US Pat. No. 9,354,579

IMAGE FORMING APPARATUS FOR FORMING OUTPUT SHEET BUNDLES INSERTED WITH TABBED SHEETS, AND CONTROL METHOD AND STORAGE MEDIUM THEREFOR

CANON KABUSHIKI KAISHA, ...

1. An image forming apparatus comprising:
a first supply unit configured to supply at least one tabbed sheet one by one from each of a plurality of tabbed sheet bundles
each comprised of tabbed sheets that are different in tab position from one another;

a second supply unit configured to supply recording sheets;
a conveyance unit configured to convey the at least one tabbed sheet supplied by said first supply unit and the recording
sheets supplied by said second supply unit and to discharge them to outside;

an image forming unit configured to form images on both surfaces of each of the recording sheets conveyed by said conveyance
unit; and

a control unit configured to, in a case where at least one surplus tabbed sheet not inserted into corresponding each of a
plurality of output sheet bundles remains in each of the plurality of tabbed sheet bundles when outputting the plurality of
output sheet bundles each having the at least one tabbed sheet inserted into a recording sheet bundle comprised of recording
sheets each formed with images on both sides by a double-sided image forming operation of said image forming unit:

control said first supply unit and said conveyance unit so that the at least one surplus tabbed sheet is conveyed directly
after conveyance of the tabbed sheet to be lastly inserted into each of a respective one of the plurality of output sheet
bundles other than the last output sheet bundle; and

control said first supply unit and said conveyance unit so that the at least one surplus tabbed sheet is conveyed subsequently
to conveyance of the last recording sheet used to form the last output sheet bundle.

US Pat. No. 9,352,554

IMAGE PROCESSING METHOD AND IMAGE PROCESSING APPARATUS

Canon Kabushiki Kaisha, ...

1. An image recording method comprising:
applying a reaction liquid onto an intermediate transfer member;
applying an ink onto the reaction liquid on the intermediate transfer member;
forming an intermediate image by applying a liquid composition containing a water-soluble polymer onto the reaction liquid
and the ink on the intermediate transfer member; and

transferring the intermediate image from the intermediate transfer member to a recording medium by bringing the intermediate
image on the intermediate transfer member into contact with the recording medium, and then separating the intermediate image
from the intermediate transfer member with the contact with the recording medium maintained,

wherein the intermediate image to be brought into contact with the recording medium has a temperature Tc higher than or equal
to the glass transition temperature of the water-soluble polymer, and the intermediate image to be separated from the intermediate
transfer member has a temperature Tr lower than the glass transition temperature of the water-soluble polymer.

US Pat. No. 9,349,078

JOB MANAGEMENT SYSTEM, IMAGE FORMING APPARATUS, CONTROL METHOD, AND STORAGE MEDIUM

CANON KABUSHIKI KAISHA, ...

1. A job management system that includes an image forming apparatus and a management system for managing job history information,
wherein the image forming apparatus comprises:
at least one processor and a memory constructed to function as:
a managing unit configured to associate a paper brand identifier with a paper name to be managed in a database;
a recording unit configured to record a number of sheets of paper used in a job executed by the image forming apparatus for
each paper brand identifier as a job history;

a first notifying unit configured to notify the management system about identifying information for identifying the latest
job history in a plurality of job histories recorded by the recording unit in a case of updating of the paper brand identifier
and the paper name in the database;

a second notifying unit configured to notify the management system about the updated paper name and the paper brand identifier;
and

a transmitting unit configured to transmit the job history information with the plurality of job histories recorded by the
recording unit to the management system, and

wherein the management system comprises:
at least one processor and a memory constructed to function as:
a managing unit configured to associate the paper name with the paper brand identifier of the image forming apparatus to be
managed based on a notification from the image forming apparatus; and

a counting unit configured to count the number of sheets of paper used for each paper name before the update by using the
job history information and the identifying information.

US Pat. No. 9,343,650

PIEZOELECTRIC MATERIAL, PIEZOELECTRIC ELEMENT, MULTILAYERED PIEZOELECTRIC ELEMENT, LIQUID EJECTION HEAD, LIQUID EJECTION APPARATUS, ULTRASONIC MOTOR, OPTICAL EQUIPMENT, VIBRATION APPARATUS, DUST REMOVING APPARATUS, IMAGING APPARAT

FUJI CHEMICAL CO., LTD., ...

1. A piezoelectric material, comprising a perovskite-type metal oxide represented by the following general formula (1) as
a main component, the piezoelectric material containing Mn in a content of 0.01 part by weight or more and 0.80 part by weight
or less with respect to 100 parts by weight of the perovskite-type metal oxide:
(Li?xNa?yK?zBa?Bi0.5?+?)a(Ti?+?Fe?)O3  (1)
where 0.800???0.999, 0???0.150, 0.001???0.050, ?+?+?=1, 0?x?0.050, 0.045?y?0.450, 0.045?z?0.450, 0.450?x+y+z?0.500, and 0.980?a?1.020.

US Pat. No. 9,340,027

INKJET RECORDING APPARATUS

Canon Kabushiki Kaisha, ...

1. An inkjet recording apparatus comprising:
a recording head configured to discharge ink;
a platen configured to hold a recording sheet in a position to face the recording head;
a first waste ink retaining member arranged in an opening of the platen and configured to absorb ink discharged from the recording
head;

a second waste ink retaining member arranged below the first waste ink retaining member;
a pair of first inclined surfaces configured to flow waste ink overflowing the first waste ink retaining member downward,
wherein a bottom end of one of the first inclined surfaces is opposed to a bottom end of the other one of the first inclined
surfaces;

a waste ink receiving surface arranged between the bottom ends and including a porous body sheet for absorbing waste ink;
and

a second inclined surface configured to flow waste ink overflowing from the porous body sheet to the second waste ink retaining
member, wherein a direction in which the second inclined surface flows ink intersects a direction which the pair of first
inclined surfaces flow waste ink,

wherein at least one of the first inclined surface and the second inclined surface includes a groove extending along a direction
of inclination of the one of the first inclined surface and the second inclined surface,

wherein an inclination angle of the second inclined surface with respect to a horizontal plane is larger than an inclination
angle of the first inclined surface with respect to the horizontal plane.

US Pat. No. 9,335,688

IMAGE FORMING APPARATUS

Canon Kabushiki Kaisha, ...

1. A fixing device for fixing a toner image on a recording material, comprising:
a cylindrical film; and
a cover covering the film along an outer circumferential surface of the film,
wherein the toner image is heated by heat of the film, and
wherein the cover is configured so that a gap, between the film and the cover at an end portion of the film in a longitudinal
direction of the film, is smaller than that at a center portion of the film in the longitudinal direction of the film.

US Pat. No. 9,335,956

PRINT CONTROL APPARATUS AND METHOD FOR PRINTING IN WHICH A FOLDING POSITION IS DISPLAYED

Canon Kabushiki Kaisha, ...

1. A print control apparatus comprising:
a specifying unit configured to specify a sheet folding size corresponding to a folding direction, the sheet folding size
being a size of a sheet corresponding to the folding direction obtained after the sheet has been folded; and

an output size specifying unit configured to specify an output size based on print setting information; and
a changing unit configured to, if the output size in at least one direction of a printing material is not equal to an integer
number times the specified folding size, change the output size to be equal to the integer number times the specified folding
size, wherein the integer number is an integer that is equal to or greater than 2.

US Pat. No. 9,331,121

METHOD OF MANUFACTURING PHOTOELECTRIC CONVERSION APPARATUS INCLUDING PIXEL WELL CONTACT

CANON KABUSHIKI KAISHA, ...

1. A method of manufacturing a photoelectric conversion apparatus, the method comprising:
forming a dielectric film for covering:
a photoelectric conversion element and an amplification element, in a well of a pixel circuit section; and
a MOS transistor in a peripheral circuit section; and
forming, by etching the dielectric film, a side spacer by retaining a portion of the dielectric film on a side surface of
a gate electrode of the MOS transistor while protecting, by a resist, a first portion and a second portion of the dielectric
film, wherein the first portion covers the photoelectric conversion element and the second portion covers the amplification
element,

wherein an opening is formed in the dielectric film in the pixel circuit section with the etching of the dielectric film,
wherein the etching for forming the side spacer and the etching for forming the opening are performed simultaneously,
wherein a contact for defining a potential of the well is formed through the opening, and
wherein the amplification element is configured to generate a signal based on an amount of charge generated in the photoelectric
conversion element.

US Pat. No. 9,329,372

ZOOM LENS AND IMAGE PICKUP APPARATUS HAVING THE SAME

CANON KABUSHIKI KAISHA, ...

1. A zoom lens comprising, in order from an object side to an image side:
a first lens unit having a negative refractive power which does not move for zooming;
a second lens unit having a positive refractive power which moves during the zooming;
a third lens unit having a negative refractive power which moves during the zooming; and
a fourth lens unit having a positive refractive power, wherein the following expressions are satisfied:
?0.80
?1.2
0.5<|m2/m3|<3.0,
where f1 represents a focal length of the first lens unit, f2 represents a focal length of the second lens unit, f3 represents
a focal length of the third lens unit, m2 represents a moving amount of the second lens unit during the zooming from a wide
angle end to a telephoto end, and m3 represents a moving amount of the third lens unit during the zooming from the wide angle
end to the telephoto end.

US Pat. No. 9,325,966

DEPTH MEASUREMENT USING MULTISPECTRAL BINARY CODED PROJECTION AND MULTISPECTRAL IMAGE CAPTURE

CANON KABUSHIKI KAISHA, ...

1. A method of measuring depth of a scene using a multichannel projector with narrow spectrally banded channels each with
a characteristic peak wavelength and a multispectral camera with broad spectrally banded channels, wherein the spectrums of
the spectrally banded channels of the multichannel projector are narrower than the spectrums of the spectrally banded channels
of the multispectral camera which are broader, wherein the spectral sensitivities of the camera channels at the characteristic
peak wavelengths of the projector channels form a band diagonal matrix, the method comprising:
projecting a multispectral binary pattern onto the scene with the multichannel projector, wherein the multispectral binary
pattern is composed of binary images, one for each channel of the projector;

capturing one or more images of the scene with the multispectral camera, each image being captured as a multispectral image;
converting each multispectral image into multiple binary images, one binary image for each projector channel; and
recovering the depth of the scene based on the multiple binary images, one binary image for each projector channel.

US Pat. No. 9,319,553

IMAGE-FORMING APPARATUS

Canon Kabushiki Kaisha, ...

1. An image-forming apparatus comprising:
a light-irradiation unit configured to irradiate a surface of a charged photosensitive member with laser light emitted by
a light source in accordance with image data so that a spot of the laser light on the surface of the photosensitive member
moves at a non-constant scanning velocity in a main scanning direction to form a latent image on the surface of the photosensitive
member;

an image data correcting unit configured to correct a length in the main scanning direction of the image data by inserting
one or more image data pieces into the image data, the number of the image data pieces increasing as the scanning velocity
decreases, and/or extracting one or more image data pieces from the image data, the number of the image data pieces increasing
as the scanning velocity increases; and

a brightness correcting unit configured to correct a brightness of the laser light so that an emission brightness of the light
source increases as the scanning velocity increases and/or the emission brightness of the light source decreases as the scanning
velocity decreases,

wherein the image-forming apparatus forms a toner image by applying toner onto the latent image.

US Pat. No. 9,317,784

IMAGE PROCESSING APPARATUS, IMAGE PROCESSING METHOD, AND PROGRAM

Canon Kabushiki Kaisha, ...

1. An image processing apparatus comprising a memory and at least one processor which function as:
an object detection unit configured to detect an object region based on an input image;
a setting unit configured to set parameters for controlling sizes of regions to be obtained by segmenting the image at respective
positions in the image, where a first parameter set for a region outside the object region is a constant and a second parameter
set for a position inside the object region is determined in accordance with that position; and

a segmentation unit configured to segment the image into a plurality of regions, each of which includes adjacent similar pixels
and sizes of the regions outside the object region are controlled to be approximately same by the first parameter and sizes
of the regions near a boundary of the object region are controlled to be smaller than other regions by the second parameter.

US Pat. No. 9,316,932

ELECTROPHOTOGRAPHIC PHOTOSENSITIVE MEMBER, METHOD FOR PRODUCING ELECTROPHOTOGRAPHIC PHOTOSENSITIVE MEMBER, PROCESS CARTRIDGE, AND ELECTROPHOTOGRAPHIC APPARATUS

Canon Kabushiki Kaisha, ...

1. An electrophotographic photosensitive member comprising:
a support, and
a photosensitive layer formed on the support,
wherein a surface layer of the electrophotographic photosensitive member comprises a polymerized product of a composition
comprising a charge transporting compound with a polymerizable functional group represented by formula (1) below,

where,
R1 and R2 each independently represent a hydrogen atom or a straight alkyl group, and

at least one of R1 and R2 is the straight alkyl group, and

wherein the charge transporting compound is a compound represented by formula (3) or (4) below,
where,
Ar1, Ar2, and Ar4 each independently represent a monovalent group represented by formula (M1) below or a substituted or unsubstituted aryl group;

Ar3 represents a divalent group represented by formula (M2) below or a substituted or unsubstituted arylene group; at least one
of Ar1 to Ar4 represents a monovalent group represented by formula (M1) below or a divalent group represented by formula (M2) below; r is
0 or 1; and when none of Ar1, Ar2, and Ar4 is a monovalent group represented by formula (M1) below, r is 1 and Ar3 is a divalent group represented by formula (M2) below;

where,
A5, Ar6, Ar9, and Ar10 each independently represent a monovalent group represented by formula (M1) below or a substituted or unsubstituted aryl group;
Ar7 and Ar8 each independently represent a divalent group represented by formula (M2) below or a substituted or unsubstituted arylene
group; at least one of A5 to Ar8 is a monovalent group represented by formula (M1) below or a divalent group represented by formula (M2) below; P1 represents an oxygen atom, a cycloalkylidene group, a divalent group having two phenylene groups bonded through an oxygen
atom, or an ethylene group; s and t each independently represent 0 or 1; and when none of A5, Ar6, Ar9, and Ar10 is a monovalent group represented by formula (M1) below and Ar7 is not a divalent group represented by formula (M2) below, t is 1 and Ar8 is a divalent group represented by formula (M2) below;

where,
R1 and R2 are the same as R1 and R2 in formula (1), Ar11 represents a substituted or unsubstituted arylene group, and m represents an integer of 1 or more:

where,
R1 and R2 are the same as R1 and R2 in formula (1), Ar12 represents a substituted or unsubstituted trivalent aromatic hydrocarbon group, and n represents an integer of 1 or more.

US Pat. No. 9,316,942

REFLECTION DETECTION APPARATUS AND APPARATUS USING THE SAME

CANON KABUSHIKI KAISHA, ...

1. A reflection detection apparatus comprising:
multiple light-receiving elements configured to detect a pattern formed on an object by receiving a reflected light from the
object; and

a selector configured to select a first light-receiving element group from the multiple light-receiving elements,
wherein the selector is configured to select the first light-receiving element group that includes plural light-receiving
elements each mainly receiving a specularly reflected light from an area of the object where no pattern is formed among the
multiple light-receiving elements, on a basis of outputs from the multiple light-receiving elements,

the detection of the pattern is made on a basis of an output from the first light-receiving element group, and
the selector is configured to be capable of shifting the first light-receiving element group in units of light-receiving elements
whose number is less than that of the light-receiving elements included in the first light-receiving element group.

US Pat. No. 9,309,071

CONVEYING APPARATUS AND RECORDING APPARATUS

Canon Kabushiki Kaisha, ...

1. A conveying apparatus, comprising:
a sheet conveyance path including a curved portion having an inner guide and a outer guide;
a roller pair including a first roller located on the inner guide and a second roller located on the outer guide and configured
to pinch a sheet; and

a mechanism configured to move the first roller to an upstream side with respect to a sheet conveying direction by a first
amount and move the second roller to the upstream side with respect to the sheet conveying direction by a second amount which
is smaller than the first amount after the roller pair pinches the sheet,

wherein the first roller is a drive roller that is supported by a swing member and rotates by a drive force transmitted from
a drive source, and when conveyance resistance of the sheet increases, the drive force swings and swing member.

US Pat. No. 9,313,715

COMMUNICATION APPARATUS, COMMUNICATION METHOD, PROGRAM AND STORAGE MEDIUM

CANON KABUSHIKI KAISHA, ...

1. A communication apparatus comprising:
a transmitting unit configured to start a process for sharing communication parameters in response to an instruction from
a user and to wirelessly transmit the communication parameters to a receiving apparatus when the receiving apparatus requests,
in response to an instruction from a user, transmission of the communication parameters, wherein the communication parameters
are parameters for performing a wireless communication between the communication apparatus and the receiving apparatus;

a communication unit configured to communicate with the receiving apparatus using the communication parameters transmitted
by the transmitting unit; and

a notifying unit configured to transmit, to the receiving apparatus, a notification stopping uses of the communication parameters
transmitted by the transmitting unit after the communication starts a communication using the communication parameters transmitted
by the transmitting unit,

wherein at least one of the providing unit and the notifying unit are implemented by one or more processors constructed to
execute computer-readable instructions stored in a memory.

US Pat. No. 9,310,717

DEVELOPER ACCOMMODATING CONTAINER, DEVELOPING DEVICE, PROCESS CARTRIDGE AND IMAGE FORMING APPARATUS

Canon Kabushiki Kaisha, ...

1. A developer accommodating unit comprising:
a flexible container provided with an opening for permitting discharge of developer accommodated therein;
a sealing member for sealing said opening; and
a frame for accommodating said flexible container, said sealing member, and the developer discharged from said flexible container,
wherein said flexible container includes a projected portion which is projected from a part of a side forming said flexible
container toward an outside of said flexible container, said projected portion is capable of accommodating developer therein,
and

wherein, when said sealing member is unsealed, said flexible container is deformed to change a shape of said opening.

US Pat. No. 9,308,721

METHOD OF MANUFACTURING SUBSTRATE FOR LIQUID EJECTION HEAD, SUBSTRATE FOR LIQUID EJECTION HEAD, LIQUID EJECTION HEAD, AND PRINTING APPARATUS

CANON KABUSHIKI KAISHA, ...

1. A method of manufacturing a substrate for a liquid ejection head including an ejection port forming member which has formed
therein ejection ports opened to a surface for ejection liquid, the method comprising the steps of:
forming a first layer by using a first layer forming member containing a solvent and a photo-acid-generating agent;
forming a second layer on the first layer by using a second layer forming member containing a solvent and a photo-acid-generating
agent; and

hardening a partial region of each of the first layer and the second layer and removing a region different from the partial
region so as to form the ejection ports, resulting in that the first layer and the second layer constitute the ejection port
forming member,

wherein a member containing a solvent to dissolve the first layer forming member and a photo-acid-generating agent having
an acid strength weaker than an acid strength of the photo-acid-generating agent contained in the first layer forming member
is used as the second layer forming member, and

wherein an absolute value of a difference between a solubility parameter of the second layer forming member and a solubility
parameter of the first layer forming member is a predetermined value that is four or less.

US Pat. No. 9,308,722

LIQUID EJECTION HEAD AND LIQUID EJECTION APPARATUS

Canon Kabushiki Kaisha, ...

1. A liquid ejection head comprising:
a substrate having a heating section and a protective film that has an area overlapping with the heating section when viewed
from a direction orthogonal to a face of the substrate,

an electrode capable of generating a voltage between the protective film and the electrode;
a flow path formed between a surface of the protective film and a surface of the electrode; and
an ejection port, liquid being ejected from the ejection port with use of heat generated by the heating section via the protective
film,

wherein the protective film and the electrode are arranged such that a distance in the flow path between the area of the protective
film and the electrode corresponding to the area satisfies 1 is set as “b”.

US Pat. No. 9,304,484

IMAGE FORMING APPARATUS WITH MOVING LIGHT EXPOSURE UNITS

Canon Kabushiki Kaisha, ...

1. An image forming apparatus that forms an image on a recording medium, the apparatus comprising:
an image-bearing-unit support member that is movable between an inside and an outside of the image forming apparatus while
supporting a plurality of image bearing units, which each include an image bearing member, such that the image bearing units
are removable from the image-bearing-unit support member;

a developing unit support member that is movable independently of the image-bearing-unit support member and that is movable
between the inside and the outside of the image forming apparatus while supporting a plurality of developing units, which
each develop an electrostatic latent image formed on a corresponding one of the image bearing members, such that the developing
units are removable from the developing unit support member;

a plurality of light exposure units that each cause a corresponding one of the image bearing members to be exposed to light
so as to form the electrostatic latent image on the image bearing member and that are movably provided in the developing unit
support member; and

a light-exposure-unit operating member that moves the light exposure units relative to the developing unit support member
when the developing unit support member is inside the image forming apparatus, thereby separating the light exposure units
further from the respective image bearing members than respective positions for image formation.

US Pat. No. 9,307,068

INFORMATION PROCESSING APPARATUS AND COMMUNICATION PROCESSING METHOD THEREOF

CANON KABUSHIKI KAISHA, ...

1. A communication apparatus comprising:
a first communication unit constructed to communicate with a plurality of another apparatuses by first wireless communication
complied with a first wireless communication protocol;

a second communication unit constructed to communicate with a base station by second wireless communication complied with
a second wireless communication protocol being different from the first wireless communication protocol;

a determination unit constructed to determine a plurality of apparatuses using the second wireless communication among the
plurality of another apparatuses communicating by the first wireless communication;

a detection unit constructed to detect disconnection of the second wireless communication performed with the base station;
and

a control unit constructed to disconnect the first wireless communication performed with the plurality of apparatuses using
the second wireless communication determined by the determination unit in a case where the detection unit detects the disconnection
of the second wireless communication performed with the base station, and maintain the first wireless communication performed
with another apparatus which does not use the second wireless communication among the plurality of another apparatuses.

US Pat. No. 9,298,149

IMAGE FORMING APPARATUS THAT PERFORMS COLOR MISALIGNMENT CORRECTION

Canon Kabushiki Kaisha, ...

1. An image forming apparatus comprising:
a photosensitive member;
a process unit configured to act on the photosensitive member;
a forming unit configured to form a detection pattern including a plurality of latent image marks that are electrostatic latent
images for color misalignment correction on the photosensitive member;

a detecting unit configured to detect the electrostatic latent images formed on the photosensitive member;
a color misalignment correcting unit configured to perform color misalignment correction based on time information obtained
by detecting, by the detecting unit, the detection pattern including the plurality of latent image marks that are electrostatic
latent images for color misalignment correction; and

a storage unit configured to store a weighting coefficient of each latent image mark of the detection pattern,
wherein the color misalignment correcting unit is further configured to weight the time information by using the corresponding
weighting coefficient and perform color misalignment correction.

US Pat. No. 9,300,216

SWITCHING POWER SUPPLY AND IMAGE FORMING APPARATUS EQUIPPED WITH SWITCHING POWER SUPPLY

CANON KABUSHIKI KAISHA, ...

1. A power supply device including a transformer having a primary winding and a secondary winding, and a switching element
connected to the primary winding configured to drive the transformer to output voltage from the secondary winding, the power
supply device comprising:
a control unit configured to drive the switching element such that the switching element is turned on and, when first signal
value of a signal according to current flowing to the primary winding reaches second signal value of a signal according to
voltage output from the secondary winding, the switching element is turned off,

wherein, in a case where the control unit performs an intermittent drive operation which repeats a period for which the switching
element is driven and a period for which the drive of the switching element is stopped, when the second signal value of a
signal according to the voltage output from the secondary winding is between a first reference value and a second reference
value greater than the first reference value the control unit drives the switching element such that the switching element
is turned off before first signal value of a signal according to the current flowing to the primary winding reaches second
signal value of a signal according to the voltage output from the secondary winding in the period for which the switching
element is driven.

US Pat. No. 9,300,228

VIBRATORY DRIVE APPARATUS USING LUBRICANT BETWEEN ELASTIC MEMBER AND PIEZOELECTRIC MEMBER

Canon Kabushiki Kaisha, ...

1. A vibratory drive apparatus comprising:
a vibrator comprising:
a first elastic member;
a second elastic member; and
an electro-mechanical energy conversion element, the electro-mechanical energy conversion element being between the first
elastic member and the second elastic member; and

a moving member having a hollow portion and being configured to contact the first elastic member and be moved relative to
the vibrator,

wherein the first elastic member has a projection portion and a flange portion supporting the moving member, the projection
portion being held within the hollow portion of the moving member, and

wherein a lubricant is provided between the first elastic member and the electro-mechanical energy conversion element.

US Pat. No. 9,300,829

IMAGE READING APPARATUS AND CORRECTION METHOD THEREOF

CANON KABUSHIKI KAISHA, ...

1. An image reading apparatus that reads an image of an original, comprising:
a plurality of line reading sensors, each formed by arraying a plurality of reading elements, which are arranged in a direction
the plurality of reading elements are arrayed and used for reading the image of the original;

a conveyance roller for conveying the original in a direction different from the direction in which the plurality of reading
elements are arrayed;

a drive unit configured to drive said conveyance roller;
a detection unit configured to detect a shift, that occurs at each of both ends of a reading area of each of the plurality
of line-type reading sensors, from an image position in a predetermined calibration sheet corresponding to a rotation angle
of the conveyance roller, for each of a plurality of positions of the plurality of line-type reading sensors, from image data
obtained by reading the calibration sheet by the plurality of line-type reading sensors while causing said drive unit to drive
said conveyance roller and conveying the calibration sheet; and

an adjustment unit configured to adjust, using the detected shift at an end of one of the plurality of line-type reading sensors
as a reference, reading at an end of another line-type reading sensor so as to reduce a difference of the shift from the reference.

US Pat. No. 9,298,537

DETECTION, DETERMINATION, AND EXTERNAL ERROR LOG STORAGE OF A FAULT CONDITION IN A USER INTERFACE

CANON KABUSHIKI KAISHA, ...

1. An information processing apparatus comprising:
a user interface;
a user interface control unit configured to recognize an operation input at said user interface, performs information processing
associated with the operation input, and control display of a status of the information processing apparatus in said user
interface;

a monitoring unit configured to monitor said user interface control unit to determine whether or not said user interface control
unit is in an error condition;

a device interface configured to allow use of an external device including a storage unit when the external device is connected
to the information processing apparatus;

a detection unit configured to detect connection of the external device; and
a holding unit configured, when an operation log is outputted from at least one of said user interface control unit, said
monitoring unit, and said detection unit, to hold the outputted operation log,

wherein said detection unit comprises
a content determination unit configured to determine whether or not debug content for retrieving the held operation log for
debugging is present in the external device upon detection of connection of the external device, and

a notification unit configured to notify said monitoring unit of a message that the external device is connected if said content
determination unit determines that the debug content is present in the external device, and

wherein said monitoring unit includes
an error determination start unit configured to start determining whether or not said user interface control unit is in an
error condition when the message is notified to said monitoring unit by said notification unit,

a retrieving unit configured to retrieve the operation log from said holding unit if a result of the determination started
by said error determination start unit shows that said user interface control unit is in an error condition, and

an operation log saving unit configured to save the operation log retrieved by said retrieving unit, into said storage unit
of the external device,

wherein said user interface control unit, said monitoring unit, said detection unit, and said holding unit are implemented,
at least in part, by a hardware processor.

US Pat. No. 9,293,493

PHOTOELECTRIC CONVERSION APPARATUS AND IMAGE SENSING SYSTEM

CANON KABUSHIKI KAISHA, ...

1. A photoelectric conversion apparatus having a plurality of photodetectors, each of the plurality of photodetectors comprising:
a photoelectric conversion portion;
a first lens portion;
a second lens portion arranged between the first lens portion and the photoelectric conversion portion; and
a light guide portion arranged between the second lens portion and the photoelectric conversion portion, the light guide portions
being located in an opening of an insulating film;

wherein the plurality of photodetectors includes a first photodetector, and a second photodetector being next to the first
photodetector,

wherein a first lens portion of the first photodetector borders a first lens portion of the second photodetector,
wherein a second lens portion of the first photodetector is spaced apart from a second lens portion of the second photodetector,
wherein a width of a light guide portion of the first photodetector is smaller than the width of the second lens portion of
the first photodetector in a direction where the first photodetector and the second photodetector are arranged, and

wherein a low-refractive-index layer having a refractive index lower than a material of the second lens portion is arranged
between the second lens portion and the light guide portion.

US Pat. No. 9,291,976

IMAGE FORMING APPARATUS HAVING A CONVEYING PATH, OPTION APPARATUS AND IMAGE FORMING SYSTEM

Canon Kabushiki Kaisha, ...

9. An option apparatus configured to connect to an image forming apparatus, the option apparatus comprising:
a first conveying path configured to be connected to a second conveying path of the image forming apparatus when the option
apparatus is connected to the image forming apparatus, and

a controller configured:
to determine, upon receiving from the image forming apparatus a notification of a detection timing of recording material by
a sensor detecting a recording material conveyed on the second conveying path, whether the detection timing of the recording
material by the sensor is different from a predetermined timing;

and, if the detection timing is different from the predetermined timing, to determine a second speed based on the detection
timing and the predetermined timing and change conveying speed of the recording material on the first conveying path from
a first speed to the second speed.

US Pat. No. 9,291,749

IMAGING OPTICAL SYSTEM AND METHOD FOR MANUFACTURING LENS ARRAY

Canon Kabushiki Kaisha, ...

1. An imaging optical system comprising a plurality of lens optical system rows each including a plurality of lens optical
systems arranged in a first direction,
wherein the plurality of lens optical system rows is arranged in a second direction perpendicular to the first direction and
to an optical axis direction,

wherein each of the plurality of lens optical systems in each of the plurality of lens optical system rows is configured to
form an erect equal-magnification image in a cross section perpendicular to the second direction and configured to form an
inverted image in a cross section perpendicular to the first direction, and

wherein, in a cross section perpendicular to the optical axis direction, optical axes of the respective plurality of lens
optical systems in adjoining ones of the plurality of lens optical system rows are separated from one another in the first
direction and are located on a same line.

US Pat. No. 9,289,984

LIQUID DISCHARGE HEAD AND LIQUID DISCHARGE APPARATUS

Canon Kabushiki Kaisha, ...

1. A liquid discharge head comprising:
a liquid discharge substrate configured to discharge liquid;
a flow channel configured to supply liquid to the liquid discharge substrate, the flow channel including;
a first flow channel portion,
a second flow channel portion communicating with the first flow channel portion and extending in a direction intersecting
a liquid supplying direction in which the first flow channel portion extends, and

a third flow channel portion provided along the liquid supplying direction of the first flow channel portion on a downstream
side of a position where the first flow channel portion and the second flow channel portion communicate with each other with
respect to a flow of liquid flowing in the first flow channel portion and communicating with the first flow channel portion
and the second flow channel portion, the third flow channel portion including a first wall defining an end portion of the
flow channel with respect to the liquid supplying direction and a second wall having an inclined surface inclining toward
a wall which defines the second flow channel portion and is connected to the first flow channel portion and connecting the
first wall with the second flow channel portion.

US Pat. No. 9,290,006

IMAGE FORMING APPARATUS FOR MEASURING THE COLOR OF A MEASUREMENT IMAGE

Canon Kabushiki Kaisha, ...

1. An image forming apparatus comprising:
an image forming unit configured to form a measurement image on a sheet;
a fixing unit configured to heat the measurement image formed on the sheet to fix the measurement image to the sheet;
a measurement unit arranged downstream of the fixing unit in a conveyance direction of the sheet and configured to measure
color of the measurement image fixed by the fixing unit;

a storage unit configured to store a plurality of pieces of conversion setting information each of which corresponds to one
of a plurality of temperatures;

a selecting unit configured to select a piece of conversion setting information from among the plurality of pieces of conversion
setting information;

a conversion unit configured to convert a measurement result of the measurement unit into a measurement result at a predetermined
temperature based on the selected conversion setting information; and

a control unit configured to cause the image forming unit to form the measurement image on the sheet, and cause the fixing
unit to fix the formed measurement image onto the sheet, and

wherein, when the sheet passed through the fixing unit is firstly conveyed to a measurement position, the control unit causes
the measurement unit to measure a color of the measurement image and first measurement color data is obtained,

after that, the control unit causes the measurement unit to measure a color of the measurement image under a condition that
a temperature of the sheet is lower than the predetermined temperature, and second measurement color data is obtained; and

a generation unit configured to generate conversion setting information based on the first and second measurement color data
and store the generated conversion setting information in the storage unit.

US Pat. No. 9,291,800

LENS APPARATUS AND IMAGE PICKUP APPARATUS INCLUDING THE SAME

CANON KABUSHIKI KAISHA, ...

10. An image pickup apparatus, comprising:
a lens apparatus comprising:
an optical system that comprises, in order from an object side to an image side, a detachable concentric-shaped dome cover
that is detachable from the lens apparatus, a first lens unit, an aperture stop, and a second lens unit having a positive
refractive power,

wherein an air interval between the first lens unit and the second lens unit is variable, and
wherein
0.02
?0.0060
?0.25 are satisfied where Ld is an air interval on an optical axis of an image-side surface of the dome cover and a most object-side
surface of the first lens unit in a case where the dome cover is mounted, D12 is a thickness on the optical axis from the
most object-side surface of the first lens unit to a most image-side surface of the second lens unit in the case where the
dome cover is mounted, f is a focal length of the optical system, fd is a focal length of the dome cover, and f1 is a focal
length of the first lens unit; and
an image pickup element that receives subject light from the lens apparatus, wherein
0.30<|sin ?p|<0.70is satisfied where ?p is an angle between an off-axial principal ray and the optical axis at an intersection between the principal
ray and the optical axis, the principal ray corresponding to a maximum image height in subject light received by the image
pickup element.
US Pat. No. 9,290,818

PROBE, PROBE SET, PROBE CARRIER, AND TESTING METHOD

CANON KABUSHIKI KAISHA, ...

1. A probe carrier comprising:
a probe set for detecting a DNA of Candida tropicalis which is a pathogenic fungus; and

a carrier on which the probe set is immobilized,
wherein the probe set comprises three probes consisting of the following base sequences (A) to (C) respectively to specifically
detect Candida tropicalis:
(A) accgccagaggttataactaaaccaaa (SEQ ID NO. 1) or the complementary sequence thereof;
(B) gagcaatacgctaggtttgtttgaaagaa (SEQ ID NO. 2) or the complementary sequence thereof; and
(C) acgcttattttgctagtggccacc (SEQ ID NO. 3) or the complementary sequence thereof.

US Pat. No. 9,283,720

POSITION DETECTION APPARATUS, IMPRINT APPARATUS, AND POSITION DETECTION METHOD

Canon Kabushiki Kaisha, ...

1. An imprint apparatus for transferring a pattern formed on a mold to an imprint material supplied to a substrate, the apparatus
comprising a detection apparatus configured to detect light diffracted by diffraction gratings formed on the mold and the
substrate,
wherein the detection apparatus comprises
an illumination optical system configured to illuminate a first diffraction grating having periods in each of a first direction
and a second direction different from the first direction, and a second diffraction grating having a period different from
the period in the second direction of the first diffraction grating in the second direction, at an oblique incidence; and

a detection optical system configured to detect diffracted light from the first diffraction grating and the second diffraction
grating,

wherein the illumination optical system includes a first pole and a second pole which is in opposite side of the first pole
with respect to an optical axis on a pupil plane thereof, and

wherein the detection optical system detects the light diffracted by the first diffraction grating and the second diffraction
grating by illuminating the first diffraction grating and the second diffraction grating with the light from the first pole
and the second pole at an oblique incidence in the first direction radiated from the illumination optical system.

US Pat. No. 9,288,352

PRINTING APPARATUS THAT PRINTS AN IMAGE ON AN ENVELOPE

Canon Kabushiki Kaisha, ...

1. A printing apparatus comprising:
a holding unit configured to hold an envelope having a flap;
a receiving unit configured to receive, from a user, a position of the flap of the envelope held by the holding unit; and
a control unit configured to perform control such that an image is printed on the envelope in a first direction when the position
received by the receiving unit indicates a front end of the envelope in a conveyance direction, to perform control such that
the image is printed on the envelope in a second direction which is opposite to the first direction when the position received
by the receiving unit indicates a back end of the envelope in the conveyance direction, and to perform control such that the
image is printed on the envelope in a third direction different from the first direction and the second direction when the
position received by the receiving unit indicates a far end from a user.

US Pat. No. 9,286,818

CALIBRATION APPARATUS AND METHOD FOR CONTROLLING THE SAME

CANON KABUSHIKI KAISHA, ...

1. A calibration apparatus comprising:
a processor; and
a memory coupled to the processor to store instructions that cause the processor to perform operations of at least one of
a plurality of steps including:

a calibration step of performing calibration for an image display apparatus;
an acquiring step of acquiring a color deviation direction that represents a direction of deviation in a color space between
a color measurement value and a theoretical value, for each of color patches of a plurality of colors after executing the
calibration; and

a control step of determining degrees of similarity of the color deviation directions in relation to the color patches of
at least some of the plurality of colors and controlling whether or not to repeat the calibration step for the image display
apparatus, on the basis of a result of the determination.

US Pat. No. 9,283,748

PRINTHEAD AND PRINTING APPARATUS

Canon Kabushiki Kaisha, ...

1. A printhead in which a plurality of element substrates, each including a plurality of printing elements, is arranged in
an arrayed direction of the plurality of printing elements, comprising:
a temperature detection element provided on each of the plurality of element substrates and configured to detect a temperature
of said each of the plurality of element substrates;

a head control IC connected to each of the plurality of element substrates and configured to control driving of the plurality
of printing elements integrated on the plurality of element substrates;

a first wire configured to transfer a signal produced by time-divisionally multiplexing a temperature detection signal output
from said temperature detection element and an image data signal as a low voltage differential signal between said head control
IC and each of the plurality of element substrates; and

a second wire, provided in parallel to said first wire, configured to flow a current to said temperature detection element
for temperature detection.

US Pat. No. 9,285,704

IMAGE FORMING APPARATUS OPERABLE IN MODE THAT RESTRICTS TONER SUPPLY

Canon Kabushiki Kaisha, ...

1. An image forming apparatus, comprising:
a developing device configured to develop an electrostatic latent image formed on an image bearing member using toner and
magnetic carrier;

a toner supplying device configured to supply toner from a toner bottle storing toner for supply;
a toner density detecting unit configured to detect information about a toner density inside of the developing device;
a control unit configured to execute a normal mode which determines a toner supply amount of the toner supplying device on
the basis of a difference value between on a detection result of the toner density detecting unit and a predetermined target
value, wherein the controller executes the normal mode so that

(i) when the difference value is a first difference value, the toner supply amount is a first toner supply amount, and
(ii) when the difference value is a second difference value which is greater than the first difference value, the toner supply
amount is a second toner supply amount which is greater than the first toner supply amount;

a remaining amount detecting unit configured to detect information relating to a remaining amount of the toner bottle; and
a replacement detecting unit configured to detect information for determining whether the toner bottle is to be replaced,
wherein the control unit prohibits an image forming operation based on a detection result of the remaining amount detecting
unit, thereafter the control unit immediately allows the image forming operation based on a detection result of the replacement
detecting unit, and the control unit executes a supply restriction mode which determines a toner supply amount of the toner
supplying device on the basis of the difference value, and

wherein the control unit executes the supply restriction mode so that
(i) when the difference value is the first difference value, the toner supply amount is a third toner supply amount which
is less than the first toner supply amount, and

(ii) when the difference value is the second difference value, the toner supply amount is a fourth toner supply amount which
is less than the second toner supply amount.

US Pat. No. 9,285,726

IMAGE FORMING APPARATUS WITH RECORDING MATERIAL SEPARATION FEATURE

Canon Kabushiki Kaisha, ...

1. An image forming apparatus comprising:
a rotatable image bearing member configured to carry a toner image;
a transfer member configured to contact said image bearing member to form a transfer nip, said transfer member being capable
of electrostatically transferring the toner image from said image bearing member onto a recording material using an electric
field applied to said transfer member;

an electroconductive member provided adjacent to a downstream side of said transfer member with respect to a feeding direction
of the recording material and opposed to a transfer member side surface of the recording material, said electroconductive
member being configured to apply an electrostatic attraction force to the recording material;

a fixing unit provided downstream of said transfer member with respect to the feeding direction and configured to fix the
toner image on the recording material having the transferred toner image fed into a fixing nip;

a first current path provided between fixing nip and a ground potential;
a feeding unit provided downstream of said fixing unit with respect to the feeding direction and configured to feed the recording
material while nipping by a feeding nip;

a guiding member disposed at a position which is downstream of said feeding unit and in which a downstream side of the recording
material contacts said guiding member when the recording material is nipped at the transfer nip to which the electric field
is applied, with respect to the feeding direction, said guiding member being configured to guide the feeding of the recording
material passing through the transfer nip; and

a second current path provided between the feeding nip and the ground potential, said second current path having an electric
resistance which is lower than that of said first current path.

US Pat. No. 9,280,047

IMPRINT APPARATUS AND ARTICLE MANUFACTURING METHOD

Canon Kabushiki Kaisha, ...

1. An imprint apparatus configured to mold an imprint material on a substrate using a mold, and to form a pattern on the substrate,
the imprint apparatus comprising:
a mold holding unit configured to hold the mold, which includes a surface including a pattern area;
a substrate holding unit configured to hold the substrate;
a first acquisition unit configured to acquire a difference in shape between a shape of the pattern area and a shape of a
shot region already formed on the substrate; and

a control unit configured to control at least one of the mold holding unit and the substrate holding unit to adjust a spacing
between the mold and the substrate, in a state where the pattern area and the imprint material are in contact with each other,
based on the difference in shape acquired by the first acquisition unit, so as to reduce the difference in shape between the
shape of the pattern area and the shape of the shot region.

US Pat. No. 9,278,517

INK JET PRINTER

CANON KABUSHIKI KAISHA, ...

1. An ink jet printer, comprising:
a print head for ejecting ink from an ejection port by energizing an energy element;
a carriage to which the print head can be mounted;
a capacitor capable of energizing the energy element; and
a determination device for determining that the print head is properly mounted in the case where an electric current is supplied
to the energy element using the capacitor after mounting the print head on the carriage, and a voltage descent in the capacitor
is detected, wherein

the amount of energy to be input at the time of energizing the energy element using the capacitor is smaller than the amount
of energy charged at the time of printing.

US Pat. No. 9,280,054

ILLUMINATION OPTICAL SYSTEM, EXPOSURE APPARATUS, AND METHOD OF MANUFACTURING DEVICE

CANON KABUSHIKI KAISHA, ...

1. An illumination optical system for illuminating a surface to be illuminated with a plurality of light beams emitted from
a plurality of light sources, the illumination optical system comprising:
a plurality of rod integrators arranged respectively with the plurality of light sources, wherein the plurality of rod integrators
uniformize a light intensity distribution of a light beam emitted from the plurality of light sources;

a combining optical system that combines the plurality of light beams emitted from said plurality of rod integrators, so that
the plurality of light beams are adjacent to each other in cross-sections thereof; and

a light transmission unit that has an entrance surface and an exit surface, divides the light beam combined by said combining
optical system into a plurality of light beams on the entrance surface, joins the plurality of divided light beams so that
a cross-sectional shape of a joined pattern of the plurality of divided light beams on the exit surface is different from
a cross-sectional shape of a joined pattern of the plurality of divided light beams on the entrance surface, and transfers
the plurality of divided light beams from the entrance surface to the exit surface using a plurality of optically coupled
light pipes.

US Pat. No. 9,282,415

ELECTROMECHANICAL TRANSDUCER AND METHOD FOR MANUFACTURING THE SAME WHICH SUPPRESSES LOWERING OF SENSITIVITY WHILE A PROTECTIVE LAYER IS FORMED

CANON KABUSHIKI KAISHA, ...

1. A method for manufacturing an electromechanical transducer comprising the steps of:
forming a first electrode on a substrate;
forming a vibrating membrane on an upper surface of the first electrode so that a gap is formed separating a portion of the
vibrating membrane from the first electrode;

forming a second electrode and wiring for electrically connecting the second electrode on portions of an upper surface of
the vibrating membrane such that the second electrode is positioned above the gap and such that the wiring extends from the
second electrode over a peripheral side of the gap to a portion of the vibrating member which is formed directly to the upper
surface of the first electrode;

forming an insulating protective layer overlapping an upper surface of both the second electrode and an upper surface of the
wiring, and further on a portion of the upper surface of the vibrating membrane which is formed directly to the upper surface
of the first electrode; and

removing at least part of the protective layer formed on the upper surface of the vibrating membrane directly above the gap
while leaving the protective layer formed on both the upper surface of the second electrode and the upper surface of the wiring.

US Pat. No. 9,282,249

IMAGE PROCESSING APPARATUS THAT TRANSMITS IMAGE DATA OUTSIDE THE APPARATUS

Canon Kabushiki Kaisha, ...

1. An image processing apparatus comprising:
a generating unit that generates a second video image by using a first video image so that a range between a white level for
the second video image and a black level for the second video image is a range defined by a specific communication standard,
wherein the second video image includes sequential frames;

a first transmitting unit that transmits the second video image to an external device in accordance with the specific communication
standard; and

a second transmitting unit that transmits predetermined data for each frame included in the second video image to the external
device, wherein the predetermined data includes information about the range between the white level for the second video image
and the black level for the second video image.

US Pat. No. 9,277,117

ELECTRONIC APPARATUS INCLUDING A TOUCH PANEL AND CONTROL METHOD THEREOF FOR REDUCING ERRONEOUS OPERATION

CANON KABUSHIKI KAISHA, ...

1. An electronic apparatus comprising:
an attitude detection unit;
a touch detection unit; and
a control unit configured to control in such a manner that
in a ease where an attitude detected by the attitude detection unit is a first attitude, if a trace of a touched position
detected by the touch detection unit satisfies a specific condition, a specific function corresponding to the detected trace
is executed, and

in a case where the attitude detected by the attitude detection unit is a second attitude upside-down turned from the first
attitude, the specific function corresponding to a trace of a touched position detected by the touch detection unit is not
executed.

US Pat. No. 9,274,831

INFORMATION PROCESSING APPARATUS, INFORMATION PROCESSING METHOD, AND STORAGE MEDIUM

Canon Kabushiki Kaisha, ...

1. An information processing apparatus for controlling execution of a plurality of threads which process a plurality of data
groups by running on a plurality of calculation cores connected to a memory including a plurality of banks, a dedicated data
area in each bank of the memory being allocated to each of the threads, said apparatus comprising:
a holding unit configured to hold the number of access requests issued by the plurality of threads in a single calculation
cycle for each of the banks;

a first selection unit configured to select, as a continuing thread which receives data from another thread, out of threads
which process a data group of interest, a thread that has a dedicated data area included in a bank for which the number of
access requests is less than an allowed number of accesses;

an incrementing unit configured to increment the number of access requests to the bank including the dedicated data area allocated
to the continuing thread when said first selection unit selects the continuing thread;

a second selection unit configured to select, as a transmitting thread which transmits data to the continuing thread, out
of the threads which process the data group of interest, a thread that has not been selected as the continuing thread or the
transmitting thread; and

a generation unit configured to generate a write instruction which instructs the transmitting thread to write data in the
dedicated data area allocated to the continuing thread, and a read instruction which instructs the continuing thread to read
data from the dedicated data area allocated to the continuing thread so that the continuing thread can receive data from the
transmitting thread.

US Pat. No. 9,274,450

CHARGING DEVICE

CANON KABUSHIKI KAISHA, ...

1. A charging device comprising:
a discharging electrode;
a casing surrounding said discharging electrode and being provided with an opening in a member-to-be-charged side;
a grid electrode provided in the opening and provided with a mesh portion having a plurality of through holes;
a cleaning brush, including a base material and a plurality of fibers held on the base material, for cleaning said grid electrode
by entrance of a part of the fibers into the through holes while contacting a surface of said grid electrode in a discharging
electrode side;

a shutter capable of shielding between a member-to-be-charged and said grid electrode; and
a moving mechanism for moving said cleaning brush and said shutter along a longitudinal direction of said grid electrode,
wherein

when said shutter is moved in a closing direction, said cleaning brush moves in advance of a leading end portion of said shutter
with respect to the closing direction by a predetermined interval or more.

US Pat. No. 9,271,001

IMAGE CODING APPARATUS, IMAGE CODING METHOD, IMAGE DECODING APPARATUS, IMAGE DECODING METHOD, AND STORAGE MEDIUM

Canon Kabushiki Kaisha, ...

1. An image coding apparatus comprising:
a processor; and
a memory;
wherein the processor performs prediction for an input image stored in the memory to generate prediction errors;
wherein the processor performs orthogonal transform to the prediction errors to generate transform coefficients;
wherein the processor quantizes the transform coefficients using a quantization matrix to generate quantization coefficients;
wherein the processor codes a difference value between a first coefficient and a second coefficient, the first coefficient
and the second coefficient are two of a plurality of coefficients in the quantization matrix;

wherein the processor codes the difference value into a code with less number of bits in case where the difference value is
a positive value than a number of bits in case where the difference value has the same absolute value as the absolute value
of the positive value while the difference value is a negative value; and

wherein the processor stores the difference value using the code in the memory.

US Pat. No. 9,267,820

TWO-DIMENSIONAL ABSOLUTE ENCODER AND SCALE WITH MARKS EACH HAVING ONE OF A PLURALITY OF DIFFERENT CHARACTERISTIC VALUES

CANON KABUSHIKI KAISHA, ...

1. A two-dimensional absolute encoder comprising:
a scale having a plurality of marks arranged thereon along a first direction and a second direction different from each other;
a detector configured to perform first detection that detects a first number of marks arranged in the first direction and
second detection that detects a second number of marks arranged in the second direction; and

a processor configured to obtain absolute positions of the scale in the first direction and the second direction based on
outputs from the detector,

wherein each of the plurality of marks has one of a plurality of different characteristic values each corresponding to a combination
of a quantized first code for indicating a position in the first direction and a quantized second code for indicating a position
in the second direction, a number of the plurality of different characteristic values being smaller than a number of the combinations;
and

the processor is configured to generate a first code sequence including the first number of the first codes based on a result
of the first detection, obtain an absolute position of the scale in the first direction based on the first code sequence,
generate a second code sequence including the second number of the second codes based on a result of the second detection,
and obtain an absolute position of the scale in the second direction based on the second code sequence.

US Pat. No. 9,266,328

LIQUID EJECTION HEAD AND LIQUID EJECTION APPARATUS

Canon Kabushiki Kaisha, ...

1. A liquid ejection apparatus which applies liquid to a medium by using a liquid ejection head including an ejection port
ejecting the liquid and a member protruding more toward a liquid ejection direction than an ejection port face where the ejection
port is formed, wherein
a first distance between the ejection port and the medium is smaller than a sum of a second distance from the ejection port
face to a tip of the member in the ejection direction and a third distance from the tip to the medium.

US Pat. No. 9,271,224

COMMUNICATION APPARATUS, AND COMMUNICATION METHOD THEREFOR

Canon Kabushiki Kaisha, ...

1. A communication apparatus comprising:
a central processing unit;
a processing unit configured to execute communication-parameter sharing processing for transmission of a communication parameter
directly to a receiving apparatus from a providing apparatus, wherein the communication-parameter sharing processing is started
in response to a user instruction;

a determining unit configured to determine, in a case where the communication apparatus is executing the communication-parameter
sharing processing as the providing apparatus, whether there exists another apparatus that has executed the communication-parameter
sharing processing; and

a cancel unit configured to cancel, in a case where there are plural apparatuses that are executing the communication-parameter
sharing processing and the communication apparatus is operating as the providing apparatus, the execution of the communication-parameter
sharing processing by the processing unit as an error,

wherein at least one of the processing unit, the determining unit, and the cancel unit is implemented by the central processing
unit.

US Pat. No. 9,267,902

METHOD OF ANALYZING SAMPLE USING SECONDARY ION EMITTED FROM SAMPLE AND ANALYZER FOR PERFORMING ANALYSIS METHOD

Canon Kabushiki Kaisha, ...

1. A sample analysis method comprising the steps of:
cooling a sample placed in a chamber;
forming an ice layer on a surface of the cooled sample by discharging one of water and an aqueous solution to the chamber;
irradiating the surface of the sample with a primary ion beam through the ice layer so as to emit a sample constituent from
the sample under the ice layer as a secondary ion; and

analyzing the secondary ion emitted from the sample under the ice layer due to the irradiation,
wherein the sample constituent is protonated,
wherein protonation of the sample constituent is promoted by the ice layer, and
wherein an amount of water forming the ice layer is from 0.1 ng/mm2 to 20 ng/mm2.

US Pat. No. 9,261,953

INFORMATION PROCESSING APPARATUS FOR DISPLAYING VIRTUAL OBJECT AND METHOD THEREOF

Canon Kabushiki Kaisha, ...

1. An information processing apparatus comprising:
a viewpoint position measurement unit configured to measure a position of a viewpoint of an operator;
an operation position measurement unit configured to measure a position of an operation unit operated by the operator; and
a determination unit configured to determine a position of a cursor to be displayed, based on the position of the viewpoint
and the position of the operation unit, and determine an orientation of the cursor such that an angle of a predetermined threshold
or more is formed from a direction indicated by the cursor and a direction of a line of sight of the operator.

US Pat. No. 9,264,565

IMAGE COMMUNICATION APPARATUS, OPERATING METHOD, AND STORAGE MEDIUM WITH POWER SAVING MODE

CANON KABUSHIKI KAISHA, ...

8. A communication apparatus, comprising:
a serial interface configured to transfer data between a master and a slave, the master being configured so as to supply a
clock signal to the slave;

an oscillation generator configured to generate a clock signal; and
a controller configured to control so as to, when the communication apparatus transits to a power saving mode, cause an operation
of the master to stop, and cause the slave to generate a clock signal.

US Pat. No. 9,254,608

IMPRINT APPARATUS, IMPRINT METHOD, AND METHOD OF MANUFACTURING ARTICLE

CANON KABUSHIKI KAISHA, ...

1. An imprint apparatus which performs an imprint process in which a resin on a substrate is cured, in a contact state in
which a mold is kept in contact with the resin, to transfer a pattern onto the substrate, the apparatus comprising:
a stage configured to move upon holding the substrate;
a detection unit configured to detect a first mark formed on the mold, and a second mark formed on the substrate; and
a processing unit configured to perform alignment of the mold and the substrate in the contact state,
wherein the processing unit performs the alignment by a first process of moving the stage in a first direction in which the
first mark and the second mark come close to using, as a target moving distance, a distance obtained by adding to a moving
distance of the stage, which is required for the alignment, an additional distance determined in accordance with an amount
of position shift between the first mark and the second mark detected by the detection unit, and a second process of moving
the stage in a second direction opposite to the first direction by a distance smaller than the target moving distance determined
in accordance with the additional distance after the first process.

US Pat. No. 9,256,177

IMAGE FORMING APPARATUS WITH A CAM CONFIGURED TO CHANGE A PRESSURIZING FORCE APPLIED TO A ROTATION MEMBER, AND A CONTROL UNIT CONFIGURED TO CONTROL A MOTOR SPEED FOR DRIVING THE CAM

Canon Kabushiki Kaisha, ...

2. The image forming apparatus according to claim 1, wherein the control unit performs control such that
the rotational position of the cam is the second rotational position if an image is formed,
the rotational position of the cam is the first rotational position if image formation is in a standby state, and
the rotational position of the cam is the third rotational position if the image forming apparatus is in a stopped state,
and wherein the pressurizing force of the pressurization unit at the first rotational position is larger than that of the
pressurization unit at the third rotational position.

US Pat. No. 9,254,105

X-RAY IMAGE DIAGNOSIS APPARATUS AND CONTROL METHOD

CANON KABUSHIKI KAISHA, ...

1. A control apparatus for controlling radiation imaging, comprising:
a receiver configured to receive an input operation from a first operation unit, and receive an input operation from a second
operation unit;

a control unit configured to, based on an input from the first operation unit or an from a second operation unit, perform
a specific for X-ray imaging,

wherein said control unit is configured to, in a case in which said receiver receives a specific input operation from the
first operation unit, restrict performance of the specific control based on an input operation from the second operation unit,
and

said control unit is configured to, in a case in which said receiver receives a specific input operation from the second operation
unit, restrict performance of the specific control based on an input operation received by said receiver from the first operation
unit.

US Pat. No. 9,253,343

INFORMATION PROCESSING APPARATUS, CONTROL METHOD, AND STORAGE MEDIUM FOR PROVIDING A PREVIEW AND/OR DISPLAY OF A MAIN DISPLAY DOCUMENT GENERATED FROM ALL PARTS OF A PRINT DOCUMENT

Canon Kabushiki Kaisha, ...

1. A control method performed by an information processing apparatus configured to display a main display document generated
from print data of all parts of a print document, the control method comprising:
generating a temporary display document, to be displayed prior to the main display document, based on print data of at least
one part fewer than all parts of the print document;

displaying the generated temporary display document;
determining whether all parts of the print document are acquired;
generating, when it is determined that the all parts of the print document are acquired, the main display document including
all pages of the print document based on the print data of the all parts of the acquired print document;

changing a display from the temporary display document to the main display document when the main display document is generated;
determining whether all parts of the print document have already been output before generation of the temporary display document
is completed; and

determining that the temporary display document should not be displayed when it is determined that all parts of the print
document have already been output before generation of the temporary display document is completed.

US Pat. No. 9,253,384

IMAGING APPARATUS

CANON KABUSHIKI KAISHA, ...

1. An imaging apparatus including an accessory shoe to which an external accessory device can be attached, the imaging apparatus
comprising:
a base member;
an accessory shoe member placed on top of the base member and configured to have a pair of engagement portions formed in a
first direction perpendicular to an attachment direction of the external accessory device and a plurality of fastening holes
formed side by side in the first direction; and

a plurality of fastening members configured to fasten the base member and the accessory shoe member to the imaging apparatus
and inserted into the plurality of fastening holes with the accessory shoe member placed on top of the base member,

wherein in the accessory shoe member, a joining portion joining the pair of engagement portions is formed, and
wherein the accessory shoe member is formed by bending a plate metal material into a loop shape in such a way that a joint
is located between the plurality of fastening holes.

US Pat. No. 9,250,557

OPTICAL SCANNING DEVICE AND IMAGE FORMING APPARATUS PROVIDED WITH SAME

Canon Kabushiki Kaisha, ...

1. An image forming apparatus comprising:
a photosensitive member;
a light-emitting element for emitting a laser beam;
a driving unit configured to drive the light-emitting element by a driving current, wherein the driving unit causes the light-emitting
element to emit light at a first light emission intensity and at a second light emission intensity in a laser light emission
region lower than the first light emission intensity;

a polygon mirror configured to scan the photosensitive member with the laser beam by rotating at a predetermined speed; and
a developing unit configured to form an image on the photosensitive member by causing toner to adhere to the photosensitive
member scanned with the laser beam,

wherein the driving unit causes the light-emitting element to emit light at the first light emission intensity toward an image
portion within an image forming region on the photosensitive member where toner is to be adhered, and causes the light-emitting
element to emit light at the second light emission intensity in the laser light emission region toward a non-image portion
within an image forming region on the photosensitive member where toner is not to be adhered, the second light emission intensity
is larger than an emission intensity of a laser emission emitted from the light-emitting element and the second light emission
intensity is an emission intensity which causes toner not to adhere to the photosensitive member,

wherein the driving unit causes the light-emitting element to emit light at the first light emission intensity with a driving
current obtained by adding a second driving current to a first driving current, and causes the light-emitting element to emit
light at the second light emission intensity in the laser light emission region with the second driving current,

wherein the driving unit performs a first adjustment adjusting the first driving current for causing the light-emitting element
to emit light at the first light emission intensity, and a second adjustment adjusting the second driving current for causing
the light-emitting element to emit light at the second light emission intensity in the laser light emission region, and

wherein the driving unit performs the first adjustment and the second adjustment during a time period after the polygon mirror
starts rotating until the predetermined speed is reached, and

wherein, during the time period, the driving unit initially performs the second adjustment before the first adjustment is
performed.

US Pat. No. 9,244,646

INFORMATION PROCESSING APPARATUS HAVING HOT FOLDERS, INFORMATION PROCESSING METHOD, AND NON-TRANSITORY COMPUTER-READABLE MEDIUM

CANON KABUSHIKI KAISHA, ...

9. An information processing method in an information processing apparatus, comprising:
holding, in a storage device, device information corresponding to printing apparatuses already connected to the information
processing apparatus, and information of hot folders corresponding to the already-connected printing apparatuses;

determining a printing apparatus similar to a printing apparatus newly connected to the information processing apparatus among
the already-connected printing apparatuses by comparing device information of the newly-connected printing apparatus with
the device information of the already-connected printing apparatuses;

generating a hot folder corresponding to the newly-connected printing apparatus by copying information of a hot folder corresponding
to the determined printing apparatus; and

deleting the information of a hot folder corresponding to the printing apparatus for which a printer driver has been deleted
upon the printer driver corresponding to the printing apparatus being uninstalled from the information processing apparatus.

US Pat. No. 9,244,391

IMAGE FORMING APPARATUS

Canon Kabushiki Kaisha, ...

1. An image forming apparatus comprising:
N image bearing members each allowing a toner image to be formed thereon, where N is 3 or greater;
N image forming units each having one of the image bearing members, the image bearing members being disposed at equal intervals;
an intermediate transfer member configured to move so as to allow toner images to be sequentially transferred thereonto at
transfer positions at which the intermediate transfer member faces the image bearing members, the first to N-th image forming
units being sequentially arranged from the upstream to the downstream along a movement direction of the intermediate transfer
member;

N transfer members each configured to transfer a toner image from one of the image bearing members onto the intermediate transfer
member at a transfer position located between the intermediate transfer member and the image bearing member;

N transfer power sources each configured to apply a transfer bias to one of the N transfer members; and
a setting unit configured to set, when L is defined as a distance between contact points of every two adjacent ones of the
first to N-th image bearing members with the intermediate transfer member, when V is defined as a moving speed of the intermediate
transfer belt, and when a timing at which the transfer power source for the n-th image forming unit is turned off using a
timing at which the transfer power source for the first image forming unit is turned off as a reference is defined as

(L/V)×(n?1)+?n,

?n for every integer n greater than or equal to 2 and less than or equal to N so that an absolute value of ?n is less than L/V and at least one pair of ?n among the plurality of ?n has different values.

US Pat. No. 9,245,199

IMAGE PROCESSING APPARATUS AND IMAGE PROCESSING METHOD

CANON KABUSHIKI KAISHA, ...

1. An image processing apparatus for generating a discriminator being used for recognizing a recognition target object, comprising:
a processor; and
a memory storing instructions that when executed cause the processor to function as:
an acquisition unit configured to acquire an image including the recognition target object;
a display control unit configured to cause a display unit to display the image including the recognition target object;
a reception unit configured to receive, on the basis of an instruction for the recognition target object included in the image
from a user, information indicating a partial portion of the recognition target object useful for recognition of the recognition
target object;

a setting unit configured to specify the partial portion of the recognition target object on the image according to the received
information and set a plurality of feature points on both of the specified partial portion and a remaining portion in the
image, so that a number of feature points at the specified partial portion is more than a number of feature points at the
remaining portion, the remaining portion being a portion on the recognition target object other than the partial portion;

an extraction unit configured to extract a plurality of feature amounts from a region including the feature points being set
on the specified partial portion and the feature points being set on the remaining portion; and

a generation unit configured to generate the discriminator for the recognition target object by clustering the plurality of
feature points using the extracted feature amounts.

US Pat. No. 9,247,128

IMAGING APPARATUS, METHOD FOR CONTROLLING IMAGING APPARATUS, AND PROGRAM

CANON KABUSHIKI KAISHA, ...

1. An imaging apparatus including a plurality of AF frames for automatic focusing based on a phase difference detection method,
the imaging apparatus comprising:
a memory configured to store a set value set in an adjustment mode, wherein the set value corresponds to at least one AF frame
among the plurality of AF frames; and

a controller configured to perform focus control by adding the set value to a result of focus detection by the automatic focusing
by the phase difference detection method, wherein, in a shooting mode, in a case where an AF frame to be used in the focus
control is different from an AF frame to which the set value is set, the controller notifies a user of this fact.

US Pat. No. 9,242,500

PRINTING APPARATUS THAT PERFORMS A BINDING PROCESS WITHOUT USING A STAPLE

Canon Kabushiki Kaisha, ...

1. A printing apparatus comprising:
a printing unit configured to print an image on a sheet;
a binding unit configured to perform a binding process for binding, without using a staple, sheets on which images are printed
by the printing unit;

an obtaining unit configured to obtain image data;
a specifying unit configured to specify an area where the binding process is to be performed by the binding unit, the area
being included in an image corresponding to the image data obtained by the obtaining unit; and

a processing unit configured to process the image data
obtained by the obtaining unit so that a part, which corresponds to the area specified by the specifying unit, of the image
corresponding to the image data obtained by the obtaining unit is deleted,

wherein the printing unit is configured to print images on sheets based on the image data processed by the processing unit,
and

wherein an image to be printed on a front face of a first sheet and an image to be printed on a back face of a last sheet
are not deleted in processing by the processing unit.

US Pat. No. 9,247,419

COMMUNICATION APPARATUS, INFORMATION PROCESSING APPARATUS, CONTROL METHODS THEREFOR, AND SYSTEM

Canon Kabushiki Kaisha, ...

1. A system in which a first communication apparatus for using a service, a second communication apparatus for making settings
about the service to be used by the first communication apparatus, and an information processing apparatus for providing the
service are communicably connected,
wherein the first communication apparatus comprises:
a communication unit configured to communicate with the second communication apparatus;
a transmission unit configured to transmit, among identification information of the first communication apparatus and management
information about the settings of the service to be used by the first communication apparatus, at least the identification
information to the second communication apparatus; and

a recording unit configured to record management information received from the second communication apparatus,
wherein the second communication apparatus comprises:
a first transmission unit configured to, if the management information has been received from the first communication apparatus,
compare the management information with management information recorded in the second communication apparatus, and if the
management information acquired from the first communication apparatus is different, transmit the management information recorded
in the second communication apparatus to the first communication apparatus;

a second transmission unit configured to, if the management information has not been received from the first communication
apparatus, transmit an issuance request of management information to the information processing apparatus, and transmit, to
the first communication apparatus, the management information which has been received from the information processing apparatus
in response to the issuance request of the management information; and

a recording unit configured to record the management information transmitted to the first communication apparatus and the
identification information acquired from the first communication apparatus in association with each other, and

wherein the information processing apparatus comprises:
a communication unit configured to communicate with the second communication apparatus; and
a first transmission unit configured to generate the management information and transmit the management information to the
second communication apparatus in response to the issuance request of the management information received from the second
communication apparatus.

US Pat. No. 9,243,812

FLOW PATH STRUCTURE AND ELECTRONIC APPARATUS

CANON KABUSHIKI KAISHA, ...

1. A flow path structure comprising:
a flow path introducing fluid from an inlet to an outlet; and
when a flow direction of the fluid is a direction that the fluid is guided from the inlet to the outlet, and an intersectional-to-flow
direction is a direction intersecting with the flow direction, a flow velocity control structure provided in a portion between
the inlet and the outlet in the flow path to reduce difference in flow velocity that the fluid flowing into the flow path
has in the intersectional-to-flow direction,

wherein the flow velocity control structure includes, in the intersectional-to-flow direction, plural flow velocity control
members provided alternately with spaces through which the fluid passes, and

wherein the flow velocity control members have a first flow velocity control member and a second flow velocity control member,
which is provided in a region in which the fluid flows at a higher flow rate than a region provided with the first flow velocity
control member,

wherein a width of the second flow velocity control member in the intersectional-to-flow direction at a position of the second
flow velocity control member is larger than a width of the first flow velocity control member in the intersectional-to-flow
direction at a position of the first flow velocity control member.

US Pat. No. 9,241,088

IMAGE FORMING APPARATUS, IMAGE FORMING SYSTEM, IMAGE FORMING SYSTEM CONTROL METHOD, AND PROGRAM

Canon Kabushiki Kaisha, ...

1. A system comprising:
a first image forming apparatus; and
a second image forming apparatus,
wherein the first image forming apparatus comprises:
a first control unit;
a first image forming unit;
a first receiving unit configured to receive data; and
a transferring unit configured to transfer the data received by the first receiving unit to the second image forming apparatus,
wherein the second image forming apparatus comprises:
a second receiving unit configured to receive the data transferred from the first image forming apparatus;
a second image forming unit configured to perform image forming based on the data received by the second receiving unit; and
a second control unit configured to perform notification to the first image forming apparatus on the basis that it is determined
that a remaining amount of toner used by the second image forming unit for performing the image forming is less than a predetermined
value, and

wherein the first control unit controls the first image forming unit to perform the image forming based on the data received
by the first receiving unit in response to reception of the notification from the second image forming apparatus.

US Pat. No. 9,239,946

METHOD AND APPARATUS FOR DETECTING AND PROCESSING SPECIFIC PATTERN FROM IMAGE

Canon Kabushiki Kaisha, ...

1. A method comprising:
calculating a first ratio of pixels having a skin color attribute in a first region of an image and a second ratio of pixels
having the skin color attribute in a second region of the image, wherein the second region is inside the first region;

determining whether the first ratio is larger than a first threshold value and the second ratio is larger than a second threshold
value; and

detecting a human face in a vicinity of a point inside the first region when the first ratio is determined to be larger than
the first threshold value and the second ratio is determined to be larger than the second threshold value,

wherein the second threshold value is larger than the first threshold value.

US Pat. No. 9,240,231

RECORDING APPARATUS AND CONTROL METHOD FOR RECORDING APPARATUS

CANON KABUSHIKI KAISHA, ...

1. A recording apparatus comprising:
an output unit configured to output a clock signal to a storage device;
a communication unit configured to output a command and data to the storage device in response to the clock signal and receive
data from the storage device in response to a timing signal;

a generating unit configured to generate the timing signal by delaying the clock signal;
a control unit configured to control the communication unit and the generating unit so that a predetermined command instructing
predetermined data for adjusting a delay amount of the clock signal to be sent is output multiple times to the storage device
and each piece of data sent by the storage device in response to the multiple predetermined commands is received in accordance
with the timing signal having a different delay amount for each of the multiple predetermined commands, and configured to
determine whether or not the communication unit successfully received the predetermined data in accordance with the respective
timing signals having different delay amounts;

a detection unit configured to detect, in order of the delay amounts, a range of the delay amounts of the timing signals for
which it has been determined that the predetermined data has been successfully received; and

a setting unit configured to set, in a case where a plurality of the ranges have been detected by the detection unit, a single
delay amount in a single predetermined range among the plurality of ranges, as the delay amount of the timing signal.

US Pat. No. 9,230,138

INFORMATION PROCESSING METHOD AND APPARATUS FOR SECURELY SHARING PERSONALIZED INFORMATION

Canon Kabushiki Kaisha, ...

1. A system including a first image processing apparatus and a second image processing apparatus,wherein the first image processing apparatus comprises:
(a) a memory; and
(b) a hardware processor in communication with the memory, the hardware processor being configured to function as:
(i) a storage unit for storing an address book in which a plurality of destination addresses are registered, the address book
being used when transmitting image data to an external apparatus;

(ii) a setting unit for setting an erasing condition of the address book to be transmitted to the second image processing
apparatus;

(iii) an issuing unit for issuing an access permission key to permit access from the second image processing apparatus in
response to the setting unit setting the erasing condition and does not issue the access permission key in response to the
setting unit not setting the erasing condition; and

(iv) a transmission unit for transmitting the address book stored in the storage unit and the erasing condition set by the
setting unit to the second image processing apparatus when the second image processing apparatus accesses the first image
processing apparatus using the issued access permission key, and
wherein the second image processing apparatus comprises:
(a) a memory; and
(b) a hardware processor in communication with the memory, the hardware processor being configured to function as:
(i) an accessing unit for accessing the first image processing apparatus using the issued access permission key;
(ii) a reception unit for receiving the address book and the erasing condition transmitted by the transmission unit;
(iii) an input unit for inputting image data;
(iv) an execution unit for transmitting the input image data to an external apparatus indicated by a destination address which
is selected by a user among the plurality of destination addresses in the address book received by the reception unit; and

(v) an erasing unit for erasing the address book received by the reception unit in accordance with the erasing condition received
by the reception unit,

wherein the setting unit is further configured to set, as the erasing condition, a condition for designating a timing for
erasing the transmitted address book, and the erasing unit is further configured to erase the received address book at the
designated timing.

US Pat. No. 9,229,672

AUDITING SYSTEM AND METHOD FOR CONTROLLING THE SAME

Canon Kabushiki Kaisha, ...

1. An auditing system that stores, using a data server, job history information of a job to be executed by an image forming
apparatus, the auditing system comprising:
a setting unit configured to set page filtering conditions, wherein the page filtering conditions include a ratio of a number
of pages to be acquired as image data to a total number of pages included in a job to be executed by the image forming apparatus;

a storing unit configured to generate and store, as the job history information, image data of all pages included in a job
executed by an image forming apparatus;

a decision unit configured to decide, in response to the ratio being set as the page filtering conditions, numbers to be included
in a group, wherein a quantity of the numbers corresponds to the number of pages to be acquired as image data and values of
the numbers are equal to or less than the total number of pages included in the job to be executed; and

an acquisition unit configured to execute an acquisition process to acquire image data,
wherein, in response to a transmission instruction for job history information, the acquisition unit execute the acquisition
process to acquire, from the storing unit and as managed job history information to be managed by the data server, image data
from pages included in the job whose page number corresponds to the numbers in the group, and

wherein at least one of the setting unit and the acquisition unit is implemented by a processor.

US Pat. No. 9,226,655

IMAGE PROCESSING APPARATUS AND IMAGE PROCESSING METHOD

Canon Kabushiki Kaisha, ...

1. An image processing apparatus comprising:
an obtaining unit configured to obtain a tomographic image including an optic disc portion and a macula portion of a fundus
of a subject's eye;

an analysis unit configured to analyze the optic disc portion and the macula portion of the fundus in the tomographic image,
analyzing the optic disc portion including calculating a bowing angle of a lamina cribrosa, analyzing the macula portion including
calculating a curvature of a layer boundary in the fundus; and

a display control unit configured to display side-by-side, on a display unit, information based on the bowing angle of the
lamina cribrosa and the curvature of the layer boundary in the fundus.

US Pat. No. 9,232,080

IMAGE FORMING APPARATUS, CONTROL METHOD FOR THE SAME AND STORAGE MEDIUM

CANON KABUSHIKI KAISHA, ...

1. An image forming apparatus comprising:
a reading unit configured to read an original to acquire image information;
a processing unit configured to process the image information acquired by the reading unit;
a determination unit configured to determine whether or not a processing result of the processing performed by the processing
unit is to be formed on the original;

a forming unit configured to form the processing result on the original if the determination unit has determined that the
processing result is to be formed on the original, and to form the processing result on a sheet other than the original if
the determination unit has determined that the processing result is not to be formed on the original; and

a setting unit configured to set whether the processing result is to be formed in a simple form or is to be formed in a detailed
form,

wherein the determination unit determines that the processing result is to be formed on a front surface of the original if
the setting unit sets that the processing result is to be formed in a simple form,

the determination unit determines that the processing result is to be formed on a back surface of the original if the setting
unit sets that the processing result is to be formed in a detailed form and furthermore the original has been subjected to
single-sided printing, and

the determination unit determines that the processing result is to be formed on a sheet other than the original if the setting
unit sets that the processing result is to be formed in a detailed form and furthermore the original has been subjected to
double-sided printing.

US Pat. No. 9,224,767

METHOD FOR DRIVING PHOTOELECTRIC CONVERSION APPARATUS

CANON KABUSHIKI KAISHA, ...

6. A photoelectric conversion apparatus including a first pixel, the first pixel including a photoelectric conversion unit
configured to accumulate charge;
a first holding unit configured to hold the charge;
a second holding unit configured to hold the charge;
a first transfer unit configured to transfer the charge from the photoelectric conversion unit to the first holding unit;
a second transfer unit configured to transfer the charge from the first holding unit to the second holding unit; and
a third transfer unit configured to electrically connect the photoelectric conversion unit and a power supply; and a control
unit, wherein

the control unit controls the first and third transfer units to form a potential barrier in the first transfer unit and a
potential barrier in the third transfer unit against the charge in the photoelectric conversion unit when accumulating charge
in the photoelectric conversion unit, wherein the potential barrier in the first transfer unit is lower than the potential
barrier in the third transfer unit,

thereafter, the control unit controls the first, second and third transfer units so that:
a potential barrier in the third transfer unit is formed;
a potential in the first transfer unit for the charge is lower than a potential in the photoelectric conversion unit; and
a potential in the second transfer unit is lower than the potential in the first transfer unit while a potential in the third
transfer unit is higher than the potential in the first transfer unit, and

thereafter, the control unit controls the third transfer unit to reset the photoelectric conversion unit and thereafter to
form a potential barrier in the third transfer unit.

US Pat. No. 9,218,147

CONDITIONALLY DISPLAYING ERRORS IN A PRINTING APPARATUS

Canon Kabushiki Kaisha, ...

1. An information processing apparatus that processes jobs, the information processing apparatus comprising:
a generation unit configured to generate a print command corresponding to a job in which print output is performed in a printing
apparatus;

a transmission and reception unit configured to transmit the generated print command to the printing apparatus and to receive
information of occurrence of a first error in the printing apparatus from the printing apparatus; and

a display unit configured to perform control such that the received information included in a file recorded by the transmission
and reception unit is displayed when a job in which print output is performed in the printing apparatus is processed in the
information processing apparatus,

wherein, when a job in which print output is not performed in the printing apparatus is processed in the information processing
apparatus, the transmission and reception unit masks the received information in the file such that a display of the received
information by the display unit is not performed, and

wherein the job in which print output is not performed in the printing apparatus includes a job for creating a form.

US Pat. No. 9,216,874

CONTROL APPARATUS, CONTROL METHOD, AND STORAGE MEDIUM

CANON KABUSHIKI KAISHA, ...

1. A control apparatus comprising:
a discharge unit configured to discharge, into a stacking unit, sheets of a plurality of copies by executing a first job that
is set to print a plurality of copies, and configured to discharge, into the stacking unit, sheets of a plurality of copies
by executing a second job that is set to print a plurality of copies and follows the first job;

a first determination unit configured to determine whether or not a setting for changing a discharge position between copies
in a job is active;

a second determination unit configured to determine whether a setting for changing a discharge position between jobs is active;
and

a control unit configured to carry out, in the case where the first determination unit determines that the setting for changing
the discharge position between copies is active and the second determination unit determines that the setting for changing
the discharge position between jobs is active, control so that a sheet discharge position for the plurality of copies discharged
by executing the first job changes selectively to a first discharge position in the stacking unit and to a second discharge
position in the stacking unit between copies of the first job, and to carry out control so that a sheet discharge position
for the plurality of copies discharged by executing the second job changes selectively to a third discharge position in the
stacking unit and to a fourth discharge position in the stacking unit between copies of the second job,

wherein the control unit carries out, in the case where the first determination unit determines that the setting for changing
the discharge position between copies is not active and the second determination unit determines that the setting for changing
the discharge position between jobs is active, control so that a sheet discharge position for the plurality of copies discharged
by executing the first job is the first position in the stacking unit and a sheet discharge position for the plurality of
copies discharged by executing the second job is the fourth position in the stacking unit, and

wherein the first discharge position is different from the third discharge position and the fourth discharge position.

US Pat. No. 9,217,973

IMAGE HEATING APPARATUS

Canon Kabushiki Kaisha, ...

1. An image heating apparatus's comprising:
a hollow heating roller, including an electroconductive layer of magnetism-adjusted alloy having a Curie temperature lower
than a heat-resistant temperature of said apparatus, configured to heat an image on a sheet;

an excitation coil provided in said heating roller and configured to generate a magnetic flux for heating said heating roller,
said excitation coil being wound about a winding center;

a first magnetic core provided in said heating roller and configured to direct the magnetic flux to said heating roller, said
first magnetic core including a first end portion positioned in the winding center and adjacent to said heating roller;

a second magnetic core provided in said heating roller and configured to direct the magnetic flux to said heating roller,
said second magnetic core including a second end portion adjacent to said heating roller not through said excitation coil;

a controller configured to control electric power supply to said excitation coil so that a temperature of said heating roller
is maintained at a target temperature lower than the Curie temperature; and

a magnetic flux shielding plate provided so as to oppose said excitation coil through said heating roller and configured to
shield the magnetic flux when said heating roller is heated up to a temperature higher than the Curie temperature, said magnetic
flux shielding plate being made of a non-magnetic metal having a resistivity smaller than that of said magnetism-adjusted
alloy and being stationary relative to said heating roller,

wherein said magnetic flux shielding plate is disposed within an angular range between a first angular position in which said
first end portion is positioned and a second angular position in which said second end portion is positioned and excluding
the first angular position and the second angular position, and

wherein a length of said magnetic flux shielding plate is the same or larger than a half length of the angular range, in a
rotational direction of said heating roller.

US Pat. No. 9,217,974

IMAGE FORMING APPARATUS

CANON KABUSHIKI KAISHA, ...

1. An image forming apparatus comprising:
an image bearing member configured to bear a toner image;
an intermediary transfer member configured to carry the toner image primary-transferred from the image bearing member at a
primary-transfer position;

a transfer member, provided contactable to an outer peripheral surface of the intermediary transfer member, configured to
secondary-transfer the toner image from the intermediary transfer member onto a recording material at a secondary-transfer
position;

a constant-voltage element, electrically connected between the intermediary transfer member and a ground potential, configured
to maintain a predetermined voltage by passing of a current therethrough;

a power source configured to form, by applying a voltage to the transfer member to pass the current through the constant-voltage
element, both of a secondary-transfer electric field at the secondary-transfer position and a primary-transfer electric field
at the primary-transfer position; and

a controller configured to control a voltage to be applied to the transfer member by the power source when the toner image
is secondary-transferred onto the recording material having a predetermined largest width with respect to a widthwise direction
perpendicular to a feeding direction, so that the constant-voltage element maintains the predetermined voltage.

US Pat. No. 9,216,575

RECORDING-ELEMENT SUBSTRATE AND LIQUID EJECTION APPARATUS

Canon Kabushiki Kaisha, ...

1. A recording-element substrate comprising:
an ejection port configured to eject liquid;
a heating resistance element configured to generate thermal energy for ejecting the liquid from the ejection port; and
a drive circuit configured to drive the heating resistance element,
wherein the heating resistance element includes a heating resistor layer and three or more electrodes provided for the heating
resistor layer;

the drive circuit forms a heating area that generates thermal energy in the heating resistor layer by selectively using at
least two of the three or more electrodes and changes an area in which the heating area is formed depending on the electrodes
used; and

the three or more electrodes include a plurality of first electrodes that allow an electric current to flow through a first
area and a plurality of second electrodes that allow an electric current to flow through a second area adjacent to the first
area, a center of the first area coinciding with a center of an area including the first area and the second area.

US Pat. No. 9,208,395

POSITION AND ORIENTATION MEASUREMENT APPARATUS, POSITION AND ORIENTATION MEASUREMENT METHOD, AND STORAGE MEDIUM

Canon Kabushiki Kaisha, ...

1. A position and orientation measurement apparatus comprising:
a storage unit configured to store a three-dimensional model of a target object;
a two-dimensional image obtaining unit configured to obtain a two-dimensional image of the target object;
an extraction unit configured to extract an occluded region in which illumination irradiated onto the target object is occluded
in the two-dimensional image;

a projection unit configured to project a geometric feature that constitutes the three-dimensional model onto the two-dimensional
image based on approximate values of position and orientation of the target object;

an association unit configured to associate the geometric feature with an image feature in the two-dimensional image;
a determination unit configured to determine whether the associated image feature in the two-dimensional image is on a contour
of the occluded region; and

a position and orientation measurement unit configured to measure the position and orientation of the target object based
on a distance on the two-dimensional image between the projected geometric feature and the associated image feature in the
two-dimensional image, in accordance with a determination result by the determination unit.

US Pat. No. 9,204,055

IMAGE CAPTURE APPARATUS, CONTROL METHOD THEREOF, AND RECORDING MEDIUM

CANON KABUSHIKI KAISHA, ...

1. An image capture apparatus comprising:
a capturing unit that captures an object image and generates image data;
a first setting unit that sets a first exposure time for the capturing unit;
a second setting unit that sets a second exposure time in which the capturing unit obtains each of a plurality of image data;
a composition unit that generates composite image data in which the plurality of image data have been composed, wherein total
exposure time of the plurality of image data corresponds to the first exposure time;

a recording control unit that records, into a recording medium, the composite image data generated by the composition unit
and a plurality of history image data generated by sequentially composing the image data of the second exposure time, obtained
from the capturing unit, that has been sequentially generated up until the composite image data has been generated; and

a detection unit that detects the brightness of the history image data sequentially generated by the composition unit,
wherein of the history image data sequentially generated by the composition unit, the recording control unit selectively records
image data, whose brightness as detected by the detection unit exceeds a predetermined value, in the recording medium.

US Pat. No. 9,201,289

IMAGE CAPTURE APPARATUS IN WHICH AN ARRANGEMENT RELATIONSHIP BETWEEN AN IMAGE SENSOR AND A MICROLENS ARRAY CAN BE VARIED, AND METHOD FOR CONTROLLING THE SAME

CANON KABUSHIKI KAISHA, ...

1. An image capture apparatus having an image sensor in which a plurality of photoelectric conversion elements are arranged,
the image capture apparatus comprising:
an obtaining unit configured to obtain, from a photographic lens that includes a lens array and is attachable to and detachable
from the image capture apparatus, information on the photographic lens; and

a control unit configured to give an instruction to shift the lens array or the image sensor, so that the lens array and the
image sensor are arranged at a distance based on the information on the photographic lens, in a state in which the photographic
lens is attached,

wherein the distance between the lens array and the image sensor is determined such that an outgoing light flux from each
of lenses that constitute the lens array is incident on a predetermined number of the photoelectric conversion elements of
the image sensor, the predetermined number being two or more.

US Pat. No. 9,195,170

CARTRIDGE, PROCESS CARTRIDGE AND IMAGE FORMING APPARATUS

Canon Kabushiki Kaisha, ...

1. A cartridge detachably mountable to a main assembly of an image forming apparatus, said cartridge comprising:
a frame;
a flexible container, provided with an opening at a lateral side thereof and provided inside said frame, for accommodating
developer; and

a feeding member, provided below said flexible container and provided between said flexible container and said frame, for
feeding the developer,

wherein said feeding member is capable of contacting the developer and discharging the developer discharged through the opening
of said flexible container from between said flexible container and said frame.

US Pat. No. 9,197,820

LENS APPARATUS AND IMAGE PICKUP APPARATUS CAPABLE OF CONTROLLING APERTURE STOP

Canon Kabushiki Kaisha, ...

1. A lens apparatus including a lens, comprising:
an aperture stop unit configured to adjust light intensity;
a drive circuit configured to drive the aperture stop unit; and
a controller configured to control the drive circuit,
wherein the controller is capable of controlling the drive circuit in a first mode and in a second mode,
wherein, in the first mode, the controller drives the aperture stop unit from a first position to a second position by way
of an open position between each exposure, and

wherein, in the second mode, the controller drives the aperture stop unit from the first position to the second position directly,
differently from the first mode, without driving the aperture stop unit to the open position between each exposure.

US Pat. No. 9,188,836

SHUTTER DEVICE AND IMAGE PICKUP APPARATUS INCLUDING SHUTTER DEVICE

Canon Kabushiki Kaisha, ...

8. An image pickup apparatus comprising a shutter device, the shutter device comprising:
a stepping motor configured to be driven in open-loop driving mode at which an energization state of a coil is switched at
predetermined time intervals and in feed-back driving mode at which the energization state of the coil is switched accordance
with a rotation position of a rotor;

a driven member configured to be driven by the stepping motor; and
a light shielding member configured to travel between a closed state in which an aperture is closed and an open state in which
the aperture is open,

wherein the light shielding member is driven by the driven member,
wherein the driven member is configured to provide a first driven zone and a second driven zone,
wherein in a case where the driven member is driven in the first driven zone, the light shielding member maintains the closed
state or the open state,

wherein in a case where the driven member is driven in the second driven zone, the light shielding member travels from the
closed state to the open state or from the open state to the closed state,

wherein the driven member is driven in the first driven zone by the stepping motor in one direction, and after the driven
member is driven in the first driven zone, the driven member is driven in the second driven zone,

wherein in a case wherein the driven member is driven in the first driven zone, the stepping motor drives the driven member
in the open-loop driving mode, and

wherein in a case where the driven member is driven in the second driven zone, the stepping motor drives the driven member
in the feed-back driving mode.

US Pat. No. 9,189,459

DOCUMENT IMAGE LAYOUT APPARATUS

CANON KABUSHIKI KAISHA, ...

1. An apparatus that arranges a target image on a template having a plurality of data arrangement areas, the apparatus comprising
at least a processor and a memory, cooperating to function as:
a first determination unit that determines an amount of a protrusion of text article data with respect to a data arrangement
area of the plurality of data arrangement areas, wherein the text article data is segmented from the target image;

a second determination unit that determines whether or not the amount of the protrusion of the text article data with respect
to the data arrangement area is less than a predetermined value;

a control unit that reduces an image corresponding to the text article data when the amount of the protrusion of the text
article data is less than the predetermined value and that segments images corresponding to the text article data into a plurality
of text row rectangle images when the amount of the protrusion of the text article data is greater than the predetermined
value; and

an arrangement unit that arranges the reduced image or a plurality of block data on the data arrangement areas,
wherein the control unit further reconstructs text article data by moving the segmented text row rectangle images, and
wherein the control unit further block-segments the reconstructed text article data into the plurality of block data.

US Pat. No. 9,185,243

CONTROLLING RE-EXECUTION OF FACSIMILE TRANMISSION

CANON KABUSHIKI KAISHA, ...

1. A facsimile apparatus having a first interface that connects to an IP network and a second interface that connects to an
analog network, the apparatus comprising:
a selection unit configured to automatically select a communication mode to be used from among a plurality of communication
modes for transmission using the first interface;

a transmission unit configured to execute facsimile transmission using the communication mode automatically selected by the
selection unit in the case where an instruction has been made to automatically select the communication mode to be used and
to execute facsimile transmission using a manually-selected communication mode in the case where one of the plurality of communication
modes has been manually selected; and

a control unit responsive to failure of facsimile transmission using the first interface, the control unit being configured
to control execution or non-execution of re-transmission using the second interface such that (a) re-transmission using the
second interface is executed in a case where the communication mode used in the facsimile transmission is the communication
mode automatically selected by the selection unit and a fallback setting is valid, (b) re-transmission using the second interface
is not executed in a case where the communication mode used in the facsimile transmission is the communication mode automatically
selected by the selection unit and the fallback setting is invalid, and (c) re-transmission using the second interface is
not executed, regardless of whether the fallback setting is valid or invalid, in a case where the communication mode used
in the facsimile transmission is the manually-selected communication mode.

US Pat. No. 9,170,513

YELLOW TONER

CANON KABUSHIKI KAISHA, ...

1. A yellow toner comprising toner particles, each of which comprises a binder resin and a colorant, wherein the colorant
comprises a compound represented by the following general formula (1):

wherein R1 represents an alkyl group, an aryl group, or an amino group;

R2 represents a functional group selected from the group consisting of a carboxylate ester group, a carboxylic acid dialkylamide
group, a carboxylic acid diphenylamide group, a carboxylic acid monoalkylamide group and a carboxylic acid monophenylamide
group;

A represents a carbonyl group or a sulfonyl group; and
both R3 and R4 represent a cyclohexyl group or both R3 and R4 represent a 2-ethylhexyl group.

US Pat. No. 9,170,550

IMAGE FORMING APPARATUS CONTROLLING POWER FROM AN AC POWER SUPPLY TO A HEATER IN ACCORDANCE WITH THE TEMPERATURE SENSED BY A TEMPERATURE SENSING ELEMENT

Canon Kabushiki Kaisha, ...

1. An image forming apparatus, comprising:
a fixing part configured to heat fix an unfixed toner image formed on a recording material to the recording material, the
fixing part comprising a heater that generates heat by power supplied from an AC power supply;

a temperature sensing element configured to sense a temperature of the fixing part; and
a power control part configured to control the power supplied from the AC power supply to the heater, the power control part
selecting a duty ratio from a plurality of duty ratios set in each of a plurality of tables in accordance with the temperature
sensed by the temperature sensing element per one control cycle defined by a predetermined even number of half-cycles of an
AC wave,

wherein a wave form of at least one duty ratio in the plurality of duty ratios in each of the plurality of tables is composed
of a combination of a phase control pattern and a wave number control pattern, which are included per the one control cycle,
and

wherein ratios of the phase control wave forms with respect to the wave number control wave forms are different among the
plurality of the tables, and

wherein the power control part selects one table per the one control cycle, among the plurality of tables.

US Pat. No. 9,170,395

LENS APPARATUS, OPTICAL APPARATUS AND CAMERA

CANON KABUSHIKI KAISHA, ...

1. A lens apparatus comprising:
a straight guiding barrel having a straight groove portion;
a cam barrel having a cam groove portion;
a straight movable barrel disposed outside the straight guiding barrel and the cam barrel, and holding a lens, the straight
movable barrel being movable in an optical axis direction by a relative movement of the straight guiding barrel and the cam
barrel;

a cam follower including:
a first cylindrical portion and a second cylindrical portion that respectively engage with the straight groove portion and
the cam groove portion, the first and second cylindrical portions having central axes decentered from each other, and

an operation portion extending from one of the first or second cylindrical portion and allowing rotational operation of the
first and second cylindrical portions from outside of the straight movable barrel; and

a connecting member connecting the cam follower and the straight movable barrel with each other to pull the cam follower inside
of the straight movable barrel, a central axis of the connecting member coinciding with a central axis of either the first
cylindrical portion or the second cylindrical portion,

wherein the operation portion is exposed outside of the straight movable barrel.

US Pat. No. 9,170,469

SYSTEM FOR CONTROLLING THE CHIRP OF AN OPTICAL SIGNAL

Canon Kabushiki Kaisha, ...

1. An apparatus for altering a chirp of an input light comprising:
a first grating structure positioned to receive the input light to produce a first dispersed light;
a first electro-optical block positioned relative to the first grating structure to receive the first dispersed light which
exits the first electro-optical block as a second dispersed light;

a second grating structure positioned relative to the first electro-optical block to receive the second dispersed light to
produce a first collinear light;

a third grating structure positioned relative to the second grating structure to receive the first collinear light to produce
a third dispersed light;

a second electro-optical block positioned relative to the third grating structure to receive the third dispersed light which
exits the second electro-optical block as a fourth dispersed light;

a fourth grating structure positioned relative to the second electro-optical block to receive the fourth dispersed light to
produce an output light; and

wherein a voltage applied to the first and second electro-optical blocks alters the chirp of the output light.

US Pat. No. 9,164,405

MEASUREMENT APPARATUS FOR CALCULATION OF SUBSTRATE TILT, EXPOSURE APPARATUS, AND DEVICE FABRICATION METHOD

CANON KABUSHIKI KAISHA, ...

1. A measurement apparatus which measures a height of a test surface, the apparatus comprising:
a stage configured to hold the test surface;
an image sensing device including a plurality of detection units configured to detect interfering light formed by measurement
light from the test surface illuminated by white light and reference light from a reference surface illuminated by white light,

wherein the reference surface is arranged to generate a difference among optical path length differences between the measurement
light and the reference light that enter said plurality of detection units, respectively;

an optical system configured to guide measurement light reflected at a plurality of measurement points on the test surface
and the reference light reflected at a plurality of reference points on the reference surface, to said plurality of detection
units; and

a processing unit configured to:
obtain a plurality of position data, within the plurality of detection units, indicating peaks or bottoms of intensities of
the interfering light detected by the plurality of detection units and configured to calculate the height of the test surface
using the obtained position data;

obtain the optical path length differences between the measurement light and the reference light corresponding to the detected
peaks or bottoms of intensities of the interfering light; and

calculate a tilt of the test surface using the obtained optical path length differences and data of the optical path lengths
of the reference light corresponding to the obtained positions within the plurality of detection units.

US Pat. No. 9,164,430

DEVELOPER CONTAINER, DEVELOPING CARTRIDGE, PROCESS CARTRIDGE AND IMAGE FORMING APPARATUS

Canon Kabushiki Kaisha, ...

1. A developer container comprising:
a developer chamber, provided with an opening, for accommodating developer;
a rotatable member rotatably supported in said developer chamber; and
a sealing member for being removed at the opening by being wound up by said rotatable member, said sealing member being provided
in said developer chamber and including a first end portion connected to said rotatable member and a second end portion sealing
the opening,

wherein the opening is sealed by bonding said sealing member along an edge of the opening,
wherein said developer container includes a first bonding portion provided upstream of the opening and a second bonding portion
provided downstream of the opening with respect to an unsealing direction of said sealing member, and

wherein a peeling-off force for peeling off said sealing member at a predetermined angle is larger at said first bonding portion
than at said second bonding portion.

US Pat. No. 9,165,226

IMAGE PROCESSING APPARATUS, METHOD, AND STORAGE MEDIUM FOR EXECUTING IMAGE PROCESSING AND PERFORMING DECORATION PROCESSING

Canon Kabushiki Kaisha, ...

6. A non-transitory storage medium storing a program that causes a computer to perform an image processing method comprising:
selecting, in performance monochrome output on color image data, either a first monochrome output for outputting the color
image data with decoration of patterns different for each color of the color data included in the color image data, or a second
monochrome output for outputting the color image data without the decoration for the color data included in the color image
data;

determining a combination of a color of color data having a highest number of pixels among colors of color data contained
in the color image data, in a case where the selecting selects performing the first monochrome output, and a decoration pattern
having a lowest number of pixels among the decoration patterns and decorating color data contained in the color image data
in accordance with a combination of a color and a decoration pattern corresponding to the color determined by the determining
for monochrome decoration output of the color image data,

wherein conversion of the color data in the color image data in accordance with the determined combination of a color and
a decoration pattern is cancelled, if an amount of black coloring material used for performing the first monochrome output
of the color image data in accordance with the determination combination is a predetermined amount or more larger than an
amount of black coloring material used for performing the second monochrome output for the color image data.

US Pat. No. 9,165,508

DISPLAY APPARATUS USING REFERENCE VOLTAGE LINE FOR PARASITIC CAPACITANCE, ELECTRONIC APPARATUS USING THE DISPLAY APPARATUS AND DRIVING METHOD OF THE DISPLAY APPARATUS

Canon Kabushiki Kaisha, ...

1. A display apparatus comprising:
a plurality of pixel circuits;
a reference voltage line connected to each of the plurality of pixel circuits;
a reference voltage source for supplying a reference voltage to the reference voltage line;
a first switch for connecting the reference voltage source to the reference voltage line; and
a data line for supplying a data voltage to each pixel circuit, and the data line being different from the reference voltage
line,

wherein each pixel circuit includes a light emitting element, a driving transistor having a source connected to an anode of
the light emitting element, a holding capacitor having one end connected to a gate of the driving transistor and having the
other end connected to the source of the driving transistor, a second switch for connecting the gate of the driving transistor
to the data line, and a third switch for connecting the source of the driving transistor to the reference voltage line; and

wherein the data voltage is written in the gate of the driving transistor, under a condition that the source of the driving
transistor is connected to the reference voltage line, while the reference voltage line is disconnected from the reference
voltage source, and that a threshold voltage of the driving transistor is held in the holding capacitor, while a difference
of the reference voltage from the threshold voltage of the driving transistor is held in the parasitic capacitance of the
reference voltage line.

US Pat. No. 9,167,149

LENS APPARATUS AND IMAGING APPARATUS INCLUDING THE SAME

Canon Kabushiki Kaisha, ...

1. A lens apparatus connectable to a camera apparatus including an image pickup unit, the lens apparatus comprising:
an imaging optical system including a movable lens unit;
a drive unit configured to drive the movable lens unit in an optical axis direction of the imaging optical system; and
a control unit configured to cause the movable lens unit to perform a wobbling motion in the optical axis direction by alternatively
outputting to the drive unit a first drive command for driving the movable lens unit at a first driving speed and a stop command
for stopping driving of the movable lens unit, and to move the movable lens unit based on contrast information obtained from
the image pickup unit during the wobbling motion of the movable lens unit in the optical axis direction,

wherein, in the wobbling motion, before outputting the first drive command to the drive unit and after outputting the stop
command to the drive unit, and before outputting the stop command to the drive unit and after outputting the first drive command
to the drive unit, the control unit outputs to the drive unit a second drive command for driving the movable lens unit at
a second driving speed lower than the first driving speed.

US Pat. No. 9,158,088

LENS BARREL AND IMAGING APPARATUS

Canon Kabushiki Kaisha, ...

1. A lens barrel comprising:
a first lens disposed on a first optical axis;
a bending optical element configured to bend a light flux incident from a direction of the first optical axis toward a direction
of a second optical axis extending in a direction different from the direction of the first optical axis;

a holding member configured to hold the bending optical element,
wherein, when the lens barrel shifts from a photographing state to a retracted state, the holding member holding the bending
optical element moves along the second optical axis while rotating around a rotational axis extending in a direction different
from the directions of the first optical axis and the second optical axis; and

a movable tube configured to move backward and forward in the direction of the first optical axis in conjunction with a movement
of the first lens,

wherein, when the lens barrel shifts from the photographing state to the retracted state, the holding member holding the bending
optical element contacts the movable tube moving in the direction of the first optical axis within the movable tube to rotate
around a rotational axis perpendicular to both the first optical axis and the second optical axis and to move along the second
optical axis.

US Pat. No. 9,152,081

DEVELOPER ACCOMMODATING CONTAINER, PROCESS CARTRIDGE, ELECTROPHOTOGRAPHIC IMAGE FORMING APPARATUS

Canon Kabushiki Kaisha, ...

1. A developer accommodating container for accommodating developer, said developer accommodating container comprising:
a flexible container provided with an opening for permitting discharge of the developer; and
a sealing member which includes a bonded portion bonded to an outer surface of said flexible container so as to seal the opening
and which is capable of exposing the opening by peeling said bonded portion from said flexible container,

wherein said sealing member includes a first bonded portion in an upstream side of the opening and a second bonded portion
in a downstream side of the opening with respect to a sealing member unsealing direction, said second bonded portion being
provided in a non-contact position with the opening, and

wherein, where said sealing member is unsealed, a shape of the opening is changed.

US Pat. No. 9,150,022

PRINTING APPARATUS

Canon Kabushiki Kaisha, ...

1. A printing apparatus using a liquid ejection head for ejecting liquid to perform printing by ejecting liquid on a print
medium which is relatively conveyed with respect to the liquid ejection head, the printing apparatus comprising:
a suction mechanism provided downstream of the liquid ejection head with respect to a direction of the conveyance of the print
medium; and

a roller for conveying the print medium, the roller being provided downstream of the suction mechanism with respect to the
direction of the conveyance,

wherein the roller includes a blowing-out mechanism for blowing out gas in a direction of the suction mechanism.

US Pat. No. 9,154,693

PHOTOGRAPHING CONTROL APPARATUS AND PHOTOGRAPHING CONTROL METHOD

CANON KABUSHIKI KAISHA, ...

1. A photographing control apparatus for controlling a shooting direction of a camera comprising:
a deriving unit configured to derive a parameter for deriving an image for displaying from the camera; and
a determining unit configured to determine, based on the parameter derived by the deriving unit, as to whether the shooting
direction of the camera is controlled or not, according to a designation of a position, in a display area, in which the image
captured by the camera is displayed.

US Pat. No. 9,152,365

IMAGE PROCESSING APPARATUS, NETWORK SYSTEM, INFORMATION PROCESSING METHOD, PROGRAM, AND STORAGE MEDIUM

CANON KABUSHIKI KAISHA, ...

1. An image processing apparatus connectable to a network, comprising:
a storage unit configured to store first address book information indicating transmission destination of data which is to
be transmitted outside the image processing apparatus and first set information for operating the image processing apparatus;

a receiving unit configured to receive, from an external apparatus via the network, second address book information indicating
transmission destination of data which is to be transmitted outside the image processing apparatus and second set information;

a setting unit configured to set a first setting as to whether or not to update the first address book information and a second
setting as to whether or not to update the first set information; and

an updating unit configured to, in a case where the first setting indicating update of the first address book information
is set by the setting unit, update the first address book information stored in the storage unit with the second address book
information received by the receiving unit, and in a case where the first setting indicating no update of the first address
book information is set by the setting unit, not update the first address book information stored in the storage unit with
the second address book information received by the receiving unit, and to, in a case where the second setting indicating
update of the first set information is set by the setting unit, update the first set information stored in the storage unit
with the second set information received by the receiving unit, and in a case where the second setting indicating no update
of the first set information is set by the setting unit, not update the first set information stored in the storage unit with
the second set information received by the receiving unit.

US Pat. No. 9,152,367

PRINTING APPARATUS, CONTROL METHOD THEREOF, AND STORAGE MEDIUM

CANON KABUSHIKI KAISHA, ...

1. A printing apparatus comprising:
a determining unit configured to determine, in a case where another type of job other than a specific type of job is received
before a predetermined time has elapsed after the specific type of job is received, whether a discharging destination of the
another type of job is the same as a discharging destination of the specific type of job;

a restricting unit configured to restrict, in a case where the determining unit determines that the discharging destination
of the another type of job is the same as the discharging destination of the specific type of job, execution of the another
type of job between the specific type of job and a next specific type of job received before the predetermined time has elapsed;
and

an executing unit configured to execute, in a case where the determining unit determines that the discharging destination
of the another type of job is not the same as the discharging destination of the specific type of job, the another type of
job between the specific type of job and the next specific type of job received before the predetermined time has elapsed.

US Pat. No. 9,154,752

IMAGE DISPLAY DEVICE AND IMAGE DISPLAY METHOD

Canon Kabushiki Kaisha, ...

1. An image display device, which forms, on a screen, an image displayed on a first display panel and an image displayed on
a second display panel superposed with each other, comprising:
an acquisition unit configured to acquire a video signal of successive respective frames;
a frame rate converting unit configured to perform frame-rate-convert-processing for outputting intermittent frames whose
frame rate is lower than that of the successive respective frames;

a first generation unit configured to generate a low frequency video signal of the intermittent frames;
a second generation unit configured to calculate a ratio of a signal value of a video signal of an acquired frame acquired
by said acquisition unit to a signal value of the low frequency video signal of an intermittent frame, wherein the intermittent
frame is every other frame of the successive respective frames, to generate a high frequency video signal having a signal
value based on the calculated ratio, and to output the generated high frequency video signal to the first display panel; and

a third generation unit configured to calculate a ratio of a signal value of the video signal of the intermittent frame to
a signal value of the high frequency video signal of the intermittent frame, to generate an adjusted low frequency video signal
having a signal value based on the calculated ratio, and to output the generated adjusted low frequency video signal to the
second display panel.

US Pat. No. 9,141,817

IMAGE PROCESSING APPARATUS, METHOD OF CONTROLLING THE SAME, AND STORAGE MEDIUM

Canon Kabushiki Kaisha, ...

1. An image processing apparatus comprising:
a display unit;
a storage unit that stores message information received from an external apparatus;
an authentication unit that executes an authentication processing of a user who uses the image processing apparatus;
an acquisition unit that acquires the message information from the storage unit;
a display control unit that displays, on the display unit, an authentication screen to execute the authentication processing;
and

a determination unit that determines whether or not the display unit is turned off when the authentication processing is executed
by the authentication unit,

wherein, when the message information is acquired by the acquisition unit, the display control unit adds the message information
to the authentication screen, and displays, on the display unit, the authentication screen to which the message information
is added, and

wherein, when the authentication processing is executed by the authentication unit and the determination unit has determined
that the display unit is turned off, the display control unit (a) turns on the display unit, (b) displays, on the display
unit, the message information acquired by the acquisition unit, and (c) displays an operation screen of the image processing
apparatus afterwards, and

wherein, when authentication processing is executed by the authentication unit and the determination unit has determined that
the display unit is not turned off, the display control unit displays, on the display unit, the operation screen of the image
processing apparatus.

US Pat. No. 9,143,753

3D IMAGE DISPLAY APPARATUS AND CONTROL METHOD FOR SAME

Canon Kabushiki Kaisha, ...

1. A 3D image display apparatus for causing a left eye image and a right eye image that are displayed by a frame-sequential
method to be observed through liquid crystal shutter glasses, the apparatus comprising:
a display unit which is driven to emit light in a line-sequential or a block-sequential manner;
a storage unit which stores characteristic information relating to temporal change in transmittance of the liquid crystal
shutter glasses with respect to light of respective primary colors in the display unit; and

a correction unit which corrects an input image signal of the respective primary colors using the characteristic information,
to reduce color fluctuation between lines or between blocks in the observed image caused by differences in the temporal change
of the transmittance of the liquid crystal shutter glasses in respect of each of the primary colors, wherein

the display unit displays a corrected image based on a corrected image signal generated by the correction unit,
the liquid crystal shutter glasses have characteristics by which the transmittance with respect to light of a first primary
color gradually increases, and

the correction unit generates the corrected image signal such that a brightness of a corrected image becomes higher the earlier
the line or block is arranged in the sequence of light emission, when an image signal of only the first primary color is input.

US Pat. No. 9,131,840

OPTICAL COHERENCE TOMOGRAPHIC IMAGING APPARATUS AND TOMOGRAPHIC IMAGING METHOD

Canon Kabushiki Kaisha, ...

1. An imaging apparatus that irradiates an object with a first measuring beam and a second measuring beam that differ from
each other in a center wavelength, and acquires an image of the object using returning light from the object, the imaging
apparatus comprising:
a first adjustment unit for adjusting a focusing position of the first measuring beam in a depth direction;
a second adjustment unit for adjusting a focusing position of the second measuring beam in the depth direction; and
a controlling unit for controlling, after the focusing position of the first measuring beam and the focusing position of the
second measuring beam are adjusted based on returning light from the object, at least one of the first adjustment unit and
the second adjustment unit such that the focusing position of the first measuring beam and the focusing position of the second
measuring beam are at different positions in the depth direction.

US Pat. No. 9,132,651

SEAL MEMBER FOR SEALING SUPPLY PORT OF INK TANK AND INK TANK UNIT INCLUDING SEAL MEMBER

Canon Kabushiki Kaisha, ...

1. A seal member that seals a supply port for supplying ink contained in an ink tank to an outside, comprising:
a film member, a surface of which has an adhesive layer;
a first area formed on the film member, the first area corresponding to the supply port; and
an ink absorbing member formed of a porous material and disposed in a second area located outside the first area, external
to the ink tank, and adjacent the supply port, and

a third area located between the first area and the second area on the film member, the third area including the adhesive
layer, and adhered to the ink tank,

wherein the seal member is configured to seal the supply port of the ink tank during distribution of the ink tank and is separated
from the ink tank before the ink tank is attached to an apparatus.

US Pat. No. 9,134,619

EXPOSURE APPARATUS AND DEVICE MANUFACTURING METHOD USING SAME

CANON KABUSHIKI KAISHA, ...

1. An exposure apparatus that irradiates a pattern formed on an original plate with light emitted from an illumination system
to thereby expose an image of the pattern on a substrate via a projection optical system, the exposure apparatus comprising:
a light shielding plate that is arranged on a plane conjugate to an object plane of the projection optical system in the illumination
system, includes a circular-arc overlapping a circular borderline, which defines a region whereupon the image on the substrate
is formed, on an inner side of an outer periphery of the substrate at an edge, and shields against light to prevent the light
from entering an outer peripheral region outside the circular borderline on the substrate;

a first driving unit that rotationally drives the light shielding plate about an axis parallel to an optical axis of the illumination
system;

a second driving unit that linearly drives the light shielding plate within a plane perpendicular to the optical axis;
a detecting unit that detects a light-shielding position at which light is shielded by the light shielding plate; and
a control unit that stores a light-shielding position at a reference time point and light-shielding positions before and after
a replacement of the light shielding plate when the light shielding plate is replaced after the reference time point, and
calculates a variation amount of the light-shielding position based on a light-shielding position detected by the detecting
unit at a time point after the light shielding plate is replaced, the light-shielding position at the reference time point,
and the difference between the light-shielding positions before and after the replacement of light shielding plate.

US Pat. No. 9,134,898

DISPLAY CONTROL APPARATUS AND CONTROL METHOD THEREOF

Canon Kabushiki Kaisha, ...

1. An apparatus comprising:
a detection unit configured to detect a touch onto a display screen of a display unit;
a display control unit configured to perform control:
to display on the display unit first guide information indicating functions executable by an operation following a movement
of the touch position from an original position on the display screen to a current position on the display screen without
releasing the detected touch,

to display second guide information indicating a function among the functions indicated by the first guide information to
be executed at a time when the detected touch is released when the movement of the touch position satisfies a first condition
without releasing the detected touch, and

to terminate display of the second guide information when the movement of the touch position of the detected touch satisfies
a second condition without releasing the touch after the movement of the touch position satisfies the first condition, the
second guide information indicating whether the function to be executed is invoked; and

a control unit configured to perform control to execute the function indicated by the second guide information, when the detected
touch is released while the second guide information is being displayed.

US Pat. No. 9,134,649

IMAGE FORMING APPARATUS

CANON KABUSHIKI KAISHA, ...

1. An image forming apparatus comprising:
an image bearing member capable of bearing a developer image that is formed by supplying a developer to a latent image formed
on a surface thereof;

a developer carrying member that is provided to be capable of rotating while carrying the developer, and that supplies the
developer to the image bearing member by contacting the image bearing member;

a regulating member that regulates a layer thickness of the developer carried on the developer carrying member; and
a voltage applying device for applying a voltage to the developer carrying member and the regulating member,
wherein the developer carrying member includes a conductive base layer and a surface layer covering the base layer, and
when a volume resistance of the surface layer is ?c, a film thickness thereof is dc, and a relative dielectric constant thereof
is ?c,

a surface charge density of the developer on the developer carrying member, the film thickness of which has been regulated
by the regulating member, is q/s, a relative dielectric constant thereof is ?t, and a layer thickness thereof is dt,

a potential difference between the developer carrying member and the regulating member is V, and
a time required for the developer to pass through a contact region between the developer carrying member and the regulating
member after entering the contact region as the developer carrying member rotates is T,


is satisfied.

US Pat. No. 9,129,718

X-RAY WAVEGUIDE

Canon Kabushiki Kaisha, ...

1. A X-ray waveguide comprising:
a core configured to guide X-rays having a wavelength band in which the real part of refractive index of material is smaller
than 1; and

a cladding configured to confine the X-rays in the core,
wherein the core has a one-dimensional periodic structure in which a plurality of layers respectively formed of inorganic
materials having different real parts of refractive indices are periodically laminated,

the core and the cladding are configured so that a critical angle for total reflection for the X-rays at an interface between
the core and the cladding is larger than a Bragg angle due to a periodicity of the one-dimensional periodic structure, and

a critical angle for total reflection for the X-rays at an interface between layers in the one-dimensional periodic structure
is smaller than the Bragg angle due to the periodicity of the one-dimensional periodic structure.

US Pat. No. 9,128,651

PRINTING APPARATUS, METHOD OF CONTROLLING PRINTING APPARATUS, AND STORAGE MEDIUM

Canon Kabushiki Kaisha, ...

1. A printing apparatus which prints an image on a print medium by a plurality of recording elements, comprising:
a conveying unit configured to convey the print medium in a conveyance direction;
an acquisition unit configured to acquire a width, in a direction which crosses the conveyance direction, of the print medium
conveyed by the conveying unit, wherein the width is detected by a sensor arrange in the conveyance direction between the
most upstream element and the most downstream element of the plurality of recording elements; and

a printing unit configured to determine whether the width has been detected by the sensor, and in response to determining
that the width has been detected by the sensor, configured to print, on the print medium, an image of a size in accordance
with the acquired width of the print medium using the recording elements so that a first part of the recording elements is
used for printing on an area which has been conveyed downstream from the sensor in the conveyance direction when the detection
is performed.

US Pat. No. 9,128,445

PRINTING APPARATUS, METHOD FOR CONTROLLING PRINTING APPARATUS, AND STORAGE MEDIUM

Canon Kabushiki Kaisha, ...

1. A printing apparatus configured to feed a sheet from any one of a plurality of sheet storage units, the printing apparatus
comprising:
a setting unit configured to set a sheet storage unit included in the plurality of sheet storage units as a particular sheet
storage unit to be used when a sheet storage unit to be used for a job has not been specified;

a specifying unit configured to specify a type of sheet to be stored in a sheet storage unit included in the plurality of
sheet storage units; and

a control unit configured to perform control so that the specifying unit does not specify a particular type in the sheet storage
unit set by the setting unit.

US Pat. No. 9,125,591

ACOUSTIC-WAVE MEASURING APPARATUS AND METHOD

Canon Kabushiki Kaisha, ...

1. An acoustic-wave measuring apparatus comprising:
a holding unit configured to hold a subject;
an irradiation unit configured to irradiate the subject with light;
an acoustic-wave detecting unit configured to receive acoustic waves generated within the subject due to irradiation with
the light irradiated from the irradiation unit, the acoustic-wave detecting unit being disposed at a side of the holding unit
opposite to the subject;

an image pickup unit configured to acquire, through the holding unit, an image of a shape of the subject held by the holding
unit;

a coordinate transforming unit configured to transform coordinates of a measurement position designated by an observer, on
the image acquired by the image pickup unit to coordinates on the holding unit; and

a position control unit configured to move at least one of the irradiation unit and the acoustic-wave detecting unit on the
holding unit based on information output from the coordinate transforming unit.

US Pat. No. 9,122,437

INFORMATION PROCESSING APPARATUS, METHOD, AND MEDIUM FOR MANAGING STATUS INFORMATION ABOUT AN IMAGE FORMING APPARATUS

Canon Kabushiki Kaisha, ...

1. An information processing apparatus configured to manage status information about an image forming apparatus, the information
processing apparatus comprising:
a history management unit configured to manage job history information recorded by the image forming apparatus;
an apparatus management unit configured to manage whether the image forming apparatus is permitted to enter a power saving
mode;

a reception unit configured to receive status information from the image forming apparatus;
a determination unit configured to, if the reception unit has not received status information for a certain time period, determine
that a status of the image forming apparatus is an unknown status or a status indicative of the power saving mode; and

an output unit configured to, if the determination unit determines that the status of the image forming apparatus is the unknown
status, output, to an administrator, information indicating that the status of the image forming apparatus is the unknown
status,

wherein if the determination unit determines that the status of the image forming apparatus is the status indicative of the
power saving mode, an output of information to the administrator by the output unit is not performed.

US Pat. No. 9,116,640

IMAGE PROCESSING APPARATUS, DISPLAY METHOD, AND STORAGE MEDIUM

CANON KABUSHIKI KAISHA, ...

1. An apparatus having a reading unit configured to read a document to acquire data and a print unit configured to execute
print, the apparatus comprising:
an execution unit configured to execute a service for communicating with an external service which manages data to be uploaded
in an external apparatus; and

a web browser configured to display an operation screen on an operation unit, the operation screen being generated by a web
application,

wherein the execution unit controls display on the web browser to display on the operation screen a name of data whose format
matches a format of the data acquired in the reading unit or a format of printable data in the print unit, wherein the format
determines whether the data can be uploaded from the external apparatus,

wherein the web application determines whether the format of the name of data matches the format of the data acquired in the
reading unit or the format of printable data in the print unit,

wherein the execution unit performs control to display on the operation screen a download button for a user to instruct download
of the data from the external apparatus by associating with a name of the data whose format matches to that of the printable
data, among the data pieces whose names are displayed on the operation screen, and

wherein the execution unit receives an instruction to download data according to a user's operation of the download button
and, if a size of data with the name associated with the download button exceeds a size of data which can be printed from
the web browser, the execution unit performs control to display on the operation screen that print cannot be executed.

US Pat. No. 9,118,608

COMMUNICATION APPARATUS, CONTROL METHOD THEREFOR, AND COMPUTER-READABLE STORAGE MEDIUM

CANON KABUSHIKI KAISHA, ...

1. A communication apparatus which communicates with a terminal, which has a transmission destination IP address, as a packet
transmission destination via a network, comprising:
a routing table configured to hold a next transmission destination IP address as route information;
an ARP table configured to manage an IP address and a MAC address of the terminal on the network in association with each
other;

a connection management table configured to hold connection management information as information added to each connection
in TCP communication;

a route decision unit configured to decide a next transmission destination IP address by referring to said routing table in
connection establishment processing in TCP communication;

a MAC address decision unit configured to decide a next transmission destination MAC address associated with the next transmission
destination IP address by referring to said ARP table;

a storage unit configured to store the transmission destination IP address and the next transmission destination MAC address
as the connection management information in said connection management table; and

a creation unit configured to create a transmission packet using the transmission destination IP address and the next transmission
destination MAC address which are managed by the connection management information stored in said connection management table.

US Pat. No. 9,110,401

INTERVAL GUARANTEE MEMBER, DEVELOPING APPARATUS, PROCESS CARTRIDGE

Canon Kabushiki Kaisha, ...

1. An interval guarantee member configured to maintain a distance between an image bearing member on which a latent image
is formed and a developer bearing member configured to bear a developer, comprising:
a first image bearing member side sliding portion configured to come into sliding contact with the image bearing member on
an upstream side of a line connecting a center of the image bearing member and a center of the developer bearing member in
the direction of rotation of the image bearing member when the image bearing member and the developer bearing member rotate
so that surfaces oppose to each other thereof move in the same direction;

a first developing side sliding portion configured to come into sliding contact with the developer bearing member on an upstream
side of a line connecting a center of the image bearing member and a center of the developer bearing member in the direction
of rotation of the developer bearing member when the image bearing member and the developer bearing member rotate so that
surfaces oppose to each other thereof move in the same direction;

a second image bearing member side sliding contact portion configured to come into sliding contact with the image bearing
member on an downstream side of the first image bearing member side sliding portion in the direction of rotation of the image
bearing member; and

a second developing side sliding contact portion configured to come into sliding contact with the developer bearing member
on an downstream side of the first developing side sliding contact portion in the direction of rotation of the developer bearing
member, wherein

a distance between the first image bearing member side sliding contact portion and the first developing side sliding contact
portion is longer than a distance between the second image bearing member side sliding contact portion and the second developing
side sliding contact portion, and the first image bearing member side sliding contact portion and the first developer side
sliding contact portion come into contact with the image bearing member and the developer bearing member respectively, whereby
the interval guarantee member is prevented from moving in the direction of rotation of the image bearing member and the developer
bearing member.

US Pat. No. 9,110,439

CARTRIDGE HAVING A GRIP PROVIDED ON A FRAME

Canon Kabushiki Kaisha, ...

1. A cartridge for detachably mounting to an apparatus body of an image forming apparatus in a mounting and dismounting direction,
the cartridge comprising:
a frame formed of a first resin; and
a grip provided on the frame for gripping the cartridge when the cartridge is mounted on or dismounted from the apparatus
body, the grip including a first molded portion integrally molded with the frame, and a second molded portion formed of a
second resin integrally molded with the first molded portion after the molding of the first molded portion,

wherein the second molded portion is molded on the first molded portion in the mounting and dismounting direction.

US Pat. No. 9,113,062

IMAGING APPARATUS

Canon Kabushiki Kaisha, ...

1. An imaging apparatus that incorporates a wireless communication unit for performing wireless communication, the imaging
apparatus comprising:
an optical member that guides light incident on the imaging apparatus to an eyepiece optical system and has a reflection surface
that reflects incident light toward the eyepiece optical system;

a outer covering member that cover the optical member; and
a substrate fixing member that fixes a substrate on which an antenna section of the wireless communication unit is mounted,
wherein the wireless communication unit is arranged in a space formed between the optical member and the outer covering member,
wherein a ground section of the wireless communication unit is connected to the substrate fixing member at a portion opposite
to the antenna section so that the wireless communication unit is arranged substantially in parallel with the reflection surface
of the optical member, and

wherein the substrate fixing member is attached to a member for holding the optical member so as to be electrically connected
to a ground section of the imaging apparatus.

US Pat. No. 9,098,781

PRINTING APPARATUS FOR MOVING A PRINT CARRIAGE AND WRITING TAG INFORMATION IN A WIRELESS TAG ON A PAPER SHEET

CANON KABUSHIKI KAISHA, ...

1. A printing apparatus comprising:
a print carriage incorporating a printhead and a communication unit configured to perform short distance wireless communication;
a movement control unit configured to move said print carriage;
a detection unit configured to detect, when said movement control unit moves said print carriage to cause said printhead to
execute printing of print data, a wireless tag on a paper sheet using said communication unit; and

a write unit configured to write tag information in the wireless tag detected by said detection unit,
wherein the movement control unit moves said print carriage to scan a width corresponding to a wireless tag search range on
the paper sheet before a number of wireless tags detected by said detection unit reaches a number of target wireless tags
which are targets of write processing by said write unit, and moves said print carriage to scan a width corresponding to a
printing range of the print data after the number of wireless tags detected by said detection unit reaches the number of target
wireless tags.

US Pat. No. 9,100,530

IMAGE PROCESSING APPARATUS, IMAGE PROCESSING METHOD AND STORAGE MEDIUM

Canon Kabushiki Kaisha, ...

1. An image processing apparatus comprising a processor for executing a method comprising:
an acquisition step of acquiring a frame image;
an identification step of identifying a single minimum pixel value, wherein the single minimum pixel value is a minimum value
of a first minimum pixel value, a second minimum pixel value, and a third minimum pixel value, the first minimum pixel value
being a minimum value of pixel values of a first color component of all pixels within a predetermined area including a pixel
of interest in the frame image, the second minimum pixel value being a minimum value of pixel values of a second color component
of all pixels within the predetermined area including the pixel of interest in the frame image, and the third minimum pixel
value being a minimum value of pixel values of a third color component of all pixels within the predetermined area including
the pixel of interest in the frame image;

a replacing step of replacing pixel values of the first, second, and third color components of the pixel of interest in the
frame image with the single minimum pixel value identified in said identification step such that respective first, second,
and third pixel values of the first, second, and third color components of the pixel of interest are equal;

a low-pass filtering step of applying a low-pass filter processing to a preprocessed image, wherein the preprocessed image
is generated based on replacing the pixel values in the replacing step; and

an output step of outputting a first subframe image based on a result of the low-pass filter processing for the preprocessed
image and of outputting a second subframe image based on a difference between the frame image acquired in the acquisition
step and the first subframe, wherein the first and second subframes are output alternately in the output step.

US Pat. No. 9,095,256

OPHTHALMOLOGIC IMAGING APPARATUS

Canon Kabushiki Kaisha, ...

1. An ophthalmologic imaging apparatus, comprising:
an irradiation unit configured to irradiate an eye to be inspected with a measuring beam;
a fixation lamp;
a lighting position changing unit configured to change a lighting position of the fixation lamp;
an optical path length difference changing unit configured to change an optical path length difference between the measuring
beam and a reference beam corresponding to the measuring beam;

a control unit configured to control, when the lighting position of the fixation lamp is changed by the lighting position
changing unit, the optical path length difference changing unit to change the optical path length difference with a changing
amount corresponding to a changing amount of the lighting position of the fixation lamp; and

an acquisition unit configured to acquire a tomographic image of the eye to be inspected based on a beam obtained by combining
the reference beam with a return beam from the eye to be inspected, which is irradiated with the measuring beam.

US Pat. No. 9,099,656

ORGANIC COMPOUND AND ORGANIC LIGHT-EMITTING DEVICE INCLUDING SAME

CANON KABUSHIKI KAISHA, ...

1. A naphtho[2?,3?:5,6]indeno[1,2,3-cd]pyrene derivative represented by general formula (1):

wherein in general formula (1), R1 to R16 are each independently selected from a hydrogen atom, a halogen atom, substituted or unsubstituted alkyl groups, substituted
or unsubstituted alkoxy groups, substituted or unsubstituted amino groups, substituted or unsubstituted aryl groups, and substituted
or unsubstituted heterocyclic groups, and at least one of R3, R4, R9, and R10 is selected from substituted or unsubstituted aryl groups and substituted or unsubstituted heterocyclic groups.

US Pat. No. 9,099,941

VIBRATION TYPE DRIVING DEVICE

Canon Kabushiki Kaisha, ...

1. A vibration type driving device comprising:
a vibrator configured to make an elliptic motion of a contact portion by combining vibrations in different vibration modes;
and

a driven body configured to be rotated relative to the vibrator by the elliptic motion while being in contact with the contact
portion,

wherein a contact pressure of the contact portion with the driven body is lower on a radial inner side than on a radial outer
side in a radial direction of the rotation.

US Pat. No. 9,100,520

DETERMINING WHETHER A SCANNED PAGE IS BLANK OR CONTAINS IMAGE DATA

Canon Kabushiki Kaisha, ...

1. An image processing apparatus comprising:
a display unit configured to display preview images of a plurality of image data;
a determining unit configured to determine whether each of the plurality of image data is a blank page;
a display control unit configured to display a preview image of image data determined not to be a blank page on the display
unit in a first display mode, and to display a preview image of image data determined to be a blank page on the display unit
in a second display mode; and

a change unit configured to: (i) when an instruction for changing a display mode of a selected preview image from the first
display mode to the second display mode is executed on the display unit, change the display mode on the display unit from
the first display mode to the second display mode and change a determination result of image data corresponding to the preview
image to a blank page; and (ii) when an instruction for changing a display mode of a selected preview image from the second
display mode to the first display mode is executed on the display unit, change the display mode on the display unit from the
second display mode to the first display mode and change a determination result of image data corresponding to the preview
image to a non-blank page.

US Pat. No. 9,095,882

PIEZOELECTRIC DEVICE, DUST REMOVING APPARATUS, AND IMAGING APPARATUS

Canon Kabushiki Kaisha, ...

1. A piezoelectric device comprising:
an elastic member;
an electrical-mechanical energy conversion element fixed to the elastic member, configured to cause the elastic member to
generate vibration; and

a supporting member that supports the elastic member,
wherein the electrical-mechanical energy conversion element comprises a piezoelectric material in which, in a usage temperature
range of the piezoelectric device, a piezoelectric constant decreases along with temperature rise, and

wherein a supporting member that supports the elastic member comprises a material in which, in the usage temperature range
of the piezoelectric device, Q value increases along with temperature rise.

US Pat. No. 9,091,974

IMAGE FORMING APPARATUS AND IMAGE FORMING METHOD

Canon Kabushiki Kaisha, ...

1. An image forming apparatus for forming an image on a recording material, the image forming apparatus comprising:
an image processing section that converts image data into a plurality of pixel data;
an image forming section that forms a toner image based on the plurality of pixel data onto the recording material; and
a fixing section that fixes the toner image onto the recording material by heating the recording material on which the toner
image is formed while conveying the recording material through a nip portion,

wherein the plurality of pixel data corresponding to one sheet of the recording material are divided into a plurality of areas,
each of which is composed of a predetermined number of pixels,

wherein the image processing section selects a fewer number of pixels than the predetermined number of pixels, regardless
of their density information, within each of the areas, and acquires density information of the fewer number of the pixels
selected,

wherein the image processing section finally does not acquire density information from pixels, except for the fewer number
of the pixels selected, within each of the areas,

wherein the image processing section determines a maximum value within the density information acquired, and
wherein the fixing section fixes the toner image for which the density information has been acquired, under a fixing condition
according to the maximum value.

US Pat. No. 9,092,232

INFORMATION PROCESSING APPARATUS, INFORMATION PROCESSING METHOD, ALTERNATE RESPONSE APPARATUS, RESPONSE METHOD, CONTROL PROGRAM, AND NETWORK SYSTEM

CANON KABUSHIKI KAISHA, ...

1. An information processing apparatus comprising:
a memory storing computer-executable code; and
a processor to execute the code to perform steps comprising:
a request step of issuing, to a network, a request for information related to a peripheral device at a predetermined interval;
a reception step of receiving, as a response to the request, information related to the peripheral device which is not in
compliance with a predetermined network discovery protocol from the peripheral device;

a specification step of specifying, as information required for an installation of a control program for controlling the peripheral
device, identification information for identifying the peripheral device from the information related to the peripheral device
previously received by the reception step, when a discovery request for the predetermined network discovery protocol is received
from a client apparatus;

a creating step of creating a message for the predetermined network discovery protocol by using the specified identification
information; and a transmission step of transmitting the message to the client apparatus,

wherein the identification information comprises at least one of manufacturer information and model information of the peripheral
device.

US Pat. No. 9,093,927

ACTUATOR WITH IONIC LIQUID

Canon Kabushiki Kaisha, ...

1. An actuator comprising:
a pair of electrodes facing each other;
an intermediate layer containing an ionic liquid and arranged between the pair of electrodes,
the electrodes and the intermediate layer being bent and deformed when a potential difference larger than a potential window
of the ionic liquid is applied between the electrodes; and

insulating layers that suppress direct contact between ions of the ionic liquid and the electrodes, the insulating layers
being arranged between the intermediate layer and the electrodes

wherein the insulating layers contain an insulating polymer and highly dielectric inorganic particles; and
wherein in the insulating layers, an amount of the highly dielectric inorganic particles may be 10% by weight or more and
90% by weight or less relative to an amount of the organic polymer.

US Pat. No. 9,091,869

TERAHERTZ-WAVE ELEMENT, TERAHERTZ-WAVE DETECTING DEVICE, AND TERAHERTZ TIME-DOMAIN SPECTROSCOPY SYSTEM

Canon Kabushiki Kaisha, ...

1. A terahertz-wave element comprising:
a waveguide that includes an electro-optic crystal and allows light to propagate therethrough; and
a coupling member that causes a terahertz wave to enter the waveguide,
wherein a propagation state of the light propagating through the waveguide changes as the terahertz wave enters the waveguide
via the coupling member,

wherein the terahertz-wave element is of a Cerenkov phase-matching type, and
wherein the coupling member includes a circular conical surface which collects a terahertz wave linearly.

US Pat. No. 9,090,077

LIQUID CONTAINER

CANON KABUSHIKI KAISHA, ...

1. An ink container comprising:
a casing including an ink chamber configured to contain an ink and having an ink supply port configured to supply the ink
in the ink chamber to an outside of the casing, the casing having a bottom wall having the ink supply port, a top wall and
a plurality of side walls, the bottom wall, the top wall and the plurality of side walls being defined by orientation in a
state that the ink container is oriented with the ink supply port facing downward, the plurality of side walls having a first
side wall and a second side wall opposed to the first side wall;

a first engaging projection provided on the first side wall;
a second engaging projection closer to the second side wall than to the first side wall; and
an electrical contact closer to the bottom wall than to the top wall and closer to the second side wall than to the first
side wall, the electrical contact being inclined relative to the bottom wall and the second side wall.

US Pat. No. 9,086,659

IMAGE FORMING APPARATUS

Canon Kabushiki Kaisha, ...

1. An image forming apparatus, comprising:
a movable photosensitive member;
an exposure unit configured to form a latent image on the photosensitive member at a predetermined exposure timing to correspond
to a position of the latent image in a direction perpendicular to a moving direction of the photosensitive member;

a developing unit configured to form toner image from the latent image on the photosensitive member;
a movable endless intermediate transfer belt configured to have transferred to the endless intermediate belt the toner image
from the photosensitive member;

a steering roller configured to stretch the intermediate transfer belt and configured to incline so as to move the intermediate
transfer belt in a width direction;

a sensor configured to detect a position of the intermediate transfer belt in the width direction;
a controller configured to incline the steering roller based on a detection result of the sensor so as to maintain the position
of the intermediate belt in the width direction within a predetermined range;

a transfer device configured to transfer the toner image on the intermediate transfer belt to a recording material at a transfer
portion;

an output portion configured to output an estimated moving amount of the intermediate transfer belt, the estimated moving
amount being a predicted value of moving amount of the intermediate transfer belt in the width direction which is determined
based on a plurality of historical data of the sensor;

a moving device configured to move in the width direction a position of a recording material conveyed to the transfer portion;
and

an adjusting portion configured to adjust at least one of the position of a recording material in the width direction and
the predetermined exposure timing so that a position of the toner image transferred onto a recording material with respect
to the width direction is not at an incorrect position when the intermediate transfer belt moves in width direction within
the predetermined range, based on information from the output portion.

US Pat. No. 9,086,662

IMAGE FORMING APPARATUS THAT CONTROLS PRINT START TEMPERATURE OF FIXING SECTION, METHOD OF CONTROLLING THE SAME, AND STORAGE MEDIUM

CANON KABUSHIKI KAISHA, ...

4. A method of controlling an image forming apparatus including an image forming unit that forms an image by transferring
a color material to a recording medium and fixing the color material onto the recording medium using a fixing section, the
method comprising:
a reception step of receiving a print job;
a warm-up step of raising a temperature of the fixing section in a case where the reception step receives the print job;
a generation step of generating a plurality of pages of images to be formed on recording mediums;
a determining step of determining, in a case where the generation step generates predetermined pages of images, whether or
not all of the predetermined pages of images are for text images; and

a controlling step of:
controlling, in a case where the determining step determines that all of the predetermined pages of images are for the text
images, the image forming unit so that printing starts when the temperature of the fixing section reaches a first temperature
that enables formation of text images representing only text; and

controlling, in a case where the determination step determines that all of the predetermined pages of images are not for the
text images, the image forming unit so that printing starts when the temperature of the fixing section reaches a second temperature,
which is higher than the first temperature, that enables formation of graphic images, including images other than the text
images.

US Pat. No. 9,085,172

RECORDING METHOD AND RECORDING APPARATUS

CANON KABUSHIKI KAISHA, ...

1. A method for recording images on a sheet having a first and a second side, using at least one inkjet recording head having
nozzles, comprising:
a first supply step of supplying a first humidified gas to the first side of the sheet, with a first supply port;
a humidifying step of supplying a second humidified gas to a space where the nozzles are exposed, with a second supply port
located at a position closer to the recording head than the first supply port;

a first recording step of recording in the space where atmosphere humidity is increased, using the inkjet recording head,
on the first side of the sheet having a moisture content increased in the first supply step;

a heating step of heating the sheet on which an image has been recorded on the first side for drying;
a second supply step of supplying the first humidified gas to the second side of the sheet having been heated in the heating
step, with the first supply port; and

a second recording step of recording in the space in which the second humidified gas is supplied, using the inkjet recording
head, on the second side of the sheet having the moisture content increased in the second supply step,

wherein an amount of humidification in the first supply step is different from that in the second supply step.

US Pat. No. 9,087,237

INFORMATION PROCESSING APPARATUS, CONTROL METHOD THEREOF, AND STORAGE MEDIUM

Canon Kabushiki Kaisha, ...

1. An information processing apparatus comprising:
an image management unit configured to manage a multi-viewpoint image group;
an object information management unit configured to manage information about objects and relationship information indicating
a relationship between the objects;

a specification unit configured to specify an object in each image of the image group by performing an object recognition
process on the image based on focal length information and the information about the objects;

a determination unit configured to determine a target object based on the relationship information; and
an image generation unit configured to generate an image that contains the determined target object specified by the specification
unit.

US Pat. No. 9,088,679

IMAGE FORMING APPARATUS, AND CONTROL METHOD AND PROGRAM FOR THE SAME

CANON KABUSHIKI KAISHA, ...

1. An image forming apparatus comprising:
a reading unit configured to read an original;
a conveying unit configured to convey an original placed on a tray to a reading position of the reading unit and to discharge
the original conveyed to the reading position, wherein a plurality of originals placed on the tray are successively, one by
one, conveyed and discharged by the conveying unit; and

a control unit configured to control the reading unit such that:
(i) the reading unit reads the conveyed originals from a first original to an Nth original of the plurality of originals placed
on the tray, where N is a predetermined number, and

(ii) the reading unit does not read the conveyed originals from the (N+1)th original to the last original of the plurality
of originals placed on the tray.

US Pat. No. 9,082,168

RADIATION IMAGING APPARATUS, RADIATION IMAGE PROCESSING APPARATUS, AND IMAGE PROCESSING METHOD

CANON KABUSHIKI KAISHA, ...

1. A radiation image processing apparatus comprising:
an obtaining unit configured to obtain a radiation image signal and electrical signals, the radiation image signal being read
during a first radiation imaging from a radiation detector including a plurality of pixels, and the electrical signals being
read in succession from the radiation detector continuously after the reading of the radiation image signal and corresponding
to accumulated electric charges of the plurality of pixels;

a determination unit configured to determine whether or not to correct another radiation image signal read from the radiation
detector during a second radiation imaging that is performed continuously after the reading of the electrical signals based
on a temporal change in the obtained electrical signals; and

a correction unit configured to correct said another radiation image signal based on a result of the determination and dark
current data which is obtained after the first radiation imaging based on the temporal charge in the obtained electrical signals.

US Pat. No. 9,082,185

INFORMATION PROCESSING APPARATUS, PROCESSING METHOD THEREFOR, AND NON-TRANSITORY COMPUTER-READABLE STORAGE MEDIUM

CANON KABUSHIKI KAISHA, ...

1. An information processing apparatus comprising:
an obtaining unit arranged to obtain pattern data including a plurality of measurement lines and a reference line which has
a plurality of intersection points with the plurality of measurement lines, wherein the reference line has a specific feature
defined by a pattern having displacement on a line which connects two of the intersection points;

an image capturing unit configured to capture an image of an object onto which projection pattern light, based on the pattern
data obtained by the obtaining unit, is projected;

an intersection extraction unit configured to extract the intersection points from the image captured by the image capturing
unit; and

an information obtaining unit configured to obtain identification information which is used to identify each measurement line
in the plurality of measurement lines, based on the specific feature.

US Pat. No. 9,079,432

SHEET CONVEYING DEVICE WITH SHEET EDGE GUIDE DOWNSTREAM OF BUFFER UNIT

Canon Kabushiki Kaisha, ...

1. A sheet conveying apparatus for conveying a sheet in a conveying direction comprising:
a correcting unit for correcting a positional deviation of the sheet by guiding with a guide member an edge of the sheet in
a crossing direction that crosses to the conveying direction;

a plurality of conveying roller pairs including a first conveying roller pair and a second conveying roller pair which is
positioned downstream of the first conveying roller pair in the conveying direction and upstream of the guide member in the
conveying direction; and

a conveying control unit configured to control conveying of the sheet by driving of the plurality of conveying roller pairs,
wherein

a conveying control unit controls conveying the sheet such that
(i) the first conveying roller pair is driven before the sheet is nipped by the second conveying roller pair, and
(ii) the first conveying roller pair is driven and the second conveying roller pair is not driven after the sheet is nipped
by the second conveying roller pair within a predetermined period,

wherein the conveying control unit controls so as to continuously drive the first conveying roller pair while correcting the
positional deviation by the correcting unit after stopping driving of second conveying roller pair, and

wherein the conveying control unit controls a moving unit configured to move the second conveying roller pair between a position
where the second conveying roller pair can nip the sheet and a position where each roller of the second conveying roller pair
is separate from each other after correcting the positional deviation by the correcting unit.

US Pat. No. 9,061,489

SUBSTRATE FOR INKJET HEAD AND INKJET HEAD HAVING PROTECTION LAYER INCLUDING INDIVIDUAL SECTIONS CORRESPONDING TO HEATING RESISTORS

Canon Kabushiki Kaisha, ...

1. A substrate for an inkjet head comprising:
a base;
a plurality of heating resistors being disposed on the base and producing heat for heating ink in a case where the heating
resistors are energized;

a first protection layer covering the heating resistors and having electrical conductivity; and
a second protection layer being disposed between the first protection layer and the heating resistors, the second protection
layer electrically insulating the first protection layer from the heating resistors,

wherein the first protection layer includes individual sections provided at positions corresponding to the plurality of heating
resistors and a common section which commonly connects the individual sections,

wherein the individual sections and the common section are connected via connect sections which include at least one of Ir
and Ru,

wherein the connect sections are formed to have a thickness smaller than that of the individual sections, and
wherein the connect sections are eluted by an electrochemical reaction that occurs between the connect sections and ink so
that an electrical connection between the individual sections and the common section is cut.

US Pat. No. 9,064,351

DISPLAY CONTROL APPARATUS AND METHOD FOR CONTROLLING THE SAME

Canon Kabushiki Kaisha, ...

1. A display control apparatus comprising:
a moving image display unit configured to control a display apparatus to display a moving image thereon;
a reading unit configured to read animation information, different from the moving image, including a plurality of frame images;
a detection unit configured to detect touch on the display apparatus; and
a display control unit configured to control the display apparatus:
(a) to display a first frame image of the animation information in a display area where the moving image is being displayed
in response to detecting touch on a specific position of the display apparatus by the detection unit when the moving image
is being displayed on the display aparatus,

(b) to keep a display of frame images of the animation information without starting a transition display of frame images of
the animation information while the touch on the display apparatus which caused the first frame image of the animation information
to be displayed is being detected, and

(c) to start a transition display of frame images of the animation information in response to detecting, by the detection
unit, that the touch on the display apparatus which caused the first frame image of the animation information to be displayed
is released.

US Pat. No. 9,057,969

ELECTROPHOTOGRAPHIC PHOTOSENSITIVE MEMBER, PROCESS CARTRIDGE, AND ELECTROPHOTOGRAPHIC APPARATUS

Canon Kabushiki Kaisha, ...

1. An electrophotographic photosensitive member comprising:
a support; and
a photosensitive layer formed on the support,
wherein the photosensitive layer comprises:
a compound represented by the following formula (1); and
a gallium phthalocyanine, and wherein, the content of the compound represented by the formula (1) in the photosensitive layer
is from 10 ppm to 1,000 ppm (mass ratio) based on the gallium phthalocyanine,

H2N—CH2—R1—CH2—NH2  (1)

wherein, in the formula (1),
R1 represents a single bond, a substituted or unsubstituted alkylene group having 1 to 10 main-chain carbon atoms,

a substituent of the substituted alkylene group is an alkyl group having 1 to 3 carbon atoms, an alkyl group having 1 to 3
carbon atoms and substituted with an amino group, or a hydroxy group,

one of the carbon atoms in the main chain of the alkylene group may be replaced with an oxygen atom, a sulfur atom, or a bivalent
group represented by the formula —NR2—, and

R2 represents a hydrogen atom, an alkyl group having 1 to 3 carbon atoms, or an alkyl group having 1 to 3 carbon atoms and substituted
with an amino group.

US Pat. No. 9,055,911

RADIATION GENERATING DEVICE AND RADIATION IMAGING APPARATUS

Canon Kabushiki Kaisha, ...

1. A radiation generating device comprising:
an arm configured to support a radiation generating unit that generates radiation;
a post configured to support the arm;
a movable portion configured to support the post and to be movable on a floor; and
a supporting foot portion that is rotatable with respect to the movable portion.

US Pat. No. 9,053,060

INFORMATION PROCESSING APPARATUS HAVING FILE SYSTEM CONSISTENCY RECOVERY FUNCTION, AND CONTROL METHOD AND STORAGE MEDIUM THEREFOR

CANON KABUSHIKI KAISHA, ...

1. An information processing apparatus having a first storage unit that stores a first program and a second storage unit that
stores a second program, for degeneracy operation, having less functions than the first program, comprising:
a hardware processor configured to execute the first program and the second program selectively;
a detection unit configured to detect a state of a file system of the first storage unit before the first program is executed
by said processor;

a recovery unit configured to recover the file system of the first storage unit in a case where said detection unit detects
an abnormality in the file system of the first storage unit; and

a measurement unit configured to measure a time period elapsed from, in a case where said detection unit detects an abnormality
in the file system of the first storage unit, the detection by the detection,

wherein said processor executes the second program instead of the first program, whereby the information processing apparatus
operates the degeneracy operation, in a case where the time period measured by said measurement unit becomes greater than
a predetermined value, and

wherein said recovery unit continues to recover the file system of the first storage unit, without said processor executing
the second program, in a case where the time period measured by said measurement unit is less than the predetermined value.

US Pat. No. 9,054,147

ALIGNMENT METHOD, ALIGNMENT APPARATUS, AND ORGANIC ELECTROLUMINESCENT (EL) ELEMENT MANUFACTURING APPARATUS

CANON KABUSHIKI KAISHA, ...

1. A method of carrying out alignment between a substrate and a mask, the substrate and the mask having respective alignment
marks, the method comprising:
irradiating the substrate with laser light and to measure vibrations of the substrate in a direction of gravity to produce
vibration data;

producing an antiphase vibrational wave, based on the corresponding vibration data produced in the irradiating step;
applying the antiphase vibrational wave to the substrate, thereby reducing the vibrations of the substrate in the direction
of gravity;

at a time when the measured vibrations of the substrate in the direction of gravity fall within a predetermined value that
is set in advance, taking images of relative positions of the respective alignment marks provided on the substrate and the
mask, from the substrate side, in the direction of gravity, and producing data corresponding to the obtained images;

calculating an amount of movement of one of the substrate and the mask in a horizontal direction, based on the data corresponding
to the obtained images; and

moving the one of the substrate and the mask, based on the calculated amount of movement.

US Pat. No. 10,070,837

MEDICAL IMAGING APPARATUS, PROGRAM INSTALLABLE IN MEDICAL IMAGING APPARATUS, AND MEDICAL IMAGING METHOD

Canon Kabushiki Kaisha, ...

1. A medical imaging apparatus comprising:a cardiac lumen region identifying unit configured to identify, based on signal values of a region where blood is flowing, a cardiac lumen region from a medical image including a heart region;
a myocardium identifying unit configured to identify a face of a myocardium region obtained by extending a surface of the cardiac lumen region, identified by the cardiac lumen region identifying unit, by a certain distance at a time toward a myocardium side; and
a generating unit configured to generate a three-dimensional color-coded image in which the face of the myocardium region, identified by the myocardium identifying unit, is colored in colors according to signal values of the medical image corresponding to positions on the face of the myocardium region.

US Pat. No. 10,036,935

IMAGING APPARATUS AND MOUNT ADAPTER

Canon Kabushiki Kaisha, ...

1. An imaging apparatus provided with a mount section on which a lens device and a mount adapter are mountable comprising:a contact unit configured to have a camera side contact portion electrically connected to an accessory side contact portion provided in the lens device or the mount adapter; and
a moving mechanical unit configured to support the contact unit movably in the direction of an optical axis corresponding to the mount section,
wherein the contact unit is movable to a first position in a direction parallel to the direction of the optical axis and a second position that is different from the first position by the moving mechanical unit, in accordance with a type of the lens device or the mount adapter to be mounted on the mount section.

US Pat. No. 9,819,829

IMAGE PROCESSING APPARATUS AND CONTROL METHOD

CANON KABUSHIKI KAISHA, ...

1. An image processing apparatus having a service provider for outputting a first log representing information about a job
executed according to a request of a service for providing a function in cooperation with the image processing apparatus,
comprising:
a memory storing instructions as an expense management application; and
a processor which is capable of executing the instructions causing the image processing apparatus to:
request an expense management apparatus to perform user authentication processing in a case where a user accesses the service;
request the service provider to perform a job in response to a reception of a request from a web application via a network;
acquire matter information of the user authenticated by the expense management apparatus;
monitor the first log output by the service provider and acquire job information about a job of the user executed by the service
provider according to the request from the web application, from the first log; and

register expense information based on the acquired job information, as expense information of the acquired matter information,
to the expense management apparatus.

US Pat. No. 9,812,473

IMAGE SENSOR AND IMAGE CAPTURING APPARATUS

Canon Kabushiki Kaisha, ...

1. An image sensor comprising:
an image sensing plane that receives light from a subject whose image has been formed by a lens,
wherein the image sensing plane has a central flat planar portion and a peripheral curved shape portion,
wherein the central flat planar portion is arranged in a region of the image sensing plane which is less influenced by field
curvature aberration of the lens and the peripheral curved shape portion is arranged in a region of the image sensing plane
which is more influenced by field curvature aberration of the lens, and

wherein the central flat planar portion enables a thickness of the image sensor to be reduced, and the curved shape suppresses
decrease in light at the peripheral curved shape portion.

US Pat. No. 9,811,019

MAGNETIC CARRIER AND TWO-COMPONENT DEVELOPER

Canon Kabushiki Kaisha, ...

1. A magnetic carrier comprising:
a filled core particle including a porous magnetic core particle and a silicone resin filled in pores thereof; and
a vinyl resin coating a surface of the filled core particle,
wherein in a pore distribution of the porous magnetic core particle measured by a mercury intrusion method, a cumulative pore
volume of the porous magnetic core particle is 35.0 to 95.0 mm3/g,

in a pore distribution of the filled core particle measured by a mercury intrusion method, a cumulative pore volume of the
filled core particle is 3.0 to 15.0 mm3/g,

the content of the vinyl resin is 1.2 to 3.0 parts by mass with respect to 100.0 parts by mass of the filled core particle,
and

the mercury intrusion method comprises the following steps:
weighing 1.0 g of the porous magnetic core particle or the filled core particle,
intruding a mercury into the pores of the porous magnetic core particle or the filled core particle while measuring a mercury
intrusion pressure and a volume of the intruded mercury in a range of 13.8 kPa to 315.6 kPa and in a range of 316.3 kPa to
413.6 MPa,

obtaining the pore distribution of the porous magnetic core particle or the filled core particle, by calculation from the
mercury intrusion pressure and the volume of the intruded mercury, and

computing the cumulative pore volume of the porous magnetic core particle or the filled core particle by integrating a Log
differential pore volume in a pore diameter range of 0.1 to 3.0 ?m in the pore distribution of the porous magnetic core particle
or the filled core particle,

wherein the vinyl resin is a copolymer of
a vinyl monomer having a cyclic hydrocarbon group in its molecular structure, and
a methyl methacrylate macromonomer having a methacryloyl group at one terminal thereof.

US Pat. No. 9,784,972

INFORMATION PROCESSING APPARATUS, INFORMATION PROCESSING METHOD, AND STORAGE MEDIUM

CANON KABUSHIKI KAISHA, ...

1. An information processing apparatus comprising a processor and a memory containing instructions that when executed by the
processor, cause the processor to perform operations, comprising:
storing attribute data having a first attribute and a second attribute that is different from the first attribute in association
with a position of a virtual object;

outputting warning information for a user, based on a position of the user and the position of the virtual object associated
with which the attribute data in a case where the first attribute indicates outputting of the warning information for the
user;

generating an image, in a case where the second attribute which indicates masking of a virtual object is set in accordance
with a position of a first virtual object without drawing a second virtual object in a region in which the position of the
first virtual object is closer to the position of the user than a position of the second virtual object, based on the position
of the real object with which the data is associated and the position at which the virtual object is arranged, and by drawing
the second virtual object in a region in which the position of the first virtual object is associated is farther from the
position of the user than the position of the second virtual object; and

outputting the image.

US Pat. No. 9,736,424

IMAGE CAPTURING APPARATUS AND CONTROL METHOD THEREFOR

CANON KABUSHIKI KAISHA, ...

1. An image capturing apparatus comprising:
one or more processors; and
a memory coupled to the one or more processors and having stored thereon instructions which, when executed by the one or more
processors, cause the image capturing apparatus to:

capture an object;
acquire image data;
acquire image capturing conditions of the image capturing apparatus;
hold history information of peripheral devices that have been connected to the image capturing apparatus;
acquire, from an external apparatus, image capturing auxiliary information related to image capturing performed by the image
capturing apparatus based on the acquired image capturing conditions and on the held history information, wherein the image
capturing auxiliary information includes composition data;

output signals for performing image capturing; and
output signals for acquiring the image capturing auxiliary information.

US Pat. No. 9,653,675

DRIVING APPARATUS, LENS APPARATUS INCLUDING THE SAME, AND IMAGING APPARATUS

Canon Kabushiki Kaisha, ...

1. A driving apparatus comprising:
a movable portion having a plurality of movable side guide portions;
a base portion having a plurality of fixed side guide portions opposed to said plurality of movable side guide portions;
a vibrator having a piezoelectric element, the vibrator being provided at either one of said movable portion and said base
portion;

a friction member provided at the other of said movable portion and said base portion;
a pressing portion, provided at said one of said movable portion and said base portion, for applying a pressing force to said
vibrator to bring the vibrator into pressed contact with said friction member; and

a plurality of rolling portions sandwiched between said plurality of movable side guide portions and said plurality of fixed
side guide portions,

wherein said plurality of movable side guide portions and said plurality of fixed side guide portions extend with a predetermined
length in a moving direction in which said movable portion is moved with respect to said base portion through said plurality
of rolling portions by vibration excited by said piezoelectric element, and

wherein, within spacing in a direction orthogonal to said moving direction of a pair of movable side guide portions of said
plurality of movable side guide portions, a pressing center of said pressing portion and another movable side guide portion
of said plurality of movable side guide portions are positioned.

US Pat. No. 9,595,415

X-RAY GENERATOR AND X-RAY IMAGING APPARATUS

Canon Kabushiki Kaisha, ...

1. An X-ray generator comprising:
an anode including an electron passage formation member having an annular inner wall surface so as to define an electron passage
hole;

an integrated target including a target layer and an insulating substrate supporting the target layer; and
an electron source facing the target layer so as to irradiate the target layer with electrons passing through the electron
passage hole,

wherein the target layer is provided at a central region of the insulating substrate such that the integrated target includes
a peripheral region and a periphery of the substrate is uncovered by the target layer,

wherein the electron passage formation member accommodates a secondary X-ray generating region at the annular inner wall surface
that generates secondary X-rays by irradiation with electrons reflected from the target layer, and

wherein an angle ? formed by the secondary X-ray generating region and the target layer shows a relation 10° the electron passage formation member generates secondary X-rays in response to irradiation electron reflected from the target
layer and at least a part of the secondary X-rays is transmitted outside of the X-ray generator through the peripheral region.

US Pat. No. 9,591,674

COMMUNICATION APPARATUS AND CONTROL METHOD THEREOF

CANON KABUSHIKI KAISHA, ...

1. A communication apparatus that searches a service providing apparatus, comprising:
a display unit configured to display a search result of the service providing apparatus;
one or more processors; and
at least one memory coupled to the one or more processors, the at least one memory having instructions stored thereon which,
when executed by the one or more processors, cause the communication apparatus to:

if a search instruction for searching the service providing apparatus is received from a user, connect a plurality of access
points to the communication apparatus in order and search the service providing apparatus via each of the plurality of access
points; and

if the search of the service providing apparatus via each of the plurality of access points is completed and an access point
to which the communication apparatus is connected does not coincide with an access point to which the communication apparatus
was previously connected before the search of the service providing apparatus was performed, a connection destination is returned
to the access point to which the communication apparatus was previously connected before the search of the service providing
apparatus was performed.

US Pat. No. 9,563,391

TRANSMITTING APPARATUS, METHOD FOR CONTROLLING THE TRANSMITTING APPARATUS, AND COMPUTER-READABLE STORAGE MEDIUM

CANON KABUSHIKI KAISHA, ...

1. A transmitting apparatus comprising:
an executing unit configured to execute a transmission job for transmitting image data;
an outputting unit configured to output a report indicating a result of the transmission job for transmitting the image data
executed by the execution unit;

a first accepting unit configured to accept, as a common setting for a plurality of transmission jobs, a first instruction
regarding output of the report with the outputting unit;

a second accepting unit configured to accept, as an individual setting for a specific transmission job, a second instruction
regarding output of the report with the outputting unit; and

a control unit configured to perform control so as to output the report using the outputting unit if the second instruction
indicates that the report is to be output by the outputting unit, even if the first instruction does not indicate that the
report is to be output by the outputting unit,

wherein the executing unit, the first accepting unit, the second accepting unit and the control unit are implemented by a
processor and a memory.

US Pat. No. 9,561,922

SHEET FEEDING DEVICE AND IMAGE FORMING APPARATUS

Canon Kabushiki Kaisha, ...

1. A sheet feeding device, comprising:
a loading unit that loads a sheet;
a first rotating member that is arranged above the loading unit;
a second rotating member that is arranged upstream in a sheet feed direction of the first rotating member;
an adsorbing member in which an inside is supported in a loose state by the first rotating member and the second rotating
member and electrically adsorbs the sheet loaded on the loading unit;

a first nip member that, together with the first rotating member, nips the adsorbing member;
a second nip member that, together with the second rotating member, nips the adsorbing member;
a driving unit that rotates the first rotating member, the first nip member, the second rotating member, and the second nip
member;

a power source that applies a voltage to the adsorbing member and provides adsorption force of adsorbing the sheet by static
electricity; and

a control unit configured to control the driving unit,
wherein the control unit causes the sheet loaded on the loading unit to be adsorbed on the adsorbing member by increasing
a downward looseness amount of the adsorbing member and then feeds the sheet adsorbed on the adsorbing member while reducing
the downward looseness amount of the adsorbing member,

wherein a distance between the first rotating member and the sheet loaded on the loading unit is larger than a distance between
the second rotating member and the sheet loaded on the loading unit,

wherein two electrodes are arranged in the adsorbing member and the power source includes a first power source that applies
a positive voltage to one of the two electrodes and a second power source that applies a negative voltage to the other of
the two electrodes, and

wherein a conducting portion is formed in at least one of the first nip member and the second nip member, one of the first
power source and the second power source is connected to one of the two electrodes of the adsorbing member through the conducting
portion, and the other of the first power source and the second power source is connected to the other of the two electrodes
of the adsorbing member through the conducting portion.

US Pat. No. 9,560,961

OPTICAL COHERENCE TOMOGRAPHY APPARATUS, CONTROL METHOD FOR OPTICAL COHERENCE TOMOGRAPHY APPARATUS, AND NON-TRANSITORY TANGIBLE MEDIUM

Canon Kabushiki Kaisha, ...

1. An image processing apparatus comprising:
an acquisition unit configured to acquire a plurality of tomographic images of an eye to be inspected;
a specification unit configured to specify an area of a tomographic image among the plurality of tomographic images, on which
a folded image is generated; and

a display control unit configured to control a display unit to display (1) a layer thickness map based on the plurality of
tomographic images with (2) data indicating the area on which the folded image is generated,

wherein the data indicating the area on which folded image is generated is superimposed on the layer thickness map, and
wherein the display control unit controls the display unit to display the layer thickness map with a color and to display
the data indicating the area on which the folded image is generated by a color different from the color of the layer thickness
map.

US Pat. No. 9,557,944

PRINTING SYSTEM INCLUDING A HOST APPARATUS, AND A PRINTING APPARATUS WHICH IS CONNECTED TO THE HOST APPARATUS FOR PERFORMING SECURE PRINTING WITH MISMATCHED AUTHENTICATION DATA

CANON KABUSHIKI KAISHA, ...

1. A printing system comprising a host apparatus which transmits to a printing apparatus: a print job and account information
including a password, a personal identifier, and an affiliation identifier, which are input by a user to the host apparatus,
and the printing apparatus which is connected to the host apparatus, receives the print job and the account information, and
performs authenticated printing, wherein the printing apparatus comprises:
a storage unit configured to store account information including a password, a personal identifier, and an affiliation identifier
for each user input by an administrator of the printing system beforehand;

a processor configured to:
authenticate the user by comparing the account information transmitted by the host apparatus with the account information
in the storage unit;

execute printing based on the print job in a first case where it is determined by authentication by the authentication unit
that: even though all of the account information transmitted by the host apparatus do not match with all of the account information
stored in the storage unit for a first user, (1) the password and the personal identifier transmitted by the host apparatus
and the password and the personal identifier stored in the storage unit for the first user match; (2) the affiliation identifier
transmitted by the host apparatus and the affiliation identifier stored in the storage unit for the first user do not match;
and (3) the affiliation identifier transmitted by the host apparatus has been stored in the storage unit for a second user;
and

suppress the printing in a second case where it is determined by authentication by the authentication unit that the password
and the personal identifier transmitted by the host apparatus and the password and the personal identifier stored in the storage
unit for the first user match, and the affiliation identifier transmitted by the host apparatus has not been stored for any
user.

US Pat. No. 9,560,256

IMAGE CAPTURE APPARATUS AND IMAGE CAPTURE METHOD IN WHICH AN IMAGE IS PROCESSED BY A PLURALITY OF IMAGE PROCESSING DEVICES

Canon Kabushiki Kaisha, ...

1. A digital camera, comprising:
an imaging unit configured to output a signal for one frame via a first and a second channel,
wherein the frame is divided in half in the vertical direction into a first portion and a second portion,
wherein data read from the first portion of the frame is outputted via the first channel and data read from the second portion
of the frame is outputted the second channel, and

wherein the signal is concurrently read out from the first channel and the second channel;
a first storage unit configured to store the data outputted by the first channel and a second storage unit configured to store
the data outputted by the second channel,

wherein the first storage unit is different than the second storage unit;
a first color interpolation circuit to perform interpolation processing of the data stored in the first storage unit;
a second color interpolation circuit to perform interpolation processing of the data stored in the second storage unit,
wherein either the first color interpolation circuit or the second color interpolation circuit performs interpolation processing;
and

JPEG processing circuit to compress the signal as one frame.

US Pat. No. 9,521,339

IMAGE PROCESSING APPARATUS, IMAGE CAPTURING APPARATUS, AND IMAGE PROCESSING METHOD

Canon Kabushiki Kaisha, ...

1. An image processing apparatus comprising:
a first correction unit configured to set each of a plurality of pixels included in an image as a target pixel in sequence,
determine whether or not the target pixel is a defective pixel, and correct the target pixel using peripheral pixels of the
target pixel in a case where the target pixel is determined to be a defective pixel, wherein the first correction unit does
not use, in the correction of the target pixel, a defective pixel in the peripheral pixels that is known at the time of the
correction of the target pixel; and

a second correction unit configured to correct each corrected pixel that has been corrected by the first correction unit using
a defective pixel which was unknown at the time of the correction, using the peripheral pixels used by the first correction
unit, wherein the second correction unit uses, for the defective pixel in the peripheral pixels used by the first correction
unit, a corrected pixel obtained by correcting the defective pixel by the first correction unit.

US Pat. No. 9,509,997

IMAGING APPARATUS, IMAGING METHOD AND STORAGE MEDIUM, IMAGE CODING APPARATUS, IMAGE CODING METHOD AND STORAGE MEDIUM

Canon Kabushiki Kaisha, ...

1. A coding apparatus configured to code multi-viewpoint images captured from a plurality of viewpoints with respect to an
object, the apparatus comprising:
an imaging element or device configured to capture images using parameters related to exposure set for each of the plurality
of viewpoints; and

at least one processor that operates to perform inter-frame predictive coding on an image to be coded using a reference image
selected from the images captured by the imaging element or device based on the parameters related to the exposure set for
each of the plurality of viewpoints,

wherein the at least one processor further operates to select the reference image based on the parameters related to exposure
and a parallax, which is a difference between a viewpoint from which the image to be coded is captured and a viewpoint from
which an image other than the image to be coded is captured,

wherein the at least one processor further operates to first determine whether an image is captured from a viewpoint of which
the parallax is within a predetermined range, and

wherein the at least one processor selects the reference image based on results of the first determination.

US Pat. No. 9,507,283

ELECTROPHOTOGRAPHIC PHOTOSENSITIVE MEMBER, METHOD OF PRODUCING ELECTROPHOTOGRAPHIC PHOTOSENSITIVE MEMBER, PROCESS CARTRIDGE, AND ELECTROPHOTOGRAPHIC APPARATUS

CANON KABUSHIKI KAISHA, ...

1. An electrophotographic photosensitive member comprising:
a support;
a charge-generating layer on the support; and
a charge-transporting layer on the charge-generating layer,
wherein:
the charge-transporting layer is a surface layer of the electrophotographic photosensitive member;
the charge-transporting layer comprises a matrix-domain structure having:
a domain which comprises a polycarbonate resin A comprising:
a structural unit represented by one of the following formulae (A-1) and (A-2);
a structural unit represented by the following formula (B); and
a structural unit represented by the following formula (C); and
a matrix which comprises a charge-transporting substance and a resin D having a structural unit represented by the following
formula (D);

a content of the structural unit represented by one of the formulae (A-1) and (A-2) is from 5% by mass to 25% by mass based
on a total mass of the polycarbonate resin A;

a content of the structural unit represented by the formula (B) is from 35% by mass to 65% by mass based on the total mass
of the polycarbonate resin A;

a content of the structural unit represented by the formula (C) is from 10% by mass to 60% by mass based on the total mass
of the polycarbonate resin A,

in the formula (A-1):
Z11 and Z12 each independently represent an alkylene group having 1 to 4 carbon atoms;

R11 to R14 each independently represent an alkyl group having 1 to 4 carbon atoms, or a phenyl group; and

n11 represents a number of repetitions of a structure within parentheses, and an average of n11 in the formula (A-1) ranges from 10 to 150;

in the formula (A-2):
Z21 to Z23 each independently represent an alkylene group having 1 to 4 carbon atoms;

R16 to R27 each independently represent an alkyl group having 1 to 4 carbon atoms, or a phenyl group; and

n21, n22, and n23 each independently represent a number of repetitions of a structure within parentheses, an average of n21 and an average of n22 in the formula (A-2) each range from 1 to 10, and an average of n23 in the formula (A-2) ranges from 10 to 200;

in the formula (C):
Y31 represents an oxygen atom or a sulfur atom; and

R31 to R34 each independently represent a hydrogen atom or a methyl group;

in the formula (D):
m41 represents 0 or 1;

when m41 represents 1, X41 represents an o-phenylene group, a m-phenylene group, a p-phenylene group, a bivalent group having two p-phenylene groups
bonded with a methylene group, or a bivalent group having two p-phenylene groups bonded with an oxygen atom;

Y41 represents a single bond, an oxygen atom, a methylene group, an ethylidene group, a propylidene group, a cyclohexylidene group,
a phenylmethylene group, or a phenylethylidene group; and

R41 to R48 each independently represent a hydrogen atom or a methyl group.

US Pat. No. 9,501,121

JOB PROCESSING APPARATUS USING MULTIPLE POWER SOURCES AND METHOD OF CONTROLLING THE SAME

Canon Kabushiki Kaisha, ...

1. A job processing apparatus that performs job processing by using power supplied from a first power supply and a second
power supply, the job processing apparatus comprising:
a receiving unit configured to receive a job;
a calculating unit configured to calculate an amount of power consumed to process the received job;
a determining unit configured to determine whether the received job is executable based on a first amount of power that can
be supplied from the first power supply and the calculated amount of power;

a control unit configured to perform control so that the job is processed with the power supplied from the first power supply
if the determining unit determines that the job is executable with the first amount of power and the job is processed with
the power supplied from the second power supply if the determining unit determines that the job is not executable with the
first amount of power;

a storage unit configured to store a power history in which each executed job is associated with a type of the power supply
that is used; and

a charging unit configured to charge each job in accordance with the type of the power supply associated with the job stored
in the storage unit.

US Pat. No. 9,495,123

IMAGE FORMING APPARATUS INCLUDING SHORT-DISTANCE WIRELESS COMMUNICATION UNIT, METHOD OF CONTROLLING THE SAME, AND STORAGE MEDIUM

CANON KABUSHIKI KAISHA, ...

1. A communication apparatus comprising:
a near field communication (NFC) unit;
a display unit configured to display a setting screen for setting a desired type of NFC data exchange format (NDEF) data from
among a plurality of types of NDEF data written into the NFC unit, wherein the plurality of types of NDEF data include at
least an application installed in an external apparatus; and

a controller configured to write, into the NFC unit, the desired type of NDEF data set through the setting screen.

US Pat. No. 9,494,775

ZOOM LENS AND IMAGE PICKUP APPARATUS INCLUDING THE SAME

Canon Kabushiki Kaisha, ...

1. A zoom lens comprising, in order from an object side of the zoom lens to an image side of the zoom lens:
a first lens unit having positive refractive power;
a second lens unit having negative refractive power;
a third lens unit having positive refractive power;
an aperture stop;
a fourth lens unit having positive refractive power; and
a fifth lens unit having negative refractive power,
wherein: (i) a distance between adjacent lens units of the zoom lens changes during zooming;
(ii) the third lens unit includes at least one positive lens and further includes at least one negative lens at the image
side with respect to the positive lens; and

(iii) following conditions are satisfied;
?4.00
?5.00 where f2 is a focal length of the second lens unit, f5 is a focal length of the fifth lens unit, fa is a combined focal length
of lenses disposed at the object side with respect to the aperture stop at a wide-angle end, and fb is a combined focal length
of lenses disposed at the image side with respect to the aperture stop at the wide-angle end.

US Pat. No. 9,497,352

COMMUNICATION APPARATUS AND CONTROL METHOD THEREOF

CANON KABUSHIKI KAISHA, ...

1. A communication apparatus having a plurality of lines, comprising:
a setting unit configured to set, for a line based on a user instruction, whether to permit transmission of data using the
line;

a selecting unit configured to select, automatically, a line from among lines which are set to permit transmission of data;
a transmission unit configured to transmit data by the line selected by the selecting unit; and
a changing unit configured to automatically change, for a line, a setting not to permit transmission of data using the line
to a setting to permit transmission of data using the line,

wherein when a predetermined line enters a disabled state and settings not to permit transmission of data are set for all
lines other than the predetermined line, the changing unit automatically changes, for one line of the lines other than the
predetermined line, the setting not to permit transmission of data using the one line to the setting to permit transmission
of data using the one line.

US Pat. No. 9,493,018

PRINTING APPARATUS WITH CUT UNIT CONFIGURED TO CUT A SHEET ACCORDING TO AN OPERATOR'S INSTRUCTIONS

Canon Kabushiki Kaisha, ...

1. A printing apparatus comprising:
a support unit configured to support a continuous sheet;
an operation unit configured to operate a conveyance unit to convey the continuous sheet in accordance with an operator's
instruction;

a detection unit configured to detect that a continuous sheet has been loaded into the support unit;
a cut unit configured to cut the continuous sheet drawn from the support unit; and
a display control unit configured to cause a display unit to display an operation screen for prompting operations by the operation
unit,

wherein in response to the detection by the detection unit that a continuous sheet has been loaded into the support unit,
the display control unit causes the display unit to display the operation screen for prompting operations by the operation
unit to selectively advance or reverse the continuous sheet before cutting the continuous sheet by the cut unit and before
a printing on the continuous sheet is started.

US Pat. No. 9,488,501

MEASURING APPARATUS, MEASURING METHOD, AND PROCESSING APPARATUS THEREOF THAT OBTAIN DISPLACEMENT AMOUNT OF AN OBJECT USING CLOCK IN SYNCHRONIZATION WITH DATA REQUEST SIGNAL

CANON KABUSHIKI KAISHA, ...

1. A measuring apparatus for performing detection of a signal that varies with displacement of an object and measurement of
the displacement, the measuring apparatus comprising:
a clock generator configured to generate, in synchronization with a request signal for requesting measurement data, a first
clock signal having a cycle shorter than a cycle of the request signal;

a detector configured to perform the detection with respect to each cycle of the first clock signal;
an operation device configured to obtain the measurement data based on an output of the detector; and
a correction device configured to:
obtain a displacement amount of the object per unit time based on a plurality of the measurement data from the operation device;
and

correct the measurement data based on the obtained displacement amount and a time difference between the first clock signal
relating to the measurement data and the first clock signal relating to the request signal.

US Pat. No. 9,485,388

IMAGE PROCESSING APPARATUS, METHOD, AND COMPUTER STORAGE MEDIUM CONFIGURED FOR LINE CORRECTION BASED ON A NUMBER OF LINKED DOTS

CANON KABUSHIKI KAISHA, ...

1. An image processing apparatus that corrects multivalued data on which halftone processing has been performed, the image
processing apparatus comprising:
a first input unit configured to input multivalued data of a correction line to be corrected among the multivalued data;
a second input unit configured to input multivalued data of a precedent line that precedes the correction line by N lines;
a detection unit configured to detect a number of linked dots, wherein the number of linked dots indicates how many pixels
having a pixel value that is equal to or greater than a predetermined threshold value are linked in the multivalued data in
a sub scanning direction from a bottom-end edge located closest to the correction line to the correction line; and

a line correction unit configured to determine whether to correct each pixel in the correction line based on the number of
linked dots indicated by the detection unit and correct the multivalued data of the pixel determined to be corrected in the
correction line inputted by the first input unit,

wherein the detection unit has a counter for counting pixels having a pixel value that is equal to or greater than a predetermined
threshold value and controls a counter value of the counter based on a result of detecting pixels having a pixel value that
is less than a predetermined threshold value between the correction line and the precedent line, so as to detect the number
of linked dots that are linked from a side of the correction line to the bottom-end edge in the sub scanning direction, and

the bottom-end edge is an edge at which the density becomes lower in the sub scanning direction and the lower of density values
represents the background color.

US Pat. No. 9,485,406

FOCUS DETECTION APPARATUS, FOCUS DETECTION METHOD AND PROGRAM, AND IMAGING APPARATUS

CANON KABUSHIKI KAISHA, ...

1. A focus detection apparatus comprising:
an image data obtaining unit configured to obtain image data of an optical image of an object, the image data being obtained
by an imaging unit, wherein the imaging unit is configured to output parallax images as the image data, wherein the imaging
unit includes a plurality of pixels arranged in an array in a first direction and a second direction different from the first
direction in a pixel array area, wherein the image data are output from the plurality of pixels arranged in the pixel array
area of the imaging unit on a line by line basis, wherein the line is extended in the first direction, and wherein a plurality
of the lines are arranged repeatedly in the second direction;

a setting unit configured to set a focus detection area which includes a plurality of detection areas;
a mode information obtaining unit configured to obtain setting information of a focus detection mode, wherein the focus detection
mode includes a first mode and a second mode, and wherein a size of a region, where the focus detection area is set, in the
second direction in the second mode is larger than a size of a region, where the focus detection area is set, in the second
direction in the first mode;

a generating unit configured to generate defocus information by calculating a phase difference of the parallax images in the
first direction; and

a drive signal generation unit configured to generate a drive signal for a photographing optical system on the basis of the
focus detection information,

wherein a size of the detection area in the first direction in the second mode is larger than a size of the detection area
in the first direction in the first mode,

wherein an arrangement of the detection areas in the second direction in the second mode is more discrete than an arrangement
of detection areas in the second direction in the first mode, and

wherein at least one of the image data obtaining unit, the mode information obtaining unit, the setting unit, the generating
unit, and the drive signal generation unit is implemented by a processor and a memory.

US Pat. No. 9,484,178

TARGET AND X-RAY GENERATING TUBE INCLUDING THE SAME, X-RAY GENERATING APPARATUS, X-RAY IMAGING SYSTEM

Canon Kabushiki Kaisha, ...

1. A target comprising;
a target layer configured to be irradiated with an electron to generate an X-ray, and
a support substrate configured to support the target layer, wherein the support substrate is a polyhedron containing a polycrystalline
diamond and including multiple structure planes each of which has a normal line from one another, and

wherein the target layer is supported by the support substrate at a structure plane with a smaller area density of a monocrystalline
domain showing a {101} plane than each of an area density of a monocrystalline domain showing a {100} plane and an area density
of a monocrystalline domain showing a {111} plane.

US Pat. No. 9,483,016

PHOTOSENSITIVE DRUM AND PROCESS CARTRIDGE

Canon Kabushiki Kaisha, ...

1. A photosensitive drum for use with an image forming apparatus, comprising:
a cylinder, having a photosensitive layer at its surface, to which process means is contacted;
a supporting shaft extending through said cylinder; and
a flange provided at a longitudinal end portion of said cylinder, said flange having a radially inner side and a radially
outer side, the radially inner side being disposed closer to said supporting shaft,

wherein said flange includes:
a supporting projection disposed on the radially outer side of said flange and supporting an inner peripheral portion of said
cylinder with a longitudinal region corresponding to a direct contact area at which the process means is in direct contact
with said cylinder,

a first supported projection disposed on the radially inner side of said flange and supported by said supporting shaft, said
first supported projection disposed further from said longitudinal end portion of said cylinder than said supporting projection,

a second supported projection disposed on the radially inner side of said flange and supported by said supporting shaft, said
second supported projection disposed closer to said longitudinal end portion of said cylinder than said supporting projection,
and

a clearance provided between said first supported projection and said second supported projection with respect to a longitudinal
direction of said cylinder,

wherein with respect to the longitudinal direction of said cylinder, said supporting projection is provided at a position
overlapping with said clearance, not overlapping with said first supported projection, and not overlapping with said second
supported projection.