US Pat. No. 9,132,670

CONVEYING DEVICE AND PRINTING APPARATUS

Canon Kabushiki Kaisha, ...

1. A conveying device comprising:
a conveyer unit conveying a sheet;
a motor for driving the conveyer unit;
an estimate device for estimating temperature of the motor based on a rotation amount and a stop period of the motor; and
a determination device to determine whether to drive the motor either in a first mode in which the motor is continuously rotated
or in a second mode in which the motor is intermittently rotated based on an estimation result of the estimate device.

US Pat. No. 9,134,641

IMAGE FORMING APPARATUS

CANON KABUSHIKI KAISHA, ...

1. An image forming apparatus comprising:
a plurality of image bearing members, provided in parallel with each other, each for forming a toner image;
a transfer unit detachably mountable to a main assembly of said image forming apparatus and including a first intermediary
transfer member and a second intermediary transfer member, wherein said first intermediary transfer member forms a primary
transfer portion between itself and each of said plurality of image bearing members, wherein the toner images formed on said
plurality of image bearing members are to be primary-transferred onto said first intermediary transfer member, and wherein
the toner images are to be secondary-transferred from said first intermediary transfer member onto said second intermediary
transfer member;

a transfer member for tertiary-transferring the toner images from said second intermediary transfer member onto a recording
material,

wherein said first intermediary transfer member includes a rotatable belt and a plurality of stretching rollers for stretching
the belt,

wherein said transfer unit is mountable in and demountable from the main assembly with respect to a direction parallel to
a rotational direction of the belt, and

wherein said first intermediary transfer member and said second intermediary transfer member are arranged in a mounting and
demounting direction of said transfer unit, and

further comprising an apparatus main assembly frame forming the main assembly of said image forming apparatus,
wherein said apparatus main assembly frame comprises a positioning portion for positioning said transfer unit relative to
said apparatus main assembly,

wherein said transfer unit comprises a transfer frame on both sides thereof with respect to a direction perpendicular to the
rotational direction of the belt, and

wherein the positioning portion is engageable with each of bearing portions of the stretching rollers and said second intermediary
transfer member.

US Pat. No. 9,134,646

IMAGE FORMING APPARATUS HAVING DEVELOPMENT BIAS CONTROL

CANON KABUSHIKI KAISHA, ...

1. An image forming apparatus comprising:
an image bearing member;
a development device that includes a developer bearing member in a development position opposite to the image bearing member
to develop an electrostatic latent image formed on the image bearing member, the developer bearing member bearing and conveying
a developer including a carrier and toner;

a bias applying portion that applies a development bias to the developer bearing member;
a degradation sensing portion that senses information related to a level of degradation of toner stored in the development
device;

an acquisition portion that acquires information on a type of a recording material to which a toner image developed by the
development device is to be transferred; and

a controlling portion that controls a condition of the development bias applied to the developer bearing member so that a
development ability of the development device is decreased when the degradation sensing portion senses information that the
level of degradation of toner is more than a predetermined level and the acquisition portion acquires information that smoothness
of the recording material is less than a predetermined reference.

US Pat. No. 9,128,004

MEASUREMENT METHOD, MEASUREMENT APPARATUS, NON-TRANSITORY COMPUTER-READABLE STORAGE MEDIUM, AND OPTICAL ELEMENT FABRICATION METHOD

CANON KABUSHIKI KAISHA, ...

1. A measurement method that utilizes a measurement apparatus to measure a shape of a measurement target surface disposed
on a stage and having a circular contour, the method comprising:
a first step of obtaining shape data by causing the stage which holds the measurement target surface, to rotate the measurement
target surface about a rotation axis, positioning each of a plurality of partial regions of the measurement target surface
in a field of view of the measurement apparatus, and causing the measurement apparatus to measure each of the plurality of
partial regions;

a second step of obtaining, for each of a plurality of partial contour regions of the plurality of partial regions, which
includes part of a contour of the measurement target surface, a central position of the measurement target surface using data
of the contour included in the shape data;

a third step of obtaining, based on the plurality of central positions obtained for the plurality of partial contour regions,
a position of the rotation axis of the measurement target surface in positioning each of the plurality of partial regions;
and

a fourth step of obtaining the shape of the measurement target surface by concatenating the shape data of the plurality of
partial regions using the position of the rotation axis obtained in the third step and a rotation angle of the measurement
target surface by the stage in positioning each of the plurality of partial regions.

US Pat. No. 9,128,405

IMAGE FORMING APPARATUS CONTROLLING CHARGING VOLTAGE BASED ON IMAGE DENSITY INFORMATION

Canon Kabushiki Kaisha, ...

1. An image forming apparatus, comprising:
a plurality of image forming stations; and
a control portion configured to control an image forming operation,
each of the plurality of image forming stations comprising:
an image bearing member configured to form a toner image on a surface thereof; and
a charging device configured to charge the image bearing member,
wherein respective toner images formed on image bearing members of the plurality of image forming stations are sequentially
transferred to a transfer incurring member so as to be superimposed on top of each other,

wherein the control portion sets a voltage applied to the charging device in forming an image in an image forming station
among the plurality of image forming stations which performs a transfer later, based on image density information of the toner
image transferred to the transfer incurring member by an image forming station among the plurality of image forming stations
which performs a transfer earlier in a sequence of image forming operations,

wherein the control portion sets the voltage applied to the charging device in forming the image in the image forming station
among the plurality of image forming stations which performs the transfer later to a first set value when the image density
information of the toner image transferred to the transfer incurring member by the image forming station among the plurality
of image forming stations which performs the transfer earlier does not satisfy a predetermined density condition, and to a
second set value when the image density information satisfies the predetermined density condition in the sequence of the image
forming operations, and

wherein an absolute value of the applied voltage in the second set value is greater than an absolute value of the applied
voltage in the first set value.

US Pat. No. 9,123,281

LIGHTING APPARATUS HAVING A PLURALITY OF LIGHT SOURCES AND CONTROL METHOD THEREOF

CANON KABUSHIKI KAISHA, ...

1. A lighting apparatus for an image display apparatus comprising:
a plurality of light sources corresponding to a plurality of areas of a screen; and
a control unit configured to control a duty ratio of a turn-on period and a turn-off period of each light source by carrying
out pulse width modulation control on the turn-on periods and the turn-off periods of said plurality of light sources according
to an image signal to be inputted;

wherein in cases where the duty ratio of each light source is controlled according to the image signal to be inputted, said
control unit adjusts turn-on timing of each light source in such a manner that a variation in the number of light sources
which are in turn-on state on at the same time is suppressed, and

said control unit groups said plurality of light sources in such a manner that light sources with their duty ratios being
mutually equal to one another or with a difference between their duty ratios being within a threshold value belong to a same
group, and adjusts the turn-on timing of each light source in such a manner that the turn-on timings of the light sources
belonging to the same group are apart from one another.

US Pat. No. 9,119,576

OPHTHALMIC DEVICE

Canon Kabushiki Kaisha, ...

1. An ophthalmic device, comprising:
a measurement optical system configured to measure an aberration of an eye to be examined by using a return light from the
eye which a first measurement light emitted from a first light source enters;

a first imaging optical system configured to capture a first fundus image by using a first return light from the eye which
a second measurement light emitted from a second light source enters, the first return light being corrected by a correction
unit based on the aberration;

a second imaging optical system configured to capture a second fundus image by using a second return light from the eye which
a third measurement light emitted from a third light source enters, the second fundus image being larger than the first fundus
image; and

a control unit configured to cause the measurement lights to enter the eye in an order of the measurement lights from the
third light source, the first light source, the second light source when an eye for imaging object is switched from a first
eye of the both eyes to a second eye of the both eyes, and to enter the eye in an order of the measurement lights from the
first light source, the second light source when an imaging position in the eye is changed.

US Pat. No. 9,104,946

SYSTEMS AND METHODS FOR COMPARING IMAGES

Canon Kabushiki Kaisha, ...

1. An image similarity scoring method comprising:
counting a number of matching visual words between a query image and a candidate image, wherein each matching visual word
is found in both the query image and the candidate image;

generating an image similarity score for the query image and the candidate image based at least in part on the counted number
of matching visual words; and

generating a normalized image similarity score based at least in part on the image similarity score and one or more of a complexity
of the query image and a complexity of the candidate image, wherein the normalized image similarity score is generated according
to a weighting function that is described by a finite unimodal function.

US Pat. No. 9,098,042

RECORDING MATERIAL DETECTION APPARATUS AND IMAGE FORMING APPARATUS

Canon Kabushiki Kaisha, ...

1. A recording material detection apparatus comprising:
a light source configured to irradiate a recording material with light;
a reference surface to be irradiated with light from the light source, the reference surface being arranged on the side of
the light source with respect to a recording material in a direction orthogonal to the surface of the recording material,

a light-receiving unit having a plurality of pixels and configured to receive light reflected from a surface of the recording
material irradiated with the light from the light source and the reference surface; and

a detecting device configured to detect information relating to roughness of the surface of the recording material on the
basis of the light reflected from the surface of the recording material and received by the light-receiving unit,

wherein the reference surface is inclined with respect to a conveyance direction of the recording material such that the reference
surface becomes closer to the light-receiving unit as it becomes farther away from the light source in the conveyance direction
of the recording material.

US Pat. No. 9,100,521

IMAGE READING APPARATUS AND IMAGE FORMING APPARATUS

CANON KABUSHIKI KAISHA, ...

1. An image reading apparatus comprising:
an apparatus main body;
an opening/closing portion configured to be rotatable with respect to the main body, around a hinge shaft;
a biasing portion configured to (i) apply a force to the opening/closing portion in an opening direction to generate a moment
about the hinge shaft higher than a moment of the self-weight of the opening/closing portion about the hinge shaft in a state
in which the opening/closing portion is in a range from a closed position to a predetermined rotation angle with respect to
the apparatus main body and (ii) generate a moment about the hinge shaft that is substantially balanced with the moment of
the self-weight of the opening/closing portion about the hinge shaft in a state in which the opening/closing portion is opened
more than the predetermined rotation angle; and

a holding portion configured to hold the opening/closing portion in a holding state, the holding state being the state of
the opening/closing portion at the closed position,

wherein, in a case that the holding state is released, the opening/closing portion rotates from the closed position to the
predetermined rotation angle by the force applied by the biasing portion.

US Pat. No. 9,093,927

ACTUATOR WITH IONIC LIQUID

Canon Kabushiki Kaisha, ...

1. An actuator comprising:
a pair of electrodes facing each other;
an intermediate layer containing an ionic liquid and arranged between the pair of electrodes,
the electrodes and the intermediate layer being bent and deformed when a potential difference larger than a potential window
of the ionic liquid is applied between the electrodes; and

insulating layers that suppress direct contact between ions of the ionic liquid and the electrodes, the insulating layers
being arranged between the intermediate layer and the electrodes

wherein the insulating layers contain an insulating polymer and highly dielectric inorganic particles; and
wherein in the insulating layers, an amount of the highly dielectric inorganic particles may be 10% by weight or more and
90% by weight or less relative to an amount of the organic polymer.

US Pat. No. 9,090,066

PROCESS FOR PRODUCING INK JET RECORDING HEAD

Canon Kabushiki Kaisha, ...

1. A process for producing an ink jet recording head which comprises:
a substrate having a first surface and a second surface which oppose to each other, a common liquid chamber formed by machining
the substrate from the second surface so as to reduce the thickness of a part of the substrate, and a plurality of independent
ink supply ports that communicate with the common liquid chamber and are through-holes extending through the substrate; and

a nozzle structure that is formed on the first surface and has an ink flow path communicating with the plurality of independent
ink supply ports and an ink ejection orifice communicating with the ink flow path,

the process comprising a step of patterning a resist applied to the substrate by using a photomask for forming the plurality
of the independent ink supply ports,

wherein in said step of patterning, infrared alignment is conducted at a depression of the substrate upon alignment between
the photomask and the substrate using an alignment mark,

wherein the depression at which the infrared alignment is conducted is the common liquid chamber, wherein an area of the alignment
mark of the photomask used in the infrared alignment is not smaller than an opening area of one of the independent ink supply
ports, and wherein one of the independent ink supply ports communicating with the ink flow path is formed at a portion of
the substrate corresponding to the alignment mark of the photomask.

US Pat. No. 9,086,671

IMAGE FORMING APPARATUS INCLUDING CLEANING UNIT FOR REMOVING DEVELOPING MATERIAL

CANON KABUSHIKI KAISHA, ...

1. An image forming apparatus comprising:
an image carrier;
an image forming unit configured to form a developing material image on the image carrier using a developing material;
a cleaning unit configured to remove a remaining amount of the developing material that was not transferred from the image
carrier to another member; and

a control unit configured to, in order to supply the developing material to the cleaning unit, control the image forming unit
such that a developing material image that is not to be transferred to the other member is formed on the image carrier,

wherein the control unit is further configured to, if a developing material image that is to be transferred to the other member
is formed on the image carrier, obtain a print ratio that is a ratio of the area of the formed developing material image with
respect to the area of a developing material image capable of being formed on the other member, and control an amount of the
developing material that is to be supplied to the cleaning unit in accordance with the print ratio and a threshold value,
and

wherein the control unit is further configured to obtain the threshold value based on a consumption amount of the developing
material in the image forming unit and a number of sheets of recording material printed by the image forming unit.

US Pat. No. 9,079,214

METHOD OF PRODUCING MAGNESIUM FLUORIDE COATING, ANTIREFLECTION COATING, AND OPTICAL ELEMENT

Canon Kabushiki Kaisha, ...

1. A method of producing a magnesium fluoride coating, comprising:
forming a coating by applying a solution containing a fluorine-containing organic magnesium compound represented by the following
formula to a base;

heat-treating the coating;
irradiating the coating with a beam of light with a wavelength of 246 nm or less,
wherein the heat-treating and the irradiating are performed in combination, so that the fluorine-containing organic magnesium
compound is decomposed:

Mg(CF3—X—COO)2  (1)
wherein X represents a single bond or one of —(CF2)n—, —(CH2)m—, and —CH2CF2— that may have a substituent, where n and m each represent an integer of 1 to 4.

US Pat. No. 9,081,308

DRIVING APPARATUS AND EXPOSURE APPARATUS AND DEVICE FABRICATION METHOD

CANON KABUSHIKI KAISHA, ...

1. A driving apparatus including a movable body, a guide which guides and supports said movable body, and a driving unit which
drives said movable body,wherein
said guide includes a support which contains a magnetic material and includes a recess and a projection on a side that guides
said movable body, and a layer which covers at least said recess of said support and includes a guide surface that guides
said movable body,

said movable body includes an air pad to cause said movable body to levitate from said guide surface, and a magnet to obtain
an attracting force with respect to said support,

said projection of said support is formed along a driving direction of said movable body which is driven by said driving unit,
and arranged to oppose said magnet,

a length of said projection in the driving direction is longer than a length of said projection in a direction perpendicular
to the driving direction,

said projection extends continuously over a movable range of the movable body so that the magnet and the projection always
oppose each other in the movable range, and

a material of said layer comprises ceramic, glass, diamond, composite carbon material, or stone.

US Pat. No. 9,083,671

IMAGE FORMING APPARATUS, METHOD FOR CONTROLLING THE SAME, AND STORAGE MEDIUM

Canon Kabushiki Kaisha, ...

1. An image forming apparatus to communicate with a service provision system via a firewall, the image forming apparatus comprising:
a processor coupled to a memory;
an identification unit configured to identify, out of services provided by the service provision system, a service which provides
a substitute function corresponding to a function of the image forming apparatus limited by a failure;

a determination unit configured to determine, based on the service identified by the identification unit, a communication
method to be used to perform data communication with the service identified by the identification unit, wherein the communication
method to be used is determined from a plurality of communication methods to be used for communication with the service provision
system via the firewall; and

a communication unit configured to perform data communication with the service identified by the identification unit by using
the communication method determined by the determination unit, wherein the plurality of communication methods includes both:

a push method with which the service provision system holds a session with the image forming apparatus, retains a state where
the session is held, and returns a response via the held session, and

a pull method with which the image forming apparatus repetitively requests the service provision system for response and,
upon reception of a response returned from the service provision system in response to the request, stops the repetitive requests
for response,

wherein, in response to the service identified by the identification unit requiring immediacy in communication and immediacy
in communication not being feasible with the communication path status, the determination unit determines the pull method,
and

wherein the identification unit, the determination unit, and the communication unit are implemented by the processor.

US Pat. No. 9,076,189

CODING APPARATUS AND METHOD FOR ENCODING IMAGE DATA

Canon Kabushiki Kaisha, ...

1. A coding apparatus comprising:
a memory that stores image data which is to be divided into CUs (coding units);
a determination unit that determines a size of a first CU (coding unit) included in the CUs;
a first generating unit that generates prediction image data after a size of the first CU is determined;
a second generating unit that generates difference data of the first CU by using image data of the first CU and the prediction
image data;

an orthogonally transforming unit that transforms the difference data of the first CU into transformed data which is to be
divided into TUs (transform units), wherein a size of a first TU (transform unit) included in the TUs is smaller than the
determined size of the first CU;

a quantization unit that quantizes transformed data of the first TU to generate quantized data of the first TU;
an encoding unit that encodes the quantized data of the first TU to generates encoded data of the first TU; and
a code amount controlling unit that controls a code amount of another CU (coding unit) included in the CUs by using a code
amount of the encoded data of the first TU,

wherein at least one of the determination unit, the first generating unit, the second generating unit, the orthogonally transforming
unit, the quantization unit, the encoding unit, and the code amount controlling unit is implemented by a processor.

US Pat. No. 9,067,430

INK JET RECORDING APPARATUS AND RECORDING METHOD

Canon Kabushiki Kaisha, ...

1. An image forming apparatus comprising:
a conveyance unit configured to convey a recording medium in a predetermined direction;
a processing unit configured to generate dot data for forming an image to be printed on the recording medium based on acquired
image data; and

a detection unit configured to detect a side end position of the recording medium conveyed by the conveyance unit,
wherein the processing unit is configured to enlarge the image to be printed on the recording medium such that a portion of
the enlarged image protruding into a predetermined margin region at a side end of the recording medium, convert the image
data of the enlarged image into dot data, and, process the dot data to trim dot about the portion of the enlarged image protruding
into the set margin region so that the portion of the enlarged image protruding into the predetermined margin region is not
to be printed on the recording medium, and

wherein the processing unit is configured to determine a trimming portion for processing the dot data to trim dot based on
the side end position of the recording medium being conveyed by the conveyance unit, detected by the detection unit, and the
length of the predetermined margin region in a crossing direction cross to the predetermined direction.

US Pat. No. 9,057,993

IMAGE HEATING APPARATUS

Canon Kabushiki Kaisha, ...

1. An image heating apparatus comprising:
a rotatable heating member configured to heat a toner image on a recording material;
an exciting coil configured to generate magnetic flux for causing said rotatable heating member to generate heat through electromagnetic
induction heating;

a plurality of magnetic cores, provided outside said rotatable heating member and arranged in a longitudinal direction of
said rotatable heating member, configured to guide the magnetic flux toward said rotatable heating member;

a magnetic flux suppressing member configured to suppress the magnetic flux actable from said exciting coil to a part of said
rotatable heating member;

a moving mechanism configured to move, when the toner image is heated on a predetermined recording material having a width
narrower than a maximum width of the recording material usable in said image heating apparatus, said magnetic flux suppressing
member depending on the width of the predetermined recording material; and

a retracting mechanism configured to retract, from said exiting coil, at least one of the plurality of magnetic cores,
wherein, when said magnetic flux suppressing member is placed in a positional relationship by said moving mechanism such that
said magnetic flux suppressing member opposes a part of a non-contact region of the rotatable heating member with the predetermined
recording material, said retracting mechanism retracts some of the magnetic cores of the plurality of magnetic cores, in a
positional relationship such that the retracted magnetic cores do not oppose said magnetic flux suppressing member but oppose
the non-contact region of said heat rotatable member.

US Pat. No. 10,075,340

INFORMATION PROCESSING APPARATUS, CONTROL METHOD FOR INFORMATION PROCESSING APPARATUS, AND RECORDING MEDIUM

CANON KABUSHIKI KAISHA, ...

1. An information processing apparatus comprising:a storage that stores setting information used by the information processing apparatus to perform an operation;
a memory that stores a set of instructions; and at least one processor that executes instructions in the memory to: manage configuration information indicating a device configuration of the information processing apparatus, the configuration information indicating at least one of an equipment which is installed with the information processing apparatus and an application which is installed with the information processing apparatus;
receive setting information, from a server, to update the setting information stored in the storage; and
control whether or not to cause a display unit to display information prompting an execution of reboot processing to reflect the update of the setting information, based on a type of the setting information to be updated and the configuration information indicating at least one of the equipment which is installed with the information processing apparatus and the application which is installed with the information processing apparatus,
wherein the information prompting an execution of reboot processing to reflect an update of predetermined setting information is not displayed, in a case where the application and the equipment for which the predetermined setting information is used are not installed with the information processing apparatus, and
wherein the predetermined setting information received from the server is stored in the storage as the setting information of the information processing apparatus, even if the application and the equipment for which the predetermined setting information is used are not installed with the information processing apparatus.

US Pat. No. 10,071,558

SYSTEM, CONTROL METHOD THEREFOR, PRINTING APPARATUS, AND CONTROL METHOD THEREFOR

Canon Kabushiki Kaisha, ...

1. A system which provides an interchangeable tank for a printing apparatus to which at least one tank containing printing materials of at least two colors is attached, comprising:an obtaining unit configured to obtain predetermined information relating to amount of printing materials for a tank attached to the printing apparatus; and
a determining unit configured to determine an interchangeable tank to be provided from a plurality of types of interchangeable tanks based on the predetermined information obtained by the obtaining unit,
wherein the plurality of types of interchangeable tanks include a first tank and a second tank,
the first tank contains printing materials of at least two colors, with a ratio of amounts of the printing materials of the at least two colors being a first constituent ratio, and
the second tank contains printing materials of at least the same two colors as those in the first tank, with a ratio of amounts of the printing materials of at least the two colors being a second constituent ratio different from the first constituent ratio.

US Pat. No. 10,055,052

OPERATION APPARATUS, AND IMAGE PICKUP APPARATUS AND PERSONAL DIGITAL ASSISTANT INCLUDING SAME

CANON KABUSHIKI KAISHA, ...

1. An operation apparatus comprising:a surface to which input of an operation is performed, the surface including a variable tactile portion whose tactile is variable;
a detector configured to detect input of a slide operation to the surface; and
a controller configured to control the tactile of the variable tactile portion such that the variable tactile portion is formed into one of a first tactile as a tactile of a region of the surface other than the variable tactile portion and a second tactile different from the first tactile,
wherein the controller is configured to control, in a case where the detector detects the input of the slide operation, the tactile of the variable tactile portion such that the variable tactile portion is formed into the first tactile before the detected slide operation reaches the variable tactile portion.

US Pat. No. 10,032,013

IMAGE FORMING APPARATUS COMMUNICATING WITH EXTERNAL DEVICE THROUGH NETWORK, NETWORK SYSTEM, METHOD OF CONTROLLING IMAGE FORMING APPARATUS, PROGRAM, AND STORAGE MEDIUM

CANON KABUSHIKI KAISHA, ...

1. An image forming apparatus capable of communicating with an authentication server via a network, the image forming apparatus comprising:one or more processors; and
one or more computer-readable media storing instructions that, when executed by the one or more processors, cause the one or more processors to perform operations comprising:
receiving card information via a network interface, the card information being read from an IC card by an IC card reader, wherein the card information is received via the network interface without an authentication process using the card information being performed;
storing the card information received via the network interface into a card information storage area;
determining, in a case where the card information is stored in the card information storage area, whether or not the image forming apparatus is in an authenticatable state;
in a case where it is determined that the image forming apparatus is in the authenticatable state, transmitting an authentication request to the authentication server based on the card information stored in the card information storage area, the authentication request including the card information received via the network interface;
in a case where it is determined that the image forming apparatus is not in the authenticatable state, deleting the card information stored in the card information storage area without transmitting the authentication request to the authentication server;
allowing a user corresponding to the card information stored in the card information storage area to log into the image forming apparatus according to an authentication result from the authentication server; and
executing a print job of the user who is allowed to log into the image forming apparatus.

US Pat. No. 9,812,473

IMAGE SENSOR AND IMAGE CAPTURING APPARATUS

Canon Kabushiki Kaisha, ...

1. An image sensor comprising:
an image sensing plane that receives light from a subject whose image has been formed by a lens,
wherein the image sensing plane has a central flat planar portion and a peripheral curved shape portion,
wherein the central flat planar portion is arranged in a region of the image sensing plane which is less influenced by field
curvature aberration of the lens and the peripheral curved shape portion is arranged in a region of the image sensing plane
which is more influenced by field curvature aberration of the lens, and

wherein the central flat planar portion enables a thickness of the image sensor to be reduced, and the curved shape suppresses
decrease in light at the peripheral curved shape portion.

US Pat. No. 9,736,424

IMAGE CAPTURING APPARATUS AND CONTROL METHOD THEREFOR

CANON KABUSHIKI KAISHA, ...

1. An image capturing apparatus comprising:
one or more processors; and
a memory coupled to the one or more processors and having stored thereon instructions which, when executed by the one or more
processors, cause the image capturing apparatus to:

capture an object;
acquire image data;
acquire image capturing conditions of the image capturing apparatus;
hold history information of peripheral devices that have been connected to the image capturing apparatus;
acquire, from an external apparatus, image capturing auxiliary information related to image capturing performed by the image
capturing apparatus based on the acquired image capturing conditions and on the held history information, wherein the image
capturing auxiliary information includes composition data;

output signals for performing image capturing; and
output signals for acquiring the image capturing auxiliary information.

US Pat. No. 9,723,650

COMMUNICATION APPARATUS THAT DISCONNECTS A WIRELESS CONNECTION AFTER A SERVICE PROVIDED ON THE WIRELESS CONNECTION IS COMPLETED, DEPENDING ON THE SERVICE, METHOD FOR CONTROLLING THE SAME, AND RECORDING MEDIUM

Canon Kabushiki Kaisha, ...

1. A communication apparatus comprising:
one or more processors; and
a memory storing instructions that, when executed by the one or more processors, cause the communication apparatus to perform
a process comprising:

performing, at a first communicator, wireless communication with another communication apparatus by a first communication
method; and

performing, at a second communicator, wireless communication with the another communication apparatus by a second communication
method in which a communication speed is faster or a communication range is broader than in the first communication method,

wherein
in communicating a message for wireless connection using the first communication method with the another communication apparatus,
the first communicator includes in the message, service information for specifying a service that is to be executed with execution
of a communication using the second communication method,

the second communicator establishes a wireless connection with the another communication apparatus using the second communication
method after the message for wireless connection using the first communication method is communicated by the first communicator,
and

the communication apparatus controls, at a controller, the second communicator in such a manner that the wireless connection
established, using the second communication method, after the message for wireless connection using the first communication
method is communicated, is either disconnected or maintained depending on which service is performed:

in a case where a service specified by the service information included in the message communicated by the first communicator
is a print service for printing, the communication apparatus controls the second communicator in such a manner that the wireless
connection established, using the second communication method, after the message for wireless connection using the first communication
method is communicated, is disconnected in response to the print service being completed, and

in a case where the service specified by the service information included in the message communicated by the first communicator
is a wireless communication parameter setting service for setting a wireless communication parameter for communicating by
the second communication method, the communication apparatus controls the second communicator in such a manner that the wireless
connection established, using the second communication method, after the message for wireless connection using the first communication
method is communicated, is maintained although the wireless communication parameter setting service is completed.

US Pat. No. 9,654,029

VIBRATION TYPE DRIVING DEVICE

CANON KABUSHIKI KAISHA, ...

1. A vibration type driving device comprising:
a vibrator comprising an electromechanical energy transducer; and
a driven body in contact with a contact portion of the vibrator,
wherein the vibrator and the driven body are configured so that a relative position of the contact portion and the driven
body is rotated by the elliptic motion,

wherein the vibrator has an end portion in a direction of the relative rotation, and
wherein a contact pressure of the contact portion with the driven body is lower on a radial inner side than on a radial outer
side in a radial direction of the relative rotation.

US Pat. No. 9,684,223

HIGH EFFICIENCY FIBER OPTICAL PARAMETRIC OSCILLATOR

Canon Kabushiki Kaisha, ...

1. An optical apparatus comprising:
an optical source that generates a first pulse with a first optical wavelength;
an optical amplifier that amplifies the first pulse and outputs an amplified pulse with the first optical wavelength;
a first waveguide that is connected to the optical amplifier which receives the amplified pulse;
a second waveguide that is connected to the first waveguide and receives the amplified pulse, wherein the second waveguide
converts the energy of the amplified pulse into energy of a second pulse while a relative center position of the second pulse
for the amplified pulse is crossing a center position of the amplified pulse in a first direction, wherein the second pulse
has a second optical wavelength different from the first optical wavelength;

wherein the amplifier, the first waveguide, and the second waveguide form an optical loop which feeds the second pulse back
to the amplifier, the first waveguide, and the second waveguide;

an output coupler to output a portion of the second pulse outside of the optical loop;
wherein the following equation is satisfied:
Lmin?L??/?P,
in which a length of the first waveguide is L, a nonlinear coefficient of the first waveguide is ?, a peak power of the amplified
pulse as it is received by the first waveguide is P, and a minimum length of the first waveguide is Lmin.

US Pat. No. 9,557,688

IMAGE FORMING APPARATUS HAVING CONDUCTIVE SHEET GUIDE

Canon Kabushiki Kaisha, ...

1. An image forming apparatus comprising:
a transfer portion transferring a toner image to a sheet;
a sheet guide portion guiding the sheet to the transfer portion, the sheet guide portion including:
a resin member made of resin;
a conductive portion provided to be in contact with the sheet to which the toner image is being transferred by the transfer
portion, supported on the resin member, and electrically connected to the resin member, the conductive portion having lower
volume resistivity than that of the resin member; and

a ground portion configured to be electrically connected to the resin member to ground the resin member,
wherein the conductive portion is grounded by passing current from the conductive portion, through the resin member, and to
the ground portion.

US Pat. No. 9,519,327

COMMUNICATION APPARATUS AND CONTROL METHOD THEREFOR

CANON KABUSHIKI KAISHA, ...

1. A communication apparatus comprising:
an acquisition unit configured to acquire information indicating whether a partner apparatus connected to the communication
apparatus by wired connection has a predetermined function of waiting in a power saving state in the wired connection;

a setting unit configured to set a communication speed with the partner apparatus in a case where the communication apparatus
is in a first state based on the information acquired by the acquisition unit;

a determination unit configured to determine whether or not the partner apparatus has the predetermined function, in a case
where the communication apparatus transits from the first state into a second state that requires more power consumption than
the first state; and

a resetting unit configured to execute a reset process of the communication speed with the partner apparatus, in a case where
it is determined that the partner apparatus does not have the predetermined function,

wherein the communication apparatus maintains, in the second state, the communication speed set by the setting unit in the
first state without executing the reset process by the resetting unit, in a case where it is determined that the partner apparatus
has the predetermined function.

US Pat. No. 9,519,336

SEMICONDUCTOR INTEGRATED CIRCUIT AND METHOD FOR CONTROLLING POWER SUPPLY IN SEMICONDUCTOR INTEGRATED CIRCUIT

CANON KABUSHIKI KAISHA, ...

1. A semiconductor integrated circuit comprising:
a control unit configured to control supply of power to a plurality of power supply domains respectively corresponding to
a plurality of functions included in an apparatus, wherein

a circuit configured to integrate bus signals between the plurality of power supply domains is included in a specific power
supply domain out of the plurality of power supply domains, and

the control unit performs control such that the supply of power to the specific power supply domain is carried out prior to
the other power supply domains connected with the specific power supply domain.

US Pat. No. 9,517,560

ROBOT SYSTEM AND CALIBRATION METHOD OF THE ROBOT SYSTEM

CANON KABUSHIKI KAISHA, ...

1. A robot system comprising:
a robot body configured to operate a work;
a visual sensor; and
a control apparatus configured to control a position and an orientation of the robot body, and to calculate a position and
an orientation of the work using a measured value by the visual sensor, wherein,

when observation of a marker by the visual sensor is performed for a calibration between a robot coordinate system fixed to
the robot body and a vision coordinate system fixed to the visual sensor, a calibration value is calculated based on a position
of the robot body in the robot coordinate system, and a position of the marker in the vision coordinate system for at least
three teaching points set within a calibration area, two of the three teaching points are placed on different positions in
a plane A of a finite size normal to an optical axis of the visual sensor, wherein the marker at two of the three teaching
points has the same inclination in relation to the optical axis of the visual sensor, and wherein the marker at the teaching
point other than the two of the three teaching points has an inclination different from that of the two of the three teaching
points and crosses the plane A.

US Pat. No. 9,507,170

OPTICAL APPARATUS, INTERCHANGEABLE LENS, AND METHOD FOR CORRECTING IMAGE BLURRING

Canon Kabushiki Kaisha, ...

1. An optical apparatus comprising:
a first image blurring correction unit configured to correct image blurring by moving a first image blurring correction lens;
a second image blurring correction unit configured to correct image blurring by moving a second image blurring correction
lens;

a blurring detection unit configured to detect blurring applied to the optical apparatus; and
a motion vector calculation unit configured to calculate a motion vector between a plurality of images shot by the optical
apparatus, wherein

the first image blurring correction unit is capable of correcting image blurring in accordance with a blurring signal detected
by the blurring detection unit; and

the second image blurring correction unit is capable of correcting image blurring in accordance with a motion vector signal
the motion vector signal calculated using a plurality of images of which image blurring has been corrected by the first image
blurring correction unit.

US Pat. No. 9,507,314

IMAGE FORMING APPARATUS

Canon Kabushiki Kaisha, ...

1. An image forming apparatus comprising:
an image bearing member;
a developer carrying member for carrying developer;
a cartridge detachably mountable to a main assembly of said image forming apparatus, said cartridge including (i) a cleaning
member configured to remove the developer remaining on said image bearing member after a developer image is transferred onto
a transfer material, (ii) a developer buffering portion for accommodating the developer being removed by said cleaning member,
and (iii) a feeding member driven for feeding the developer from said developer buffering portion to a developer container
provided in the main assembly; and

a controller configured to control said feeding member to stop the drive of said feeding member,
wherein said controller stops said feeding member when an estimated amount of toner to be removed by said cleaning member
during a remaining lifetime of the cartridge is less than an amount of the developer storable in the developer buffering portion.

US Pat. No. 9,500,975

MAGNETIC CARRIER AND TWO-COMPONENT DEVELOPER

CANON KABUSHIKI KAISHA, ...

1. A magnetic carrier, comprising magnetic carrier particles each comprising a magnetic carrier core, wherein
the magnetic carrier core is obtained by intermediate treatment of a magnetic material-dispersed resin particle including
a magnetic material and a resin having a hydroxy group, with a compound represented by the following formula (1):


in which R represents a hydrocarbon group having 8 or more carbon atoms, and R? represents —OH, —Cl, or —OR10 and R10 represents an organic group having 1 or more carbon atoms,

the magnetic carrier particles each further comprises a resin coating layer formed on a surface of the magnetic carrier core,
and

the magnetic carrier has an adsorbed moisture amount of 0.40 mass % or less when the magnetic carrier is left to stand in
an environment of a temperature of 30° C. and a humidity of 80% RH for 72 hours.

US Pat. No. 9,495,750

IMAGE PROCESSING APPARATUS, IMAGE PROCESSING METHOD, AND STORAGE MEDIUM FOR POSITION AND ORIENTATION MEASUREMENT OF A MEASUREMENT TARGET OBJECT

Canon Kabushiki Kaisha, ...

1. An image processing apparatus comprising:
one or more memory devices storing instructions for execution by one or more processors; and
the one or more processors, operable when executing the instructions to:
obtain an image including a target object;
hold model information of the target object;
obtain an approximate position and orientation of the target object included in the image;
estimate information related to a shadow region of the target object in the image;
correct the approximate position and orientation on the basis of the estimated information related to the shadow region;
associate the model information of the target object with image features of the target object in the image based on the corrected
approximate position and orientation; and

derive a position and orientation of the target object in the image by updating the corrected approximate position and orientation
on the basis of an association result.

US Pat. No. 9,470,800

RADIATION IMAGING APPARATUS AND RADIATION IMAGING SYSTEM

Canon Kabushiki Kaisha, ...

1. A radiation imaging apparatus comprising:
a pixel array having a plurality of pixels arranged in a plurality of rows and a plurality of columns, each pixel including
a conversion element for accumulating charge in accordance with radiation and a switching element for connecting the conversion
element to a signal line;

a bias line for supplying a bias potential to the conversion elements of the plurality of pixels;
a plurality of driving lines for supplying a driving signal to control the switching elements of the plurality of pixels;
a driving unit configured to supply a driving signal to the plurality of driving lines in units of one or more driving lines
and repeat an initialization operation comprising switching each driving signal from an OFF voltage at which the switching
element is turned off, to an ON voltage at which the switching element is turned on, and then returning the driving signal
to the OFF voltage;

an acquisition unit configured to acquire an effective value and a noise value in each driving cycle, the driving cycle being
a time duration from the time when a driving signal to particular one or more driving lines is switched to the ON voltage
to the time when a driving signal to a next one or more driving lines is switched to the ON voltage, the effective value representing
a current flowing through the bias line upon supply of the ON voltage to at least one of the plurality of driving lines, and
the noise value representing a current flowing through the bias line upon supply of the OFF voltage to each of the plurality
of driving lines;

a calculation unit configured to calculate radiation information based on the effective value and the noise value; and
a determination unit configured to determine whether irradiation of said pixel array with radiation is present based on the
calculated radiation information.

US Pat. No. 9,455,124

DRAWING APPARATUS, AND METHOD OF MANUFACTURING ARTICLE

CANON KABUSHIKI KAISHA, ...

1. A drawing apparatus for performing drawing on a substrate with a charged particle beam, the apparatus comprising:
a substrate stage configured to hold the substrate and be moved;
a charged particle optical system having a function of irradiating a plurality of charged particle beams arrayed along a first
axis, of individually blanking the plurality of charged particle beams, and of deflecting at least a portion of the plurality
of charged particle beams to perform displacement of the at least a portion of the plurality of charged particle beams on
the substrate; and

a controller configured to control the drawing so as to perform multiple irradiation of a target portion on the substrate
with at least a portion of the plurality of charged particle beams,

wherein the controller is configured to control the drawing such that the substrate stage is moved in one direction along
the first axis with respect to a plurality of shot regions formed on the substrate along the first axis, and the deflection
for the displacement along the first axis is performed with drawing on each of the plurality of shot regions as a unit, and

wherein the controller is configured to control the drawing such that, during drawing on a first shot region of the plurality
of shot regions with at least a portion of the plurality of charged particle beams, charged particle beams, of the plurality
of charged particle beams, located in a second shot region, of the plurality of shot regions, as the substrate stage is moved,
are blanked, and after the drawing on the first shot region with the at least a portion of the plurality of charged particle
beams is ended, the deflection for the displacement along the first axis is performed, and then drawing on the second shot
region with at least a portion of the plurality of charged particle beams is started.

US Pat. No. 9,450,006

IMAGE PICKUP ELEMENT, IMAGE PICKUP APPARATUS, AND IMAGE PICKUP SYSTEM

Canon Kabushiki Kaisha, ...

1. An image pickup element comprising:
four pixels which share one micro lens, the four pixels being divided into two portions in a first direction and being divided
into two portions in a second direction different from the first direction;

a first boundary provided between adjacent pixels in the first direction among the four pixels; and
a second boundary provided between adjacent pixels in the second direction among the four pixels,
wherein the first boundary and the second boundary are configured by a P-type semiconductor, and
wherein a P-type impurity concentration of the first boundary is lower than that of the second boundary.

US Pat. No. 9,438,792

IMAGE-PROCESSING APPARATUS AND IMAGE-PROCESSING METHOD FOR GENERATING A VIRTUAL ANGLE OF VIEW

Canon Kabushiki Kaisha, ...

1. An image-processing apparatus, comprising:
an obtaining unit configured to obtain first image data having a first angle of view obtained by image-capturing and second
image data having a second angle of view smaller than the first angle of view, the second image data corresponding to the
same viewpoint as the first image data, wherein the second image data has been generated using fourth image data and fifth
image data each having the second angle of view and each captured from viewpoints different from each other; and

a generating unit configured to generate third image data, corresponding to the same viewpoint as the first and second image
data, by performing weighted combination of the first image data and the second image data, the third image data having a
third angle of view determined according to a user command, wherein the third image data has an angle of view that is smaller
than the first angle of view but is larger than the second angle of view,

wherein the generating unit determines weights on the first image data and the second image data used for the weighted combination
such that the closer the third angle of view is to the second angle of view, the larger the weight on the second image data
is relative to the weight on the first image data, and

wherein the generating unit performs the weighted combination of the first image data and the second image data using the
determined weights.

US Pat. No. 9,437,646

DETECTING DEVICE, DETECTOR, AND IMAGING APPARATUS USING THE SAME

Canon Kabushiki Kaisha, ...

20. An imaging apparatus to perform image pickup of an object of measurement using electromagnetic waves, the imaging apparatus
comprising:
an oscillator configured to oscillate electromagnetic waves of a frequency band including a part of 30 GHz to 30 THz;
a detector to detect electromagnetic waves, the detector comprising:
a detecting device which detects electromagnetic waves, the detecting device comprising:
an antenna configured to receive electromagnetic waves; and
a plurality of semiconductor rectifying devices serially connected to the antenna, and connected in parallel to each other
such that the polarity is aligned,

wherein the plurality of semiconductor rectifying devices are in contact with the antenna or connected to the antenna via
a transmission line to rectify electromagnetic waves received by the antenna and transmitted, directly or via the transmission
line, to the plurality of semiconductor rectifying devices, and

wherein the plurality of semiconductor rectifying devices are each disposed at positions where the phase of electromagnetic
waves propagated from the antenna is substantially the same phase; and

a measuring unit configured to measure an electric field at the antenna; and
an image constructing unit configured to construct an image relating to the object of measurement, based on electromagnetic
waves detected by the detector.

US Pat. No. 9,433,031

COMMUNICATION APPARATUS, CONTROL METHOD FOR THE SAME AND NON-TRANSITORY COMPUTER-READABLE STORAGE MEDIUM

CANON KABUSHIKI KAISHA, ...

1. A communication apparatus comprising:
a first radio communication unit that communicates with another communication apparatus;
a first acquisition unit that acquires device information regarding said another communication apparatus via the first radio
communication unit;

a storage unit that stores the acquired device information via the first radio communication unit;
a second radio communication unit that communicates with said another communication apparatus, using a different radio communication
system from that of the first radio communication unit;

a detection unit that, when a predetermined service is being executed with said another communication apparatus based on the
device information acquired by the first acquisition unit, detects a predetermined signal to stop executing of the predetermined
service via the second radio communication unit,

a determination unit that, if the detection unit detects the predetermined signal, determines whether device information,
included in the predetermined signal, regarding said another communication apparatus is included in the device information
which has been acquired via the first radio communication unit and has been stored in the storage unit; and

an execution unit that,
(i) if the device information, included in the predetermined signal, regarding said another communication apparatus is included
in the device information which has been acquired via the first radio communication unit and has been stored in the storage
unit, executes stop processing of the predetermined service, and,

(ii) if the device information, included in the predetermined signal, regarding said another communication apparatus is not
included in the device information which has been acquired via the first radio communication unit and has been stored in the
storage unit, does not execute the stop processing of the predetermined service.

US Pat. No. 9,409,738

PRINTING APPARATUS AND CONTROL METHOD

CANON KABUSHIKI KAISHA, ...

1. A printing apparatus that can discharge sheets to a stacking apparatus that includes a first stacking unit onto which discharged
sheets are stacked, and a second stacking unit onto which the sheets stacked onto the first stacking unit can be caused to
slide from the first stacking unit to a position for user retrieval, the printing apparatus comprising:
a first control unit configured to control execution of a first job of discharging sheets to the stacking apparatus, and a
second job of discharging sheets to a finisher that is different from the stacking apparatus; and

a second control unit configured to perform sheet discharge preparation in the finisher before the discharge of sheets to
the stacking apparatus is interrupted by an operation for sliding the stacked sheets to the position for the user retrieval,

wherein the first control unit executes the second job when sheet discharge preparation is performed in the finisher by the
second control unit.

US Pat. No. 9,403,989

PRODUCTION PROCESS FOR SELF-DISPERSIBLE PIGMENT, SELF-DISPERSIBLE PIGMENT, INK, INK CARTRIDGE AND INK JET RECORDING METHOD

Canon Kabushiki Kaisha, ...

1. A production process for a self-dispersible pigment, the process comprising a step of bonding a functional group containing
a hydrophilic group to a particle surface of a pigment by causing a compound represented by the following general formula
(1) to react with the particle surface of the pigment:

wherein R1 is a halogen atom, R2 is an alkali metal, R3 is a single bond, —CO—, —CONH— or —SO2—, and R4 is a group (a) having at least one of an aliphatic group and an aromatic group and (b) being substituted with at least one
hydrophilic group selected from the group consisting of a carboxylic acid group, a sulfonic acid group, a phosphoric acid
group, and a phosphonic acid group.

US Pat. No. 9,405,288

ROBOT APPARATUS AND CONTROLLING METHOD OF THE ROBOT APPARATUS

CANON KABUSHIKI KAISHA, ...

1. A robot apparatus comprising:
a robot body having a multi joint arm including a plurality of joints;
a motor provided as a driving source of at least a part of the plurality of joints; and
a controlling system capable of controlling the motor, wherein
the controlling system comprises
a motion controlling unit configured to input a current to the motor to rotate the motor,
a heat generation controlling unit configured to input the current to the motor to generate heat, without rotating the motor,
and

a controlling unit configured to calculate a temperature raising current necessary to rise up to a predetermined temperature
without rotating the motor, to generate a current instruction for temperature raising to set the heat generation controlling
unit to output the temperature raising current, and to transmit the current instruction for temperature raising to the heat
generation controlling unit at stopping the robot body.

US Pat. No. 9,398,850

OPHTHALMIC APPARATUS, METHOD FOR CONTROLLING OPHTHALMIC APPARATUS, AND STORAGE MEDIUM

CANON KABUSHIKI KAISHA, ...

1. An ophthalmic apparatus comprising:
an illumination optical system including a light source and configured to illuminate an eye to be examined;
an imaging optical system including an image sensor, the image sensor imaging the eye illuminated by the illumination optical
system;

a plurality of optical member insertion/removal units configured to insert/remove a plurality of optical members in/from at
least one of optical paths in the illumination optical system and the imaging optical system;

a control unit configured to control the optical member insertion/removal units so as to insert/remove the optical members
in/from the at least one optical path;

a determination unit configured to determine whether or not insertion/removal of each optical member in/from an optical path
has been normally performed, based on an analysis result of an image corresponding to each optical member obtained by the
image sensor in synchronism with insertion/removal of each optical member in/from the optical path; and

a notification unit configured to notify an abnormality in a case where the determination unit has determined that insertion/removal
of at least one of the plurality of optical members in/from the optical path has not been normally performed.

US Pat. No. 9,397,132

SOLID-STATE IMAGING DEVICE, MEMBERS FOR THE SAME, AND IMAGING SYSTEM

CANON KABUSHIKI KAISHA, ...

1. A device comprising:
a first substrate provided with a first transistor, the first substrate having a first face where the first transistor is
provided and having a second face on the opposite side of the first face of the first substrate;

a first wiring structure provided on the first face of the first substrate, the first wiring structure having a first wiring
layer;

a second substrate provided with a second transistor, the second substrate having a first face where the second transistor
is provided and having a second face on the opposite side of the first face of the second substrate; and

a second wiring structure provided on the first face of the second substrate, the second wiring structure having a second
wiring layer; and

a pad for connection with an external terminal,
wherein the second wiring structure is arranged between the first substrate and the second substrate,
wherein the first wiring layer includes a first wiring made mainly of copper,
the second wiring layer includes a second wiring made mainly of copper, and
the pad includes a conductive element made mainly of aluminum, and
wherein a distance between the pad and the second face of the second substrate is larger than a thickness (D2) of the second substrate, and is smaller than a distance between the second face of the first substrate and the second face
of the second substrate.

US Pat. No. 9,389,538

IMAGE FORMING APPARATUS HAVING TONER SUPPLY CONTROL

CANON KABUSHIKI KAISHA, ...

1. A toner supply system including a toner receiving apparatus and a toner supply container detachably mountable to said toner
receiving apparatus, said system comprising:
said toner supply container includes:
(i) a container body configured to contain toner;
(ii) a discharge port configured to permit discharging of the toner in said container body; and
(iii) a feeding portion configured to feed the toner in said container body toward said discharge port with a rotation of
said container body,

said toner receiving apparatus includes:
(i) a toner receiving portion configured to receive the toner from said toner supply container, which is in a set position,
through said discharge port;

(ii) a driving mechanism engageable with said container body to rotationally drive said container body; and
(iii) a regulating mechanism movable between a regulating position, where the rotation of said container body, which is in
the set position and is engaged with said driving mechanism, is regulated, and a releasing position, where regulation of rotation
of said container body, which is in the set position and is engaged with said driving mechanism, is released.

US Pat. No. 9,389,820

INFORMATION PROCESSING APPARATUS AND CONTROL METHOD THEREOF, AND NON-TRANSITORY COMPUTER-READABLE MEDIUM

Canon Kabushiki Kaisha, ...

1. An information processing apparatus comprising:
a setting unit configured to accept (i) a layout setting in a case of laying out a plurality of pages forming print data on
one printing medium sheet and (ii) a punch processing setting for the printing medium sheet;

a decision unit configured to decide on respective orientations of the plurality of pages laid out on the printing medium
sheet, based on the layout setting and the punch processing setting set by the setting unit; and

a control unit configured to cause a printing unit to print, on the printing medium sheet, the plurality of pages based on
the orientations decided by the decision unit,

wherein the printing medium sheet is subjected to printing and is then cut by a post processing apparatus into pages,
wherein the decision unit decides on respective orientations of the plurality of laid out pages such that the same relationship
between a position of punch holes punched by the punch processing and a page orientation is maintained between printing medium
sheets respectively corresponding to the plurality of pages after cutting, and

wherein at least a part of the decision unit is implemented by a processor and a memory of the information processing apparatus.

US Pat. No. 9,390,354

METHOD FOR PRINTING AN UPSCALED IMAGE

CANON KABUSHIKI KAISHA, ...

1. A method of printing an transformed image corresponding to a source image, said method comprising:
determining at least a first scale factor to upscale said source image to generate said transformed image, said first scale
factor being at a first mathematical precision;

enlarging said source image along at least two orthogonal edges of said source image to form an enlarged area defining an
enlarged source image;

copying pixel data along the at least two orthogonal edges of the source image into the enlarged area of said enlarged source
image; and

mapping each pixel of said transformed image back to a corresponding pixel of the enlarged source image including the copied
pixel data along the at least two orthogonal edges of the source image.

US Pat. No. 9,392,176

IMAGE CAPTURE APPARATUS AND CONTROL METHOD THEREFOR

Canon Kabushiki Kaisha, ...

1. An image capture apparatus performs an optical anti-shake function that reduces an image shake by driving an anti-shake
element in a different direction from an optical axis of an imaging optical system in accordance with a detected shake, the
image capture apparatus comprising:
a determination unit configured to determine, when a plurality of geometric deformation correction processes are electronically
applied to a captured image captured by an image sensor, respective reference coordinates for the plurality of geometric deformation
correction processes to be a coordinate of an intersection of the optical axis moved by the optical anti-shake function and
the image sensor; and

a deformation processing unit configured to electronically apply the plurality of geometric deformation correction processes
to the captured image using the respective reference coordinates determined by the determination unit and an amount of geometric
deformation based on the detected shake.

US Pat. No. 9,392,241

IMAGE PROCESSING APPARATUS AND IMAGE PROCESSING METHOD

CANON KABUSHIKI KAISHA, ...

1. An apparatus configured to generate a luminance signal from image data, the apparatus comprising:
a generation circuit configured to receive a first image data in which color signals corresponding to a plurality of colors
are alternately arranged in a predetermined arrangement and generate a plurality of image data corresponding to different
frequency bands using the first image data;

a synthesis circuit configured to generate a second image data by synthesizing the plurality of image data;
a sampling circuit configured to generate a third image data from the second image data by sampling the color signals corresponding
to the colors in accordance with the predetermined arrangement; and

a luminance signal generation circuit configured to generate the luminance signal from the third image data.

US Pat. No. 9,384,531

IMAGE PROCESSING APPARATUS, IMAGE PROCESSING METHOD, AND STORAGE MEDIUM FOR REDUCING NOISE IN A CAPTURED IMAGE

CANON KABUSHIKI KAISHA, ...

1. An image processing apparatus for determining a pixel value of a target pixel by a weighted mean of a plurality of reference
pixels in image data, comprising a processor and a memory storing instructions which, when executed by the processor, cause
the processor to function as:
a derivation unit configured to derive a weight for each of the reference pixels, based on similarity between a target region
associated with the target pixel and a reference region associated with the reference pixels; and

a weighted mean processing unit configured to perform weighted mean processing by calculating a sum of products of pixel values
of the plurality of reference pixels and the weights corresponding to the reference pixels, respectively, derived by the derivation
unit,

wherein the derivation unit derives a weight for the target pixel to be used for the sum of products calculated by the weighted
mean processing unit as 0, and

the weighted mean processing unit calculates a result of the weighted mean processing using the sum of products by using the
weights derived by the derivation unit.

US Pat. No. 9,373,800

ORGANIC LIGHT EMITTING ELEMENT HAVING LITHIUM—BORON COMPLEX

Canon Kabushiki Kaisha, ...

1. An apparatus comprising an organic light emitting element comprising:
a pair of electrodes; and
an organic compound layer arranged between the pair of electrodes,
wherein the organic compound layer contains a lithium complex compound represented by the following general formula [1]:

in the formula [1], R1 to R16 each independently represent a hydrogen atom, a halogen atom, a cyano group, an alkyl group that may be substituted with fluorine,
an alkoxy group that may be substituted with fluorine, or a substituted or unsubstituted aryl group.

US Pat. No. 9,367,009

FIXING MEMBER HAVING A POROUS ELASTIC LAYER WITH A NEEDLE-LIKE FILLER

CANON KABUSHIKI KAISHA, ...

1. A fixing member used for fixing a toner image on a recording material, comprising:
a base layer; and
a porous elastic layer provided on said base layer and configured to contain a needle-like filler,
wherein said elastic layer has a thermal conductivity with respect to a longitudinal direction thereof in a first region where
said fixing member is contactable to the recording material, the thermal conductivity is 6 times to 900 times a thermal conductivity
with respect to a thickness direction in the first region,

wherein said elastic layer has a thermal conductivity with respect to the thickness direction thereof in a second region outside
the first region of said fixing member with respect to the longitudinal direction, and

wherein the thermal conductivity with respect to the thickness direction in the second region is larger than the thermal conductivity
with respect to the thickness direction in the first region.

US Pat. No. 9,365,043

LIQUID EJECTION HEAD

Canon Kabushiki Kaisha, ...

1. A liquid ejection head, comprising:
a connector unit comprising:
a first electric contact portion and a second electric contact portion for electric connection; and
a fixing portion configured to fix the first electric contact portion and the second electric contact portion; and
a first electric substrate to be electrically connected to the first electric contact portion,
wherein each of the first electric contact portion and the second electric contact portion has spring force, and
wherein the spring force of the first electric contact portion and the spring force of the second electric contact portion
are in opposite directions.

US Pat. No. 9,361,157

INFORMATION PROCESSING APPARATUS AND CONTROL METHOD THEREOF

CANON KABUSHIKI KAISHA, ...

1. An information processing apparatus comprising:
a plurality of circuit blocks, each of which comprises a plurality of arithmetic elements;
a power supply controller configured to control power supply to the plurality of circuit blocks individually so as to reduce
power consumption due to static power in said plurality of circuit blocks, by power shutdown of each circuit block;

an acquisition unit configured to acquire first information with regard to at least a number of arithmetic element(s) necessary
for an arithmetic process, and second information with regard to which at least a number of arithmetic elements are included
in circuit blocks that are currently being supplied with power by said power supply controller; and

a management unit configured to determine, based on the first information and the second information, whether a process for
implementing the arithmetic process can be assigned to one of the arithmetic elements that are included in circuit blocks
that are currently being supplied with power by said power supply controller so as to perform a preferential assign of processes
for implementing the arithmetic process to the arithmetic elements included in the circuit blocks.

US Pat. No. 9,356,585

IMAGE PICKUP DEVICE

Canon Kabushiki Kaisha, ...

1. An image pickup device comprising:
a first output line for current signals from a plurality of pixels being output to the first output line;
a current mirror circuit including a first transistor electrically connected to the first output line and a second transistor
electrically connected to a second output line, the current mirror circuit being configured to mirror the current signals
from the plurality of pixels into the second output line, the first transistor being configured to receive the current signals
from the first output line, and the second transistor being configured to output a mirrored current signal to the second output
line; and

a comparator configured to compare the mirrored current signal being output from the current mirror circuit to the second
output line with a reference current signal, and to output a signal representing a comparison result of amplitudes of the
mirrored current signal and the reference current signal,

wherein each of the plurality of the pixels includes a photoelectric conversion unit and an amplification unit configured
to output, to the first output line, one of the current signals from the plurality of pixels, and

wherein each of the current signals from the plurality of pixels is based on an amount of charges generated by the photoelectric
conversion unit.

US Pat. No. 9,354,556

IMAGE FORMING APPARATUS

Canon Kabushiki Kaisha, ...

1. An image forming apparatus comprising:
an image carrying member that carries a toner image;
a transfer unit that includes
a transfer member configured to transfer the toner image from the image carrying member to a recording material,
a first separating portion configured to separate an end of the transfer member that is on one side from the image carrying
member, and

a second separating portion configured to separate an end of the transfer member that is on another side from the image carrying
member;

an engaging unit that includes
a first engaging portion configured to engage with the first separating portion, and
a second engaging portion configured to engage with the second separating portion,
the engaging unit being configured to separate the transfer member from the image carrying member when the first engaging
portion engages with the first separating portion and the second engaging portion engages with the second separating portion;
and

a regulating member configured to regulate a movement of the engaging unit,
wherein the engaging unit is moved by the regulating member from the one side toward the other side or from the other side
toward the one side.

US Pat. No. 9,354,828

PRINT SYSTEM, PRINT SERVER, CONTROL METHOD THEREOF, AND PROGRAM

CANON KABUSHIKI KAISHA, ...

1. A system which is configured by a client terminal including a web browser, a printer, and a print server for providing
print data generated on the basis of data acquired by an external service to the printer, the system comprising:
a reception unit constructed to receive from the web browser included in the client terminal a registration request for registering
information of the printer to the print server;

a transmission unit constructed to transmit, in response to reception of the registration request by said reception unit,
the information of the printer associated with user information input via a user authentication screen transmitted from the
print server to the client terminal;

a printing unit constructed to print data, after the print data is received, which is provided by the print server in response
to designation for causing the printer to print the data; and

a provision unit constructed to provide a print setting screen of a printer, which is provided by the print server, after
the user information is associated with the information of the printer.

US Pat. No. 9,354,580

IMAGE FORMING APPARATUS

Canon Kabushiki Kaisha, ...

1. An image forming apparatus comprising:
an apparatus main body formed with an opening;
an image forming unit configured to form an image on a sheet;
a plurality of storage portions each configured to store the sheet on which the image is formed inside the apparatus main
body;

a moving unit configured to move the sheet stored in a storage portion included in the plurality of storage portions and expose
the sheet outside of the apparatus main body via the opening; and

a control unit configured to permit the moving unit to move and expose a first sheet stored in the storage portion if the
control unit receives information about a first user who has instructed to print the first sheet,

wherein the control unit is configured to,
in a case where the control unit is not instructed to print more sheets than the number of sheets that can be stored in the
plurality of storage portions, prohibit the moving unit from moving and exposing the first sheet if the control unit receives
information about a second user different from the first user, and

in a case where the control unit is instructed to print more sheets than the number of sheets that can be stored in the plurality
of storage portions, permit the moving unit to move and expose the first sheet if the control unit receives the information
about the second user.

US Pat. No. 9,352,053

PARTICLE AND PHOTOACOUSTIC CONTRAST AGENT HAVING THE PARTICLE

CANON KABUSHIKI KAISHA, ...

1. A contrast agent for photoacoustic imaging, comprising a particle,
wherein the particle has dopamine and iron atoms, and
wherein the particle has a ratio of a number of moles of the dopamine to a number of moles of the iron atoms that is from
270/10,000 to 3,000/10,000.

US Pat. No. 9,335,686

IMAGE FIXING APPARATUS HAVING A HEATER, A THERMOSENSITIVE ELEMENT, AND A TENSION SPRING CONFIGURED TO BIAS OR URGE THE THERMOSENSITIVE ELEMENT

Canon Kabushiki Kaisha, ...

1. An image fixing apparatus comprising:
a heater configured to heat and fix a toner image formed on a recording material onto the recording material;
a thermosensitive element configured to sense heat from said heater;
a stay, having a U-shaped cross-section, configured to apply pressure to a fixing nip for nipping and feeding the recording
material; and

a tension spring configured to urge said thermosensitive element toward said heater,
wherein said thermosensitive element and said tension spring are provided inside of said stay.

US Pat. No. 9,329,372

ZOOM LENS AND IMAGE PICKUP APPARATUS HAVING THE SAME

CANON KABUSHIKI KAISHA, ...

1. A zoom lens comprising, in order from an object side to an image side:
a first lens unit having a negative refractive power which does not move for zooming;
a second lens unit having a positive refractive power which moves during the zooming;
a third lens unit having a negative refractive power which moves during the zooming; and
a fourth lens unit having a positive refractive power, wherein the following expressions are satisfied:
?0.80
?1.2
0.5<|m2/m3|<3.0,
where f1 represents a focal length of the first lens unit, f2 represents a focal length of the second lens unit, f3 represents
a focal length of the third lens unit, m2 represents a moving amount of the second lens unit during the zooming from a wide
angle end to a telephoto end, and m3 represents a moving amount of the third lens unit during the zooming from the wide angle
end to the telephoto end.

US Pat. No. 9,325,898

COMMUNICATION APPARATUS AND METHOD FOR CONTROLLING THE SAME

CANON KABUSHIKI KAISHA, ...

1. A communication apparatus comprising:
a connection unit that connects to a first network formed by an access point;
a data communication unit configured to establish communication with an information processing apparatus on the first network
by using a first application;

a determination unit configured to determine whether the information processing apparatus is operating as the access point
forming the first network;

a detection unit configured to detect a transition of the first application to a background, wherein the first application
is capable of transitioning to a foreground and the background; and

a control unit configured to perform control to disconnect from the first network after the determination unit determines
that the information processing apparatus is operating as the access point and after the detection unit detects the transition
of the first application to the background.

US Pat. No. 9,319,680

IMAGE ENCODING APPARATUS AND ITS CONTROL METHOD

CANON KABUSHIKI KAISHA, ...

1. An image encoding apparatus for encoding image data including a plurality of frames, comprising:
an obtaining unit configured to obtain the image data;
a prediction unit configured to determine a size of an encoding block of an encoding subject frame on the basis of the obtained
image data;

an encoding unit configured to encode the obtained image data on an encoding block unit basis in accordance with the determined
encoding block size; and

a code amount control unit configured to control a code amount of the encoding block whose size is determined by the prediction
unit, based on encoding information of a current encoding block, whose size is determined by the prediction unit and an encoding
block encoded by the encoding unit before the current encoding block,

wherein the code amount control unit arithmetically operates predetermined encoding information of the encoding subject frame
on the basis of the encoding information and restricts the encoding block size which is to be determined by the prediction
unit, in accordance with the predetermined encoding information which is arithmetically operated,

wherein the code amount control unit calculates a code amount error rate from a generated code amount and a target code amount
of the encoding subject frame and changes a maximum size of the encoding block size which is to be determined by the prediction
unit, in accordance with the calculated code amount error rate.

US Pat. No. 9,310,226

POSITION DETECTION APPARATUS, DRIVE CONTROL APPARATUS, AND LENS APPARATUS

Canon Kabushiki Kaisha, ...

1. A position detection apparatus comprising:
a signal output unit that is arranged to be opposite to a scale unit and configured to read patterns of the scale unit and
output a plurality of signals, the position detection apparatus detecting a relative position of a position detection target
that moves in synchronism with the scale unit or the signal output unit from a reference position on the basis of the plurality
of signals;

a relative position detection unit configured to detect the relative position of the position detection target from the reference
position on the basis of the plurality of signals;

an absolute position detection unit configured to detect an absolute position of the position detection target on the basis
of the plurality of signals;

a reference position setting unit configured to set the absolute position detected by the absolute position detection unit
as the reference position; and

a state detection unit configured to detect a state of the position detection target,
wherein the state includes a stopped state in which the position detection target is stopped, a low-speed operating state
in which the position detection target is operated at a low speed, and a high-speed operating state in which the position
detection target is operated at a higher speed than in the low-speed operating state,

wherein the absolute position detection unit determines that the absolute position is used in a case where the state is the
stopped state or the low-speed operating state and determines that the absolute position is not used in a case where the state
is the high-speed operating state, and

wherein the reference position setting unit sets the absolute position determined to be used by the absolute position detection
unit as a confirmed reference position corresponding to the reference position that has been confirmed in a case where the
state is the stopped state and sets the absolute position as a tentative reference position corresponding to the reference
position that has tentatively been set in a case where the state is the low-speed operating state.

US Pat. No. 9,310,762

PROCESS CARTRIDGE AND ELECTROPHOTOGRAPHIC IMAGE FORMING APPARATUS

Canon Kabushiki Kaisha, ...

1. An image forming apparatus for forming an image on a recording material, said image forming apparatus comprising:
a main assembly including:
(a) a main assembly side plate,
(b) a main assembly side positioning portion,
(c) a main assembly side regulating portion that is provided on said main assembly side plate, and
(d) a main assembly slanted surface; and
a detachably mountable process cartridge positioned at said main assembly side positioning portion, said process cartridge
including:

(i) a cartridge side portion-to-be-positioned configured to be positioned at said main assembly side positioning portion when
said process cartridge is mounted to said main assembly, and

(ii) a cartridge side portion-to-be-regulated configured to be regulated to prevent contact of said cartridge side portion-to-be-positioned
to said main assembly side positioning portion by contact between said main assembly side regulating portion and said cartridge
side portion-to-be-regulated,

wherein, when said process cartridge is inserted into said main assembly along a longitudinal direction of said process cartridge,
said process cartridge contacts said main assembly slanted surface so that said cartridge side portion-to-be-regulated comes
into contact with said main assembly side regulating portion and said cartridge side portion-to-be-positioned is positioned
at said main assembly side positioning portion.

US Pat. No. 9,300,935

IMAGE PROCESSING APPARATUS CAPABLE OF REDUCING DIFFERENCES OF COLOR CHARACTERISTICS BETWEEN INTERCHANGEABLE LENSES USING WHITE BALANCE ADJUSTMENT AND CONTROL METHOD THEREOF

CANON KABUSHIKI KAISHA, ...

1. An image processing apparatus comprising:
a programmable processor;
a memory that stores a program causes, when executed, the programmable processor to function as:
a determination unit adapted to determine a type of an interchangeable lens used to shoot an image from a plurality of types
of interchangeable lenses having different color characteristics; and

an image processing unit adapted to apply white balance adjustment,
wherein the image processing unit reduces the influence of differences in the color characteristics of the interchangeable
lenses on the tint of the image by setting white balance coefficients used in the white balance adjustment to correspond to
the type of the interchangeable lens used to shoot the image, and

wherein the image processing unit computes the white balance coefficients used in the white balance adjustment based on a
white region detected from the image using a white detection range that corresponds to the type of the interchangeable lens
used to shoot the image.

US Pat. No. 9,300,979

METHODS FOR TRANSMITTING AND RECEIVING DATA CONTENTS, CORRESPONDING SOURCE AND DESTINATION NODES AND STORAGE MEANS

Canon Kabushiki Kaisha, ...

1. A method for transmitting at least first and second video streams, each comprising images, by means of a source node to
a destination node via at least first and second transmission paths, said method for transmitting comprising steps of:
sub-dividing each of said first and second video streams into a succession of image lines;
selecting a transmission scheme as a function of at least one piece of information on quality of transmission on at least
one of the paths, said transmission scheme defining, for each path, a predetermined alternation of several lines of the first
video stream and several lines of the second video stream; and

transmitting, on at least one of said paths, packets of lines each packet comprising the predetermined alternation of several
lines defined by the transmission scheme selected by considering the quality of transmission of the transmission path on which
the packet is transmitted,

wherein when each path uses a distinct transmission trajectory, the transmission scheme is selected from at least two different
transmission schemes dependent upon quality of transmission on at least one of the paths, and

wherein transmission trajectory is defined by a specific configuration of at least one antenna among a send antenna included
in the source node and a receive antenna included in the destination node.

US Pat. No. 9,298,972

IMAGE PROCESSING APPARATUS AND IMAGE PROCESSING METHOD

CANON KABUSHIKI KAISHA, ...

1. An image processing apparatus for detecting an object in an image, comprising:
an input unit configured to input an image;
an image rotating unit configured to rotate the image in a predetermined angle; and
a detection unit configured to perform both of detection of an object inclined at angles within a first angle range in the
image input by the input unit and detection of an object inclined at angles within a second angle range in the image rotated
by the image rotation unit;

wherein the second angle range is narrower than the first angle range, wherein
the detection unit is configured to perform object detection processing by a split AdaBoosting with a first number of splits
for detecting an object inclined at angles within the first angle range in the image input by the input unit, and to perform
the object detection processing by the split AdaBoosting with a second number of splits for detecting an object inclined at
angles within the second angle range in the image rotated by the image rotating unit, and wherein the second number of splits
is smaller than the first number of splits.

US Pat. No. 9,298,742

INFORMATION PROCESSING APPARATUS AND CONTROL METHOD THEREOF

Canon Kabushiki Kaisha, ...

1. An image processing apparatus for processing a plurality of moving image files each including added file numbers based
on a predetermined order and each including associated information relating to a continuity between a moving image file and
another moving image file, comprising:
an obtaining unit configured to obtain the associated information of the plurality of moving image files,
wherein the associated information includes first identification information indicating a moving image file which is continuously
recorded before the moving image file during a shooting of a moving image and second identification information indicating
a moving image file which is continuously recorded after the moving image file during the shooting of the moving image;

a detecting unit configured to detect, from among the plurality of moving image files, a plurality of moving image files of
the same group which are divided and continuously recorded during the shooting of the moving image, in accordance with the
associated information of the plurality of moving image files obtained by the obtaining unit,

wherein the detecting unit checks the associated information of the moving image files obtained by the obtaining unit in numeric
order corresponding to the file numbers, and detects the plurality of moving image files of the same group; and

a combining unit configured to perform combining processing for combining the plurality of moving image files of the same
group,

wherein the combining unit combines the plurality of moving image files of the same group into one file based on their shooting
order.

US Pat. No. 9,296,231

PRINTING APPARATUS AND POSTURE CHANGE CORRECTING METHOD FOR PRINT HEAD

CANON KABUSHIKI KAISHA, ...

1. A printing apparatus comprising:
a print head which includes a surface in which nozzles for ejecting ink are formed;
a moving unit configured to mount the print head and move in a first direction;
a platen positioned to face the print head for supporting a print medium;
a pattern printing unit configured to cause the print head to print a plurality of test patterns at each of a plurality of
different positions in the first direction on the print medium;

a measuring unit configured to measure the plurality of test patterns printed on the print medium;
a changing unit configured to change an angle of the print head with respect to the platen by moving the print head such that
the direction of a line perpendicular to the surface is changed; and

a control unit configured to cause the changing unit to change the angle of the print head corresponding to positions of the
print head in the first direction, based on measurement results by the measuring unit.

US Pat. No. 9,289,117

OPTICAL TOMOGRAPHIC IMAGING APPARATUS

Canon Kabushiki Kaisha, ...

1. An optical tomographic imaging apparatus configured to acquire a tomographic image of an object to be examined based on
light produced by combining return light from the object to be examined irradiated with measurement light via a first lens,
and reference light corresponding to the measurement light, the optical tomographic imaging apparatus comprising:
a first scanning unit disposed on an optical path of the measurement light, and configured to scan the measurement light on
the object to be examined in a first direction;

a second scanning unit disposed on the optical path of the measurement light, and configured to scan the measurement light
in a second direction intersecting with the first direction;

a second lens disposed on the optical path of the measurement light between the first lens and the first and second scanning
units, the second lens having a focal length longer than a focal length of the first lens; and

an optical path branching unit disposed between the first lens and the second lens, the optical path branching unit being
configured to branch light from the optical path of the measurement light to an observation optical path for observing the
object to be examined,

wherein a focal position of the second lens is located a substantially half-way between the first and second scanning units,
and

wherein the first and second scanning units scan the measurement light with a narrower range of an angle than a range of an
angle with which the measurement light irradiates the object to be examined via the first lens.

US Pat. No. 9,291,445

OPTICAL COHERENCE TOMOGRAPHIC APPARATUS

Canon Kabushiki Kaisha, ...

1. An optical coherence tomographic apparatus which obtains a tomographic image of an object based on light obtained by combining
return light from the object irradiated with measurement light through a first lens and reference light corresponding to the
measurement light, the apparatus comprising:
a scanning unit configured to be provided on an optical path of the measurement light and configured to scan the measurement
light on the object;

a second lens configured to be disposed between said scanning unit and the object on the optical path of the measurement light;
an optical path branching unit configured to be disposed between the first lens and said second lens and configured to make
the optical path of the measurement light branch off to an observation optical path for observation of the object,

wherein the first lens is an objective lens,
wherein said second lens and said scanning unit are disposed so as to make a plurality of light beams, obtained by said scanning
unit scanning the measurement light between the objective lens and said second lens, become almost parallel to each other
and such that the plurality of light beams obtained by said scanning unit irradiate the objective lens almost in parallel.

US Pat. No. 9,291,748

ANTI-REFLECTION STRUCTURE WITH GRADED REFRACTIVE INDEX LAYER AND OPTICAL APPARATUS INCLUDING SAME

CANON KABUSHIKI KAISHA, ...

1. An anti-reflection structure comprising:
a first layer that is a graded refractive index layer which is disposed on a substrate and whose refractive index decreases
as a distance from the substrate increases;

a second layer that is disposed on the first layer and whose refractive index is homogeneous, wherein refractive index of
the second layer is na and 1.10
an interface between the first layer and the second layer, wherein the following condition is satisfied at the interface:
nb?na>0.10
where nb represents refractive index of the first layer at the interface between the first layer and the second layer.
US Pat. No. 9,290,818

PROBE, PROBE SET, PROBE CARRIER, AND TESTING METHOD

CANON KABUSHIKI KAISHA, ...

1. A probe carrier comprising:
a probe set for detecting a DNA of Candida tropicalis which is a pathogenic fungus; and

a carrier on which the probe set is immobilized,
wherein the probe set comprises three probes consisting of the following base sequences (A) to (C) respectively to specifically
detect Candida tropicalis:
(A) accgccagaggttataactaaaccaaa (SEQ ID NO. 1) or the complementary sequence thereof;
(B) gagcaatacgctaggtttgtttgaaagaa (SEQ ID NO. 2) or the complementary sequence thereof; and
(C) acgcttattttgctagtggccacc (SEQ ID NO. 3) or the complementary sequence thereof.

US Pat. No. 9,283,755

LIQUID EJECTION HEAD

CANON KABUSHIKI KAISHA, ...

1. A liquid ejection head comprising:
a plurality of discharge orifices arrayed in a predetermined direction; energy generation devices disposed in correspondence
with the discharge orifices and configured to generate thermal energy for use in ejecting liquid; pressure chambers partitioned
by walls, the pressure chambers each accommodating the energy generation device and communicating with the discharge orifice;
and

channels configured to supply liquid to the pressure chambers; wherein the edge of the discharge orifice has at least one
protrusion protruding toward a central portion of each of the discharge orifices, and the discharge orifices have an elongated
shape in which a length in a direction in which the liquid flows from the channel to the pressure chamber is larger than a
width in a direction perpendicular to the liquid flowing direction,

wherein a curvature of a first portion of the edge where the direction in which liquid flows from the channel to the pressure
chamber and a tangent to the first portion are parallel to each other is smaller than a curvature of a second portion of the
edge next to the protrusion, the second portion being except a portion where the protrusion is provided.

US Pat. No. 9,285,691

EXPOSURE APPARATUS AND METHOD FOR MANUFACTURING ARTICLE

CANON KABUSHIKI KAISHA, ...

1. An exposure apparatus for transferring an image of a pattern formed on an original onto a substrate via a projection optical
system, the exposure apparatus comprising:
a first detector that detects at least one of substrate-side marks formed on the substrate via an original-side mark formed
on the original and the projection optical system;

a plurality of second detectors that are arranged in a larger number than the first detector and respectively detect the substrate-side
marks not via the projection optical system;

a reference plate that has a plurality of reference marks; and
a control unit configured to control alignment of the original and the substrate,
wherein the control unit is configured to obtain a first detection result of the plurality of reference marks by the second
detectors and to obtain first information relating to a first distance between the plurality of second detectors based on
the first detection result,

wherein the control unit is configured to obtain a second detection result of the identical substrate-side mark by the first
detector and the second detectors and to obtain second information relating to a second distance between the first detector
and the second detectors based on the second detection result, and

wherein the control unit is configured to control the alignment of the original and the substrate based on the first information
and the second information.

US Pat. No. 9,285,729

IMAGE FORMING APPARATUS INCLUDING TEMPERATURE DETECTION PROCESSING OF A FIXING MEMBER

CANON KABUSHIKI KAISHA, ...

1. An image forming apparatus comprising:
a fixing unit having a heater, and a fixing member configured to be heated by the heater, the fixing unit configured to heat
a recording material bearing an image using the fixing member so that the image is fixed on the recording material;

a film provided in non-contact with the fixing member, the film configured to increase its temperature by absorbing infrared
rays emitted from the fixing member;

a first sensor configured to measure a temperature of the film;
a holding member configured to hold the film;
a second sensor configured to measure a temperature of the holding member;
a storage unit for storing corresponding relations among information about measurement results of the first sensor and measurement
results of the second sensor, and the temperature of the fixing member, as a plurality of temperature determination information
wherein the plurality of temperature determination information has the different corresponding relations;

a selection unit configured to select temperature determination information to interest, based on the measurement results
of the first sensor and the measurement results of the second sensor, from among the plurality of the temperature determination
information stored in the storage unit; and

a determination unit configured to determine a temperature of the fixing member using the temperature determination information
to interest selected by the selection unit, based on the measurement results of the first sensor and the measurement results
of the second sensor.

US Pat. No. 9,280,054

ILLUMINATION OPTICAL SYSTEM, EXPOSURE APPARATUS, AND METHOD OF MANUFACTURING DEVICE

CANON KABUSHIKI KAISHA, ...

1. An illumination optical system for illuminating a surface to be illuminated with a plurality of light beams emitted from
a plurality of light sources, the illumination optical system comprising:
a plurality of rod integrators arranged respectively with the plurality of light sources, wherein the plurality of rod integrators
uniformize a light intensity distribution of a light beam emitted from the plurality of light sources;

a combining optical system that combines the plurality of light beams emitted from said plurality of rod integrators, so that
the plurality of light beams are adjacent to each other in cross-sections thereof; and

a light transmission unit that has an entrance surface and an exit surface, divides the light beam combined by said combining
optical system into a plurality of light beams on the entrance surface, joins the plurality of divided light beams so that
a cross-sectional shape of a joined pattern of the plurality of divided light beams on the exit surface is different from
a cross-sectional shape of a joined pattern of the plurality of divided light beams on the entrance surface, and transfers
the plurality of divided light beams from the entrance surface to the exit surface using a plurality of optically coupled
light pipes.

US Pat. No. 9,272,544

CONTROL APPARATUS, CONTROL METHOD, AND STORAGE MEDIUM

CANON KABUSHIKI KAISHA, ...

1. A control apparatus comprising:
a print control unit configured to cause a printing unit to print an image on a print medium based on a job; and
a determination unit configured to determine, in accordance with a mode of a first job and a mode of a second job next to
the first job, whether to add a margin between an image to be printed based on the first job and an image to be printed based
on the second job.

US Pat. No. 9,274,471

ROTATABLE HEATING MEMBER AND IMAGE HEATING APPARATUS

Canon Kabushiki Kaisha, ...

1. A rotatable heating member incorporating a heat source configured to heat a toner image on a sheet, comprising:
an elastic layer; and
a surface layer provided on the elastic layer,
wherein when thermal effusivity of the surface layer is Bs and thermal effusivity of the elastic layer is Be, ?0.04<(Be?Bs)/Be<0.04.

US Pat. No. 9,274,740

LIQUID CRYSTAL DISPLAY APPARATUS ENABLING A USER TO RECOGNIZE POSITIONS AND BOUNDARIES OF LIGHT SOURCE BLOCKS, METHOD FOR CONTROLLING THE SAME, AND IMAGE DISPLAY SYSTEM

CANON KABUSHIKI KAISHA, ...

1. An image display apparatus comprising:
a display panel;
a light emitting unit which has a plurality of light source blocks and brightness of which is controlled for each of the light
source blocks;

a generating unit which generates a boundary image which indicates a boundary around each of the light source blocks;
a first input unit which inputs setting of at least one of a color, a transmittance, and a line thickness of a boundary line
in the boundary image; and

a display control unit which displays at least the boundary image on the display panel on the basis of the setting input by
the first input unit.

US Pat. No. 9,277,078

INFORMATION PROCESSING APPARATUS WITH POWER CONTROL UNIT, CONTROL METHOD THEREFOR, AND STORAGE MEDIUM STORING CONTROL PROGRAM THEREFOR

CANON KABUSHIKI KAISHA, ...

1. An information processing apparatus that operates in a first power state, a second power state of which electric energy
consumption is smaller than the first power state, or a third power state of which electric energy consumption is smaller
than the second power state, comprising:
a power supply unit configured to supply electric power to devices including first and second devices of the information processing
apparatus;

a secondary battery configured to supply charged power to a part of the devices;
a power-state-switching unit configured to switch a power state of the information processing apparatus among the first power
state in which said power supply unit supplies power to the devices, the second power state in which said power supply unit
does not supply power to the first device without supplying power from said secondary battery to the devices, and the third
power state in which said secondary battery supplies power to the second device; and

a control unit configured to control so that said secondary battery is charged by the power supplied from said power supply
unit in the first power state, and to control so that active charging of the secondary battery is stopped upon detection of
a condition causing a shift to the second power state regardless of a charge state of the secondary battery.

US Pat. No. 9,266,695

PRINTING SYSTEM, CONTROL METHOD THEREOF, AND STORAGE MEDIUM

Canon Kabushiki Kaisha, ...

1. A printing system including a printing device and a plurality of sheet stacking devices for stacking sheets on which images
are printed by the printing device, comprising:
an obtaining unit configured to obtain an amount of stacked sheets from the plurality of sheet stacking devices;
a determination unit configured to determine whether the amount of the stacked sheets reaches a predetermined amount which
is set as a maximum stacking amount; and

a control unit configured (i) to cause, in a case where it is determined by the determination unit that the amount of the
stacked sheets in one sheet stacking device among the plurality of sheet stacking devices reaches the predetermined amount,
said one sheet stacking device to shift to a sleep state without causing the printing device to shift to the sleep state,
and (ii) to cause, in a case where it is determined by the determination unit that the amount of the stacked sheets in each
of all of the plurality of sheets stacking devices reaches the predetermined amount, said all of the plurality of sheet stacking
devices and the printing device to shift to the sleep state.

US Pat. No. 9,270,851

IMAGE FORMING APPARATUS METHOD AND STORAGE MEDIUM STORING PROGRAM FOR CONTROLLING DISPLAY WHEN THE IMAGE FORMING APPRATUS RETURNS TO AN ACTIVE STATE FROM A POWER-SAVING STATE

Canon Kabushiki Kaisha, ...

1. An image forming apparatus comprising:
a detection unit configured to detect a cause for causing the image forming apparatus to return to an active state from a
power-saving state, wherein power is supplied to the detection unit in both the active state and the power-saving state;

an attachment unit configured to allow an external memory device to be attached to the image forming apparatus, wherein no
power is supplied to the attachment unit in the power-saving state;

a return unit configured to cause, when the detection unit detects the cause, the image forming apparatus to return to the
active state from the power-saving state;

a first determination unit configured to determine, when the return unit causes the image forming apparatus to return to the
active state from the power-saving state, whether or not the detection unit detects a predetermined cause;

a second determination unit configured to determine, when the return unit causes the image forming apparatus to return to
the active state from the power-saving state, whether or not the external memory device is attached to the attachment unit;
and

a control unit configured to control, when (a) the first determination unit determines that the detection unit detects the
predetermined cause and (b) the second determination unit determines that the external memory device is attached to the attachment
unit, a display unit (i) not to display a default screen for displaying a plurality of functions selectable by a user and
(ii) to display a first screen for performing a function, of the plurality of functions, using the external memory device.

US Pat. No. 9,260,259

IMAGE FORMING APPARATUS, SHEET FEED CONTROL METHOD, AND STORAGE MEDIUM

CANON KABUSHIKI KAISHA, ...

1. An image forming apparatus comprising:
a plurality of sheet holding units configured to hold a recording sheet having a standard size or a non-standard size;
a first setting unit configured to set a first type of non-standard size of a recording sheet to a first sheet holding unit,
among the plurality of sheet holding units, wherein vertical and lateral lengths of the first type of non-standard size are
respectively designated by a user;

a second setting unit configured to set a second type of non-standard size of a recording sheet to a second sheet holding
unit, among the plurality of sheet holding units, wherein neither a vertical length nor a lateral length of the second type
of non-standard size is designated by the user; and

a selecting unit configured to, when receiving a print job designating a non-standard size as a size of a recording sheet
where an image is to be printed, select the first sheet holding unit in a case where the first type of non-standard size set
to the first sheet holding unit matches vertical and lateral lengths designated by the print job, while selecting the second
sheet holding unit in a case where the first type of non-standard size set to the first sheet holding unit does not match
the vertical and lateral lengths designated by the print job; and

a printing unit configured to execute the print job using a recording sheet fed from the selected sheet holding unit by said
selecting unit.

US Pat. No. 9,262,714

FREQUENT PATTERN EXTRACTION APPARATUS FREQUENT PATTERN EXTRACTION METHOD AND PROGRAM

Canon Kabushiki Kaisha, ...

1. A frequent pattern extraction apparatus comprising:
an acquisition unit configured to acquire time series data for a data operation in user units from a data operation history
database;

a dividing unit configured to divide the time series data for the data operation into a plurality of data operation sets;
a set degree of similarity acquisition unit configured to acquire a set degree of similarity among the plurality of data operation
sets;

a generation unit configured to generate an abstract data operation set from the plurality of data operation sets using the
set degree of similarity; and

an extraction unit configured to extract a pattern of a sequence that frequently appears among sequences consisting of the
plurality of abstract data operation sets.

US Pat. No. 9,256,148

TONER

CANON KABUSHIKI KAISHA, ...

1. A toner comprising toner particles, each of which contains a binder resin, a wax, a colorant and inorganic fine particles,
wherein
the binder resin is a polyester resin,
the wax is a hydrocarbon wax,
the inorganic fine particles are fixed at the surface of the toner particles as a result of a surface treatment by hot air,
and

the toner satisfies the following formula (1):
1.20?P1/P2?2.00  (1)

in the formula (1), P1=Pa/Pb and P2=Pc/Pd, wherein,
Pa is an intensity of the highest absorption peak in a range from 2843 cm?1 to 2853 cm?1, and

Pb is an intensity of the highest absorption peak in a range from 1713 cm?1 to 1723 cm?1 in an FT-IR spectrum obtained by an attenuated total reflectance (ATR) method by using Ge as the ATR crystal and under the
condition of an infrared light-incidence angle of 45°,

and wherein
Pc is an intensity of the highest absorption peak in a range from 2843 cm?1 to 2853 cm?1, and

Pd is an intensity of the highest absorption peak in a range from 1713 cm?1 to 1723 cm?1 in an FT-IR spectrum obtained by an attenuated total reflectance (ATR) method by using KRS5 as the ATR crystal and under the
condition of an infrared light-incidence angle of 45°.

US Pat. No. 9,248,647

LIQUID EJECTION HEAD IN WHICH POSITIONAL RELATIONSHIPS OF ELEMENTS ARE NOT AFFECTED BY CURING OF BONDING ADHESIVE

Canon Kabushiki Kaisha, ...

1. A liquid ejection head comprising:
a printing element substrate on which an ejection port for ejecting liquid is provided;
a support member supporting the printing element substrate;
another member arranged to be separated from the support member by a gap;
an electrical wiring substrate that is provided to be extended over the support member and the other member and covers the
gap; and

an electrical connecting portion having a wiring to electrically connect with the printing element substrate,
wherein the electrical connecting portion is sealed with a sealing agent.

US Pat. No. 9,253,424

IMAGE PROCESSING APPARATUS AND CONTROL METHOD THEREOF

CANON KABUSHIKI KAISHA, ...

1. An image processing apparatus which processes a captured image including angle information of a light beam traveling from
the object, comprising:
a generation unit configured to generate a reconstructed image by reconstructing the captured image;
an extraction unit configured to extract an address of a defective photoelectric conversion element which is included in photoelectric
conversion elements which captured the captured image based on a plurality of reconstructed images corresponding to different
imaging distances.

US Pat. No. 9,249,308

COMPOUND HAVING BISAZO DYE SKELETON, PIGMENT COMPOSITION CONTAINING THE SAME, PIGMENT DISPERSION, INK, AND COLOR FILTER RESIST COMPOSITION

Canon Kabushiki Kaisha, ...

1. A compound, comprising: a polyester moiety; and a bisazo structure moiety having the following formula (1) or (2):

wherein R1 to R4 independently denote a hydrogen atom or a halogen atom,

R5 and R6 independently denote an alkyl group having 1 to 6 carbon atoms or a phenyl group,

R7 to R11 independently denote a hydrogen atom, a COOR12 group, or a CONR13R14 group, provided that at least one of R7 to R11 denotes the COOR12 group or the CONR13R14 group,

R12 to R14 independently denote a hydrogen atom or an alkyl group having 1 to 3 carbon atoms, and

L1 denotes a divalent linking group to be bonded to the polyester moiety.

US Pat. No. 9,247,101

STORING SCANNED DOCUMENT DATA BASED ON AT LEAST A CONFIDENTIALLY ATTRIBUTE OF THE SCANNED DOCUMENT DATA

Canon Kabushiki Kaisha, ...

1. An image forming apparatus that communicates with a remote apparatus, the image forming apparatus comprising:
a storage unit;
a reading unit configured to read a document;
a first determination unit configured to determine whether a confidentiality attribute has been set for the document read
by the reading unit;

a control unit configured to, in a case that the first determination unit determines that the confidentiality attribute has
been set, store the document in the storage unit, and, in a case that the first determination unit determines that the confidentiality
attribute has not been set, store the document in the remote apparatus; and

a second determination unit configured to determine whether the remote apparatus includes an overwriting deletion function,
wherein the control unit is configured to, based on a determination that the remote apparatus includes the overwriting deletion
function, control movement of the document when the first determination unit determines that the confidentiality attribute
has been set.

US Pat. No. 9,241,109

IMAGE CAPTURING APPARATUS, CONTROL METHOD, AND RECORDING MEDIUM FOR MOVING IMAGE GENERATION

CANON KABUSHIKI KAISHA, ...

1. An image capturing apparatus comprising:
an obtaining unit configured to sequentially obtain images obtained by image capturing of a subject; and
a generation unit configured to combine a plurality of images obtained by said obtaining unit and generate a moving image
including an obtained composite image as a frame,

wherein if the plurality of images differ in angle of view at the time of image capturing, said generation unit changes the
plurality of images into images having the same angle of view by adjusting angles of view of images which differ in angle
of view from one reference image of the plurality of images, and combines the images, and

whether the plurality of images differ in angle of view at the time of image capturing is detected by detecting whether zooming
operation has been performed during image capturing of the plurality of images.

US Pat. No. 9,239,561

IMAGE FORMING APPARATUS

CANON KABUSHIKI KAISHA, ...

1. An image forming apparatus comprising:
an apparatus body;
a drawer unit configured to be drawably stored in the apparatus body;
a plurality of interlocked lock portions configured to lock the drawer unit to the apparatus body in a state in which the
drawer unit is stored in the apparatus body;

an interlocking portion configured to interlock the interlocked lock portions; and
an independent lock portion configured to lock the drawer unit to the apparatus body independently from the plurality of interlocked
lock portions in a state in which the drawer unit is stored, the independent lock portion locking a first end side of the
drawer unit, in a direction orthogonal to a drawing direction of the drawer unit, to the apparatus body,

wherein a resistance force caused in the first end side of the drawer unit in storing the drawer unit is greater than a resistance
force caused in a second end side of the drawer unit in the direction orthogonal to the drawing direction in storing the drawer
unit.

US Pat. No. 9,241,159

ENCODING APPARATUS, METHOD OF CONTROLLING THEREOF, AND COMPUTER PROGRAM

CANON KABUSHIKI KAISHA, ...

1. An encoding apparatus which divides an input image into a plurality of blocks and encodes the input image, comprising:
one or more processors;
a memory; and
a computer program including program codes stored in the memory, which, when executed by the one or more processors, causes
the one or more processors to perform operations of:

determining a characteristic of an image of each of the plurality of blocks and detecting a block in which visual degradation
is noticeable, wherein the block to be detected includes at least one of an edge block and a skin color block;

determining a quantization parameter of each block based on a detection result of the detection;
performing transformation including orthogonal transformation of each block and quantization using the determined quantization
parameter;

encoding a result of the performed transformation;
and
changing a reaction parameter to determine the quantization parameter according to the proportion of detected blocks to entire
blocks of the input image.

US Pat. No. 9,213,253

IMAGE FORMING APPARATUS HAVING IMAGE CARRIER AND BELT MEMBER

CANON KABUSHIKI KAISHA, ...

1. An image forming apparatus comprising:
a photosensitive drum;
an image forming unit configured to form an image on the photosensitive drum;
an intermediate transfer belt;
a transfer unit configured to transfer the image formed on the photosensitive drum to the intermediate transfer belt, and
transfer the image on the intermediate transfer belt to a recording medium;

a determination unit configured to determine whether the photosensitive drum should be replaced based on usage conditions
of the photosensitive drum;

a notification unit configured to notify that the photosensitive drum should be replaced in a case where the determination
unit determines that the photosensitive drum should be replaced; and

a separation unit configured to perform a separating operation for separating the intermediate transfer belt from the photosensitive
drum,

wherein, in a case where the determination unit determines that the photosensitive drum should be replaced, the separation
unit is configured to perform the separating operation after the image on the intermediate transfer belt is transferred to
the recording medium by the transfer unit,

wherein, in a case where the determination unit does not determine that the photosensitive drum should be replaced, the separation
unit is configured to not perform the separating operation, and

wherein, in a case where the determination unit determines that the photosensitive drum should be replaced while the image
forming unit continuously forms a plurality of images, the separation unit is configured to perform the separating operation
after the plurality of images are transferred to the recording mediums by the transfer unit.

US Pat. No. 9,210,292

IMAGE PROCESSING APPARATUS AND METHOD USING DIFFERENT DITHER PATTERNS FOR DIFFERENT INKS AND SELECTING A QUANTIZATION PROCESS FOR EACH INK

CANON KABUSHIKI KAISHA, ...

1. An image processing apparatus that, in order to print an image on a print medium according to binary data defining printing
or non-printing of a dot, processes pieces of multivalued data corresponding to multiple inks using dither patterns representing
threshold values for comparing with values of the multivalued data, the image processing apparatus comprising:
a first quantization unit configured to use a first dither pattern to quantize multivalued data for a first ink in such a
way as to reduce the number of levels of the multivalued data for the first ink;

a second quantization unit configured to use a second dither pattern that is different from the first dither pattern to quantize
the multivalued data for the first ink in such a way as to reduce the number of levels of the multivalued data for the first
ink;

a third quantization unit configured to use a third dither pattern to quantize multivalued data for a second ink that has
different color from the first ink in such a way as to reduce the number of levels of the multivalued data for the second
ink;

a fourth quantization unit configured to use a fourth dither pattern that is different from the third dither pattern to quantize
the multivalued data for the second ink in such a way as to reduce the number of levels of the multivalued data for the second
ink; and

a selection unit configured to, on the basis of a combination of the multivalued data for the first ink and the multivalued
data for the second ink, select one of a quantization result from the first quantization unit and a quantization result from
the second quantization unit to be used for printing of the first ink, and select one of a quantization result from the third
quantization unit and a quantization result from the fourth quantization unit to be used for printing of the second ink,

wherein:
a dispersibility of an arrangement of dots, that are printed by a printing unit with the first ink based on the quantization
result of quantizing a multivalued data having a predetermined gradation level by using the first dither pattern, is higher
than a dispersibility of an arrangement of dots, that are printed by the printing unit with the first ink based on the quantization
result of quantizing the multivalued data having the predetermined gradation level by using the second dither pattern; and

a dispersibility of an arrangement of dots, that are printed by a printing unit with the second ink based on the quantization
result of quantizing a multivalued data having a predetermined gradation level by using the third dither pattern, is higher
than a dispersibility of an arrangement of dots, that are printed by the printing unit with the second ink based on the quantization
result of quantizing the multivalued data having the predetermined gradation level by using the fourth dither pattern.

US Pat. No. 9,207,581

DEVELOPER ACCOMMODATING UNIT, DEVELOPING DEVICE, PROCESS CARTRIDGE AND IMAGE FORMING APPARATUS

Canon Kabushiki Kaisha, ...

1. A developer accommodating unit for accommodating developer, said developer accommodating unit comprising:
an accommodating portion, provided with an opening, for accommodating the developer;
a sealing member for sealing the opening; and
an unsealing member rotatable for winding up said sealing member,
wherein said sealing member is peelable from said accommodating portion to unseal the opening in a first unsealing direction
and a second unsealing direction that is opposite to the first unsealing direction,

wherein the first unsealing direction is a direction from an upstream side of the opening to a downstream side of the opening
with respect to a rotational direction of said unsealing member, and

wherein the second unsealing direction is a direction from a downstream side of the opening to an upstream side of the opening
with respect to a rotational direction of said unsealing member.

US Pat. No. 9,201,493

COMMUNICATION APPARATUS, METHOD FOR CONTROLLING COMMUNICATION APPARATUS, AND PROGRAM

Canon Kabushiki Kaisha, ...

1. A communication apparatus that receives data from another communication apparatus, the communication apparatus comprising:
a storage unit configured to store the data;
a reception unit configured to receive from the other communication apparatus an estimated size value as a size of the data
on which conversion processing is performed before the other communication apparatus performs the conversion processing of
a bit rate of the data; and

a transmission unit configured to transmit a signal for stopping the conversion processing of the data depending on the size
value received by the reception unit and a free space of the storage unit.

US Pat. No. 9,188,927

INFORMATION PROCESSING APPARATUS FOR CONTROLLING ELECTRIC POWER CONSUMPTION, INFORMATION PROCESSING METHOD, AND STORAGE MEDIUM STORING CONTROL PROGRAM THEREFOR

CANON KABUSHIKI KAISHA, ...

1. An information processing apparatus comprising:
a first execution unit configured to execute a first job;
a second execution unit configured to execute a second job irrespective of a reason for interruption of the first job;
a calculation unit configured to calculate electric energy consumption in a period from a start of execution of the first
job by said first execution unit to an end except electric energy consumption in a period from interruption of execution of
the first job by said first execution unit to restarting, as electric energy consumption at the time of job execution,

wherein the first execution unit performs a degeneration operation of a function in a case where the second executing unit
starts and completes execution of the second job while the first execution unit interrupts execution of the first job due
to the reason for interruption of the first job, and

the calculation unit calculates electric energy consumption of the information processing apparatus in a period from interruption
of execution of the first job by said first execution unit to restarting, except electric energy consumption in a period from
a start of execution of the second job by said second execution unit to an end, as electric energy consumption during the
interruption of the first job.

US Pat. No. 9,188,936

IMAGE FORMING APPARATUS WITH FIRST AND SECOND POWER SUPPLY

Canon Kabushiki Kaisha, ...

1. An image forming apparatus comprising:
a first power supply unit configured to generate first output power;
a second power supply unit configured to generate second output power;
a switching unit disposed on the primary side of the second power supply unit;
a monitoring unit configured to monitor the second output power generated by the second power supply unit;
a power source control unit supplied with the first output power generated by the first power supply unit, and configured
to turn the switching unit ON or OFF; and

a control unit supplied with the first output power generated by the first power supply unit, and configured to control operations
of the power source control unit,

wherein, when the power source control unit determines that the second output power generated by the second power supply unit
is lower than a threshold value based on the result of the monitoring by the monitoring unit, the power source control unit
turns the switching unit OFF and then back to ON in a state where the first output power generated by the first power supply
unit is supplied to the control unit.

US Pat. No. 9,183,888

INFORMATION PROCESSING DEVICE INFORMATION PROCESSING METHOD AND PROGRAM STORAGE MEDIUM

Canon Kabushiki Kaisha, ...

1. An information processing device for editing a moving image, comprising:
a processor; and
memory, the memory storing instructions for:
a display control unit for displaying on a display module a first object three-dimensionally represented by frames contained
in a first moving image and a time axis indicative of a playback time of the first moving image, and

detecting, by a detection unit, that a point on the time axis has been designated in response to an instruction by a thing
approaching a portion of the display module where the first object is being displayed,

wherein the display control unit, in response to the detection unit detecting that two points have been designated on the
time axis, the two points representing a starting point and an end point of a second moving image, the second moving image
corresponding to a part of the first moving image, displays a second object that is distinct from the first object, the second
object being representative of the second moving image which corresponds to the part of the first moving image between the
starting point and the end point in the first moving image, and moves the second object in accordance with a moving operation
of the thing,

wherein, from among a plurality of moving images, the display control unit designates a moving image for which an approach
of the thing is detected by the detecting unit, a part of the frames of which are displayed as a still image on the display
module as the first moving image, and displays the first object three-dimensionally represented by frames contained in the
first moving image and a time axis indicative of a playback time of the first moving image,

wherein the detecting unit is a touch panel display which two-dimensionally projects and displays the three-dimensionally
represented object and detects a user's touch.

US Pat. No. 9,164,430

DEVELOPER CONTAINER, DEVELOPING CARTRIDGE, PROCESS CARTRIDGE AND IMAGE FORMING APPARATUS

Canon Kabushiki Kaisha, ...

1. A developer container comprising:
a developer chamber, provided with an opening, for accommodating developer;
a rotatable member rotatably supported in said developer chamber; and
a sealing member for being removed at the opening by being wound up by said rotatable member, said sealing member being provided
in said developer chamber and including a first end portion connected to said rotatable member and a second end portion sealing
the opening,

wherein the opening is sealed by bonding said sealing member along an edge of the opening,
wherein said developer container includes a first bonding portion provided upstream of the opening and a second bonding portion
provided downstream of the opening with respect to an unsealing direction of said sealing member, and

wherein a peeling-off force for peeling off said sealing member at a predetermined angle is larger at said first bonding portion
than at said second bonding portion.

US Pat. No. 9,154,760

APPARATUS FOR RECORDING SIGNALS ON DISK RECORDING MEDIUM

Canon Kabushiki Kaisha, ...

1. A recording apparatus comprising:
an obtaining unit configured to obtain motion image data;
a recording unit configured to record on a recording medium the motion image data obtained by the obtaining unit and management
information relating to recording address information of data recorded on the recording medium,

wherein the recording unit records the moving image data intermittently on the recording medium from a recording start instruction
to a recording stop instruction;

a control unit configured to control the recording unit to record, in at least one recording stop period of the intermittent
recording of the motion image data, on the recording medium the management information relating to recording address information
of the motion image data recorded in accordance with the recording start instruction.

US Pat. No. 9,151,929

IMAGE PICKUP APPARATUS AND LENS UNIT

Canon Kabushiki Kaisha, ...

1. A lens unit comprising:
a mount to mechanically couple with an image pickup apparatus and to electrically connect the lens unit with the image pickup
apparatus; and

a lens controller configured to receive power supply at a fourth voltage from the image pickup apparatus, to produce from
the fourth voltage a sixth voltage different from the fourth voltage, and to perform the communication with the image pickup
apparatus with the sixth voltage,

wherein the mount includes a first lens terminal enabling provision of a type of the lens unit by a configuration to output
a predetermined voltage corresponding to the type of the lens unit in a state of being attached to the image pickup apparatus.

US Pat. No. 9,148,526

IMAGE PROCESSING APPARATUS, INFORMATION PROCESSING APPARATUS, METHOD FOR CONTROLLING IMAGE PROCESSING APPARATUS, METHOD FOR CONTROLLING INFORMATION PROCESSING APPARATUS, AND STORAGE MEDIUM

Canon Kabushiki Kaisha, ...

1. An image processing apparatus including an image forming unit configured to form an image, the image processing apparatus
comprising:
a storage unit configured to store a reference feature quantity acquired using a result of measuring a first chart by a measurement
device;

a first acquisition unit configured to acquire a first feature quantity using a result of measuring a second chart by the
measurement device, the second chart being created by the image forming unit; and

an estimation unit configured to estimate a defective point generated in the image processing apparatus, by acquiring a second
feature quantity from the reference feature quantity stored in the storage unit and the first feature quantity acquired by
the first acquisition unit and using data in which the second feature quantity is associated with information about a defect
generated in the image processing apparatus.

US Pat. No. 9,141,042

IMAGE FORMING APPARATUS HAVING MISREGISTRATION CONTROL

CANON KABUSHIKI KAISHA, ...

1. An image forming apparatus, comprising:
a first image bearing member on which an electrostatic latent image is formed;
a first developing device for developing an electrostatic latent image formed on the first image bearing member;
a second image bearing member on which an electrostatic latent image is formed;
a second developing device for developing an electrostatic latent image formed on the second image bearing member;
an intermediate transfer member which is rotatable and is configured to form a first primary transfer portion with the first
image bearing member and a second primary transfer portion with the second image bearing member; and

a control unit that is configured to execute an image forming mode,
wherein in a case where the control unit receives a print signal for transferring a toner image onto a recording material,
the control unit controls a timing of forming a toner patch so that the toner patch developed by the second developing device
is provided to the second primary transfer portion between a timing when the control unit receives the print signal and a
timing when the toner image developed on the first image bearing member is primarily transferred to the intermediate transfer
member at the first primary transfer portion.

US Pat. No. 9,141,066

SHEET PROCESSING APPARATUS FOR APPLYING POST PROCESS TO SHEET

CANON KABUSHIKI KAISHA, ...

1. A sheet processing apparatus comprising:
a conveyance unit configured to convey a sheet;
a sensor unit configured to have a plurality of sensors that are arranged in a sheet width direction that intersects perpendicularly
with a sheet conveyance direction, and that detect a side end of a sheet in the sheet width direction;

a moving unit configured to move said sensor unit in the sheet width direction;
a control unit configured to control said moving unit so as to move said sensor unit at a first movement speed during conveyance
of the sheet by said conveyance unit, and so as to move said sensor unit at a second movement speed after the side end of
the sheet is detected by a first sensor among the plurality of sensors so that the side end of the sheet is detected by a
second sensor among the plurality of sensors;

an obtaining unit configured to obtain a sheet length of the sheet in the sheet conveyance direction; and
a setting unit configured to set up the second movement speed based on the sheet length obtained by said obtaining unit,
wherein said control unit controls said moving unit so as to move said sensor unit at the second movement speed set up by
said setting unit until the side end of the sheet is detected by the second sensor after the side end of the sheet is detected
by the first sensor.

US Pat. No. 9,137,427

IMAGING APPARATUS AND IMAGE DISPLAY METHOD THEREFOR

Canon Kabushiki Kaisha, ...

1. An imaging apparatus, comprising:
a lens;
an imaging unit configured to capture an optical image that has entered through the lens from an imaging element;
a display device comprising multiple pixels whose light emission period is adjustable, configured to display the optical image
captured from the imaging element as a picture;

an angular velocity sensor configured to detect a movement of the imaging element;
a panning speed detection unit configured to detect a panning speed based on an output from the angular velocity sensor;
a light emission period ratio determination unit configured to determine a light emission period ratio of each of the multiple
pixels based on the panning speed; and

a display device driving unit configured to cause the each of the multiple pixels to emit light based on the light emission
period ratio,

wherein the panning speed detection unit comprises:
an offset removal portion configured to subtract an offset from a rotational direction waveform obtained by removing a high-frequency
component from the output from the angular velocity sensor; and

an absolute value acquisition portion configured to convert the rotational direction waveform from which the offset has been
subtracted by the offset removal portion into a positive signal by acquiring an absolute value of the rotational direction
waveform, and

wherein the panning speed detection unit outputs the positive signal as the panning speed.

US Pat. No. 9,136,407

SOLID-STATE IMAGE SENSOR, METHOD OF MANUFACTURING THE SAME, AND CAMERA

Canon Kabushiki Kaisha, ...

1. A method of manufacturing a solid-state image sensor including a first charge accumulation region, a second charge accumulation
region positioned adjacent to the first charge accumulation region, a first transfer gate positioned adjacent to the first
charge accumulation region and configured to transfer a charge in the first charge accumulation region, and a second transfer
gate positioned adjacent to the second charge accumulation region and configured to transfer a charge in the second charge
accumulation region, the first accumulation region and the second accumulation region being positioned between a region below
the first transfer gate and a region below the second transfer gate, the method comprising:
preparing a semiconductor substrate provided with the first transfer gate and the second transfer gate;
forming, on the semiconductor substrate, a mask pattern including a first opening for implanting ions into a first region
where the first charge accumulation region is to be formed, a second opening for implanting ions into a second region where
the second charge accumulation region is to be formed, and a wall portion which is positioned between the first opening and
the second opening, the first region including a first portion which is arranged below the first transfer gate, and the second
region including a second portion which is arranged below the second transfer gate; and

implanting ions into the semiconductor substrate through the first opening and the second opening to form the first charge
accumulation region and the second charge accumulation region,

wherein the implanting ions into the semiconductor substrate includes:
a first implantation of implanting ions into a part of the first region, which includes the first portion, and a part of the
second region; and

a second implantation of implanting ions into a part of the first region, and a part of the second region, which includes
the second portion.

US Pat. No. 9,125,598

OPTICAL COHERENCE TOMOGRAPHY APPARATUS, CONTROL METHOD, AND COMPUTER-READABLE STORAGE MEDIUM

Canon Kabushiki Kaisha, ...

1. An optical coherence tomography apparatus for obtaining a tomographic image from an interference light between a reference
light and a measurement light having passed through an object, the optical coherence tomography apparatus comprising:
a detection unit configured to detect the presence/absence of an anterior eye imaging attachment member of the optical coherence
tomography apparatus; and

a control unit configured to display an imaging screen for anterior imaging or for fundus imaging based on a detection result
by the detection unit.

US Pat. No. 9,129,718

X-RAY WAVEGUIDE

Canon Kabushiki Kaisha, ...

1. A X-ray waveguide comprising:
a core configured to guide X-rays having a wavelength band in which the real part of refractive index of material is smaller
than 1; and

a cladding configured to confine the X-rays in the core,
wherein the core has a one-dimensional periodic structure in which a plurality of layers respectively formed of inorganic
materials having different real parts of refractive indices are periodically laminated,

the core and the cladding are configured so that a critical angle for total reflection for the X-rays at an interface between
the core and the cladding is larger than a Bragg angle due to a periodicity of the one-dimensional periodic structure, and

a critical angle for total reflection for the X-rays at an interface between layers in the one-dimensional periodic structure
is smaller than the Bragg angle due to the periodicity of the one-dimensional periodic structure.

US Pat. No. 9,122,224

IMAGE FORMING APPARATUS AND POWER SUPPLY DEVICE

Canon Kabushiki Kaisha, ...

1. An image forming apparatus comprising:
an image forming section configured to form a toner image on recording material; and
a power supply section including
a voltage detection circuit configured to detect a voltage of a commercial alternating-current power supply,
a first power supply configured to convert the voltage of the commercial alternating-current power supply into a direct-current
voltage and to output a first voltage,

a second power supply configured to convert the voltage of the commercial alternating-current power supply into a direct-current
voltage and to output a second voltage larger than the first voltage, the second power supply being configured to switch between
a first rectification state and a second rectification state in accordance with an output of the voltage detection circuit,

a first switch section configured to be capable of disconnecting the second power supply from the commercial alternating-current
power supply and that operates with the first voltage, and

a second switch section configured to be capable of disconnecting the voltage detection circuit from the commercial alternating-current
power supply and that operates with the first voltage,

wherein when the image forming apparatus is to be in a power saving mode, the second power supply is disconnected from the
commercial alternating-current power supply by using the first switch section, and the voltage detection circuit is disconnected
from the commercial alternating-current power supply by using the second switch section.

US Pat. No. 9,124,151

DRIVING APPARATUS, EXPOSURE APPARATUS, AND METHOD OF MANUFACTURING ARTICLE

CANON KABUSHIKI KAISHA, ...

1. A driving apparatus comprising:
an axis member;
a movable member movable along an axial direction of the axis member and engaged with the axis member; and
a cover unit connected to the movable member and movable together with the movable member, and includes:
a cover member that covers a portion of the axis member;
a plurality of plate members each including a through-hole through which the axis member penetrates,
wherein the plurality of plate members are located spaced apart from each other in a moving direction of the movable member;
and

spacer that maintains gaps between the plurality of plate members,
wherein the spacer is disposed so that a gap between the axis member and the spacer is greater than a gap between the axis
member and the plurality of plate members.

US Pat. No. 9,116,649

IMAGE FORMING APPARATUS WITH UNIT DETERMINING WHETHER OPERATION INFORMATION IS TRANSMITTED TO LOG STORAGE SERVER

Canon Kabushiki Kaisha, ...

1. An image forming apparatus, which is configured to communicate to/from a management server for managing operation information
on multiple image forming apparatus, the image forming apparatus comprising:
a transmission unit configured to transmit a first piece of operation information of the image forming apparatus to the management
server in accordance with a schedule set by the management server;

a reception unit configured to receive from the management server (a) a transmission instruction for a second piece of operation
information, (b) destination information on a log storage server to which the second piece of operation information is to
be transmitted, the log storage server being different from the management server, and (c) authentication information;

a determination unit configured to determine in accordance with a link speed with respect to the log storage server whether
or not the second piece of operation information is to be transmitted to the log storage server; and

a notification unit configured to notify the management server of an error when the determination unit determines that the
second piece of operation information is not to be transmitted to the log storage server, wherein

the transmission unit is further configured to transmit the second piece of operation information of the image forming apparatus
to the log storage server by using the destination information and the authentication information in accordance with reception
of the transmission instruction for the second piece of operation information when the determination unit determines that
the second piece of operation information is to be transmitted to the log storage server.

US Pat. No. 9,113,022

VIDEO DISPLAY APPARATUS, VIDEO PLAYBACK APPARATUS AND METHOD FOR CONTROLLING THE SAME

Canon Kabushiki Kaisha, ...

1. A device comprising:
a receiving unit that receives a playback request for requesting a trick playback;
a reproducing unit that reproduces predetermined video if the playback request is received by the receiving unit;
a first changing unit that performs a first process for changing a number of frames included in the predetermined video;
a transmitting unit that transmits video to an external display device, wherein the external display device includes a second
changing unit that performs a second process for changing a number of frames included in video which is received from the
transmitting unit; and

a control unit that (a) selects, according to a capability of the first changing unit and a capability of the second changing
unit, at least one of the first changing unit and the second changing unit after the playback request is received by the receiving
unit, and (b) causes a selected changing unit to perform a process for changing a number of frames included in video to generate
video requested by the playback request.

US Pat. No. 9,105,441

MOBILE X-RAY IMAGE CAPTURING APPARATUS

Canon Kabushiki Kaisha, ...

1. A mobile X-ray-capturing apparatus comprising:
an X-ray tube for irradiating an object with X-rays;
an arm for holding the X-ray tube;
a support pillar for holding the arm;
a first electrical conductor comprising an electrode incorporated in the arm for supplying power or a signal to the X-ray
tube; and

a second electrical conductor comprising an electrode incorporated in the support pillar for supplying power or the signal
to the arm.

US Pat. No. 9,106,827

IMAGE CAPTURING APPARATUS AND METHOD OF CONTROLLING THE SAME

Canon Kabushiki Kaisha, ...

1. An image capturing apparatus comprising:
an image sensor including a plurality of pixels that are two-dimensionally arranged and include focus detection pixels including
photoelectric conversion units configured for outputting a pair of image signals obtained by receiving a pair of light beams
that have passed through different exit pupil regions of an imaging optical system;

a determination unit configured to determine whether each line of the pixels of said image sensor is a non-addition line that
outputs an image signal unsuitable for detection of a correlation amount;

a calculation unit configured to obtain the correlation amount for each addition line based on the pair of image signals output
from the focus detection pixels included in the addition line determined not to be the non-addition line by said determination
unit and add the obtained correlation amount of the addition line;

a counting unit configured to count the number of addition lines added by said calculation unit;
a computing unit configured to obtain a defocus amount based on the correlation amount added by said calculation unit; and
a focus control unit configured to drive a focus lens included in the imaging optical system based on the defocus amount in
a case where a product of an evaluation value representing reliability of the defocus amount obtained by said computing unit
and a predetermined standard number of additions is smaller than the product of the number of addition lines counted by said
counting unit and a standard evaluation value representing a predetermined evaluation value.

US Pat. No. 9,095,984

FORCE CONTROL ROBOT

CANON KABUSHIKI KAISHA, ...

1. A force control robot, comprising:
a robotic arm having one end as a fixed end and another end as a movable end;
an end effector coupled to the movable end of the robotic arm, the end effector having a grip mechanism portion and a grip
drive portion for moving the grip mechanism portion; and

a force sensor configured to detect an external force applied to the grip mechanism portion based on displacement of the end
effector, the force sensor including an elastic member coupling the end effector to the movable end, the force sensor being
positioned so that when the end effector is displaced with respect to the movable end about a rotation center, the rotation
center exists inside the force sensor,

wherein the grip drive portion is positioned so that a center of gravity of the grip drive portion is nearer to the robotic
arm than the rotation center.

US Pat. No. 9,098,052

IMAGE FORMING APPARATUS

CANON KABUSHIKI KAISHA, ...

1. An image forming apparatus comprising:
an image bearing member configured to bear and convey a toner image;
a transfer member configured to transfer the toner image formed on said image bearing member onto a recording material at
a transfer portion;

a contact-and-separation unit configured to move said transfer member between a contact position where said transfer member
contacts said image bearing member, a first spacing position where said transfer member is separated from said image bearing
member at a first interval, and a second spacing position where said transfer member is separated from said image bearing
member at a second interval larger than the first interval, said contact-and-separation unit including a movable supporting
member configured to support said transfer member, an urging member configured to urge said supporting member so that said
transfer member is urged toward said image bearing member, a cam configured to abut an abutted portion of said supporting
member and configured to move said supporting member by being rotated about a rotation center against an urging force of said
urging member, and a driving unit configured to rotate said cam;

an adjustment toner forming portion configured to form an adjustment toner on said image bearing member in a region between
a toner image to be transferred to a recording material and a toner image to be transferred to a following recording material;

a detecting member configured to detect the adjustment toner formed on said image bearing member;
a changing portion configured to change an image forming condition based on a result of said detecting member; and
a control portion configured to control said driving unit so that said transfer member is located in the contact position
during a period in which the toner image to be transferred onto the recording material passes through the transfer portion,
and so said transfer member is located in the first spacing position during a period in which the adjustment toner passes
through the transfer portion, and configured to control said driving unit so that said cam is stopped at any one of three
phases of a first phase corresponding to the contact position, a second phase corresponding to the first spacing position,
and a third phase corresponding to the second spacing position when said cam is rotated in a rotation range from the first
phase to the third phase via the second phase, wherein

said cam has a shape such that a distance between its outer circumference at the abutted portion and the rotation center continuously
increases in a phase range from the first phase toward the third phase via the second phase when said cam is rotated from
the first phase to the third phase in the rotation range.

US Pat. No. 9,099,941

VIBRATION TYPE DRIVING DEVICE

Canon Kabushiki Kaisha, ...

1. A vibration type driving device comprising:
a vibrator configured to make an elliptic motion of a contact portion by combining vibrations in different vibration modes;
and

a driven body configured to be rotated relative to the vibrator by the elliptic motion while being in contact with the contact
portion,

wherein a contact pressure of the contact portion with the driven body is lower on a radial inner side than on a radial outer
side in a radial direction of the rotation.

US Pat. No. 9,093,347

DETECTING APPARATUS AND DETECTING SYSTEM

CANON KABUSHIKI KAISHA, ...

1. A detecting apparatus comprising:
a substrate that permits visible light to pass therethrough;
a converting element including a pixel electrode, an impurity semiconductor layer, and a semiconductor layer arranged in that
order from a side adjacent to the substrate, the converting element being configured to convert radiation or light into charge;
and

a light source configured to emit the visible light through the substrate to the converting element,
wherein the pixel electrode includes a metal layer that permits the visible light to pass therethrough.

US Pat. No. 9,093,351

SOLID-STATE IMAGING APPARATUS

CANON KABUSHIKI KAISHA, ...

1. A solid-state imaging apparatus comprising a plurality of pixels arranged two-dimensionally,
wherein each of the pixels comprises:
a photoelectric conversion element configured to generate electric charges by photoelectric conversion;
a floating diffusion;
a transfer transistor configured to transfer the electric charges generated by the photoelectric conversion element to the
floating diffusion;

an amplifying portion configured to output a signal based on the electric charges in the floating diffusion; and
a reset transistor configured to reset a voltage of the floating diffusion, and wherein
the solid-state imaging apparatus further comprises
a connecting transistor configured to connect electrically the floating diffusions of at least two of the plurality of pixels
to each other to add the electric charges in the floating diffusions of the at least two of the plurality of pixels, and

a threshold voltage of the connecting transistor is significantly lower than a threshold voltage of the reset transistor so
that a voltage derived by subtracting a reset voltage of the floating diffusion from a high level voltage of a gate of the
connecting transistor is higher than the threshold voltage of the connecting transistor.

US Pat. No. 9,091,910

IMAGE PROJECTOR

CANON KABUSHIKI KAISHA, ...

1. An image projector comprising:
an image display element configured to display an original image;
a first deflector configured to deflect a first optical path through which light from a light source passes, and to form a
second optical path;

a second deflector configured to deflect the second optical path and to form a third optical path;
a shifter configured to shift a projection lens in a vertical direction, which is orthogonal to an optical axis of the projection
lens, the projection lens projecting light that has transmitted the image display element, the first deflector, and the second
deflector;

a housing configured to house the image display element, the first deflector, and the second deflector, and having an installing
surface, which is one of a top surface or a bottom surface, that is closer to the third optical path than the first optical
path; and

a fixture member configured to integrally fix the projection lens, the shifter, the first deflector, and the second deflector,
the fixture member being fixed onto the housing at on an installing surface side of the housing,

wherein the shifter is configured so that, in relation to the third optical path, a shiftable amount of the projection lens
in a direction away from the installing surface side is larger than a shiftable amount of the projection lens toward the installing
surface side.

US Pat. No. 9,091,948

ELECTROPHOTOGRAPHIC PHOTOSENSITIVE MEMBER, METHOD FOR MANUFACTURING THE SAME, AND ELECTROPHOTOGRAPHIC APPARATUS

CANON KABUSHIKI KAISHA, ...

1. An electrophotographic photosensitive member to be negatively electrified, comprising: a conductive substrate; a photoconductive
layer which is formed from hydrogenated amorphous silicon on the conductive substrate; and a surface layer which is formed
from hydrogenated amorphous silicon carbide on the photoconductive layer, wherein
the surface layer has a change region in which a ratio (C/(Si+C)) of the number of carbon atoms (C) with respect to the sum
of the number of silicon atoms (Si) and the number of carbon atoms (C) gradually increases toward a surface side of the electrophotographic
photosensitive member from a side of the photoconductive layer,

the change region has an upper charge injection prohibiting portion containing a Group 13 atom, and a surface-side portion
which is positioned closer to the surface side of the electrophotographic photosensitive member than the upper charge injection
prohibiting portion and does not contain the Group 13 atom, and

when a precipitous property of the distribution of the Group 13 atom in a boundary portion between the surface-side portion
and the upper charge injection prohibiting portion is evaluated with a following evaluation method A, the precipitous property
satisfies a relation expressed by a following expression (A7), wherein

the evaluation method A of the precipitous property of the distribution of the Group 13 atom comprises the following steps
of:

(A1) obtaining a depth profile of a surface of the electrophotographic photosensitive member by an SIMS analysis;
(A2) making D represent a distance from the surface of the electrophotographic photosensitive member, in the depth profile,
making a function f(D) of the distance D represent an ionic strength of the Group 13 atom at the distance D, making f(DMAX) represent a maximal value of f(D), making f?(D) represent a second order differential of f(D), making DA represent a distance of a point at which when the D is increased toward the photoconductive layer, f?(D) changes from f?(D)=0
to f?(D)<0, from the surface of the electrophotographic photosensitive member, and making DB represent a distance of a point at which f?(D) subsequently changes from f?(D)<0 to f?(D)=0, from the surface of the electrophotographic
photosensitive member;

(A3) making DS represent a first distance among the distances D which satisfy f((DA+DB)/2)?f(DMAX)×0.5, when the upper charge injection prohibiting portion is viewed from the surface of the electrophotographic photosensitive
member, and

making a standard ionic strength f(DS) represent the ionic strength f(D) of the Group 13 atom at the distance DS;

(A4) making a precipitous property ?Z represent a length in a thickness direction of the boundary portion, in which the ionic
strength of the Group 13 atom in the boundary portion between the surface-side portion and the upper charge injection prohibiting
portion increases from 16% to 84%, when viewed from the surface of the electrophotographic photosensitive member and when
the standard ionic strength f(DS) is determined to be 100%;

(A5) producing a standard laminated film A which has a film A1 that has a composition corresponding to the upper charge injection prohibiting portion and a film A2 that has a composition corresponding to the surface-side portion, stacked in this order;

(A6) determining a surface of the film A2 as a surface of the standard laminated film A with respect to the standard laminated film A, and determining a precipitous
property ?Z0 in the boundary portion between the film A2 and the film A1 of the standard laminated film A, with similar steps to the steps (A1) to (A4); and

(A7)
determining 1.0??Z/?Z0?3.0  (A7).

US Pat. No. 9,091,963

DEVELOPING DEVICE, CARTRIDGE AND ELECTROPHOTOGRAPHIC IMAGE FORMING APPARATUS

Canon Kabushiki Kaisha, ...

1. A developing device comprising:
a flexible container for accommodating developer, said flexible container provided with an opening for permitting discharge
of the developer;

a frame for accommodating said flexible container and for accommodating the developer discharged from said flexible container;
an urging member, rotatably provided inside said frame, for urging said flexible container by rotation thereof to deform said
flexible container; and

a developer carrying member for carrying the developer on its surface,
wherein a distance X from a rotation center of said urging member to said surface of said developer carrying member is less
than a distance T from the rotation center of said urging member to a free end of said urging member for urging said flexible
container, and

wherein a shielding member for preventing contact of said urging member with said developer carrying member is provided between
the rotation center of said urging member and said surface of said developer carrying member.

US Pat. No. 9,090,789

AQUEOUS INK, INK JET RECORDING METHOD, INK CARTRIDGE AND INK JET RECORDING APPARATUS

Canon Kabushiki Kaisha, ...

1. An ink set comprising:
an aqueous ink comprising water, a water-soluble organic solvent, and at least two pigments, the at least two pigments being
different from each other; and

a reaction liquid containing a reactive component that reacts with the aqueous ink to cause aggregation or gelation of the
aqueous ink,

wherein the at least two pigments have a difference in precipitation value to the reaction liquid of 0.2 or less,
wherein the precipitation values of all the pigments contained in the aqueous ink to the reaction liquid are 0.5 or less,
the at least two pigments are each independently any one of a self-dispersion type pigment, a resin dispersion pigment comprising
a pigment and a dispersant, and a microcapsule type pigment, and the precipitation value is determined by adding dropwise
0.25 g of a 3% aqueous solution of the at least two pigments into a container having an inner diameter of 10 mm and containing
5 g of the reaction liquid diluted to 1/100 by pure water followed by being left in a stationary state for 60 minutes, and
calculating the proportion of the height of a precipitate to the height from a bottom of the container to the air-liquid interface.

US Pat. No. 9,092,868

APPARATUS FOR DETECTING OBJECT FROM IMAGE AND METHOD THEREFOR

Canon Kabushiki Kaisha, ...

1. An image processing apparatus comprising:
a storage device configured to store a background model in which a feature amount is associated with time information for
each of a plurality of states at each position of an image to be a background;

a memory configured to store a program; and
a processor configured to execute the program to provide:
an extraction unit configured to extract a feature amount for each position of an input video image;
an input state determination unit configured to compare the feature amount in the input video image with the feature amount
of each of the plurality of states in the background model, to determine the state similar to the input video image, and update
the time information of the state that has been determined to be similar to the input video image;

a foreground determination unit configured to determine a foreground area in the input video image based on the time information
of the state that has been determined to be similar to the input video image by the input state determination unit;

a subject detection unit configured to detect a predetermined subject from the foreground area; and
an updating unit configured to update the time information of the state in the background model based on a detection result
obtained by the subject detection unit.

US Pat. No. 9,082,161

IMAGE PROCESSING APPARATUS, IMAGE PROCESSING METHOD, AND NON-TRANSITORY COMPUTER READABLE MEDIUM

CANON KABUSHIKI KAISHA, ...

1. An image processing apparatus which converts first image data having a first resolution into second image data having a
second resolution lower than the first resolution, comprising:
a decision unit configured to decide, based on the first resolution and the second resolution, a sampling pixel to be used
for resolution conversion in the first image data;

a determination unit configured to determine whether the first image data includes a white line which is not larger than a
predetermined width;

a replacing unit configured to, in a case where the determination unit determines that the first image data includes a white
line and a pixel of interest in the first image data is a pixel included in the white line and is not the sampling pixel,
replace a value of the pixel of interest with a value of a pixel adjacent to the pixel of interest; and

a conversion unit configured to convert the first image data including the replaced value of the pixel into the second image
data having the second resolution.

US Pat. No. 9,083,530

AUTHENTICATION APPARATUS, AUTHENTICATION SYSTEM, AUTHENTICATION METHOD AND STORAGE MEDIUM

Canon Kabushiki Kaisha, ...

1. An authentication apparatus comprising:
a first authentication unit configured to decide whether first authentication data exists in a received message, perform first
authentication based on the first authentication data if it is decided that the first authentication data exists, and output,
without analyzing whether second authentication data exists in the received message, authentication result data indicating
whether the first authentication data exists in the received message; and

a second authentication unit configured to decide whether the second authentication data exists in the received message, and
perform second authentication based on the second authentication data, if it is decided that the second authentication data
exists,

wherein the second authentication unit decides if authentication of the received message for a service succeeds based on the
authentication result data indicating whether the first authentication data exists in the received message and a result of
the decision of whether the second authentication data exists in the received message.

US Pat. No. 9,079,408

INK JET PRINTING APPARATUS AND MAINTENANCE METHOD

CANON KABUSHIKI KAISHA, ...

1. An ink jet printing apparatus comprising:
a printing head having a plurality of nozzles for ejecting ink;
an ink tank storing ink to be supplied to the printing head;
a first pump arranged in a first ink supplying path for supplying ink from the ink tank to the printing head;
a second pump arranged in an ink collecting path for collecting ink from the printing head to the ink tank;
a second ink supplying path configured to supply ink from the ink tank to the printing head;
a switch unit installed between the ink tank and the printing head and configured to switch between a first state where the
ink tank is in communication with the printing head through the first ink supplying path and a second state where the ink
tank is in communication with the printing head through the second ink supplying path;

a cleaning unit to clean the printing head;
a control unit configured to control the first pump, the second pump, the switch unit, and the cleaning unit; and
wherein the control unit is configured to (i) operate the first pump to discharge ink from the printing head with the switch
unit in the first state, (ii) operate the second pump to generate a negative pressure in the printing head with the switch
unit in the second state, and (iii) operate the cleaning unit to clean the printing head.

US Pat. No. 9,083,939

MOVING IMAGE PLAYBACK APPARATUS, CONTROL METHOD THEREFOR, AND RECORDING MEDIUM

Canon Kabushiki Kaisha, ...

1. A moving image playback apparatus comprising:
a recording unit configured to record on a recording medium a moving image file including moving image data,
wherein for each moving image file being recorded the recording unit records the moving image data in only one recording mode
including a digest recording mode and a high frame rate recording mode,

wherein a chapter is added within a predetermined time to a frame corresponding to a position to which the moving image data
is added in the moving image file in said digest recording mode;

a playback unit configured to play back moving image data from the recording medium; and
a controller configured to change a playback position of the moving image data being played back by the playback unit according
to a predetermined instruction from a user for skipping a playback position of moving image data,

wherein the controller detects the recording mode of the moving image data being played back and selects, according to the
detected recording mode of the moving image data being played back, one of a plurality of skip search modes including a first
skip search mode in which the playback position of the moving image data currently played back is changed to a frame a predetermined
time before or after a frame currently played back, and a second skip search mode in which the playback position of the moving
image data currently played back is changed to a frame corresponding to a chapter before or after the frame currently played
back, and

wherein the controller selects the first skip search mode if the recording mode of the moving image data currently played
back is said high frame rate recording mode, and selects the second skip search mode if the recording mode of the moving image
data currently played back is said digest recording mode.

US Pat. No. 9,081,358

FIXING APPARATUS, AND IMAGE FORMING APPARATUS EQUIPPED WITH FIXING APPARATUS

Canon Kabushiki Kaisha, ...

1. An image forming apparatus comprising:
a main assembly;
a fixing unit including a fixing rotatable member for fixing an unfixed image formed on a recording material, and a frame
for accommodating said fixing rotatable member, said fixing unit is detachably mountable to said main assembly; and

an air feeding member for feeding air to said fixing rotatable member provided in said main assembly,
wherein said frame is provided with an opening for applying the air fed from said air feeding member to said fixing rotatable
member, and an openable member movable between a first position for closing said opening and a second position for opening
said opening,

wherein said openable member moves from the second position to the first position in response to an operation of taking said
fixing unit out of said main assembly.

US Pat. No. 9,083,409

WIRELESS COMMUNICATION DEVICE, COMMUNICATION METHOD AND STORAGE MEDIUM

Canon Kabushiki Kaisha, ...

1. A wireless communication device, comprising:
a formation unit configured to form a second spatial directivity response pattern having a null value in the spatial direction
of a main lobe of a first spatial directivity response pattern; and

a communication unit configured to communicate with a communication partner device by using the first spatial directivity
response pattern and the second spatial directivity response pattern.

US Pat. No. 9,076,089

IMAGE PROCESSING APPARATUS AND METHOD FOR PRINTING ACCORDING TO A DOT-ARRANGEMENT MATRIX

CANON KABUSHIKI KAISHA, ...

1. An image processing apparatus comprising:
a storing unit configured to store a plurality of small matrices, each of which correlates each pixel included in a predetermined
area of a printing medium with a dot-arrangement pattern specifying a dot arrangement to be printed in an area corresponding
to a pixel according to a gradation level of the pixel, wherein a plurality of the dot-arrangement patterns are prepared for
each gradation level and correlation relationships between each pixel and the dot-arrangement pattern are different among
the plurality of the small matrices;

a generation unit configured to determine a size for arranging a small matrix and a combination of the small matrices among
the plurality of the small matrices for arranging in the size and generate a dot-arrangement matrix of the size by arranging
the determined small matrices; and

a setting unit configured to set a dot arrangement to be printed in an area of the printing medium corresponding to the size
according to the dot-arrangement matrix generated by the generation unit.

US Pat. No. 9,058,148

COMMUNICATION APPARATUS, CONTROL METHOD THEREFOR, AND STORAGE MEDIUM

Canon Kabushiki Kaisha, ...

1. A communication apparatus configured to communicate with an external apparatus, the communication apparatus comprising:
a recording unit configured to record content data on a removable recording medium;
a transmission unit configured to transmit the content data to the external apparatus;
a selection unit configured to select a mode from among a plurality of modes including a setting mode for acquiring information
necessary for transmitting the content data to the external apparatus by communicating with the external apparatus, and storing
the information on an unremovable recording medium other than the removable recording medium, and a transmission mode for
communicating with the external apparatus using the information stored in the setting mode, and transmitting content data
read from the removable recording medium to the external apparatus;

a determination unit configured to determine whether the removable recording medium is in a detachable state; and
a control unit configured to control communication with the external apparatus,
wherein, in a case where the selected mode is the transmission mode when it is determined by the determination unit that the
removable recording medium is in the detachable state, the control unit stops communication with the external apparatus, and

in a case where the selected mode is the setting mode when it is determined by the determination unit that the removable recording
medium is in the detachable state, the control unit does not stop communication with the external apparatus.

US Pat. No. 9,046,800

MAGNETIC CARRIER

CANON KABUSHIKI KAISHA, ...

1. A magnetic carrier, comprising:
a magnetic carrier core; and
a resinous coating layer formed on a surface of the magnetic carrier core,
wherein the resinous coating layer contains a resin composition and silica-alumina composite particles, and
wherein the silica-alumina composite particles have a dielectric dissipation factor at 1,000 Hz of 0.02 or more and 1.00 or
less.

US Pat. No. 9,049,453

IMAGE ENCODING APPARATUS AND METHOD BASED ON INTENSITY OF EDGE INFORMATION

Canon Kabushiki Kaisha, ...

1. An image encoding apparatus comprising:
an encoding unit configured to divide a pixel arrangement included in an image into a plurality of first blocks and perform
an encoding process including quantization on the first block basis;

an edge detecting unit configured to detect edges of a plurality of second blocks divided from each of the plurality of first
blocks;

a calculating unit configured to calculate highest edge intensity of the first block based on intensity of the edge detected
by the edge detecting unit from each second block divided from the first block and output edge intensity information concerned
with the highest edge intensity of the first block;

an acquiring unit configured to acquire a reference value of a quantization scale code for the quantization on the first block
based on an amount of bits generated by the encoding unit and a bit amount to be assigned to the first block; and

an encoding controlling unit configured to receive the edge intensity information and adjust the reference value acquired
by the acquiring unit in accordance with the highest edge intensity of the first block.

US Pat. No. 10,111,317

PRINTED CIRCUIT BOARD FOR TRANSMITTING DIGITAL SIGNALS

Canon Kabushiki Kaisha, ...

1. A printed circuit board comprising:a printed wiring board; and
a transmission circuit implemented on the printed wiring board and configured to transmit digital signals,
wherein the printed wiring board includes a main wiring pattern which is connected to the transmission circuit and which transmits the digital signals, a first wiring pattern having a connection end connected to the main wiring pattern and an open end which is open, and a second wiring pattern having a grounded end which is grounded and an open end which is open and extending in a direction in which the first wiring pattern extends, and the second wiring pattern is disposed such that the grounded end of the second wiring pattern is disposed such that the grounded end of the second wiring pattern is disposed adjacent to the open end of the first wiring pattern.

US Pat. No. 10,070,837

MEDICAL IMAGING APPARATUS, PROGRAM INSTALLABLE IN MEDICAL IMAGING APPARATUS, AND MEDICAL IMAGING METHOD

Canon Kabushiki Kaisha, ...

1. A medical imaging apparatus comprising:a cardiac lumen region identifying unit configured to identify, based on signal values of a region where blood is flowing, a cardiac lumen region from a medical image including a heart region;
a myocardium identifying unit configured to identify a face of a myocardium region obtained by extending a surface of the cardiac lumen region, identified by the cardiac lumen region identifying unit, by a certain distance at a time toward a myocardium side; and
a generating unit configured to generate a three-dimensional color-coded image in which the face of the myocardium region, identified by the myocardium identifying unit, is colored in colors according to signal values of the medical image corresponding to positions on the face of the myocardium region.

US Pat. No. 9,811,008

IMAGE FORMING METHOD, PROCESS CARTRIDGE, AND ELECTROPHOTOGRAPHIC APPARATUS

Canon Kabushiki Kaisha, ...

1. An image forming method comprising:
(1) charging the surface of an electrophotographic photosensitive member;
(2) forming an electrostatic latent image by exposing the charged surface of the electrophotographic photosensitive member;
(3) forming a toner image on the surface of the electrophotographic photosensitive member by developing the electrostatic
latent image with a toner,

(4) transferring the toner image to a transfer material through or without an intermediate transfer body;
(5) removing the transfer residual toner from the surface of the electrophotographic photosensitive member after the toner
image is transferred, and (6) irradiating the surface of the electrophotographic photosensitive member, from which the transfer
residual toner has been removed, with destaticizing light for eliminating residual charge on the surface of the electrophotographic
photosensitive member,

wherein a surface layer of the electrophotographic photosensitive member contains a compound having a structure represented
by formula (1) below in an amount of 0.1% to 10% by mass based on the total mass of the surface layer, and when in a charged
region of the surface of the electrophotographic photosensitive member charged in the step (1), a charged region in which
the electrostatic latent image is formed in the step (2) is referred to as an “image forming region” and a charged region
in which the electrostatic latent image is not formed is referred to as a “non-image forming region”, the non-image forming
region is not irradiated with the destaticizing light or is irradiated with the reduced destaticizing light in the step (6),

in the formula (1), R1 and R2 each independently represent a methyl group, an ethyl group, or a phenyl group.

US Pat. No. 9,716,895

IMAGE CODING APPARATUS, METHOD FOR CODING IMAGE, PROGRAM THEREFOR, IMAGE DECODING APPARATUS, METHOD FOR DECODING IMAGE, AND PROGRAM THEREFOR

Canon Kabushiki Kaisha, ...

1. An image coding apparatus comprising:
a division unit configured to divide an input image into a plurality of blocks, at least one of the blocks being divided into
at least four subblocks, the subblocks included in a block being represented by a quadtree structure;

a decision unit configured to decide respective quantization parameters of at least four subblocks represented by the quadtree
structure;

an acquisition unit configured to acquire a first difference value between a first quantization parameter of a first subblock
of the subblocks and a second quantization parameter of a second subblock of the subblocks, the first subblock to be coded
before the second subblock and the second subblock being arranged at the right of the first subblock,

and to acquire a second difference value between a third quantization parameter of a third subblock of the subblocks and a
value corresponding to an average of quantization parameters of subblocks which are to be coded before the third subblock,
the third subblock being arranged at the bottom right of the first subblock; and

a coding unit configured to code the first difference value and the second difference value.

US Pat. No. 9,661,249

IMAGE CAPTURING APPARATUS AND IMAGE CAPTURING SYSTEM WITH VARIABLE GAIN

CANON KABUSHIKI KAISHA, ...

1. An image capturing apparatus, comprising:
a plurality of pixels arranged in a matrix form, each of the pixels outputting a signal from a photoelectric conversion element;
and

a plurality of readout circuits each provided for a corresponding column of the pixels, signals from the pixels being input
to the readout circuits,

wherein
at least one of the readout circuits includes
an amplifier unit configured to amplify the signal from a corresponding one of the pixels, and having a variable gain, and
a hold capacitance connected to an output terminal of the amplifier unit via a sampling switch, and having a variable capacitance
value,

wherein,
at a time when the variable gain of the amplifier unit is a first gain and the sampling switch is changed from an off state
into an on state, the variable capacitance value of the hold capacitance is a first capacitance value and,

at a time when the variable gain of the amplifier unit is a second gain larger than the first gain and the sampling switch
is changed from the off state into the on state, the variable capacitance value of the hold capacitance is a second capacitance
value smaller than the first capacitance value.

US Pat. No. 9,651,916

CARTRIDGE HAVING STORING MEDIUM AND IMAGE FORMING APPARATUS USING THE CARTRIDGE

CANON KABUSHIKI KAISHA, ...

1. A cartridge insertable into a main assembly of an image forming apparatus, comprising:
a first unit including a first bearing portion for rotatably supporting an image bearing member;
a second unit including a second bearing portion for rotatably supporting a developer carrying member; and
a storing medium including an electrical contact,
wherein said second bearing portion is provided inside said first bearing portion with respect to a rotational axis direction
of said image bearing member,

wherein at least a part of said storing medium is supported by said second unit and is provided at a position outside said
second bearing portion and inside an outermost end of said first unit with respect to the rotational axis direction, and

wherein said electrical contact faces toward a direction crossing the rotational axis direction.

US Pat. No. 9,563,601

FORCE SENSOR CORRECTING METHOD

Canon Kabushiki Kaisha, ...

1. A force sensor correcting method in a robot system which includes a pair of robots each having an arm and an end effector
provided at the end of the arm via a force sensor for sensing a force and a moment, the method comprising:
a first abutting step of making the force sensor of the pair of robots abut on each other by activating the pair of robots
such that the respective robots have plane-symmetrical postures with respect to a virtual plane;

a first measurement step of obtaining a first value indicating a force of the force sensor of one robot and a second value
indicating a force of the force sensor of the other robot, generated by execution of the first abutting step;

a first correction step of updating a first conversion data of the force sensor of the other robot, which converts the second
value into the first value;

a second abutting step of making ends of the end effectors of the pair of robots abut on each other and making the force sensors
of the pair of robots be spaced away from each other by activating the pair of robots such that the respective robots have
plane-symmetrical postures with respect to the virtual plane;

a second measurement step of obtaining a third value indicating a moment of the force sensor of one robot and a fourth value
indicating a moment of the force sensor of the other robot, generated by execution of the second abutting step; and

a second correction step of updating a second conversion data of the force sensor of the other robot, which converts the fourth
value into the third value.

US Pat. No. 9,557,702

IMAGE FORMING APPARATUS WITH CURL CORRECTING UNIT

Canon Kabushiki Kaisha, ...

1. An image forming apparatus comprising:
an image forming unit configured to form an image on a sheet;
a fixing unit configured to fix the image on the sheet while conveying and heating the sheet, on which the image has been
formed by the image forming unit, at a first nip portion, the fixing unit including a first fixing member and a second fixing
member forming the first nip portion with the first fixing member;

a curl correcting unit configured to correct a curl of the sheet while conveying the sheet, on which the image has been fixed
by the fixing unit, at a second nip portion, the curl correcting unit including a first curl correcting member and a second
curl correcting member forming the second nip portion with the first curl correcting member;

a pressure changing mechanism configured to change a pressure applied to the first nip portion and a pressure applied to the
second nip portion, the pressure changing mechanism including a rotary member rotating about a rotational axis; and

a controller for controlling a rotational phase of the rotary member by rotating the rotary member,
wherein the pressure applied to the first nip portion and the pressure applied to the second nip portion are changed according
to the rotational phase of the rotary member controlled by the controller, and

wherein the rotary member includes a shaft rotating about the rotational axis, a first cam portion, provided on the shaft
and rotating with the shaft about the rotational axis, for changing the pressure applied to the first nip portion and a second
cam portion, provided on the shaft and rotating with the shaft about the rotational axis, for changing the pressure applied
to the second nip portion, the first cam portion and the second cam portion provided on different positions of the shaft in
a rotational axis direction of the shaft.

US Pat. No. 9,560,297

IMAGE PROCESSING APPARATUS, IMAGE PROCESSING METHOD AND PROGRAM, AND IMAGE PICKUP APPARATUS INCLUDING IMAGE PROCESSING APPARATUS FOR CORRECTING DEFECT PIXELS

CANON KABUSHIKI KAISHA, ...

1. An image processing apparatus for processing an image signal obtained from an image pickup element, a plurality of pixels
of the image pickup element being assigned to one microlens, the image processing apparatus comprising:
one or more processors; and
a memory storing instructions which, when the instructions are executed by the processor, cause the image processing apparatus
to function as:

a correction unit configured to correct an image signal of a defect pixel of the image pickup element using an image signal
of another pixel of the image pickup element,

wherein the correction unit determines the another pixel to be used for correcting the image signal of the defect pixel based
on a corresponding position of an image signal of a pixel of the image pickup element on a refocus plane.

US Pat. No. 9,537,850

INFORMATION PROCESSING APPARATUS, INFORMATION PROCESSING METHOD, AND STORAGE MEDIUM

CANON KABUSHIKI KAISHA, ...

1. An information processing apparatus comprising:
a memory configured to store at least one program; and
at least one processor configured to execute the at least one program stored in the memory;
wherein the at least one processor, in executing the at least one program, executes:
storing first authentication information corresponding to a first web service and second authentication information corresponding
to a second web service different from the first web service, in a first storage area;

causing a display unit displaying a web page corresponding to the first web service to display an indicator to receive a predetermined
instruction;

executing, in the first storage area, upon receiving the predetermined instruction by the indicator displayed by the display
unit, deletion processing of both of the first authentication information and the second authentication information; and

executing authentication processing for the first web service using the first authentication information stored in a second
storage area different from the first storage area, in a case where the deletion processing is executed in accordance with
the predetermined instruction.

US Pat. No. 9,521,320

IMAGE PROCESSING APPARATUS, IMAGE CAPTURING APPARATUS, IMAGE PROCESSING METHOD, AND STORAGE MEDIUM

CANON KABUSHIKI KAISHA, ...

1. An image processing apparatus comprising:
an acquisition unit configured to acquire an image including a plurality of subject areas and distance information corresponding
to the plurality of subject areas;

a first generation unit configured to generate a rearranged image in which the plurality of subject areas is rearranged in
the image based on the distance information; and

a second generation unit configured to generate an image comprising the rearranged image in which information on a focus state
for image combination processing to change the focus state of the image including the plurality of subject areas is reflected
in the rearranged image.

US Pat. No. 9,517,043

MULTI-SOURCE RADIATION GENERATOR AND RADIOGRAPHY SYSTEM

Canon Kabushiki Kaisha, ...

1. A radiation generator comprising:
an electron source array including a plurality of electron sources each of which is configured to emit electrons;
a radiation source array having a plurality of radiation sources arranged in series from one array end to the other array
end of the radiation source array corresponding to the electron source array; and

a control unit configured to control each of the electron sources in the electron source array so as to form a dose distribution
of radiation in the radiation source array,

wherein the control unit controls the electron sources such that each radiation source sequentially irradiates a common region
with a controlled dose of radiation controlled based on a different position of the radiation source and the dose distribution
of radiation shows a decreasing profile and an increasing profile in that order from the one array end to the other array
end.

US Pat. No. 9,514,910

RADIATION TUBE, RADIATION GENERATING APPARATUS, AND RADIATION IMAGING SYSTEM

Canon Kabushiki Kaisha, ...

1. A radiation tube, comprising:
an insulating tube having a tubular shape;
a cathode disposed at one end of the insulating tube;
an anode disposed at another end of the insulating tube;
a conductive member with an opening disposed in the radiation tube; and
a dielectric disposed at at least one of an inside and an end of the conductive member.

US Pat. No. 9,514,555

METHOD OF RENDERING AN OVERLAPPING REGION

CANON KABUSHIKI KAISHA, ...

1. A method of modifying a graphics command, the method comprising:
receiving from a computerized graphical interface a graphics command comprising a drawing operation in a region and a pattern
of the region;

obtaining transparency characteristics from a frequency representation of the pattern;
determining if the obtained transparency characteristics satisfy a set of transparency criteria; and
replacing at least the pattern with a transparency coefficient based on the frequency representation if the obtained transparency
characteristics satisfy the set of transparency criteria.

US Pat. No. 9,505,250

IMAGE FORMING SYSTEM AND NETWORK MANAGEMENT DEVICE INCLUDING AN IMAGE FORMING APPARATUS AND AN ACCESSORY DEVICE

Canon Kabushiki Kaisha, ...

1. An image forming system having an image forming apparatus configured to perform image formation and an accessory device
configured to be capable of establishing communication with the image forming apparatus via a network bus,
wherein the accessory device is adjacent to the image forming apparatus, and the accessory device comprises:
a first communication device configured to communicate with the image forming apparatus via the network bus, and detect a
communication state of the network bus;

a first port to which a line, which is connected to the image forming apparatus and is different from the network bus, is
connected,

a first processor configured to control a state of the first port, and configured to control, when the detected communication
state of the network bus represents an abnormal state, a state of the first port to be in an off state for notifying the adjacent
image forming apparatus or other adjacent accessory device of the abnormal state,

wherein the image forming apparatus comprises:
a second communication device configured to communicate with the accessory device via the network bus;
a second port to which the line is connected;
a storing unit configured to store identification information which identifies the accessory device; and
a second processor configured to erase, when a state of the second port is an off state, the identification information of
the accessory device.

US Pat. No. 9,509,931

SOLID-STATE IMAGING APPARATUS AND CAMERA

Canon Kabushiki Kaisha, ...

1. A solid-state imaging apparatus comprising:
a pixel array in which a plurality of pixels are arrayed;
a plurality of processing units configured to process signals each being based on a signal which is output from each pixel
on each column of the pixel array, wherein the plurality of processing units form a plurality of groups each including two
or more processing units;

an output line;
a power supply line configured to transfer a power voltage;
a plurality of signal lines each corresponding to a different one of the plurality of groups, and each configured to connect
to output nodes of the two or more processing units in the corresponding one of the plurality of groups;

a plurality of connecting units each corresponding to a different one of the plurality of groups; and
a control unit,
wherein, in a case of outputting signals from the processing units in one group of the plurality of groups during a first
period,

the control unit, during the first period, controls the connecting unit of the one group, to connect the output line and the
signal line of the one group electrically and to output the signals from the processing units in the one group,

the control unit, during the first period, controls the connecting unit of another group, to connect the power supply line
and the signal line of the another group electrically and to set an electrical path between the output line and the signal
line of the another group, in a high impedance state, and

each of the plurality of processing units includes a conversion unit configured to perform analog/digital conversion on the
signals from the respective pixels and a signal holding unit configured to hold the signals from the conversion unit.

US Pat. No. 9,497,788

COMMUNICATION DEVICE, AND CONTROL METHOD THEREFOR

CANON KABUSHIKI KAISHA, ...

1. A communication device configured to perform a communication parameter setting process as a providing device configured
to provide a communication parameter or a receiving device configured to receive the communication parameter provided by the
providing device, the communication device comprising:
one or more processors; and
a memory having stored thereon instructions which, when executed by the one or more processors, cause the communication device
to:

search for another communication device;
set a role of the communication device based on the following:
(i) in a case where the another communication device is searched for, a role of the communication device is set to the providing
device or the receiving device using first information transmitted from the another communication device as a response signal
to a predetermined request signal and second information stored in the communication device, and

(ii) in a case where the communication device receives third information different from the first information and transmitted
from a device operating as a providing device as a signal different from the response signal to the predetermined request
signal, a role of the communication device is set to the receiving device without using the second information when the communication
device performs the communication parameter setting process with the device operating as the providing device; and

transmit the third information in a case where a role of the communication device is set to the providing device using the
first information and the second information.

US Pat. No. 9,489,566

IMAGE RECOGNITION APPARATUS AND IMAGE RECOGNITION METHOD FOR IDENTIFYING OBJECT

Canon Kabushiki Kaisha, ...

1. An image recognition apparatus comprising:
an acquisition unit configured to acquire an object image;
a feature extraction unit configured to extract a plurality of feature amounts by extracting respective histogram features
from a plurality of regions in the object image acquired by the acquisition unit;

a first function calculation unit configured to calculate, as a group of training samples, values of a first kernel function
for combinations of feature amounts calculated for bins of the histogram features extracted by the feature extraction unit
from a plurality of object images including a same object;

a determination unit configured to determine a training sample that is present near a boundary of a class containing the group
of training samples by checking a condition for the values of the first kernel function, as a boundary sample;

a registration unit configured to register the boundary sample;
a second function calculation unit configured to calculate values of a second kernel function for combinations of the feature
amount of the histogram feature extracted by the feature extraction unit from the object image of a recognition target acquired
by the acquisition unit and respective boundary samples of a plurality of classes registered by the registration unit;

a reliability calculation unit configured to calculate a reliability for each class with respect to the object image of the
recognition target based on the values of the second kernel function; and

an identification unit configured to identify a class of the recognition target based on the reliability for each class calculated
by the reliability calculation unit.

US Pat. No. 9,485,383

IMAGE BASED CORRECTION OF DISTORTION FROM A SCANNER

Canon Kabushiki Kaisha, ...

1. An imaging system for imaging an eye, comprising:
a scanner, wherein the scanner positions a spot of light on the eye along a scanning path, the scanning path includes a plurality
of scan lines;

a detector arranged to output raw data associated with positions along the scanning path, wherein the detector detects the
spot of light reflected from the eye;

one or more processors that perform calculations comprising:
dividing the raw data into forward scan data and backward scan data;
reversing the order of the backward scan data to produce inverted backward scan data;
determining an offset value by calculating cross-correlation between the forward scan data and the inverted backward scan
data; and

producing a first image of the eye that comprises the forward scan data and the inverted backward scan data, wherein the forward
scan data is shifted by the offset value relative to the inverted backward scan data, and

adjusting a data sampling window based on the offset value.

US Pat. No. 9,483,702

METHOD, APPARATUS AND SYSTEM FOR DETERMINING A SALIENCY MAP FOR AN INPUT IMAGE

Canon Kabushiki Kaisha, ...

1. A method of determining a saliency map for an input image, said method comprising:
accessing predetermined data defining relative salience of image features, the predetermined data representing saliency observations
obtained using psychophysical experimentation, and the predetermined data relating to multiple image features that are correlated
with human perceptions of saliency;

decomposing the input image according to the predetermined data to identify image features of the input image that have corresponding
image features in the predetermined data;

obtaining a perceptual scale, for each of the identified image features of the input image that have corresponding image features
in the predetermined data, by:

selecting a portion of the predetermined data corresponding to a range of feature data values associated with the respective
identified image feature, and

determining the perceptual scale for the respective identified image feature using the respective selected portion of the
predetermined data, the perceptual scale for the respective identified image feature being based on probabilities determined
using the respective selected portion of the predetermined data; and

determining the saliency map for the input image using the determined perceptual scale or the determined perceptual scales.

US Pat. No. 9,471,979

IMAGE RECOGNIZING APPARATUS AND METHOD

CANON KABUSHIKI KAISHA, ...

1. An image recognizing apparatus comprising:
a memory for storing a program;
a processor for executing the program stored in the memory to function as:
an extracting unit configured to extract a partial feature quantity from an object in an input image;
a determination unit configured to determine, based on an attribute of the partial feature quantity extracted by the extracting
unit, whether or not a parameter for dimension reduction is to be dynamically generated;

a generation unit configured to generate a dynamic parameter for dimension reduction if the determination unit determines
that the parameter is to be dynamically generated;

a read out unit configured to read out a preset parameter for dimension reduction stored in a parameter storing unit if the
determination unit does not determine that the parameter is to be dynamically generated;

a reduction unit configured to reduce a dimension of the partial feature quantity using the dynamic parameter for dimension
reduction generated by the generation unit or the preset parameter for dimension reduction read out by the read out unit;

a feature quantity storing unit configured to store the partial feature quantity of an object in a registration image of which
a dimension has been reduced; and

a calculating unit configured to calculate similarity between the object in the input image and the object in the registration
image, using the partial feature quantity of the object in the input image of which the dimension has been reduced by the
compressing unit and the partial feature quantity of the object in the registration image stored in the storing unit.

US Pat. No. 9,472,648

SEMICONDUCTOR DEVICE, PRINTING APPARATUS, AND MANUFACTURING METHOD THEREOF

CANON KABUSHIKI KAISHA, ...

1. A manufacturing method of a semiconductor device including a DMOS transistor, an NMOS transistor, and a PMOS transistor
arranged on a semiconductor substrate,
wherein the DMOS transistor includes a source region, a drain region, a first semiconductor region that is of a first conductivity
type and has a lower impurity concentration than the drain region, and a second semiconductor region that is of a second conductivity
type opposite to the first conductivity type, and is formed to be adjacent to the first semiconductor region, the drain region
being formed in the first semiconductor region, and the source region being formed in the second impurity region,

the manufacturing method of the semiconductor device comprising:
a first step of forming the first semiconductor region at the same time as a first well of the first conductivity type in
which one of the NMOS transistor and the PMOS transistor is to be formed; and

a second step of forming the second semiconductor region at the same time as a second well of the second conductivity type
in which the other of the NMOS transistor and the PMOS transistor is to be formed.

US Pat. No. 9,473,671

METHOD FOR PERFORMING DITHER PROCESSING

CANON KABUSHIKI KAISHA, ...

1. A method performed by a processor in an apparatus, the method comprising:
applying a same dither matrix to images; and
printing the images to which the same dither matrix has been applied, on a sheet,
wherein, phases of the dither matrix to be applied to different jobs are shifted, and phases of the dither matrix to be applied
to different pages in a same job are not shifted.

US Pat. No. 9,472,766

FUSED POLYCYCLIC COMPOUND AND ORGANIC LIGHT EMITTING ELEMENT INCLUDING THE SAME

Canon Kabushiki Kaisha, ...

1. A fused polycyclic compound represented by the following general formula [1] or [2]:

wherein in the general formulas [1] and [2], R1 to R20 are each independently selected from the group consisting of a hydrogen atom, a cyano group, a substituted or an unsubstituted
alkyl group, a substituted or an unsubstituted aryl group, and a substituted or an unsubstituted heterocyclic group.

US Pat. No. 9,472,639

FORMING A LIQUID EJECTION HEAD WITH THROUGH HOLES AND A DEPRESSION

Canon Kabushiki Kaisha, ...

1. A method of manufacturing a substrate of a liquid ejection head comprising:
forming a plurality of recesses in a first surface of a silicon wafer, the first surface being opposite to a second surface
where the second surface aids in ejecting liquid;

covering an outer periphery of the silicon wafer with a protective film, and etching the silicon wafer with etchant to form
a depression formed on the first surface of the silicon wafer;

forming a plurality of through holes formed from the plurality of recesses in the depression; and
manufacturing a plurality of substrates of the liquid ejection head from the silicon wafer by dividing the silicon wafer on
the basis of the through holes

formed from the plurality of recesses.

US Pat. No. 9,446,594

METHOD OF MANUFACTURING LIQUID EJECTION HEAD AND LIQUID EJECTION HEAD

Canon Kabushiki Kaisha, ...

1. A liquid ejection head comprising:
a liquid ejection substrate configured to eject liquid;
an electric wiring member electrically connected to the liquid ejection substrate; and
a supporting member having a first supporting surface configured to support the liquid ejection substrate and a second supporting
surface configured to support the electric wiring member on the side of the first supporting surface, wherein

an outer peripheral portion of the electric wiring member disposed on the side of the second supporting surface is positioned
on an outside of the second supporting surface when viewed in a direction orthogonal to the second supporting surface,

the supporting member includes a first depression and a second depression, wherein the first depression and the second depression
are each depressions made in the second supporting surface, and wherein a first portion of the first depression is provided
at a position facing a first part of the outer peripheral portion of the electric wiring member, the second depression is
connected to the first portion of the first depression and a second portion of the first depression, and is provided at a
position facing a second part of the outer peripheral portion of the electric wiring member, and the second portion of the
first depression is provided at a position facing a third part of the outer peripheral portion of the electric wiring member,
the first, second and third parts of the outer peripheral portion of the electric wiring member each being different from
one another, and wherein the second depression has a width in cross section, orthogonal to a direction in which the second
depression is connected to the first depression, smaller than a width of the first depression, and

the electric wiring member and the supporting member are adhered to each other at least via an adhesive agent applied to the
first depression and the second depression,

wherein the first depression and the second depression are provided along one side of the outer peripheral portion of the
electric wiring member arranged successively in order of a first portion of the first depression, the second depression and
a second portion of the first depression, and are not provided in parallel to each other.

US Pat. No. 9,440,809

SHEET STACKING APPARATUS AND IMAGE FORMING APPARATUS

Canon Kabushiki Kaisha, ...

1. A sheet stacking apparatus, comprising:
a main body;
a first storage unit configured to be drawn out of/inserted into the main body and storing a sheet, the first storage unit
comprising a guide portion; and

a second storage unit configured to be drawn out of/inserted into the main body, provided above the first storage unit, and
storing a sheet, the second storage unit comprising an abutment portion guided by the guide portion of the first storage unit
when the second storage unit is being drawn out of the main body in a state in which the first storage unit has already been
precedingly drawn out of the main body,

wherein the second storage unit comprises a second storage portion storing the sheet and a second exterior cover provided
at an end portion of the second storage portion in a drawing direction of the second storage unit,

wherein the abutment portion is provided so as to project downward from a lower surface of the second exterior cover of the
second storage unit, and

wherein the abutment portion is a rotator rotatably supported by the second exterior cover.

US Pat. No. 9,440,475

IMAGE FORMING METHOD

Canon Kabushiki Kaisha, ...

1. An image forming method, comprising:
a liquid composition applying step of applying a liquid composition to a recording medium;
an ink applying step of applying an ink to the recording medium in such a manner as to be at least partially overlapped with
a region to which the liquid composition is applied;

and a heating step of heating the recording medium to which the liquid composition and the ink are applied, wherein
the ink contains a self-dispersible pigment and resin particles,
the liquid composition contains:
an agglomerating component of agglomerating at least either the self-dispersible pigment or the resin particles; and
wax particles,
a heating temperature TH in the heating step, a softening point Tmp of the resin particles, and a melting point Tmw of the wax particles satisfy a relationship of Tmp
a penetration specified by JIS K2235 of the wax particle is 5 or less, and
an application amount to the recording medium of wax particles X having a particle diameter equal to or larger than a film
thickness D represented by Expression (1) shown below among the wax particles is 0.01 g/m2 or more;

D=a×(b1/c1+b2/c2),  Expression (1):

wherein, in the expression, a is an application amount (g/m2) to the recording medium of the ink, b1 is a content (% by mass) of the self-dispersible pigment in the ink, c1 is a specific gravity of the self-dispersible pigment, b2 is a content (% by mass) of the resin particles in the ink, and c2 is a specific gravity of the resin particles.

US Pat. No. 9,442,288

METHOD OF ASSEMBLING AND ADJUSTING A MULTI-BEAM SCANNING OPTICAL APPARATUS AND METHOD OF MANUFACTURING A MULTI-BEAM SCANNING OPTICAL APPARATUS

CANON KABUSHIKI KAISHA, ...

1. A method of manufacturing a multi-beam scanning optical apparatus including a light source unit having multiple light emitting
points, a deflecting unit configured to deflect multiple light beams emitted from the light source unit, and an imaging optical
system having a first imaging optical element and configured to focus the multiple light beams deflected by the deflecting
unit on a single surface to be scanned, the method comprising:
irradiating the first imaging optical element with the multiple light beams;
adjusting locations of incident positions of the irradiated multiple light beams on the first imaging optical element in a
sub-scanning direction; and

adjusting locations of irradiated positions of the multiple light beams on the single surface to be scanned in the sub-scanning
direction while keeping the locations of the incident positions of the irradiated multiple light beams on the first imaging
optical element the same,

wherein the adjusting of the locations of the incident positions comprises moving the first imaging optical element in the
sub-scanning direction.

US Pat. No. 9,437,764

PHOTOELECTRIC CONVERSION DEVICE AND METHOD FOR MANUFACTURING PHOTOELECTRIC CONVERSION DEVICE

CANON KABUSHIKI KAISHA, ...

1. A photoelectric conversion device comprising:
a semiconductor substrate;
a photoelectric conversion portion including first and second semiconductor regions of a first conductivity type disposed
in the semiconductor substrate; and

a transfer portion configured to transfer charges of the first and second semiconductor regions,
wherein the first semiconductor region includes a part having a lower impurity concentration than that of a different part
of the first semiconductor region,

wherein the part having the lower impurity concentration and the different part of the first semiconductor region are arranged
along a first direction parallel to a surface of the semiconductor substrate,

wherein the second semiconductor region is disposed under the part having the lower impurity concentration, the second semiconductor
region and the part having the lower impurity concentration being arranged along a second direction perpendicular to the surface,
and

wherein a length of the first semiconductor region along the first direction is greater than a length of the second semiconductor
region along the first direction, and

a semiconductor region of the second conductivity type is disposed laterally to the second semiconductor region along the
first direction and under the different part of the first semiconductor region along the second direction.

US Pat. No. 9,438,058

ELECTRONIC DEVICE

Canon Kabushiki Kaisha, ...

1. An electronic device comprising:
a communication control unit configured to perform an enumeration process; and
a charging unit configured to charge a battery unit with power supplied from an external device,
wherein the communication control unit performs the enumeration process with power supplied from the battery unit when a voltage
of the battery unit is higher than a predetermined voltage, and

wherein the communication control unit disables the enumeration process when a voltage of the battery unit is not higher than
the predetermined voltage.

US Pat. No. 9,437,162

IMAGE OUTPUT APPARATUS, CONTROL METHOD THEREFOR, IMAGE DISPLAY APPARATUS, CONTROL METHOD THEREFOR, AND STORAGE MEDIUM

Canon Kabushiki Kaisha, ...

1. An image output apparatus that outputs first image data to a first image display apparatus and second image data to a second
image display apparatus, each of the first image display apparatus and the second image display apparatus being capable of
controlling amount of light of a backlight thereof, the image output apparatus comprising:
a storage that stores the first image data and the second image data; and
a processor configured:
to determine whether the first image data and the second image data stored in the storage satisfy a predetermined condition;
to control, in a case where the first image data and the second image data satisfy the predetermined condition, the first
image display apparatus and the second image display apparatus such that the first image display apparatus and the second
image display apparatus are the same in amount of light of light emission control of the backlight used for display of the
first image data and the second image data by the first image display apparatus and the second image display apparatus even
if the first image data and the second image data are different from each other; and

to control, in a case where the first image data and the second image data do not satisfy the predetermined condition, the
first image display apparatus and the second image display apparatus such that the respective amounts of light of the backlights
thereof used for display of the first image data and the second image data by the first image display apparatus and the second
image display apparatus are adjusted based on respective signal levels of the first image data and the second image data.

US Pat. No. 9,431,595

VIBRATION WAVE DRIVING DEVICE, IMAGE PICKUP DEVICE, OPTICAL APPARATUS, LIQUID DISCHARGE DEVICE, AND ELECTRONIC APPARATUS

Canon Kabushiki Kaisha, ...

1. A vibration wave driving device that generates a vibration wave by applying an AC voltage to a piezoelectric element, the
vibration wave driving device comprising:
the piezoelectric element including a piezoelectric material and an electrode; and
a capacitor that is connected in parallel to the piezoelectric element,
wherein the piezoelectric material contains a perovskite-type metal oxide as a main component, the perovskite-type metal oxide
being represented by general formula (1)

(Ba1-xCax)a(Ti1-yZry)O3  (1)

where 1.00?a?1.01, 0.02?x?0.30, 0.020?y?0.095, and y?x,
wherein the perovskite-type metal oxide contains Mn, the content of Mn in 100 parts by weight of the perovskite-type metal
oxide being 0.02 parts by weight or more and 0.40 parts by weight or less on a metal basis,

wherein the capacitor contains Ba, Ca, Ti, and Zr as main components, and
wherein, when a maximum value of a relative dielectric constant of the piezoelectric material in a temperature range of ?60°
C. to +50° C. is ?(Pmax), a temperature at the maximum value of the relative dielectric constant of the piezoelectric material
is T?(Pmax), a relative dielectric constant of the capacitor at the temperature T?(Pmax) is ?(Cc), a maximum value of the
relative dielectric constant of the capacitor in the temperature range of ?60° C. to +50° C. is ?(Cmax), and a temperature
at the maximum value of the relative dielectric constant of the capacitor is T?(Cmax), 20[° C.]?T?(Cmax)?T?(Pmax)?75[° C.]
and 0.50??(Cc)/?(Cmax)?0.80 are satisfied.

US Pat. No. 9,427,149

OPTICAL TOMOGRAPHIC IMAGING APPARATUS

Canon Kabushiki Kaisha, ...

1. An optical tomographic imaging apparatus configured to acquire a tomographic image of an object to be examined based on
light generated by combining return light from the object to be examined irradiated by measurement light via a first lens,
and reference light corresponding to the measurement light, the optical tomographic imaging apparatus comprising:
a scanning unit disposed on an optical path of the measurement light, and configured to scan the measurement light on the
object to be examined;

a second lens disposed on the optical path of the measurement light between the scanning unit and the first lens; and
an optical path branching unit disposed between the first lens and the second lens, and configured to branch from the optical
path of the measurement light to an observation optical path for observing the object to be examined,

wherein the second lens and the scanning unit are disposed in such a manner that an angle at which the measurement light scanned
by the scanning unit is incident on the optical path branching unit satisfies a wavelength separation characteristic of 90%
or higher at a wavelength of observation light of the object to be examined in a wavelength band of the measurement light.

US Pat. No. 9,427,150

OPTICAL TOMOGRAPHIC IMAGING APPARATUS

Canon Kabushiki Kaisha, ...

1. An optical tomographic imaging apparatus configured to acquire a tomographic image of a subject's eye based on light generated
by combining return light from the subject's eye irradiated by measurement light via a first lens, and reference light corresponding
to the measurement light, the optical tomographic imaging apparatus comprising:
a scanning unit disposed on an optical path of the measurement light, and configured to scan the measurement light on a fundus
of the subject's eye;

a second lens disposed on the optical path of the measurement light between the scanning unit and the first lens;
a first optical path branching unit disposed on the optical path of the measurement light between the first lens and the second
lens, and configured to branch from the optical path of the measurement light to an optical path of an anterior eye observation
optical system for observing an anterior eye of the subject's eye; and

a second optical path branching unit disposed on the optical path of the measurement light between the first lens and the
second lens, and configured to branch from the optical path of the measurement light to an optical path of a fundus observation
optical system for observing the fundus,

wherein the optical path of the anterior eye observation optical system is located on a reflection optical path of the first
optical path branching unit,

wherein the optical path of the fundus observation optical system is located on a transmission optical path of the first optical
branching unit and a transmission optical path of the second optical path branching unit,

wherein the optical path of the measurement light is located on the transmission optical path of the first optical path branching
unit and a reflection optical path of the second optical path branching unit, and

wherein the second lens and the scanning unit are disposed such that an angle at which the measurement light scanned by the
scanning unit is incident on the first optical path branching unit and the second optical path branching unit is substantially
maintained.