;

after receiving the automated reply request message, determining at the voicemail proxy server, whether the client is authorized
to access the automated reply function of the first messaging service based on a comparison of the authentication information
in the automated reply request message received from the client with the authentication key registered for the mobile device;

when the client is determined to be authorized, determining at the voicemail proxy server, whether a voicemail system server
of the first messaging service associated with the user's mobile device is known based on cached internet protocol address
information available at the voicemail proxy server;

upon determining that the voicemail system server is unknown, sending from the voicemail proxy server to a registration server
system in the mobile communication network, a network address request for a location of the voicemail system server;

in response to sending the network address request to the registration server system, receiving at the voicemail proxy server,
a first internet protocol address associated with the voicemail system server and caching the first internet protocol address
of the voicemail system server;

in response to receiving the first internet protocol address, subscribing at the voicemail proxy server, to the registration
server system to receive updates to the cached first internet protocol address of the voicemail system server; and

in response to receiving the first internet protocol address, sending from the voicemail proxy server, a voicemail service
request to the voicemail system server of the first messaging service using the cached first internet protocol address so
as to allow the client to access the automated reply function of the first messaging service in accordance with the configuration
information specified in the automated reply request message from the client.

US Pat. No. 9,059,953

MESSAGE PREVIEW CONTROL

RingCentral, Inc., Belmo...

1. A method, comprising:
receiving, by a processing device, a message;
displaying, by the processing device, an indicator of the message;
receiving, by the processing device, an input selecting the indicator of the message;
extracting, by the processing device, components from the message; and
displaying, by the processing device, the components from the message as preview information in a preview window.

US Pat. No. 9,056,290

KNEADING SYSTEM WITH CLOSED-TYPE RUBBER KNEADER

The Yokohama Rubber Co., ...

1. A kneading system with a closed-type rubber kneader, comprising:
a closed-type rubber kneader that kneads kneading materials that include raw rubber and carbon black;
a rotation meter that measures the rate of rotation of a rotor of the kneader;
a power meter that measures the instantaneous power required to drive the rotation of the rotor; and
a calculation device to which the measurement data of the rotation meter and the power meter are input, based on the input
measurement data, data on the outer diameter of the rotor, data on the clearance between the position of the outer diameter
of the rotor and the inner wall face of a chamber that contains the rotor, the calculation device calculating the total amount
of shear by integrating the shear velocity applied to the kneading materials by the rotor over the kneading time, calculating
a unit work by dividing the integrated power obtained by integrating the instantaneous power over the kneading time by the
mass of the kneading materials, and based on the total amount of shear and the unit work, calculating an evaluation index
that evaluates the kneading efficiency of the kneader.

US Pat. No. 9,060,079

IMAGE FORMING APPARATUS

KONICA MINOLTA, INC., (J...

1. An image forming apparatus that forms an image on a sheet, comprising:
an image forming section configured to form an image;
a read sensor that reads the image formed on a sheet; a detection section configured to detect detachment and attachment of
a component or a unit constituting the image forming apparatus;

a storage section configured to store read data read by the read sensor before the detection section detects detachment and
attachment of the component or unit, read data read by the read sensor after the detection section detects detachment and
attachment of the component or unit, and original image data read by the read sensor that is used to generate read data for
times before and after the detection section detects detachment and attachment of the component or unit;

a determination section configured to determine whether or not quality of an image, which is formed on the sheet after detachment
and attachment of the component or unit, has been improved, using the read data before the detection section detects detachment
and attachment of the component or unit and the read data after the detection section detects detachment and attachment of
the component or unit, the both read data being stored in the storage section; and

an output section configured to output a determination result of the determination section,
wherein the determination section compares a difference between the read data before detachment and attachment of the component
or unit and the original image data of the read data with a difference between the read data after detachment and attachment
of the component or unit and the original image data of the read data, and

the determination section determines that quality of an image, which is formed on the sheet after detachment and attachment
of the component or unit, has been improved, when the difference after detachment and attachment of the component or unit
is smaller than the difference before detachment and attachment.

US Pat. No. 9,056,131

INDOCYANINE COMPOUND, SYNTHESIS METHOD AND PURIFICATION METHOD THEREOF, DIAGNOSTIC COMPOSITION USING THE INDOCYANINE COMPOUND, AND DEVICE FOR MEASURING BIOKINETICS AND DEVICE FOR VISUALIZING CIRCULATION USING THE DIAGNOSTIC COMPOS

NATIONAL UNIVERSITY CORPO...

1. A cyclodextrin-bonded indocyanine compound represented by formula (5):

wherein:
m, n, p and q are an integer of 2 or more and 6 or less;
r is an integer of 5 or more and 7 or less;
s is an integer of 0 or more and 4 or less; and
R is a hydrogen atom, an alkyl group, an aryl group, a halogen atom, an alkoxy group, an amino group, a carboxyl group, a
formyl group, a sulfonyl group, a sulfonic acid group, an alkyloxycarbonyl group, an aryloxycarbonyl group, an alkylcarbonyl
group, an arylcarbonyl group or a heterocyclic ring.

US Pat. No. 9,055,919

SPECTRAL IMAGING

Koninklijke Philips N.V.,...

1. A method, comprising:
performing a perfusion imaging procedure with a computed tomography scanner while concurrently modulating administration of
at least two different contrast agents to a same vessel of a subject during the imaging procedure based on a modulation profile,
wherein the at least two different contrast agents exhibit different spectral characteristics;

generating time series perfusion volumetric image data indicative of the at least two different contrast agents;
performing a spectral decomposition of the time series perfusion volumetric image;
determining concentrations of the at least two different contrast agents for an image of the time series perfusion volumetric
image data based on the spectral decomposition;

determining a ratio of the concentrations;
mapping the ration of the concentrations to a time of the ratio in the modulation profile at which the at least two different
contrast agents were administered with the ratio in the modulation profile; and

determining a perfusion parameter based on the mapping time between the ratio of the concentrations and the modulation profile.