US Pat. No. 9,055,877


The Regents of the Univer...

1. A method of processing cardiac activation information, the method comprising:
accessing a first cardiac signal and a second cardiac signal obtained from a patient;
processing the first cardiac signal and the second cardiac signal to identify a point of change in the first cardiac signal
at which a derivative of the first cardiac signal diverges with respect to a derivative of the second cardiac signal; and

assigning an activation onset time in the first cardiac signal at the point of change to define a cardiac activation.

US Pat. No. 9,047,429



1. An apparatus for increasing fault tolerance of an FPGA circuit, comprising:
a computer configured for designing an FPGA circuit; and
programming executable on said computer for:
describing a logic circuit for implementation on the FPGA circuit and routing of circuits through a synthesis process which
arrives at a physical design;

performing a circuit analysis on said logic circuit;
performing in-place iterations of reconfiguring, don't care X filling, and/or inversion of look-up table (LUT) bits toward
increasing overall reliability of said logic circuit; and

updating said FPGA circuit in response to said in-place iterations;
wherein said in-place iterations are performed after placement and routing to preserve physical design while optimizing the
logic circuit to mask faults originating upstream; and

wherein said programming executable on said computer is configured to perform said in-place iterations by performing single
event upset (SEU) fault analysis to obtain weight values for routing configuration memory (CRAM) bits, followed by performing
in-place logic inversion which inverts functions of driving logic in response to reassigning look-up table (LUT) polarities,
followed by adjusting all of the truth tables of its fanout LUTs and driven LUTs to preserve functionality, whereby total
weight of configuration memory (CRAM) bits on routing multiplexers is minimized.

US Pat. No. 9,227,014


The Board of Trustees of ...

1. A non-transitory computer-readable medium carrying one or more sequences of instructions, wherein execution of the one
or more sequences of instructions by one or more processors causes an apparatus to:
determine values for a plurality of parameters for an automatic on-off switch for an insulin pump configured to inject insulin
into a subject, wherein the plurality of parameters comprises a first prediction time horizon (H1), a first predicted glucose
threshold (Goff) for turning the insulin pump off, a maximum shut off time within a first time window, and duration of the
first time window;

determine a safety rule based at least in part on the maximum shut off time within the first time window and the duration
of the first time window;

collect a plurality of glucose readings of a glucose level in a bloodstream of the subject up to a current time;
determine an expected current glucose value G and expected current glucose temporal rate of change dG/dt based only on the
plurality of glucose readings and a Kalman filter configured for noisy glucose readings of the glucose level in the bloodstream
of the subject;

predict a glucose level (Gh1) for a first future time that is the first prediction time horizon after the current time; and
issue a command to shut off the insulin pump if it is determined both that the predicted glucose level (Gh1) is less than
Goff and that the safety rule is satisfied.

US Pat. No. 9,302,085


The Regents of the Univer...

6. A topical composition for locally increasing arterial diameter and providing local anesthesia in a subject, the topical
composition comprising:
a vasodilation agent in an amount sufficient for locally increasing arterial diameter in the subject and ranging from 22.5
mg to 75 mg; and

an anesthetic agent in an amount sufficient for providing local anesthesia in the subject, wherein the vasodilation agent
is nitroglycerin and the anesthetic agent is lidocaine, and wherein the amounts of the vasodilation agent and the anesthetic
agent are sufficient for locally increasing arterial diameter and providing local anesthesia in the subject without producing
a significant systemic effect in the subject.

US Pat. No. 9,391,832


Menlo Security, Inc., Me...

1. A system, comprising:
a set of one or more processors, configured to use a set of one or more interfaces to:
receive, at a surrogate, a request from a client device for a page;
request, from a site, the page specified by the client device;
render, at the surrogate, data received from the site in response to the request made by the surrogate, on behalf of the client
device, for the specified page;

perform at least one transformation operation on the rendered data to generate a representation of the rendered data, wherein
the representation of the rendered data comprises Document Object Model (DOM) layout content;

transmit the representation of the rendered data to the client device, wherein the representation of the rendered data transmitted
to the client device comprises DOM layout content;

receive an event from the client device, wherein the event corresponds to a user interaction at the client device with a browser

reproduce the received event at the surrogate; and
transmit an update to the client device after reproducing the received event at the surrogate; and
a memory coupled to the set of one or more processors and configured to provide the set of one or more processors with instructions.
US Pat. No. 9,272,051


California Institute of T...

1. A composition comprising a combination of 6-n-propylthiouracil and a complementary molecule, wherein the complementary
molecule interferes with systemic absorption and release of 6-n-propylthiouracil upon enteral administration, wherein the
complementary molecule is polyethylene glycol, wherein the polyethylene glycol is conjugated to the 6-n-propylthiouracil,
and wherein the combination results in prolonged activation of bitter taste receptors in the gut.
US Pat. No. 9,156,906



wherein the at least one carbohydrate moiety is a ?-Gal-[1->3]-?-GaINAc or a N-Acetylgalactosamine (GaINAc, 2-Acetamido-2-deoxy-D-galactopyranose
or N-Acetyl -D-galactosamine).

US Pat. No. 9,295,116



1. A switched-capacitor voltage converter apparatus, comprising:
a current regulator having at least two H-bridge switch stages interconnected with capacitors, each said H-bridge stage configured
for receiving an input voltage and generating a predetermined output current;

a multi-primary-winding transformer having a separate primary winding connecting across each H-bridge stage of said current
regulator, and a secondary winding with an output configured for driving current through the load; and

a current controlled oscillator which generates two phase outputs for driving states in said H-bridge switch stages;
wherein said current controlled oscillator is configured for sensing current delivered to a load and changing duty cycle and/or
frequency of said current controlled oscillator to maintain a predetermined load current.

US Pat. No. 9,238,139



1. A cutaneous electrode assembly for trigeminal nerve stimulation for treatment of a neuropsychiatric disorder, the cutaneous
electrode assembly comprising:
a first pair of contacts configured for placement on a first region of a patient's face;
a second pair of contacts configured for placement on a second region of the patient's face; and
an insulating connection region connecting the first pair of contacts and the second pair of contacts,
wherein the first pair of contacts and the second pair of contacts are configured to contact a portion of the patient's face
overlying the cutaneous distribution of at least one branch of the trigeminal nerve and to stimulate said branch of said nerve
with minimal or no current penetration below the surface of the skull, and wherein the first pair of contacts and the second
pair of contacts are spaced apart according to the distance between the at least one branch of the trigeminal nerve on one
side of the patient's face and the at least one branch of the trigeminal nerve on an opposing side of the patient's face.

US Pat. No. 9,307,256


The Regents of the Univer...

1. An apparatus for processing a video data stream, comprising:
a codec for processing a video data stream comprised of a plurality of frames, wherein the codec comprises an encoder, a decoder,
or both an encoder and a decoder;

the encoder processes a video data stream to generate encoded data and the decoder processes encoded data to reconstruct a
video data stream;

the encoded data is comprised of a base layer of lower spatial resolution and at least one enhancement layer of higher spatial
resolution as compared to the base layer; and

the enhancement layer's processing comprises transform domain predictions, wherein predictions of one or more transform coefficients
are made from the base layer's information on the transform coefficients in a current frame, and the enhancement layer's motion
compensated information from one or more prior frames;

wherein the base layer's information comprises bounds on the transform coefficients' values; and
wherein the base layer's processing at the encoder comprises down-sampling the current frame of the video data stream in the
transform domain by discarding high frequency transform coefficients in the base layer.

US Pat. No. 9,245,694


The Regents of the Univer...

1. A solid-state supercapacitor comprising:
a first electrode comprising a first conductive supporting structure and a first array of conductive quasi-one-dimensional
structures that extend from the first conductive supporting structure;

a second electrode comprising a second conductive supporting structure and a second array of conductive quasi-one-dimensional
structures that extend from the second conductive supporting structure; and

a solid-state ionogel structure disposed between the first electrode and the second electrode, wherein:
the solid-state ionogel structure prevents direct electrical contact between the first electrode and the second electrode;

the solid-state ionogel structure substantially fills voids within and between the first array of conductive quasi-one-dimensional
structures and the second array of conductive quasi-one-dimensional structures.

US Pat. No. 9,173,564


California Institute of T...

1. A method for sensing pressure, the method comprising:
establishing a gap between first and second membranes at a first pressure, the first and second membranes comprising nanophotonic

transmitting a first beam of light to the nanophotonic components;
measuring a first reflectance of the light off of the nanophotonic components at the first pressure and determining a first
resonance by detecting a dip in reflectance;

changing the gap between first and second membranes in response to a second pressure;
transmitting a second beam of light to the nanophotonic components;
measuring a second reflectance of the light off of the nanophotonic components at the second pressure and determining a second
resonance by detecting a dip in reflectance; and

calculating the second pressure using the difference between the first resonance and second resonance.

US Pat. No. 9,055,876


The Regents of the Univer...

1. A method of processing cardiac activation information, the method comprising:
accessing a first cardiac signal and a second cardiac signal obtained from a patient;
processing the first cardiac signal and the second cardiac signal to determine whether there is a point of change in the first
cardiac signal at which a derivative of the first cardiac signal diverges with respect to a derivative of the second cardiac
signal above a threshold; and

assigning an activation onset time in the first cardiac signal at the point of change to define a cardiac activation if the
point of change is in the first cardiac signal.

US Pat. No. 9,409,023


California Institute of T...

1. A device for use with a plurality of electrodes, and one or more sensors, the device comprising:
a stimulation assembly connectable to the plurality of electrodes, wherein the plurality of electrodes are configured to connect
to a spinal cord at a location below a lesion of the spinal cord; the stimulation assembly being configured to deliver stimulation
to selected ones of the plurality of electrodes when the stimulation assembly is connected to the plurality of electrodes;

a sensor interface connectable to the one or more sensors, the sensor interface being configured to receive signals from the
one or more sensors when the sensor interface is connected to the one or more sensors, wherein the one or more sensors are
selected from an electromyography sensor, an evoked potential sensor, a joint angle sensor, a flex sensor, an accelerometer,
a gyroscope sensor, a flow sensor, a pressure sensor, a load sensor, a temperature sensor, or a combination thereof;

at least one processor connected to both the stimulation assembly and the sensor interface, the at least one processor being
configured to direct the stimulation assembly to deliver at least one complex stimulation pattern to the selected ones of
the plurality of electrodes, and to receive the signals from the sensor interface, the at least one processor being further
configured to modify the at least one complex stimulation pattern by performing a machine learning method implementing a Gaussian
Process Optimization operable to determine the stimulation parameters delivered by the stimulation assembly based on the signals
received from the sensor interface.

US Pat. No. 9,242,014


The Regents of The Univer...

1. An isolated scFv antibody comprising an amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2, wherein the scFv binds to

US Pat. No. 9,226,850


The Regents of the Univer...

1. A device for forming an opening in the trabecular meshwork of the eye of a subject, said device comprising:
an elongate probe having a distal end that is insertable into the anterior chamber of the eye;
a member extending from the distal end of the elongate probe, said member having opposing upper and lower sides; and
a cutting or ablating apparatus is located adjacent to the upper side of the member;
said member being insertable, while the elongate shaft extends through the anterior chamber of the eye, into the Schlemm's
canal such that the member is advanceable through a portion of Schlem's canal with the cutting or ablating apparatus cutting
or ablating trabecular meshwork tissue as the member is being so advanced.

US Pat. No. 9,055,878


The Regents of the Univer...

1. A method of reconstructing cardiac activation information, the method comprising:
accessing pairs of cardiac signals out of a plurality of cardiac signals obtained from a patient, the pairs having a first
cardiac signal that is common among the pairs and second cardiac signals that are different among the pairs;

processing the first cardiac signal and the second cardiac signals of the pairs to determine whether there are points of change
in the first cardiac signal at which a derivative of the first cardiac signal diverges with respect to derivatives of the
second cardiac signals above a threshold; and

assigning an activation onset time at a point in the first cardiac signal based on correspondence of the points of change
to define a cardiac activation indicating a beat if the points of change are in the first signal.

US Pat. No. 9,240,529


The Regents of the Univer...

1. A light emitting device, comprising:
an LED chip emitting light at a first wavelength, wherein the emitted light is extracted from both front and back sides of
the LED chip;

a lead frame to which the LED chip is attached, wherein the LED chip resides on or above a transparent plate in the lead frame
that allows the emitted light to be extracted out of the LED chip through the transparent plate in the lead frame; and

a phosphor for converting the light emitted by the LED chip at the first wavelength to a second wavelength.

US Pat. No. 9,274,181


The United States of Amer...

1. An optical fiber, having at least one fiber Bragg grating therein, for magneto-optic field coupling, comprising:
at least an inner core and a cladding surrounding the inner core; and,
an optical interrogation system that provides a propagating electromagnetic wave within the fiber to measure the optically
based change of index of refraction within the optical fiber;

wherein at least a portion of the inner core, the cladding, or a combination thereof comprises at least a portion of ferromagnetic
particles adjacent to the at least one fiber Bragg grating, so that the ferromagnetic particles are exposed to the propagating
electromagnetic wave in an amount sufficient to modify the optical index of refraction when the fiber is exposed to a magnetic

US Pat. No. 9,305,780



1. A method for depositing silicon on a semiconductor or metallic surface, the method comprising:
cycling dosing of silane and chlorosilane precursors at a temperature between 50° C. and 300° C.;
continuing cycling until the deposition self-limits via termination of surface sites with Si—H groups; and
after self-termination, raising the temperature and depositing additional silicon.

US Pat. No. 9,296,988


The Regents of the Univer...

1. A cell adhesion matrix prepared by the process comprising:
contacting a plurality of poly(vinyl alcohol) chains and at least one boronic acid crosslinker having at least two boronic
acids in a mixture, under conditions such that each boronic acid becomes linked to two adjacent hydroxy groups of one of the
plurality of poly(vinyl alcohol) chains,

the boronic acid crosslinker is of formula I:

Linker comprises a biocompatible polymer selected from the group consisting of a poly(propylene glycol) polymer and a poly(ethylene
glycol) polymer of the following formula:

X1 and X2 are each independently selected from the group consisting of a bond, a branching moiety, lysine and a lysine derivative; and

subscript p is from about 10 to about 500;
subscript m is from about 1 to about 100; and
each poly(vinyl alcohol) shain is of formula II:

wherein subscript n is from about 10 to about 5000.
US Pat. No. 9,297,008


The Regents of the Univer...

1. An isolated composition comprising a double stranded small activating RNA (saRNA) molecule of 19 base pairs in length,
wherein the saRNA molecule comprises a first ribonucleic acid strand comprising the sequence of SEQ ID NO:32, wherein the
saRNA molecule increases expression of the VEGF gene when introduced into a cell.
US Pat. No. 9,295,983



2. A catalytic process comprising reducing an organic molecule by contacting the organic molecule with (a) a complex or the
metal colloid of claim 1 and (b) a reductant;wherein the complex comprises:
(i) a metal colloid comprising a plurality of iridium atoms; and
(ii) a calixarene-related compound comprising a linker, wherein the linker comprises a coordinating atom coordinated to one
of the plurality of iridium atoms.

US Pat. No. 9,295,133


The Regents of the Univer...

1. An electro-optic device, comprising:
a first electrode;
a second electrode spaced apart from said first electrode;
an active layer disposed between said first electrode and said second electrode; and
an interfacial layer in contact with said active layer,
wherein said interfacial layer comprises a blend of a metal oxide and a salt in a ratio, by volume, of at least 1:0.1 and
less than 1:1.2.

US Pat. No. 9,222,142


The Regents of the Univer...

1. A method of detecting a baboon adenovirus type 3 (BaAdV-3) or a baboon adenovirus type 2/4 (BaAdV-2/4) infection in a subject,
the method comprising the steps of:
(a) obtaining a sample from a subject suspected of having an infection caused by BaAdV-3or BaAdV-2/4, wherein the sample comprises
antibodies from the subject;

(b) contacting the sample of step (a) with a full-length BaAdV-3 or BaAdV-2/4 polypeptide(s) encoded by SEQ ID NO 1 , SEQ
ID NO: 2 or SEQ ID NO: 3,

(c) screening for antibodies bound to a full length polypeptide;
wherein antibody binding confirms the BaAdV-3 or the BaAdV-2/4 infection.

US Pat. No. 9,333,259


The Regents of the Univer...

1. A method for selective fat removal in a target area, comprising:
applying a solution of photo-absorbing biocompatible nanoparticles to the target area, wherein the nanoparticles are dimensioned
to have an aspect ratio in the range of 1:3 to 1:5;

delivering near infrared light to the target area and solution for an exposure duration to induce surface plasmon resonance,
wherein the near infrared light has a combination of optical parameters selected from the group consisting of emission wavelength,
emission intensity, beam focus and a beam size, the optical parameters and the exposure duration selected to excite the nanoparticles
to melt and liquefy fat within the target area with minimal damage to tissue surrounding the target area; and

aspirating liquefied fat from the target area.

US Pat. No. 9,299,940


The Regents of the Univer...

1. A device comprising:
a polymer substrate, the polymer substrate defining a mesh structure;
a gate electrode disposed on the polymer substrate;
a dielectric layer disposed on the gate electrode and on exposed portions of the polymer substrate;
a carbon nanotube network disposed on the dielectric layer; and
a source electrode and a drain electrode disposed on the carbon nanotube network.

US Pat. No. 9,281,206



1. A method for guided electroless etching to form a cut in a material, comprising:
forming a patterned mask on a substrate to partially cover the surface of the substrate while exposing one or more selected
regions on the surface of the substrate to be removed by etching;

depositing an etcher layer of a first catalyst material on each exposed surface of the selected regions of the substrate,
a guide layer of a magnetic material on the etcher layer, and a protection layer of a second catalyst material on the guide
layer, wherein the etcher layer, guide layer and protection layer form a composite etching structure;

etching the substrate by applying an etching solution to the substrate that chemically reacts with the etcher layer and etches
material from the substrate at each selected region not covered by the patterned mask to form a sliced region;

steering the composite etching structure into the substrate during the etching by an applied magnetic field that creates a
force on the guide layer to direct a direction of the etching, wherein the steering defines the shape of the sliced region
of the etched substrate; and

removing the etched material, the patterned mask, and the composite etching structure from the substrate to produce a sliced
material structure.

US Pat. No. 9,102,609


The Regents of the Univer...

1. A method to convert an alkane to an alcohol or carboxylic acid by contacting the alkane with a catalytically active heterogeneous
vanadium containing metal organic framework (MOF) in the presence of an oxidant, wherein the vanadium containing MOF comprises
a plurality of repeating cores comprising vanadium or vanadium ion(s) that are linked together by organic linking moieties.

US Pat. No. 9,222,943



1. An isolated MS-cleavable cross-linker for proteins and protein complexes, the cross-linker having two symmetric collision-induced
dissociation (CID) cleavable sites and the formula:

where X is selected from the group consisting of:

 wherein R is H, methyl or ethyl.

US Pat. No. 9,386,676



1. An apparatus for containing plasma comprising
a generally cylindrical chamber,
a first means for creating a magnetic field within the chamber having a field reserved topology,
a second means for creating an electrostatic well within the chamber, and
a third means for injecting plasma into the chamber.
US Pat. No. 9,045,387


The Regents of the Univer...

1. A method to connect aryls by homocoupling comprising contacting a porous metal organic framework (MOF) or a porous metal
organic polyhedral (MOP) with boronic acid substituted aryls wherein the MOF or MOP catalyze the synthesis of a biaryl through
a homo-coupling reaction, wherein the MOF or MOP comprises a plurality of linking moieties that have a substructure selected
from the group consisting of (C1-C20)alkyl, (C3C20)cycloalky, aryl, (C1-C20)alkylamine, arylamine, and heterocycle; and wherein the substructure has one or more covalently attached CO2H linking clusters that undergo condensation with a copper metal and wherein the MOF or the MOP comprise open copper centers
that are mono-dispersed throughout the pores.

US Pat. No. 9,370,086



1. A method of forming a field reversed configuration (FRC) magnetic field about a plasma of charged particles comprising
the steps of
creating a magnetic guide field within a cylindrical chamber having a longitudinal axis, wherein the magnetic guide field
having field lines axially extending within the chamber parallel to the longitudinal axis,

injecting a plasma of charged electron and ion particles into the chamber toward a midplane of the chamber,
generating an azimuthal electric field within the chamber coupling to the charged electron and ion particles of the plasma
causing ponderomotive forces causing the charged electron and ion particles to accelerate and the plasma to rotate within
the chamber and form a magnetic poloidal self field surrounding the rotating plasma due to the rotating plasma's current,
thereby creating and rapidly increasing an axial magnetic flux within the chamber, and increasing a current running through
a betatron flux coil concentric with a principle axis of the chamber,

increasing the rotating plasma's rotational energy to increase the self-field's magnitude to a level that overcomes a guide
field axially extending within the chamber causing the formation of a magnetic field within the chamber with field reversed

US Pat. No. 9,079,189



1. An apparatus for sorting cells or particles by light induced dielectrophoresis (DEP), the apparatus comprising:
(a) a fluidic chamber having a first surface and a second surface configured for retaining in the fluidic chamber a liquid
containing a population of particles or cells to be sorted;

(b) a photoconductive area on said first or said second surface configured for conversion of received light to a local electric
field in the vicinity of the received light;

(c) an inlet configured for receiving a sample liquid containing a population of particles or cells to be sorted; and
(d) a plurality of outlet channels spaced-apart at relative distances in relation to the position of the photoconductive area
of the fluidic chamber;

(e) wherein the particles or cells are retrievable through specific outlet channels in the plurality of outlet channels as
a function of response to the electric field;

(f) wherein a specific outlet channel through which a said particle or cell is retrievable is indicative of relative magnitude
of the response of the particle or cell to the electric field; and

(g) an extraction port configured for manual extraction of a particle or cell from the fluidic chamber using a micropipette.

US Pat. No. 9,045,474


The Regents of the Univer...

1. A method of mitigating tissue damage, genetic instability, or lethality induced by radiation or a chemical carcinogen in
a cell, the method comprising contacting the cell with a compound having a structure of Formula IA
or a pharmaceutically acceptable salt thereof.

US Pat. No. 9,281,183


The Regents of the Univer...

13. A method of fabricating a III-nitride semiconductor device, comprising:
growing a III-nitride semiconductor layer and an oxide sequentially to form an oxide/III-nitride interface, without exposure
to air in between growth of the oxide and growth of the III-nitride semiconductor layer, wherein a density of trap states
at the oxide/III-nitride interface is less than 1011 cm2.

US Pat. No. 9,360,428


The Regents of the Univer...

1. An optical microscopy method for noninvasive imaging of a biological tissue, comprising:
wavefront shaping using interferometric focusing to compensate for light scattering, wherein the interferometric focusing
focuses light onto a guide-star in a biological tissue to illuminate the guide-star, wherein the guide-star is used for refractive
and interferometric refocusing of the scattered light in the biologic tissue to correct for refractive phase aberrations and
to shape the wavefront for un-scattering the scattered light inside the biological tissue;

measuring fluorescence from the illuminated guide-star using direct wavefront sensing;
wavefront shaping using geometric focusing based on the measured fluorescence from the guide-star to correct for refractive
aberrations; and

applying the combined interferometric and geometric wavefront shaping in the optical microscopy method.
US Pat. No. 9,295,715


The Regents of the Univer...

1. A method for treating ileus, the method comprising:
administering into the lumen of an intestine of an individual a first therapeutic dose comprising a protease inhibitor; and
administering to an abdominal cavity of the individual a second therapeutic dose comprising a combination of the same protease
inhibitor used in the first therapeutic dose and an antibacterial compound.

US Pat. No. 9,121,852



1. A method for the preventative or curative treatment of familial adenomatous polyposis (FAP) or neuroblastoma in a patient
a) obtaining results from a test that determines the patient's genotype at position +316 of at least one ODC1 promoter gene
allele; and

b) if the results indicate that the patient's genotype at position +316 of at least one allele of the ODC1 promoter gene is
G, administering to the patient effective amounts of a pharmaceutical therapy comprising:

(i) a first agent that inhibits ornithine decarboxylase (ODC) within the patient; and
(ii) a second agent that modulates the polyamine pathway to reduce overall polyamine content within the patient when combined
with the first agent.

US Pat. No. 9,233,068


OTONOMY, INC., San Diego...

1. A sterile aqueous pharmaceutical composition for use in the treatment of an otic disease or condition comprising a thermoreversible
gel and a micronized and non-microencapsulated antimicrobial agent,
wherein the thermoreversible gel has a gelation temperature between about room temperature and about body temperature; a non-gelation
viscosity that allows injection at or about room temperature with a needle having a gauge in the range of 18-31; and a gelation
viscosity between about 15,000 cP and about 1,000,000 cP; and

wherein the composition provides sustained release of the antimicrobial agent into the ear for a period of at least 5 days.

US Pat. No. 9,304,234


The Regents of the Univer...

1. An apparatus comprising:
a plasmonic condenser for generating surface plasmon at an evanescent wave surface, the plasmonic condenser comprising:
a substrate layer;
a metal layer comprising the evanescent wave surface; and
a media layer disposed between the metal layer and the substrate layer, the media layer comprising a source of radiation,
the radiation interacting with the metal layer to create surface plasmons that are not substantially optically detectable
as far field radiation until an interfering object is brought into proximity with the evanescent wave surface, the interfering
object causing coupling of at least some of the surface plasmons into propagating radiation detectable by an objective lens,
the media layer further comprising at least one of a light emitting diode or an organic light emitting diode that emits the
radiation at one or more wavelengths upon experiencing an applied voltage, the radiation being directly coupled into the surface

US Pat. No. 9,302,025


The Regents of the Univer...

1. A device containing a hemostatic composition, the device comprising:
a sterile container; and
a hemostatic composition comprising a hemostatically effective amount of a wet layered clay selected from the group consisting
of a kaolin, a palygorskite and a sepiolite, wherein the clay is not vitrified, and wherein the hemostatic composition is
provided in the sterile container, is hydrated from 0.5 wt. % to 30 wt. %, and does not include a zeolite.

US Pat. No. 9,300,010


The Regents of the Univer...

1. A solid lithium electrolyte comprising:
a metal-organic framework comprising Mg2(dobdc), wherein dobdc=1,4-dioxido-2,5-benzenedicarboxylate; and

a lithium alkoxide comprising lithium isopropoxide (LiOiPr).

US Pat. No. 9,099,641



1. A magnetoelectric junction comprising:
a ferromagnetic fixed layer;
a ferromagnetic free layer that is magnetically anisotropic;
a first dielectric layer interposed between the ferromagnetic fixed layer and the ferromagnetic free layer; and
a second dielectric layer disposed proximate the ferromagnetic free layer;
wherein the ferromagnetic fixed layer is magnetically polarized in a first direction;
wherein the ferromagnetic free layer has a first easy axis that is substantially aligned with the first direction, such that
the ferromagnetic free layer can adopt a magnetic polarity that is either parallel with or antiparallel with the first direction;

wherein the magnetoelectric junction is configured such that when a potential difference is applied across the magnetoelectric
junction, the magnetic anisotropy of the ferromagnetic free layer is altered such that the relative strength of the magnetic
anisotropy along a second easy axis that is orthogonal to the first easy axis, or the easy plane where there is no easy axis
that is orthogonal to the first easy axis, as compared to the strength of the magnetic anisotropy along the first easy axis,
is magnified or reduced for the duration of the application of the potential difference;

wherein the extent of the magnification or reduction of the relative strength is enhanced by the presence of the second dielectric

US Pat. No. 9,255,290


The Regents of the Univer...

2. A method for amplifying a target nucleic acid sequence contained in a sample that consists of or contains one or more nucleic
acid(s), said method comprising the steps of:
a) treating, the sample with primers for the target sequence under conditions that produce a primer extension product that
is complementary to the target nucleic acid sequence;

b) performing the method of claim 1 to separate the primer extension product from the nucleic acid on which it was synthesized, thereby producing a single-stranded
intermediate product; and

c) treating the single-stranded intermediate product with the primers under annealing conditions to cause a further primer
extension product to be produced.

US Pat. No. 9,446,306



1. A system for local multiplayer gaming comprising a plurality of mobile devices including an individual mobile device of
the plurality of mobile devices designated as a server device and other mobile devices of the plurality of mobile devices
designated as client devices, wherein the client devices include more than two mobile devices, each mobile device comprising:
a display;
at least one local network interface for communication with each of the other mobile devices; and
a processor programmed for
playing a multiplayer game with other mobile devices; and
rendering on the display a game situation directly corresponding to a command or information transmitted by the server device
to an individual client device or transmitted by an individual client device to the server device or another client device;

wherein each individual mobile device of the plurality of mobile devices is configured to overhear a command or information
transmitted by each of the other mobile devices of the plurality of mobile devices to the server device or to an individual
client device and direct-input render on the display of each mobile device a game situation corresponding directly to the
overheard command or information, wherein a command or information transmitted by the server to an individual client device
or by an individual client device to the server device or to another individual client device is overhearable by each of the
other mobile devices of the plurality of mobile devices that are not the recipient of the transmitted command or information,
and wherein a game situation directly corresponding to the overheard command or information is direct-input renderable on
the display of each of the plurality of mobile devices.

US Pat. No. 9,327,036


The Regents of the Univer...

1. A composition comprising: a live cell that has no cell wall, wherein the cell has a surface comprising a native functional
group linked to a nucleic acid moiety, wherein the nucleic acid moiety is covalently linked directly to the native functional
group, wherein the native functional group comprises an amino acid selected from the group consisting of lysine, cysteine,
tyrosine, threonine, serine, aspartic acid, glutamic acid and tryptophan, and wherein the cell has not undergone metabolic
engineering to introduce an azide modified sugar.
US Pat. No. 9,296,798


Florida State University ...

1. A test for detecting a cashew allergy in a patient, said test comprising contacting the skin of a patient with a composition
comprising at least one purified polypeptide sequence selected from the group consisting of SEQ ID NOs: 3-14, and 15 and detecting
whether the patient exhibits an allergic response indicative of a cashew allergy to the at least one polypeptide sequence.

US Pat. No. 9,249,170


California Institute of T...

1. A compound, wherein the compound is
(A) a compound of Formula I:

wherein, independently for each occurrence,
X is, independently for each occurrence, alkoxy or halo;
R2 is, independently for each occurrence, alkyl;

R3 is alkyl;

R4 is alkyl, aryl, heteroaryl, aralkyl, or heteroaralkyl;

or R3 and R4, taken together with the carbon atom to which they are attached, form a five-, six-, or ten-membered cycloalkyl or heterocyclyl

R5 is alkyl;

R6 is H or alkyl, provided that (i) R5 and R6 are not the same, and (ii) R6 has fewer atoms than R5; and

R7 is alkyl;

(B) a compound of Formula II:

wherein, independently for each occurrence,
X is, independently for each occurrence, alkoxy or halo;
R2 is, independently for each occurrence, alkyl;

R3 is alkyl;

R4 is alkyl, aryl, heteroaryl, aralkyl, or heteroaralkyl;

or R3 and R4, taken together with the carbon atom to which they are attached, form a five-, six-, or ten-membered cycloalkyl or heterocyclyl

R5 is, independently for each occurrence, alkyl; and

R7 is alkyl;

(C) a compound of Formula III:

wherein, independently for each occurrence,
X is, independently for each occurrence, alkoxy or halo;
R2 is alkyl;

R3 is alkyl;

R5 is, independently for each occurrence, methyl or ethyl;

R7 is alkyl; and

R8 is aryl or heteroaryl; or

(D) a compound of Formula IV:

wherein, independently for each occurrence,
X is, independently for each occurrence, alkoxy or halo;
R2 is alkyl;

R3 is alkyl;

R5 is, independently for each occurrence, alkyl;

R7 is alkyl; and

R9 is C2-C6 alkyl;

or R3 and R9, taken together with the carbon atom to which they are attached, form a five-, or ten-membered cycloalkyl or heterocyclyl

US Pat. No. 9,272,034


The Regents of the Univer...

1. A method for prevention or treatment of physiological shock in an individual comprising administering to the lumen of an
intestine of the individual a therapeutic dose of a combination of a pancreatic digestive enzyme inhibitor, a cytotoxic mediator
inhibitor, an MMP inhibitor, and an antibacterial agent.

US Pat. No. 9,267,891


The Regents of the Univer...

1. A method for using spatially distributed interferometric excitation in an optical diagnostic instrument, comprising:
using a multi-mode interferometer (MMI) to create a wavelength dependent excitation pattern in a fluidic channel in direct
contact with the MMI, wherein the excitation pattern includes a wavelength-dependent number, k, of light spots in the fluidic

causing a fluorescent or light scattering particle to flow in the channel past the MMI and the entire excitation pattern so
as to produce k fluorescence or light scattering pulses at time steps ?t, wherein ?t depends on the spacing of the light spots
in the fluidic channel;

detecting the k fluorescence or light scattering pulses and producing a measured detector signal S(t); and
identifying the fluorescent or light scattering particle based on a predefined algorithm and the measured detector signal

US Pat. No. 9,076,104


The Regents of the Univer...

1. A method, comprising executing computer executable instructions by one or more processors for predicting gene expression
profile changes upon inhibiting proteins or genes of drug targets on treating a disease, the method further comprising:
constructing a genetic network comprising a structure of a dynamic Bayesian network based at least in part on knowledge of
drug inhibiting effects on a disease;

associating a set of parameters with the constructed dynamic Bayesian network;
determining values of a joint probability distribution of the dynamic Bayesian network via an automatic procedure;
deriving a mean dynamic Bayesian network with one or more averaged parameters based at least in part on the joint probability
values; and

calculating a quantitative prediction based at least in part on the mean dynamic Bayesian network,
wherein said method searches for an optimal combination of drug targets whose perturbed gene expression profiles are most
similar to healthy cells.

US Pat. No. 9,305,166


The Regents of the Univer...

1. A method for detecting a timing channel in a hardware design, the method comprising:
receiving a hardware design;
synthesizing at least one portion of the hardware design with gate level primitives;
adding tracking logic to the gate level primitives to monitor information flow through the gate level primitives;
simulating sets of inputs to the gate level primitives including added taint inputs to identify information flows by generating
outputs from the gate level primitives for every clock tick while changing only taint inputs;

isolating timing flows from information flows by conducting input-to-output deterministic traces to isolate functional flows
in the information flows.

US Pat. No. 9,301,976


The Regents of the Univer...

1. A method of treating or ameliorating a medical condition, comprising
sorting a population of cells to obtain sorted perivascular stem cells identified by CD146, CD45, and CD34 antibodies as CD146?CD34+CD45?
(adventitial cells) or CD146+CD34?CD45?(pericytes), and

administering to a subject:
the sorted adventitial cells or pericytes: or
a composition comprising the sorted adventitial cells or pericytes;
wherein the medical condition is associated with an injured or diseased tissue or organ, or wherein the medical condition
is associated with a tissue or organ damaged by a disease or pathogen.

US Pat. No. 9,289,280


The Regents of the Univer...

1. A vascular filter device, comprising:
a frame having a plurality of ellipses each having a major axis and a minor axis, with the major axes of each ellipse overlapping
one another in a proximal and distal direction such that the plurality of ellipses share a single major axis; and

a web having a circumference that is positioned within the plurality of ellipses;
wherein the plurality of ellipses expand away from the shared major axis, such that the web is held taut along the circumference
and is substantially perpendicular to the shared major axis when the plurality of ellipses are in an expanded state.

US Pat. No. 9,271,665



1. A fabric-based pressure sensor array, comprising:
a first layer including M elongated conductive strips coated thereon;
a second layer including N elongated conductive strips coated thereon, the M elongated conductive strips extending crosswise
relative to the N elongated conductive strips to define M x N intersections; and

a unitary textile sheet extending between the first layer and the second layer so as to overlap the M×N intersections, the
textile sheet having a variable resistivity in response to applied pressure so as to define M×N pressure sensors at locations
corresponding to the M×N intersections.

US Pat. No. 9,302,070


Genzyme Corporation, Cam...

1. A stepped cannula configured for delivering one or more materials to the brain of a subject, wherein the cannula has an
exterior diameter, a distal end, a proximal end and a lumen extending between the proximal and distal ends, the stepped cannula
one or more tubular components extending through the lumen of the cannula,
two or more co-axially disposed segments, each segment having an exterior diameter that defines the exterior diameter of the

wherein the exterior diameter of the segments is different, and further wherein a surface of the cannula which comes into
contact with the material to be delivered is composed of fused silica.

US Pat. No. 9,248,447


The Regents of the Univer...

1. A blood collection tube for separation of whole blood into a cell-depleted phase and a cell-enriched phase comprising:
a polymerizable composition having a predetermined density and flowability effective to allow sedimentation of the composition
under a centrifugal force to a position between the cell-depleted phase and the cell-enriched phase;

wherein the polymerizable composition has a composition effective to retain the predetermined flowability during irradiation
sterilization, and to allow subsequent UV curing to a hardness of at least 10 on a Shore A hardness scale within ten minutes.

US Pat. No. 9,304,094



1. A method of co-functionalizing single-walled carbon nanotube interconnects for gas sensors, the method comprising:
fabricating by alignment single-walled carbon nanotube interconnects;
synthesizing discrete tin oxide nanocrystallites onto a surface of the single-walled carbon nanotube interconnects by electrodeposition;

synthesizing metal nanoparticles onto the discrete tin oxide nanocrystallites and the surface of the single-walled carbon
nanotube interconnects by electrodeposition, and

wherein an overall sensitivity of the gas sensor is enhanced compared to other single-walled carbon nanotube gas sensors.

US Pat. No. 9,305,677


The Regents of the Univer...

1. A method comprising:
(a) providing boron oxide and carbon fiber, the carbon fiber having a circular cross-section;
(b) heating the boron oxide to melt the boron oxide and heating the carbon fiber;
(c) mixing a nitrogen-containing gas with boron oxide vapor from molten boron oxide; and
(d) converting a portion of the carbon fiber proximate a perimeter of the circular cross-section of the carbon fiber to boron
nitride, the boron nitride having a thickness of about 10 nanometers to 1.5 microns.

US Pat. No. 9,238,661



1. A method of making an organoboron compound, comprising a reaction described by one of the following schemes:

wherein X1 is O, N, S, or C, wherein each of R, R1, R2, R3, R4, and R5 are independently selected from: H, a carbonyl functional group, a carbocycle group, a heterocycle, a halide, or an alkyl
group, wherein, optionally, R1 and R2 together with the carbon atoms they are attached to form a C1 to C10, aromatic or non-aromatic, cyclic moiety, wherein X2 is catecholate, pinacolate, ethylene glycolate, 1,3-propanediolate, N-methyliminodiacetate, 2,2?-azanediyldiethanolate, fluoride,
or chloride, wherein n is 0 to 8, wherein y is from 1 to 3, wherein X3 is C, O, N, or S, and wherein X4 is a halogen, trifluoroacetic acid (TFA), tosylate (OTs), mesylate (OMs), or triflate (OTf);

wherein the reagent in each Scheme (1) to (25) is reacted with a salt of BX2 to form the organoboron compound(s) shown in each Scheme (1) to (25.

US Pat. No. 9,303,258


The Regents of the Univer...

1. A composition comprising a nucleotide sequence selected from the group consisting of:
(i) loop “a” of U1 snRNA consisting of GGGAGAACCAUGAUCACGAAGGUGGUUUUCCC (SEQ ID NO:2);
(iii) a fragment of a loop “c” of U1 snRNA consisting of 10-26 nucleotides of CGAUUUCCCCAAAUGUGGGAAACUCG (SEQ ID NO:4);
(iv) any of the foregoing sequences wherein U is T;
(v) complements of any of the foregoing sequences;
(vi) any of the foregoing sequences comprising a non-natural nucleotide; and
(vii) an oligonucleotide having 99% identity with any of the foregoing sequences wherein the oligonucleotide can stimulate
IL-6 and/or TNF ? production in a mammalian cell,

wherein the nucleotide sequence is chemically linked to a charge neutralizing agent and wherein the composition comprises
a pharmaceutically acceptable carrier.

US Pat. No. 9,290,474


The Regents of the Univer...

1. A method for producing compounds of the formulae

the method comprising esterification of Merulin A.

US Pat. No. 9,266,076



1. A device for generating droplets comprising:
a substrate comprising a reservoir site configured to hold a liquid and comprising a first electrode, a droplet creation site
comprising a second electrode, and a droplet separation site comprising a third electrode disposed between the reservoir site
and the droplet creation site, wherein the first electrode is larger than the second electrode and third electrode;

control circuitry operatively coupled to the second electrode, the control circuitry configured to repeatedly measure capacitance
at the second electrode, the control circuitry further being configured to compare the measured capacitance to a first threshold
value C1 and a second threshold value C2, wherein when the measured capacitance is below the first threshold value the control circuitry applies a high voltage to
the second electrode and a low or zero voltage to the first electrode, and wherein the measured capacitance is above the first
threshold value C1 and the second threshold value C2, the control circuitry applies a low or zero voltage to the second electrode and a high voltage to the first electrode, and
wherein the measured capacitance is above the first threshold value C1 and below the second threshold value C2, the control circuitry applies a high voltage to the second electrode and a high voltage to the first electrode.

US Pat. No. 9,255,260


Wisconsin Alumni Research...

1. An engineered pancreatic ribonuclease A variant comprising an amino acid sequence which differs from the amino acid sequence
of SEQ ID NO:1 solely by four to seven amino acid substitutions, wherein at least one of the four to seven amino acid substitutions
is at a position corresponding to any one of positions 85-94 of SEQ ID NO:1, wherein at least three of the four to seven amino
acid substitutions are at positions corresponding to positions 7, 31, 38, 39, 41, or 67 of SEQ ID NO:1, wherein if the engineered
pancreatic ribonuclease A variant has an amino acid substitution at a position corresponding to position 41 of SEQ ID NO:1,
said amino acid substitution corresponds to the amino acid substitution K41A of SEQ ID NO:1, and wherein the engineered pancreatic
ribonuclease A variant has ribonuclease activity.

US Pat. No. 9,205,423


California Institute of T...

1. A method of priming a microfluidic device with a liquid material, the method comprising:
loading a plurality of wells on an upper surface of a microfluidic device with a liquid material;
biasing a holder piece against the upper surface such that a continuous raised rim of the holder piece presses against the
upper surface surrounding the wells, such that a chamber is created over the wells; and

applying a positive pressure to the chamber to drive the material from the wells into an active area of the microfluidic device.

US Pat. No. 9,403,915


The Regents of the Univer...

1. A composition comprising (a) a first liquid phase comprising a water-miscible ionic liquid (IL), a ketone, and a biomass,
lignin, cellulose, or lignocellulosic biomass (LBM); and (b) a solid or second liquid phase comprising an alcohol; wherein
the composition has a molar ratio X:Y:Z:: ketone: the alcohol: the IL, wherein the molar ratio X:Y:Z is defined by the area
labeled “Porous Solid+Liquid” in FIG. 3.
US Pat. No. 9,290,796


The Regents of the Univer...

1. A method of identifying the presence of a wastewater bacterial type in a sample, comprising the following steps:
isolating bacterial DNA from the sample;
performing a PCR amplification reaction which includes the bacterial DNA and PCR primers comprising SEQ ID 1 and SEQ ID 2;
collecting the amplification product from the PCR amplification reaction and incubating it, under hybridizing conditions,
with one or more wastewater bacterial identification probes; and

assaying for the hybridization of the one or more wastewater bacterial identification probes to the amplification product,
wherein the detectable hybridization of a wastewater bacterial identification probe to an amplification product is indicative
of the presence of that probe's corresponding wastewater bacterial type being present in the sample.

US Pat. No. 9,155,398



1. A heating and cooling system for a seat, said system comprising:
(a) a seat body with at least one plenum, said plenum having one or more plenum openings;
(b) a plurality of fans configured to create an airstream in said plenum;
(c) a moisture-permeable material covering said plenum openings;
(d) at least one heating source; and
(e) a power supply for powering said heating source and said fans;
(f) wherein said airstream cools said moisture-permeable material of said seat body by convective and evaporative heat exchange.

US Pat. No. 9,078,738


Lawrence Livermore Nation...

1. A device comprising:
a vascular stent, to be implanted in a patient, including first and second windows along a central lumen of the stent, the
first and second windows respectively including first and second shape memory polymer (SMP) struts that each include SMP having
a first state and a second state;

a SMP foam, coupled to the first and second SMP struts, having a first state and a second state;
a core, included in the central lumen of the stent and directly contacting an inner surface of the first strut but not directly
contacting an outer surface of the first strut, to provide structural support to the first and second SMP struts during advancement
of the stent within vasculature of the patient; and

an outer portion of a heating system that directly contacts an inner portion of the core;
wherein (a) in a first position the vascular stent is configured to be located, with the first and second SMP struts in the
first state and the SMP foam in the first state, proximate to a vascular aneurysm; (b) in a second position the SMP foam is
configured to be expanded to the second state, radially outward from the first and second SMP struts and into the vascular
aneurysm, based on heat from the heating system; and (c) in a third position the first and second SMP struts are configured
to be expanded to the second state, proximate to the vascular aneurysm, based on heat from the heating system;

wherein (d) the inner surface of the first strut is between the core and the first strut and the outer surface of the first
strut is between the first strut and the SMP foam, and (e) the inner portion of the core is between the heating system and
the core and an outer portion of the core is between the core and the stent.

US Pat. No. 9,234,017


The Regents of the Univer...

wherein the peptide is up to 20 amino acids in length, and
X1 is Val (V) or Ile (I),

X2 is Asp (D),

X3 is Val (V), Ile (I), or Gly (G),

X4 is Leu (L) or Ile (I),

X5 is Met (M) or Ser (S),

and X6 is Leu (L), Val (V), or Ala (A).

US Pat. No. 9,174,213


Lawrence Livermore Nation...

1. A method of passive sorting of microdroplets of uniform size, comprising the steps of:
providing a main flow channel,
directing a sample material and reagents into said main flow channel,
directing a carrier fluid into said main flow channel thereby providing a flow stream of microdroplets in said main flow channel
wherein said microdroplets have substantially the same diameter and wherein said droplets include first microdroplets containing
said sample material and second microdroplets that do not contain said sample material,

amplifying said microdroplets in said flow stream of microdroplets resulting in said flow stream of microdroplets having been
amplified so that it includes said first microdroplets containing said sample material having a first degree of stiffness
and said second microdroplets that do not contain said sample material having a second degree of stiffness wherein said second
degree of stiffness is less than said first degree of stiffness,

providing a second flow channel connected to said main flow channel for said second microdroplets that do not contain said
sample material having a second degree of stiffness, and

providing a separator for separating said second microdroplets that do not contain said sample material having a second degree
of stiffness from said first microdroplets containing said sample material having a first degree of stiffness and directing
said second microdroplets that do not contain said sample material having a second degree of stiffness into said second flow

US Pat. No. 9,303,068


The Regents of the Univer...

1. An isolated, modified peptidoglycan (PG) comprising at least one modified D-amino acid chemically conjugated to a reagent
via a heterocycle, wherein the modified D-amino acid is an azide-modified, an alkyne-modified, or a norbornene-modifed D-amino
acid, and the reagent is an azide-containing reagent, an alkynyl reagent or a norbornene-reactive reagent.

US Pat. No. 9,291,557



1. A mercury detection system comprising:
a flow cell comprising a mercury sensor, wherein the mercury sensor comprises:
a transparent substrate; and
a submonolayer of spherical gold nanoparticles on a surface of the substrate, wherein the spherical gold nanoparticles are
substantially free of a surface coating;

a light source that directs light from the light source to the mercury sensor;
a light detector that detects a localized surface plasmon resonance (LSPR) signal from the spherical gold nanoparticles; and
a heat source that heats the mercury sensor to regenerate the mercury sensor,
wherein the system determines whether mercury is present in a sample based on a rate of change of the detected LSPR signal
from the spherical gold nanoparticles.

US Pat. No. 9,065,093


Massachusetts Institute o...

1. An electrode, comprising:
a matrix material comprising high-tortuosity pores having tortuosities of at least 2; and
a plurality of low-tortuosity pores having tortuosities of less than 1.5 extending through the matrix material and from a
first external geometric surface of the electrode to a second external geometric surface of the electrode, wherein:

the electrode has a total porosity of from 20% to 60%, and
the percentage of the total porosity that is occupied by the low-tortuosity pores is from 20% to 80%.
US Pat. No. 9,301,947


The Regents of the Univer...

1. A method of treating a T-cell mediated skin disorder in a patient, the method comprising administering to the patient a
pharmaceutical composition comprising a ryanodine receptor (RyR) inhibitor and a pharmaceutically acceptable carrier, in the
amount and form that is effective to treat or prevent the disease or disorder, wherein the RyR inhibitor is selected from
the group consisting of a natural ryanoid, a synthetic ryanoid, and ryanodine.

US Pat. No. 9,297,801


The Regents of the Univer...

1. A method of forming a sensor, comprising the steps of:
(A) providing an electromagnetic radiation source having a wavelength between 350 nm and 1075 nm;
(B) providing a plurality of nanoparticle aggregates, wherein each of the nanoparticle aggregates comprise a diameter between
60 nm and 200 nm, a metallic molecular core, a sulfur-oxygen shell having a surface in contact with the core;

(C) providing a notch filter, the notch filter having an electromagnetic wavelength absorption profile of between 650 nm and
950 nm;

(D) selectively sizing by irradiating the plurality of nanoparticle aggregates provided in Step B with the electromagnetic
radiation source of Step A through the notch filter provided in Step C and irradiating them with electromagnetic energy, the
irradiating resulting in narrowing the optical absorption of the nanoparticle aggregates towards a selected surface plasmon
resonance wavelength; the step resulting in selective-sized nanoparticle aggregates, and whereby the steps result in forming
a sensor.

US Pat. No. 9,273,277


The Regents of the Univer...

1. A lock-in nanostructure comprising a plurality of nanotubes, wherein:
(a) at least a nanotube of the plurality of nanotubes has a locked-in nanotube entrance that is smaller in size than an interior
of the nanotube to exhibit a re-entrant configuration;

(b) the plurality of nanotubes have an outer diameter of between about 10 to 1000 nm;
(c) a height of at least a nanotube of the plurality of nanotubes has a height of at least about 40 nm;
(v) a vertical alignment angle of at least a nanotube of the plurality of nanotubes is within from about 0 to 45 degrees off
a vertical direction, or about 5, 10, 15, 20, 25, 30 or 35 degrees variation off a perpendicular axis; and

(vi) a lateral spacing between adjacent nanotubes of the plurality of nanotubes is from about 2 to 100 nm.
US Pat. No. 9,333,171


OTONOMY, INC., San Diego...

1. An intratympanic composition for use in the treatment of an otic disease or condition by administration on or near the
round window membrane of the ear, the intratympanic composition comprising
a micronized Central Nervous System (CNS) modulator, or pharmaceutically acceptable salt thereof; and
an auris acceptable gel, wherein the auris acceptable gel has a viscosity between about 15,000 cP and about 1,000,000 cP,
wherein the micronized Central Nervous System (CNS) modulator, or pharmaceutically acceptable salt thereof is not provided
as polymer-containing particles, and is suspended in the auris acceptable gel; and wherein sustained release of the CNS modulator
into the cochlea occurs for a period of at least 5 days after a single administration.

US Pat. No. 9,267,112



1. An isolated antibody that specifically binds to an isolated protein encoded by a nucleotide sequence of SEQ ID NO:9, wherein
the isolated antibody is bound to a detectable moiety.

US Pat. No. 9,066,855


OTONOMY, INC., San Diego...

1. A sterile aqueous pharmaceutical composition for use in the treatment of otic disorders by intratympanic administration
on or near the round window membrane of the ear, the pharmaceutical composition comprising an auris acceptable thermoreversible
gel and a multiparticulate non-microencapsulated glutamate receptor antagonist, wherein sustained release of the glutamate
receptor antagonist into the cochlea occurs for a period of at least 5 days.

US Pat. No. 9,576,799



1. A method for doping a substrate, comprising:
disposing a coating of a composition comprising a block copolymer, a dopant precursor and a solvent on a substrate; where
the block copolymer is capable of phase segregating and embedding the dopant precursor while in solution or on a surface of
the substrate; and

annealing the substrate at a temperature of 550 to 1300° C. for 0.1 second to 24 hours to diffuse the dopant into the substrate.

US Pat. No. 9,487,551


California Institute of T...

1. A method of modifying nematode behavior, comprising:
providing a composition comprising a compound of the formula:
or a salt thereof;
R1 is H, —C(R)3, —OR, —N(R)2 halogen, an alkyl, a haloalkyl, an alkenyl, or a haloalkenyl; wherein each R is independently H, halogen, an alkyl, or an

R1? is absent, H, —C(R)3, —OR, —N(R)2, halogen, an alkyl, a haloalkyl, an alkenyl, or a haloalkenyl; wherein each R is independently H, halogen, an alkyl, or an

R2 is a moiety of the formula:

R3 is H, —CR6R7R8, —C(O)R8, an alkyl, a haloalkyl, an alkenyl, a haloalkenyl, an aryl, a heteroaryl, a heterocyclyl, a cycloalkyl, a cycloalkenyl, an
acyl, an amino acid, a nucleoside, a monosaccharide having 5 or 6 carbon atoms, or a bond connecting to R5 of another unit of Formula I;

R4 is H, —CR6R7R8, —C(O)R8, an alkyl, a haloalkyl, an alkenyl, a haloalkenyl, an aryl, a heteroaryl, a heterocyclyl, a cycloalkyl, a cycloalkenyl, an
acyl, an amino acid, a nucleoside, a monosaccharide having 5 or 6 carbon atoms, or a bond connecting to R5 of another unit of Formula I;

R5 is H, —OH, —OR6, —OCR6R7R8, —CR6R7R8, —NH2, —NHR6, —NR6R7, halogen, an alkyl, a haloalkyl, an alkenyl, a haloalkenyl, an aryl, a heteroaryl, an arylalkyl, a heterocyclyl, a cycloalkyl,
a cycloalkenyl, an acyl, an amino acid, a nucleoside, a monosaccharide having 5 or 6 carbon atoms, or a bond connecting to
R3 or R4 of another unit of Formula I;

R6 and R7 are each independently H, —CR3, —OR, —N(R)2, halogen, alkyl, haloalkyl, alkenyl, haloalkenyl, aryl, heteroaryl, heterocyclyl, cycloalkyl, or cycloalkenyl, where the
alkyl, alkenyl, aryl, heteroaryl, heterocyclyl, cycloalkyl, or cycloalkenyl is optionally substituted with one or more substituents
independently selected from —OR8, —C(O)R8, —NHC(O)R8, alkyl, haloalkyl, aryl, heteroaryl, heterocyclyl, and cycloalkyl;

R8 is H, —C(R)3, —[C(R)2]n4NHC(O)R9, —[C(R)2]n4C(O)(NH)R9, —OR, —N(R)2, halogen, alkyl, haloalkyl, alkenyl, haloalkenyl, aryl, heteroaryl, heterocyclyl, cycloalkyl, cycloalkenyl, purine, pyrimidine,
or a monosaccharide having 5 or 6 carbon atoms, where the alkyl, alkenyl, aryl, heteroaryl, heterocyclyl, cycloalkyl, cycloalkenyl,
purine, pyrimidine, or monosaccharide is optionally substituted with one or more substituents independently selected from
—C(R)3, —OR9, —C(O)R9, —NHC(O)R9, halogen, alkyl, haloalkyl, aryl, heteroaryl, heterocyclyl, cycloalkyl, and a monosaccharide having 5 or 6 carbon atoms;

R9 is H, —C(R)3, —OR, —N(R)2, halogen, alkyl, haloalkyl, alkenyl, haloalkenyl, aryl, heteroaryl, heterocyclyl, cycloalkyl, cycloalkenyl, purine, pyrimidine,
or a monosaccharide having 5 or 6 carbon atoms, where the alkyl, alkenyl, aryl, heteroaryl, heterocyclyl, cycloalkyl, cycloalkenyl,
purine, pyrimidine, or monosaccharide is optionally substituted with one or more substituents independently selected from
—C(R)3, —OR, —C(O)R, halogen, alkyl, haloalkyl, aryl, heteroaryl, heterocyclyl, and cycloalkyl;

each R is independently H, halogen, alkyl, or alkenyl;
n1, n2, and n3 are each independently an integer of 0 to 30;

n4 is an integer of 1 to 30; and

the sum of n1, each n2, and each n3 is 1 to 30; and

administering an effective dosage of the composition to the nematode;
wherein the nematode is in contact with a mammal; and
further wherein the nematode is not a Caenorhabditis species.

US Pat. No. 9,227,200



1. A microfluidic integrated optoelectronic tweezers (OET) apparatus, comprising:
an upper polydimethylsiloxane (PDMS) chamber with an embedded single-walled nanotube (SWNT) thin film electrode; and
a lower photoconductive OET surface, the photoconductive OET providing a lower electrode.

US Pat. No. 9,295,838


The Regents of the Univer...

1. A method for reducing clinical presentations of a neurological movement disorder in a subject, the method comprising:
(i) administering a first deep brain stimulus train to the subject;
(ii) measuring cortical local field potentials (LFPs) from a surface of the subject's primary motor cortex using at least
one electrode, wherein the at least one electrode is located at a position corresponding to an arm area of primary motor cortex

(iii) calculating, with a processor, a modulation index for synchronization of brain rhythms in the LFPs, wherein the synchronization
of brain rhythms in the LFPs comprises synchronization of phase of beta rhythm and amplitude of gamma activity; and

(iv) administering a second deep brain stimulus train to the subject when the calculated modulation index is outside of a
predefined threshold range;

wherein steps (i)-(iv) are continued in a manner effective to reduce the clinical presentations of the neurological movement

US Pat. No. 9,205,048


OTONOMY, INC., San Diego...

1. A method of treating middle ear effusion in a pediatric patient with otitis media undergoing tympanostomy tube placement,
the method comprising intratympanically administering to the pediatric patient a composition comprising poloxamer 407 and
a therapeutically effective amount of multiparticulate and non-microencapsulated ciprofloxacin, wherein the composition provides
a sustained release of ciprofloxacin in the ear for a period of at least 5 days after a single intratympanic administration;
and wherein the composition comprises from about 10 wt % to about 20 wt % poloxamer 407.

US Pat. No. 9,186,417


The Regents of the Univer...

1. A hemostatic composition comprising a hemostatically effective amount of a hemostatic agent comprising:
a silica nanoparticle; and
a polyphosphate polymer attached to the silica nanoparticle.

US Pat. No. 9,356,779


The Board of Trustees of ...

1. A method, comprising:
with computing equipment, encrypting data using a public key that is formed using an identity, wherein encrypting the data
comprises encrypting the data using cryptographic system parameters and a bilinear map, wherein the cryptographic system parameters
include an element P of an algebraic group and a computed value sP, wherein s represents a secret master key, and wherein
encrypting the data using the cryptographic system parameters and the bilinear map comprises:

with the computing equipment, obtaining the cryptographic system parameters P and sP;
with the computing equipment, selecting a random secret r; and
with the computing equipment, encrypting the data using r, sP, the public key that is formed using the identity, and the bilinear

US Pat. No. 9,284,547


The Regents of the Univer...

1. A method for determining a protein synthesis rate, comprising:
(a) isolating a plurality of monosomes from a plurality of polysomes, wherein each of said plurality of polysomes comprises
a ribosome bound to a portion of a translatable RNA molecule;

(b) sequencing each of said portions;
(c) determining a ribosome footprint density for each translatable RNA molecule from said sequencing; and
(d) determining a protein synthesis rate from the ribosomal footprint density.

US Pat. No. 9,101,769


The Regents of the Univer...

1. A method comprising:
positioning a human patient in a training device, the patient having a neurologically derived paralysis in a portion of the
patient's body, the training device being configured to assist with physical training that is configured to induce neurological
signals in the portion of the patient's body having the paralysis, the patient having a spinal cord with at least one selected
spinal circuit that has a first stimulation threshold representing a minimum amount of stimulation required to activate the
at least one selected spinal circuit, and a second stimulation threshold representing an amount of stimulation above which
the at least one selected spinal circuit is fully activated and adding the induced neurological signals has no additional
effect on the at least one selected spinal circuit, the induced neurological signals being below the first stimulation threshold
and insufficient to activate the at least one selected spinal circuit; and

applying electrical stimulation to a portion of a spinal cord of the patient, the electrical stimulation being below the second
stimulation threshold such that the at least one selected spinal circuit is at least partially activatable by the addition
of at least one of (a) a second portion of the induced neurological signals, and (b) supraspinal signals.

US Pat. No. 9,427,472


OTONOMY, INC., San Diego...

1. An intratympanic composition for use in the treatment of an otic disease or condition associated with free-radical induced
damage, the intratympanic composition comprising
a micronized free-radical modulating agent, or pharmaceutically acceptable prodrug or salt thereof; and
an auris acceptable gel,
wherein the micronized free-radical modulating agent, or pharmaceutically acceptable prodrug or salt thereof is not provided
as polymer-containing particles, and is suspended in the auris acceptable gel; and wherein sustained release of the free-radical
modulating agent into the ear occurs for a period of at least 5 days after a single administration.

US Pat. No. 9,266,915


Chevron U.S.A. Inc., San...

9. A method for preparing an open metal carbonyl cluster comprising chemically reacting a closed metal carbonyl cluster and
an opening agent, with the opening agent reacting with a bound carbonyl group so as to unbind it from the cluster and leave
behind a CO-labile ligand on the cluster, and then removing the CO-labile ligand to create vacant sites, wherein the co-labile
ligand is removed by reaction with a strong acid or by heating the open metal carbonyl cluster under flow of an inert gas.

US Pat. No. 9,266,738


The Regents of the Univer...

42. A carbon-based material comprising:
a metal covalently bonded to carbon, wherein the metal binds two benzene units,
wherein the carbon material comprises extended sp2-bonded carbon atoms wherein the metal is bonded to the carbon material by hexahapto bonding or bis-hexahapto bonding wherein
conductive bridges are formed between single-walled nanotubes by intercalating metal atoms.

US Pat. No. 9,409,011


California Institute of T...

1. A method of constructing an implantable electrode array assembly, the method comprising:
applying electrically conductive material to a frame layer forming a patterned layer of electrically conductive material defining
a plurality of electrodes and a plurality of traces, at least one trace being connected to each of the plurality of electrodes,
wherein at least a portion of the electrically conductive material is applied to a sacrificial material, wherein the portion
of the conductive material is removed with the sacrificial material;

forming a first layer of a substantially electrically nonconductive material, the first layer being adjacent the patterned

forming a plurality of first openings in the first layer, the first openings providing access to the plurality of electrodes
through the first layer, a different grid defining portion of the first openings being adjacent each of the electrodes, each
grid defining portion exposing a plurality of contacts of the electrode to which the grid defining portion is adjacent; and

forming a plurality of second openings in the first layer, the second openings providing access to the plurality of traces
through the first layer.

US Pat. No. 9,255,088


The Regents of the Univer...

1. A compound having the ability to increase read through of premature termination codons (PTCs) in RNA, a pharmaceutically
acceptable salt thereof, having a structure of formula (VIII):
X is O;
R3 is an ortho, meta, or para group and is a hydrogen, halo, or nitro; and

R4 is hydrogen, —C(O)H, halo, or a C1-C6 group.

US Pat. No. 9,717,145



1. A method for filling through-silicon vias (TSVs) in an integrated circuit, the method comprising:
(a) positioning an inkjet printhead, or a first integrated circuit, so that droplets ejected from the inkjet printhead are
directed into a through-silicon via (TSV) to be filled in said first integrated circuit;

(b) ejecting sufficiently small droplets of a conductive nanoparticle ink from said inkjet printhead into said TSV;
(c) heating said integrated circuit to drive evaporation of a solvent carrying conductive nanoparticles within said conductive
nanoparticle ink;

(d) inducing relative motion between the integrated circuit and the inkjet printhead along the length of the TSV while it
is being filled;

(e) determining that the TSV has been sufficiently filled by determining that a predetermined number of droplets have been
ejected with respect to size of the TSV being filled; and

(f) repeating steps (a) through (e) for all TSV to be filled on said first integrated circuit, whereby said first integrated
circuit is prepared for bonding to a second integrated circuit in a process which includes a bonding temperature above a sintering
temperature of nanoparticles in the conductive nanoparticle ink to form electrical interconnection between the first integrated
circuit and the second integrated circuit.

US Pat. No. 9,309,236


The Board of Trustees of ...

1. A compound of the structure:
R1 is selected from an aryl, a heterocycle, and a cycloalkyl;

R2 is selected from hydrogen, a halogen, an alkyl and an alkoxy;

R3 is an alkyl;

R4 is an alkyl, an alkyl-cycloalkyl, or an alkyl-heterocyclyl;

W1 is —SO2—; and

W2 is —NHCO—.

US Pat. No. 9,228,007


The Regents of the Univer...

1. A method of producing an engineered thymocyte or an engineered T cell which comprises
spectratyping-based cloning to obtain a nucleic acid molecule which encodes a human T cell receptor specific for a virus or
an epitope thereof;

transducing a human hematopoietic stem cell with a vector containing the nucleic acid molecule to give a recombinant progenitor
cell; and

differentiating or developing the recombinant progenitor cell into the engineered thymocyte by subjecting the recombinant
progenitor cell to a thymus tissue, and then optionally maturing the engineered thymocyte into the engineered T cell, and

wherein the spectratyping-based cloning comprises
obtaining peripheral blood mononuclear cells from a subject infected with the virus and dividing the peripheral blood mononuclear
cells into a first portion and a second portion;

culturing the first portion with the virus or the epitope thereof;
spectratyping the TCR ?-genes and TCR ?-genes in the first portion to obtain a first fingerprint;
spectratyping the TCR ?-genes and TCR ?-genes in the second portion to obtain a second fingerprint;
selecting a TCR ?-gene and a TCR ?-gene in the first portion which are not present in the second portion; and
recombinantly joining the selected TCR ?-gene and TCR ?-gene to give the nucleic acid molecule.
US Pat. No. 9,283,194


The Regents of the Univer...

1. A method for producing an enzymatically-degradable nanocapsule that encapsulates not more than one core cargo molecule,
the method comprising:
(a) selecting a core cargo molecule for encapsulation;
(b) preparing a plurality of cross-linkers having at least one enzyme cleavage site;
(c) physically adsorbing a plurality of shell monomers and cross-linkers to said core cargo molecule, wherein said adsorbing
is modulated by electrostatic forces between the monomers and the core cargo molecule; and

(d) polymerizing a polymeric shell comprising the plurality of adsorbed shell monomers and cross-linkers around said core
cargo molecule to provide a enzymatically-degradable nanocapsule;

the core cargo molecules are not covalently coupled to the enzymatically-degradable nanocapsules:
said enzymatically-degradable nanocapsule encapsulates not more than one core cargo molecule; and
said cross-linker enzyme cleavage sites of said cross-linkers are configured to be cleaved in the presence of site specific

US Pat. No. 9,273,284


The Regents of the Univer...

1. A method of inducing dendritic cell differentiation from a mammalian precursor cell, the method comprising:
contacting a population of human monocytes with an effective dose of IL-32, for a period of time sufficient to induce differentiation
of the precursor cells into dendritic cells wherein the contacting is performed ex vivo; and

isolating CD1b positive dendritic cells from said population.

US Pat. No. 9,274,084


The Regents of the Univer...

1. A magnetic particle imaging device comprising:
a magnetic field source configured to produce a magnetic field having a non-saturating magnetic field region;
an excitation signal source configured to produce an excitation signal in the non-saturating magnetic field region that produces
a detectable signal from magnetic particles in the non-saturating magnetic field region; and

a signal processor configured to recover low frequency image data lost during acquisition of the detectable signal and convert
the detectable signal into an image of the magnetic particles.

US Pat. No. 9,395,304


Lawrence Livermore Nation...

1. A method comprising:
providing an optical fiber having a planar facet end;
attaching a ferrule to the optical fiber adjacent to the planar facet end;
fitting the optical fiber with the ferrule on a spin coater;
coating the planar facet end of the optical fiber with the ferrule with a photoresist;
producing a pattern in the photoresist for a nanoscale structure by interference lithography;
developing the photoresist;
removing the photoresist and a portion of the optic fiber unprotected by the photoresist, thus obtaining a nanoscale structure
in the optic fiber; and

depositing a layer of metal on the nanoscale structure.

US Pat. No. 9,303,042


The Regents of the Univer...

15. A compound of structure (III):

or a single stereoisomer, a mixture of stereoisomers, tautomer or pharmaceutically acceptable salt thereof, wherein,
X is an alkylene chain;
Y is —CH?CH2—, —CH?N—, S, or O;

each R3 and R4 is independently hydrogen, alkyl, halo or haloalkyl;

R7 is —C(R10)(R11)—R12, —OR9 or halo;

R8 is optionally substituted aryl, optionally substituted heteroaryl or optionally substituted heterocyclyl, or —OR9;

R9 is alkyl or haloalkyl;

R10 and R11 are each independently halo or alkyl; and

R12 is alkyl, halo or haloalkyl,

wherein when Y is —CH?CH2— and R7 is isopropyl at the position para to the linking carbon, R8 is not furanyl or thiophenyl, and when Y is —CH?CH2— and R7 is Br at the position para to the linking carbon, R8 is not thiophenyl.

US Pat. No. 9,156,682



1. A method of preparing a block copolymer film comprising a line pattern, comprising:
forming a block copolymer film on a substrate surface comprising parallel facets; and
annealing the block copolymer film to form an annealed block copolymer film comprising linear microdomains parallel to the
substrate surface and orthogonal to the parallel facets;

wherein the parallel facets of the substrate are characterized by a pitch, ?, having units of nanometers;
wherein the block copolymer in bulk comprises a hexagonal array of cylindrical microdomains characterized by a center-to-center
spacing, L2, of adjacent cylindrical microdomains, wherein L2 has units of nanometers; and

wherein ?/L2 is either less than or equal to 0.73 or greater than or equal to 1.4.

US Pat. No. 9,132,087


OTONOMY, INC., San Diego...

1. A pharmaceutical intratympanic formulation comprising:
a multiparticulate immunomodulating agent, or pharmaceutically acceptable salt thereof wherein the immunomodulating agent
is in the form of non-coated micronized particles; and

a polyoxyethylene-polyoxypropylene copolymer in an amount sufficient to provide a viscosity of between about 750 and 1,000,000
centipoise, or allow for injection through the tympanic membrane with a 18-30 gauge needle;

the pharmaceutical intratympanic formulation having an osmolarity of about 100 mOsm/L to about 500 mOsm/L;wherein a single administration of the pharmaceutical intratympanic formulation provides sustained release of the immunomodulating
agent into the inner ear through the round window membrane for a period of at least 5 days.

US Pat. No. 9,233,973


The United States of Amer...

1. A method of inhibiting prostate cancer in a male mammal, the method comprising:
administering to the mammal a pharmaceutical composition comprising a compound selected from the group consisting of:

and pharmaceutically acceptable salts, solvates and stereoisomers thereof, wherein the composition comprises a pharmaceutically
and physiologically acceptable carrier, in an amount effective to inhibit prostate cancer cell growth in the mammal.

US Pat. No. 9,196,703


Northrop Grumman Systems ...

1. A method for fabricating a semiconductor device, said method comprising:
providing a semiconductor substrate including a front side and a back-side;
depositing semiconductor epitaxial layers on the front side of the semiconductor substrate;
etching at least one thermal via into the back-side of the semiconductor substrate;
depositing a diamond nucleation seed layer across the entire back-side of the semiconductor substrate so that the diamond
nucleation layer is deposited on planar portions of the back-side of the substrate and within the at least one thermal via
including sidewalls thereof;

depositing a mask layer on the diamond nucleation layer;
removing a portion of the mask layer outside of the thermal via on the planar portions of the back-side of the substrate so
that only mask material remains within the thermal via;

removing a portion of the diamond nucleation layer on the planar portions of the substrate outside of the at least one thermal

removing the remaining portion of the mask material in the thermal via;
depositing a bulk diamond layer within the thermal via on the remaining portion of the diamond nucleation layer in a manner
that only allows diamond to be formed within the thermal via and not on the planar portions of the back-side of the substrate;

fabricating device layers on the epitaxial layers.

US Pat. No. 9,335,629



1. A layered article, comprising:
a polymer layer comprising a topographically patterned surface formed by contact with a topographically patterned surface
of a single crystal substrate; wherein the topographically patterned surface of the single crystal substrate is a substantially
planar surface at least one degree removed from any crystallographic plane of the single crystal substrate; and

a block copolymer film comprising a surface in contact with the patterned surface of the polymer layer; wherein the block
copolymer film consists of a block copolymer selected from the group consisting of polystyrene-b-poly(4-vinylpyridine)s, polystyrene-b-poly(2-vinylpyridine)s,
and polystyrene-b-poly(ethylene oxide)s wherein the block copolymer film is an annealed block copolymer film and the annealed
block copolymer film comprises a hexagonal array of cylindrical microdomains.

US Pat. No. 9,237,347



1. A video communication system comprising:
a first electronic device operably couplable to a second electronic device enabled to receive and display video data, the
first electronic device being configured to transmit video having a plurality of frames, each frame of the plurality of frames
having a plurality of macroblocks, each macroblock having a plurality of pixels, and wherein the first electronic device includes
a video encoder having a coding control sub-system configured to

refresh a first segment of a first plurality of macroblocks of a first frame of the plurality of frames,
refresh a second segment of a second plurality of macroblocks of a second frame of the plurality of frames,
determine, by consulting a bitmap table, whether there are any of a plurality of macroblocks of a first segment of the second
frame encoded with data from an unrefreshed macroblock of the first frame, and

refresh the macroblocks of the first segment of the second frame that are marked to be refreshed;
wherein the bitmap table stores a status of each macroblock, and wherein the status of a macroblock is listed as to be refreshed
when at least one pixel of the macroblock contains unrefreshed or contaminated data; and

wherein a period of time, Mb, between the refresh of the first segment and a refresh of a last segment is determined as Mb=NcxT/Nx, where Nc is a total number of macroblock segments in a frame of the plurality of frames, T is a time between two frames being refreshed,
and Nx is a number of segments being regularly refreshed in one frame; and

wherein a number of intra-segments, Colpgop, is determined as Colpgop=Mx?/Nc, where M is a total number of macroblocks in one frame, and ? is a percentage of intra-macroblocks for the first frame.

US Pat. No. 9,274,136


The Regents of the Univer...

1. A multi-axis microelectromechanical-systems (MEMS) inertial measurement unit (IMU) in a vacuum sealed single packaged device
a single silicon chip;
an FM vibratory gyroscope for generating frequency modulated (FM) gyroscopic output signals fabricated in the silicon chip
using silicon MEMS technologies as part of the vacuum sealed single packaged device;

an FM resonant accelerometer for generating frequency modulated (FM) accelerometer output signals fabricated in the silicon
chip using silicon MEMS technologies as part of the vacuum sealed single packaged device; and

a signal processor coupled to the an FM vibratory gyroscope and to the FM resonant accelerometer for receiving the frequency
modulated (FM) gyroscopic output signals and the frequency modulated (FM) accelerometer output signals, the signal processor
generating simultaneous and decoupled measurement of input acceleration, input rotation rate, and temperature and/or temperature
distribution within the IMU, self-calibration of the biases and scale factors of the IMU and its support electronics against
temperature variations and common mode errors, and reduction of the cross axis sensitivity by reducing acceleration errors
in the gyroscope and rotation errors in the accelerometer,

wherein the FM resonant accelerometer comprises:
a tuning fork resonator having two tines with an anti-phase and in-phase mode of vibration; and
a plurality of variable gap parallel plate electrodes coupled to the two tines to produce a negative electrostatic spring,
where external acceleration causes a shift of both tines with in-phase motion, which changes an effective gap in the parallel
plate electrodes thereby changing the effective stiffness for each tine, where the change of stiffness induces a change of
an anti-phase resonant frequency, and where the change of the anti-phase resonant frequency is an FM measure of the input

US Pat. No. 9,278,319


The Regents of the Univer...

1. A filtration membrane comprising from about 25% to 100% by weight of a high defect density polyaniline polymer
having an average molecular weight between 1,000 and 1×106 Daltons,

capable of forming a dispersion at a concentration of at least 11 weight % in a solvent consisting essentially of N-methyl-2-pyrrolidone,
and having a higher proportion of covalent bonds at the meta and/or ortho position on the aniline rings than (i) a polyaniline
polymer formed in an oxidative polymerization reaction in the absence of mechanical force sufficient to disrupt nucleation
during the reaction, and (ii) a polyaniline polymer formed in an oxidative polymerization reaction at a temperature below
15° C.

US Pat. No. 9,243,016


Chevron U.S.A. Inc., San...

16. A method for preparing an open metal carbonyl cluster comprising chemically reacting a closed metal carbonyl cluster,
which is an Ir4 carbonyl cluster, and an opening agent, with the opening agent reacting with a bound carbonyl group so as to unbind it from
the cluster and leave behind a CO-labile ligand on the cluster.
US Pat. No. 9,511,020


Otonomy, Inc., San Diego...

1. A method of ameliorating an inner ear disease or disorder in a patient in need thereof comprising injecting through the
tympanic membrane into the middle ear cavity of the patient a controlled release composition comprising dexamethasone and
a thermosetting polymer; wherein the dexamethasone is uncoated and is suspended in the composition, and the thermosetting
polymer is poloxamer 407 at a concentration of at least 10% w/w and up to 20% w/w, and wherein a single dose of the controlled
release composition in the syringe is from 300 ?L to 500 ?L.

US Pat. No. 9,130,119


The Regents of the Univer...

1. A III-nitride light emitting device, comprising:
a plurality of III-nitride layers comprising at least one p-type layer, an active region, and at least one n-type layer,
wherein the III-nitride layers are not c-plane III-nitride layers, and
wherein the active region is comprised of at least one III-nitride quantum well layer having a thickness that achieves a current
density such that light is emitted at an output power of at least 25 milliWatts (mW) when a current input at 20 milliAmps
(mA) is applied.

US Pat. No. 9,347,935


The Regents of the Univer...

1. A method for determining a functional effect of a compound upon a cell expressing a first recombinant polypeptide and a
second recombinant polypeptide, the method comprising the steps of:
(a) expressing the first recombinant polypeptide and the second recombinant polypeptide in a plasma membrane of the cell,
wherein the first recombinant polypeptide comprises a first extracellular region and a first transmembrane region, wherein:
(i) the first extracellular region amino acid sequence is selected from the group consisting of: an amino acid sequence that
has at least 93% amino acid sequence identity to the extracellular region of SEQ ID NO:20 or an amino acid sequence that has
at least 94% amino acid sequence identity to the extracellular region of SEQ ID NO:23,

(ii) the first transmembrane region amino acid sequence is selected from the group consisting of: an amino acid sequence that
has at least 93% amino acid sequence identity to the transmembrane region of SEQ ID NO:20 or has at least 94% amino acid sequence
identity to the transmembrane region of SEQ ID NO:23, and

the second recombinant polypeptide comprises a second extracellular region and a second transmembrane region, and wherein
the second extracellular region has an amino acid sequence having at least 90% amino acid sequence identity to the extracellular
region of SEQ ID NO:2 and the second transmembrane region has an amino acid sequence having at least 90% amino acid sequence
identity to the transmembrane region of SEQ ID NO:2,

(b) assaying a parameter in the cell, the parameter indirectly or directly under the influence of a T1R GPCR protein or a
sweet and/or an amino acid taste receptor comprising one or more T1R GPCR proteins wherein the parameter is ligand binding
or transduction of a cellular signal in response to ligand binding;

(c) contacting the cell with the compound;
(d) assaying the cell for an increase or decrease in the parameter, thereby determining the functional effect, if any, of
the compound.

US Pat. No. 9,730,282


The Regents of the Univer...

1. A switchable luminance LED light bulb device comprising: an AC input component in functional communication with a driver
board, the driver board comprising a rectifier, wherein a DC current is fed into a switch, the switch having a single input
pole and multiple output poles and a plurality of selectable positions, wherein the switch directs the current through one
of a plurality of selectable capacitors and/or resistors corresponding to one of a plurality of different DC output currents,
wherein the selected DC output current is fed into at least one of a plurality of light emitting diodes, wherein the selected
DC output current corresponds to the light output of the light emitting diodes and wherein the device further comprises a
current regulating device functionally associated with the driver board and at least one transistor, wherein the current regulating
device modulates the gate of the output transistor by measuring a voltage, thereby regulating current wherein any selectable
DC output current is sufficient to cause at least one of a plurality of light emitting diodes to emit light.
US Pat. No. 9,322,042


The Regents of the Univer...

1. A composition comprising an ionic liquid that is equal to or less than 20% by volume of the composition and a thermostable
cellulase, wherein the thermostable cellulase has at least 90% identity to SEQ ID NO:20 or comprises the amino acid sequence
of SEQ ID NO:21.
US Pat. No. 9,127,045



1. A method for treating a condition associated with the attachment of Streptococcus mutans to teeth of a subject, comprising:
administering to the subject a composition comprising an orally acceptable carrier in combination with a competence stimulating
peptide in an amount effective to inhibit the expression of at least one glucosyltransferase gene selected from the group
consisting of gftB and gftC, thereby reducing the presence of Streptococcus mutans on the teeth of the subject,

wherein the effective amount is dependent on the level of reduction based on a dose-response relationship between a growth
rate of Streptococcus mutans and the competence stimulating peptide, and

wherein the competence stimulating peptide comprises SEQ ID NO: 1.
US Pat. No. 9,303,088


The Regents of the Univer...

1. A method of predicting a clinical outcome for a patient having breast cancer, comprising:
providing a biological sample comprising breast cancer cells from the patient;
contacting said breast cancer cells with an antibody specific for FAM83A;
detecting a FAM83A expression level in the breast cancer cells by measuring the level of binding between the antibody and
the breast cancer cells; and

predicting the clinical outcome of the patient based on the FAM83A expression level, wherein the FAM83A expression level is
positively correlated with the breast-cancer related mortality.

US Pat. No. 9,278,112


New York University, New...

1. A beverage comprising sodium citrate, potassium citrate, citric acid, magnesium salt and pyridoxine, wherein the magnesium
salt is magnesium citrate or magnesium hydroxide.

US Pat. No. 9,263,757


The Regents of the Univer...

1. A cross-linked ionomer comprising at least two highly basic ionomers cross-linked together, each of the highly basic ionomers
independently comprising:

M1 is a polymer-forming monomer comprising an aromatic moiety or a plurality of such monomers at least one of which comprises
an aromatic moiety and B+OH? is a highly basic functional group having a pKb of between ?0.2 and 0.2;

x is defined as the mole ratio of the B+ to the M1 and is between 0.01 and 10;

n is defined as number of the repeat unit M1 and is between 10 and 10000; and
m is the number of equilibrated moles of OH?, wherein m is the product of x and n.

US Pat. No. 9,263,513


The Regents of the Univer...

1. A semiconductor structure comprising:
a first substrate comprising a first semiconductor layer and a buried layer, wherein the first semiconductor layer comprises
a plurality of channels, each of the plurality of channels being in the depth direction and extending from a first surface
of the semiconductor layer to the buried layer, wherein the plurality of channels is arranged in a first arrangement that
is two-dimensional; and

a second substrate comprising second semiconductor layer having a second surface;
wherein the second surface and first surface are joined at a bonding interface, and wherein each channel of the plurality
thereof is dimensioned and arranged to enable gas byproducts generated at the bonding interface to traverse the channel and
diffuse into the buried layer.

US Pat. No. 9,270,228


The Regents of the Univer...

1. Wafer masks for laying out a semiconductor device, comprising:
a first pattern for laying out a first plurality of clocked devices on a semiconductor wafer;
a second pattern for laying out a second plurality of clocked devices on a semiconductor wafer; and
a third pattern for laying out a clock distribution system on a semiconductor wafer, the clock distribution network having
a first clock buffer driving a first clock tree with a first plurality of conductors that are connected to the first plurality
of clocked devices, a first LC network adjacent a first clocked device of the first plurality of clocked devices, and a second
LC network adjacent a second clocked device of the first plurality of clocked devices, the clock distribution network further
including a second clock buffer driving a second clock tree with a second plurality of second conductors connected to a second
plurality of clocked devices and a third LC network adjacent a first clocked device of the second plurality of clocked devices;

wherein the third pattern is for producing an unsymmetrical first clock tree;
wherein the third pattern is for producing a first clock tree and an asymmetrical second clock tree;
wherein the third pattern is for producing a resonant first LC network;
wherein the third pattern is for producing a resonant second LC network; and
wherein the third pattern is for producing a resonant third LC network.

US Pat. No. 9,321,990


The Regents of the Univer...

1. A method comprising:
(a) directing a target object comprising an organelle to a platform that receives an ablation radiation
(b) photosensitizing the organelle to the ablation radiation;
(c) generating an image of the target object on the platform;
(d) generating an outline of the photosensitized organelle based upon the image; and
(e) emitting the ablation radiation toward the specimen to selectively disrupt the photosensitized organelle wherein the emitting
comprises at least one of:

(i) emitting the ablation radiation based on a shape determined by the organelle outline;
(ii) translocating the ablation radiation in a movement pattern determined by the organelle outline; and
(iii) maintaining the ablation radiation substantially stationary while translocating the target object in a movement pattern
determined by the organelle outline.

US Pat. No. 9,279,769


The Regents of the Univer...

1. An isolated polynucleotide encoding a miniSOG polypeptide comprising an amino acid sequence selected from the group consisting
of SEQ ID NO:1 and SEQ ID NO:2.
US Pat. No. 9,157,130


Sandia Corporation, Live...

1. A composition comprising a solution comprising (a) an ionic liquid (IL) or ionic liquid-aqueous (ILA) phase, wherein the
IL or ILA phase comprises a cellulase, and (b) an organic phase, wherein the solution comprises a sugar and a boronic acid.
US Pat. No. 9,110,064



1. A method for determining the likelihood of a non-cancerous endometrial cell becoming cancerous, comprising:
determining the level of expression of epithelial membrane protein 2 (EMP2) in a test sample comprising the non-cancerous
endometrial cell, wherein increased levels of expression of EMP2 in the non-cancerous endometrial cell relative to a control
level correlates with the endometrial cell having an increased likelihood of becoming cancerous,

wherein the level of expression is determined using an anti-epithelial membrane protein 2 (EMP2) antibody or antigen binding
fragment thereof that binds to the amino acid sequence as set forth in SEQ ID NO: 1.

US Pat. No. 9,488,655



1. A method of treating endometrial cancer in a subject comprising:
(a) measuring binding of antibodies in a serum sample obtained from the subject, wherein the antibodies specifically bind
three biomarkers consisting of transthyretin (TTR), apolipoprotein AI (ApoAI) and transferrin (TF) in the serum sample;

(b) administering radiotherapy or chemotherapeutic drugs for endometrial cancer to the subject when a decrease is found in
the measured three biomarkers of in the serum sample compared to the measurement of the three biomarkers in the normal sample.

US Pat. No. 9,376,728


The Regents of the Univer...

1. A composition comprising an isolated or recombinant polypeptide comprising an amino acid sequence having at least 90% identity
with the amino acid sequence of SEQ ID NO:1 or SEQ ID NO:5, wherein said isolated or recombinant polypeptide comprises a catalytic
domain, a fibronectin domain 3 (FN-3) and an Ig-like domain, and has a halophilic thermostable or thermophilic cellobiohydrolase
(CBH) activity and 2-5 M of NaCl, 20-30% of an ionic liquid (IL), or a pH of 7.5 to 12.5.
US Pat. No. 9,045,751


The Regents of the Univer...

1. A method for increasing the expression of a p21 gene in a cell, the method comprising:
introducing into a cell an effective amount of a modified p21 gene-specific small activating RNA (saRNA), the modified p21
gene-specific saRNA comprising:

i. an antisense strand comprising a mismatch at the 5? terminal nucleotide compared to antisense strand of a p21 gene-specific
control saRNA; and

ii. a sense strand of the p21 gene-specific control saRNA, the sense strand comprising a blocking moiety at the 5? terminus;
wherein the expression of the p21 gene is increased, wherein the increase in expression of the p21 gene by introduction of
said modified gene-specific saRNA is greater than the increase in expression of a gene following administration of said p21
gene-specific control saRNA, and the off-target effects of the modified p21 gene-specific saRNA are less than the off-target
effects following introduction of said p21 gene-specific control saRNA, wherein the sense and antisense strands form a duplex
region of between 15 to 30 base pairs in the modified saRNA molecule.

US Pat. No. 9,487,575



1. A method of inhibiting the proliferation of gynecologic cancer cells in vivo, comprising contacting the cancer cells in
vivo with apolipoprotein A-1 (ApoA-1).

US Pat. No. 9,488,599



1. An apparatus for analyzing a sealed container comprising:
a) a waveform generator, which waveform generator is capable of producing a frequency swept electrical field;
b) a first solenoid coil operably coupled to the waveform generator, which solenoid produces a magnetic field;
c) a gradiometer comprising a top sample solenoid coil and a lower reference solenoid coil, wherein the top sample solenoid
coil and the lower reference solenoid coil are counter-wound with respect to each other, wherein the gradiometer is positioned
within the first coil, and wherein the container can be positioned within the top sample solenoid coil;

d) a receiver operably coupled to the top sample solenoid coil, which receiver is capable of capturing a set of empirical
data points reflecting a change in the magnetic field due to the contents of the container; and

e) a computer operably coupled to the receiver and configured to empirically compare data from the set of empirical data points
to known magnetic field empirical data from a known contents sealed container and thereby identify or authenticate the contents
of the sealed container.

US Pat. No. 9,352,155


The Regents of the Univer...

1. A method of brain stimulation for treatment of a neurological disease, comprising:
(a) stimulating neurons in a brain region;
(b) measuring or calculating a phase response curve for a population of interest of said stimulated neurons; and
(c) calculating by a computer programmed device and using said measured or calculated phase response curve, stimulus parameters
and waveforms to synchronize or desynchronize neuronal oscillators in said brain region, wherein said calculation is based
on a Lyapunov exponent described in terms of said measured or calculated phase response curve.

US Pat. No. 9,260,493


The Regents of the Univer...

1. A composition comprising a nucleic acid binding polypeptide containing the sequence selected from the group consisting
(a) SEQ ID NO:2, wherein at least 2 histidines are present in the sequence at a position selected from residues selected from
the group consisting of 16, 18, 19, 20, 37, 38, 44, 46, 57 and 58;

(b) SEQ ID NO:3;
(c) SEQ ID NO:4;
(d) SEQ ID NO:5; and
(e) SEQ ID NO:6,
wherein the polypeptide is in complex with an anionically charged nucleic acid to form a nucleic acid binding protein-nucleic
acid complex having a net cationic charge.

US Pat. No. 9,169,303


The Regents of the Univer...

1. A vaccine comprising a pathogen immunogenic peptide or a pathogen immunogenic fragment or variant thereof incorporated
within a vault-like particle, wherein the vault-like particle comprises MVP, and wherein administration of the vaccine to
a subject in need thereof stimulates a cellular immune response.

US Pat. No. 9,125,625


The Regents of the Univer...

1. A wearable garment product comprising:
a substrate comprising a wearable material;
an electrode printed on the substrate; and
a catalyst-containing ink printed onto the electrode.
US Pat. No. 9,492,415


Genzyme Corporation, Fra...

1. A method for delivering recombinant adeno-associated virus (rAAV) virions to the brain of a subject, comprising administering
via convection-enhanced delivery (CED) said rAAV virions into the central nervous system (CNS) of the subject, wherein said
rAAV virions comprise a nucleic acid sequence encoding a therapeutic polypeptide, and at least 1×109 rAAV virions are administered and distribution of said rAAV virions over an area greater than 5 mm2 is achieved.
US Pat. No. 9,498,537


Albert Einstein College o...

1. A method for treating a sickle cell disease in a subject who will receive a blood transfusion to treat the sickle cell
disease comprising administering to the subject a composition comprising a PEGylated-hemoglobin antioxidant conjugate prior
to the blood transfusion.

US Pat. No. 9,260,443


The Regents of the Univer...

1. A method of fabricating an organic device comprising
providing a first solution comprising an organic semiconductor compound or a precursor compound thereof, a solvent and a decomposable
polymer additive, wherein the organic semiconductor compound or the precursor compound thereof, and the decomposable polymer
additive are dissolved in the first solution;

casting said first solution; and
removing at least 80% of the polymer additive by decomposing the polymer additive into volatile small molecules.
US Pat. No. 9,603,796


OTONOMY, INC., San Diego...

1. A method of treating otitis externa or swimmer's ear in a patient, the method comprising administering to ear canal of
the patient a composition comprising from about 10 wt % to about 20 wt % poloxamer 407 and a therapeutically effective amount
of micronized and non-microencapsulated ciprofloxacin.
US Pat. No. 9,512,180


The Regents of the Univer...

1. A compstatin analog comprising the sequence X1X2X3CVX4QDWGX5HRCT, wherein X1 and X2 may or may not be present, if X1 and/or X2 are present X1 is selected from S, W, R, E or N and X2 is selected from S, W, R or N; wherein X3 is selected from W, meW, R, I or L, wherein X4 is W, meW, Nmw, V, Y or a non-natural amino acid analog of alanine; wherein X5 is A or a non-natural amino acid analog of alanine; wherein the analog is acetylated at the N-terminus and amidated at the
C-terminus; and wherein the compstatin analog is capable of binding mouse, rat or human C3.

US Pat. No. 9,433,219


The Regents of the Univer...

1. A composition comprising spores harvested from a pure culture of an endophytic microorganism selected from the group consisting
of Aureobasidium sp., Geomyces sp., and a combination thereof, at a concentration of 105 to 106 spores/mL in sterile water; and
a pure culture of Achromobacter sp.,
wherein the composition inhibits an Xylella fastidiosa infection in a plant.

US Pat. No. 9,136,483


The Regents of the Univer...

1. A Compound of the formula:

US Pat. No. 9,844,507


OTONOMY, INC., San Diego...

1. A method of treating an otic disease or condition in a pediatric patient, wherein the otic disease or condition is selected
from acute otitis media with tympanostomy tubes or otitis media requiring tympanostonmy tube placement, the method comprising
intratympanically administering to the pediatric patient a composition comprising poloxamer 407 and a therapeutically effective
amount of multiparticulate ciprofloxacin, wherein the multiparticulate ciprofloxacin is non-microencapsulated, and wherein
the composition provides a sustained release of ciprofloxacin in the ear for a period of at least 5 days after a single intratympanic
US Pat. No. 9,486,539



1. A Nipah virus (NiV) envelope pseudotyped lentivirus particle comprising NiV fusion (NiV-F) and attachment (NiV-G) glycoproteins,
wherein the NiV-F glycoprotein has a cytoplasmic tail truncation consisting of deletion of amino acid residues 525-544 of
SEQ ID NO: 1 NiV-F (T234 truncation) and a mutation to an N-linked glycosylation site, wherein the Niv-G glycoprotein is a
wild type Niv-G, and wherein the lentivirus infects cells expressing Ephrin B2 or Ephrin B3 receptors.
US Pat. No. 9,334,539


The Hospital for Sick Chi...

1. A method of detecting a mutation in an EPM2A gene, comprising:
(a) direct sequencing a nucleic acid molecule that has at least 90% identity to SEQ ID NO:5 over the full length of SEQ ID
NO:5; and

(b) detecting the presence of a T at a position corresponding to position 273 of SEQ ID NO:5; an A at a position corresponding
to position 387 of SEQ ID NO:5; a T at a position corresponding to position 430 of SEQ ID NO:5; or an insertion of nucleotide
A at a position corresponding to position 352 of SEQ ID NO:5.

US Pat. No. 9,231,376


The Regents of the Univer...

1. A light emitting device configured as a laser device, comprising:
a semipolar III-nitride film including a light emitting device structure, wherein:
the light emitting device structure includes one or more semipolar III-nitride active layers grown on or above a semipolar
surface of a substrate comprising a free-standing gallium nitride (GaN) substrate, the semipolar surface having a {20-21}
orientation or off-cut thereof, and

one or more material properties of the semipolar III-nitride active layers are such that the device has an output power of
at least 1.5 milliwatts at 250 milliamps drive current; and

an edge configured on the light emitting device structure for emission of electromagnetic radiation.

US Pat. No. 9,164,024


The Regents of the Univer...

1. An optofluidic apparatus for analyzing samples and detection of individual particles, comprising:
an optical layer comprising a plurality of waveguides;
a plurality of fluidic layers, wherein a first fluidic layer of the plurality of fluidic layers is attached to the optical
layer and is configured as an interface layer, and a second fluidic layer of the plurality of fluidic layers is attached to
the first fluidic layer and is configured as a functional fluidic layer, wherein a first function of the second fluidic layer
comprises distributing samples to the plurality of waveguides, and wherein a second function of the second fluidic layer comprises
mechanical filtration of samples; and

a protective layer attached to a fluidic layer of the plurality of fluidic layers;
wherein the optical layer is made of a different substrate material than the plurality of fluidic layers; and
wherein the optical layer, plurality of fluidic layers, and protective layer are vertically integrated, and wherein light
and individual particles in flow propagate through a channel of a fluidic layer such that the individual particles experience
the full optical intensity of the light.

US Pat. No. 9,486,474



1. A composition for intravesical instillation into the bladder, wherein said composition consists of an aqueous solution
(i) heparin,
(ii) a local anesthetic agent selected from the group consisting of lidocaine, bupivacaine, and mepivacaine,
(iii) a phosphate buffer, and
(iv) optionally an osmolar component selected from the group consisting of sodium chloride, dextrose, dextran 40, dextran
60, starch and mannitol,

wherein said heparin is present in a quantity from about 5000 USP units to about 100,000 USP units per unit dose, and
wherein said composition treats interstitial cystitis or at least one symptom thereof when instilled into the bladder.
US Pat. No. 9,485,994


The Regents of the Univer...

1. A method of cultivating a plant comprising:
a). contacting said plant with bacteria of the genus Collimonas; and

b). contacting said plant with bacteria of the genus Bacillus,
wherein said contacting of a) in combination with said contacting of b) causes a synergistic antifungal or synergistic anti-oomycete
effect against a fungal or an oomycetous infection.

US Pat. No. 9,359,309


The Regents of the Univer...

1. A method to synthesize a compound 1 having the structure of:

comprising reactions (a)-(d):

wherein, R3 is a (C1-C6) alkyl, and Boc is a tert-butyloxycarbonyl protecting group.

US Pat. No. 9,290,800


Pacific Biosciences of Ca...

6. A method of amplifying a nucleic acid target region, the method comprising:
a) providing a nucleic acid template, which template is a circular nucleic acid having a double-stranded central region and
two single-stranded hairpin end regions; wherein the double-stranded central region comprises a first polynucleotide sequence
and a second polynucleotide sequence complementary to the first polynucleotide sequence, which first and second polynucleotide
sequences collectively comprise the target region and a recognition site for a first site-specific endonuclease; and wherein
the circular nucleic acid comprises a first primer binding sequence;

b) binding a first primer to the first primer binding sequence;
c) performing polymerase-mediated template-directed primer extension of the first primer with a polymerase comprising strand
displacement activity, thereby producing a first nucleic acid product comprising at least two copies of the first polynucleotide
sequence and the second polynucleotide sequence, at least one copy of each of which is not base paired to the template;

d) cutting the first product with the first endonuclease and releasing at least one first product hairpin having at least
one single-stranded hairpin end region, a double-stranded region that comprises the target region, a free 5? terminus, and
a free 3? terminus; and

e) circularizing the at least one first product hairpin, thereby producing at least one first circular progeny nucleic acid.
US Pat. No. 9,744,126


Otonomy, Inc., San Diego...

1. An intratympanic composition for use in the treatment of an otic disorder, the intratympanic composition comprising
a multiparticulate anti-inflammatory corticosteroid in the form of micronized and non-coated particles; and
an auris acceptable gel; wherein the auris acceptable gel is an auris acceptable hydrogel; and the intratympanic composition
has a pH between 7.0 and 8.0.

US Pat. No. 9,487,522


The Regents of the Univer...

1. A pharmaceutical compound, a formulation, or a composition comprising: 3-[(4,5-dimethoxy-3-oxo-1H-isobenzofuran-1-yl)amino]-4-methylbenzoic
acid; 2-ethoxy-5-(4-phenylpiperidine-1-sulfonyl)benzoic acid; 3-[bis(2-methoxyethyl)sulfamoyl]benzoic acid; or any combination
thereof, or any analog or derivative thereof, or a stereoisomer or a bioisostere thereof.

US Pat. No. 9,403,815


The Regents of the Univer...

1. A compound having a structure corresponding to Formula (I):
(A)-(B)-(C)-(D)  (I)
or a pharmaceutically acceptable salt or prodrug thereof:
Wherein A is:

Wherein each E is independently N, NR, C, or CR1 , provided that two or three E's are N or NR;

N is nitrogen; C is carbon; R is hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted
or unsubstituted alkynyl, substituted or unsubstituted alkoxy, substituted or unsubstituted alkylamino, substituted or unsubstituted
cycloalkyl, or substituted or unsubstituted aryl;

Each R1 is independently hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted
alkynyl, substituted or unsubstituted alkoxy, substituted or unsubstituted alkylamino, substituted or unsubstituted cycloalkyl,
or substituted or unsubstituted aryl;

Wherein B is:

Wherein each G is independently CR2;

Each R2 is independently a hydrogen, halogen, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted
or unsubstituted alkynyl, substituted or unsubstituted alkoxy, substituted or unsubstituted alkylamido, substituted or unsubstituted
alkylamino, substituted or unsubstituted amino, substituted or unsubstituted alkylsulfide, substituted or unsubstituted alkyl
sulfinyl group, or substituted or unsubstituted alkyl sulfonyl group;

Wherein B is:

Wherein each G is independently CR3a;

Each R3a is independently a hydrogen, halogen, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted
or unsubstituted alkynyl, substituted or unsubstituted alkoxy, substituted or unsubstituted alkylamido, substituted or unsubstituted
alkylamino, substituted or unsubstituted amino, substituted or unsubstituted alkylsulfide, substituted or unsubstituted alkyl
sulfinyl group, or substituted or unsubstituted alkyl sulfonyl group;

Wherein each G is independently CR3b;

Each R3b is independently a hydrogen, halogen, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted
or unsubstituted alkynyl, substituted or unsubstituted alkoxy, substituted or unsubstituted alkylamido, substituted or unsubstituted
alkylamino, substituted or unsubstituted amino, substituted or unsubstituted alkylsulfide, substituted or unsubstituted alkyl
sulfinyl group, or substituted or unsubstituted alkyl sulfonyl group; or

Wherein each G is independently CR3c;

Each R3c is independently a hydrogen, halogen, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted
or unsubstituted alkynyl, substituted or unsubstituted alkoxy, substituted or unsubstituted alkylamido, substituted or unsubstituted
alkylamino, substituted or unsubstituted amino, substituted or unsubstituted alkylsulfide, substituted or unsubstituted alkyl
sulfinyl group, or substituted or unsubstituted alkyl sulfonyl group; and

Wherein C is:

Wherein R4 is hydrogen, halogen, substituted or unsubstituted alkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted
aryl, or substituted or unsubstituted alkoxy; and

Wherein D is:

Wherein R5 is a hydrogen, substituted or unsubstituted alkyl, or substituted or unsubstituted cycloalkyl;

R6a and R6b are independently a hydrogen, substituted or unsubstituted alkyl, or substituted or unsubstituted cycloalkyl;

Wherein R7 is a hydrogen, substituted or unsubstituted alkyl, or substituted or unsubstituted cycloalkyl;

M is independently CHR8;

Each R8 is independently a hydrogen, halogen, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted
or unsubstituted alkynyl, or substituted or unsubstituted alkoxy; or

Where R9 is a hydrogen, halogen, or a substituted or unsubstituted alkyl;

J is independently CH or N;
Z is independently CHR10;

Each R10 is independently a hydrogen, halogen, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted
or unsubstituted alkynyl, or substituted or unsubstituted alkoxy.

US Pat. No. 9,300,251



13. A frequency conversion device comprising:
a substrate;
a ferromagnetic film of a first type disposed over a surface of the substrate;
a ferromagnetic film of a second type disposed over the surface of the substrate;
an insulator disposed over the ferromagnetic film of the first type and of the second type;
a first microstrip antenna disposed over the insulator at a location above the ferromagnetic film of the first type; and
a second microstrip antenna disposed over the insulator at a location above the ferromagnetic film of the second type.
US Pat. No. 9,488,908


The Regents of the Univer...

1. A method of forming a supramolecular nanocomposite thin film comprising:
mixing a block copolymer polystyrene-b-poly-4-vinylpyridine (PS-b-P4VP) with 3-pentadecylphenol (PDP) and nanoparticles in
a solution;

spin-coating the mixed solution onto a substrate; and
solvent annealing the thin film by injecting chloroform (CHCl3) solvent, wherein the amount of solvent infected is varied from approximately 0.01 to 5 mL to control a swelling rate of
the thin film.

US Pat. No. 9,718,094



1. A structured article comprising:
a substrate comprising a surface comprising parallel facets characterized by a pitch, ?, having units of nanometers and corresponding
to the separation between adjacent facets; and an annealed block copolymer film comprising a surface contacting the substrate
surface comprising parallel facets;

wherein the annealed block copolymer film comprises linear microdomains parallel to the substrate surface and orthogonal to
the parallel facets;

wherein the block copolymer in bulk comprises a hexagonal array of cylindrical microdomains characterized by a center-to-center
spacing, L2, of adjacent cylindrical microdomains, wherein L2 has units of nanometers;

wherein ?/L2 is either less than or equal to 0.73 or greater than or equal to 1.4; and

wherein the structured article is prepared by a method comprising
forming a block copolymer film on the substrate surface comprising parallel facets; and
annealing the block copolymer film to form the annealed block copolymer film.

US Pat. No. 9,315,671


The Regents of the Univer...

1. A composition compound comprising of the formula:

wherein x, y=F, Cl, Br, I,

and R=-Alkyl, -OAlkyl, -SAlkyl, Z=—CR2, NR, —SiR2, —CR?CR—.

US Pat. No. 9,254,280


The Regents of the Univer...

1. A composition comprising a synergistic combined amount of fisetin and docosahexaenoic acid (DHA) in a ratio effective in
reducing cognitive defects.
US Pat. No. 9,193,956



1. A recombinant adeno-associated virus (rAAV) virion comprising:
a) a variant AAV capsid protein, wherein the variant AAV capsid protein comprises a peptide insertion relative to a corresponding
parental AAV capsid protein, wherein the peptide insertion comprises the amino acid sequence LGETTRP (SEQ ID NO:13), wherein
the insertion site is located between two adjacent amino acids at a position between amino acids corresponding to amino acids
570 and 611 of VP1 of AAV2 or the corresponding position in the capsid protein of another AAV serotype, and wherein the variant
capsid protein confers increased infectivity of a retinal cell compared to the infectivity of the retinal cell by an AAV virion
comprising the corresponding parental AAV capsid protein, wherein the retinal cell is a photoreceptor, a retinal ganglion
cell, a Müller cell, a bipolar cell, an amacrine cell, a horizontal cell, or a retinal pigmented epithelium cell; and

b) a heterologous nucleic acid comprising a nucleotide sequence encoding a gene product.

US Pat. No. 9,170,312


The Board of Trustees of ...

1. A method for imaging a substrate and product over time, comprising:
magnetically tagging the substrate and product with at least one magnetic gradient where magnetically tagging provides a tag-dependent
signal phase for the substrate and a different tag-dependent signal phase for the product;

providing at least one readout of magnetically tagged substrate and product over time; and
using tag-dependent signal phase to determine product that has been transformed from magnetically tagged substrate and substrate
that has been transformed from magnetically tagged product over time.

US Pat. No. 9,452,587


The Regents of the Univer...

1. A fiber reinforced elastic composite material comprising:
a multiplicity of fiber ply layers, each fiber of each layer being rotated along the longitudinal axis at a desired angle
relative to the next adjacent layer, each extending longitudinally over the composite, wherein the fiber ply layers are substantially
left-handed helicoidal, substantially right-handed helicoidal, or where a portion are substantially left-handed helicoidal
while another portion are substantially right-handed helicoidal; and

a matrix comprising an elastic material having a modulus of elasticity that is lower than that of the fiber that substantially
fills the interstitial spaces between the fibers.

US Pat. No. 9,295,604


Ekso Bionics, Inc., Rich...

1. A method of controlling a powered exoskeleton configured to be coupled to lower limbs of a person comprising:
establishing a control parameter based on monitoring at least one of: positional changes in an arm portion of the person,
positional changes in a head of the person, an orientation of a walking aid employed by the person, a contact force between
a walking aid employed by the person and a support surface, a force imparted by the person on a walking aid used by the person,
a force imparted by the person on a walking aid used by the person, a relative orientation of the exoskeleton, moveable components
of the exoskeleton and the person, and relative velocities between the exoskeleton, moveable components of the exoskeleton
and the person;

determining a desired movement for the lower limbs of the person based on the control parameter; and
controlling the exoskeleton to impart the desired movement.

US Pat. No. 9,296,133


The Regents of the Univer...

1. A method for batch fabrication of three-dimensional shells used as vibrational membranes for a vibratory sensor comprising:
defining a plurality of cavities of a predetermined volume into a substrate prior to glassblowing;
disposing a planar thermoplastically deformable layer over the substrate and trapping a gas in the cavities of a predetermined
volume; and

inflating the three-dimensional shells through the planar thermoplastically deformable layer by heating the thermoplastically
deformable layer to a plastic state and the gas in the plurality of cavities,

wherein inflating the three-dimensional shells through the planar thermoplastically deformable layer inflates the three-dimensional
shells to form spherical three-dimensional shells and further comprising etching away or physically removing an upper portion
of the spherical three-dimensional shells to form hemispherical three-dimensional shells.

US Pat. No. 9,284,604


The Regents of the Univer...

1. A method of identifying a cellular nascent RNA transcript, comprising:
(a) arresting transcription in a cell;
(b) purifying a native cellular nascent RNA transcript; and
(c) sequencing said native cellular nascent RNA transcript thereby identifying the cellular nascent RNA transcript;
wherein said native cellular nascent RNA transcript is purified as part of an RNA polymerase complex, wherein said cellular
nascent RNA transcript does not comprise a labeled nucleotide and wherein said cellular nascent RNA transcript is not crosslinked
to an RNA polymerase complex.

US Pat. No. 9,205,119


Rutgers, The State Univer...

1. A method for treating a neurological or neurodegenerative disease or disorder, the method comprising administering to a
subject suffering from the disease or disorder a composition comprising a therapeutically effective amount of a compound according
to Formula (I), (II), or (III) as a neuroprotective agent:
or a pharmaceutically acceptable salt or solvate thereof, wherein:
R1, at each occurrence, is independently hydrogen or C1-6 alkyl;

R2, R3, and R4 are each independently hydrogen or R5C(O)—;

R5 is selected from C1-6 alkyl, C6-10 aryl, or 5- to 10-membered heteroaryl, wherein the alkyl is optionally substituted by one, two, or three substituents independently
selected from hydroxyl, halo, C1-4 alkoxy, and —CO2R6, and wherein the aryl or heteroaryl is each optionally substituted by one to five substituents independently selected from
C1-4 alkyl, hydroxyl, halo, C1-4 alkoxy, and —CO2R6; and

R6 is hydrogen or C1-4 alkyl; and

wherein the neurodegenerative disease or disorder is stroke, paralysis, or cognitive memory deterioration.

US Pat. No. 9,498,144


The Regents of the Univer...

1. A method of reconstructing cardiac activation information, the method comprising:
accessing, by a computing device, an analysis cardiac signal and a reference cardiac signal obtained from a patient;
processing, by the computing device, the analysis cardiac signal and the reference cardiac signal to determine a first point
of change in the analysis cardiac signal at which a derivative of the analysis cardiac signal diverges with respect to a derivative
of the reference cardiac signal, the derivative of the analysis cardiac signal and the derivative of the reference cardiac
signal being one of zero, first, and second order derivative;

processing, by the computing device, the analysis cardiac signal and the reference cardiac signal to determine a second point
of change in the analysis cardiac signal at which a different derivative of the analysis cardiac signal diverges with respect
to a different derivative of the reference cardiac signal, the different derivative of the analysis cardiac signal and the
different derivative of the reference cardiac signal being a different one of zero, first, and second order derivative; and

assigning an activation onset time in the analysis cardiac signal at a point based on a mathematical association of the first
point of change and the second point of change to define cardiac activation indicating a beat in the analysis cardiac signal.

US Pat. No. 9,346,858


Cornell Research Foundati...

1. A recombinant expression vector comprising a heterologous polynucleotide molecule encoding a polypeptide comprising an
amino acid sequence greater than 90% identical to the amino acid sequence set forth as SEQ ID NO: 8.

US Pat. No. 9,260,688



1. A microfluidic culture system for providing an environment for one or more of biologic growth or analysis or manipulation,
the system comprising:
(a) a plurality of culture units, at least one of said culture units comprising:
(i) a culture area having a culture area inlet, the culture area inlet configured to allow passage of cells or other culture
objects into the culture area; and

(ii) a flow channel having a flow channel inlet and a separate flow channel outlet, the flow channel inlet, the flow channel
outlet, and the flow channel separated from the culture area and the culture area inlet by:

(1) a micro fluidic passage structure substantially surrounding the culture area and positioned between the culture area and
the flow channel;

(2) wherein the micro fluidic passage structure comprises one or more micro passages providing fluidic connection between
the flow channel and the culture area;

(b) wherein the micro fluidic passage structure separates the flow channel inlet from the culture area inlet and the culture

(c) wherein the micro fluidic passage structure separates the flow channel outlet from the culture area inlet and the culture

(d) wherein the micro fluidic passage structure is configured to prevent culture objects from passing between the flow channel
and the culture area; and

(e) wherein the flow channel is configured such that fluid input in the flow channel inlet flows to the flow channel outlet
without passing through the culture area inlet while the fluid is in fluidic communication with the culture area through the
micro fluidic passage structure.

US Pat. No. 9,050,300


The Regents of The Univer...

1. A method of increasing the rate of bone formation in vertebrate tissue, comprising applying to a tissue a peptide having
the sequence of SEQ ID NO: 11, or a fragment thereof, and a dose of least one bone growth factor, wherein the combination
results in a faster rate of bone formation than treatment with the same dose of the at least one bone growth factor alone.
US Pat. No. 9,867,778


OTONOMY, INC., San Diego...

1. A method of treating an otic disease or condition in a pediatric patient, wherein the otic disease or condition is selected
from acute otitis media with tympanostomy tubes or otitis media requiring tympanostonmy tube placement, the method comprising
intratympanically administering to the pediatric patient a composition comprising poloxamer 407 and a therapeutically effective
amount of multiparticulate ciprofloxacin, wherein the multiparticulate ciprofloxacin is non-microencapsulated, and wherein
the composition provides a sustained release of ciprofloxacin in the ear for a period of at least 5 days after a single intratympanic

US Pat. No. 9,490,454


The Regents of the Univer...

1. An organic light emitting device, comprising:
a transparent composite electrode comprising metal wires, carbon particles, light scattering particles, and a polymer support,

the carbon particles comprise at least one particle selected from a carbon nanotube, graphite powder, and graphene,
the metal wires are applied to the carbon particles to form a porous bilayer,
the polymer support comprises a polymer matrix, the polymer matrix containing the light scattering particles and the polymer
matrix coupled to the porous bilayer to form a composite film;

at least one semiconductive active layer electrically coupled to the transparent electrode; and
a second electrode electrically coupled to the active layer, wherein the organic light emitting device is fabricated using
a process comprising:

depositing the carbon particles on a surface of a platform to form a carbon layer;
applying the metal wires to the carbon layer to form a porous bilayer;
coupling the porous bilayer to the polymer matrix containing the light scattering particles to form the composite film;
removing the composite film from the platform, wherein the surface of the composite film that is removed from the surface
of the platform is smooth with average surface height variations of 20 nm or less;

applying the at least one semiconductive active layer to the carbon layer; and
depositing the second electrode on the active layer.
US Pat. No. 9,296,693


The Regents of the Univer...

1. A compound, the compound being 1-(1-cyclopropanecarbonylpiperidin-4-yl)-3-(4-(trifluoromethyl)phenyl)urea, or salts and
isomers thereof.

US Pat. No. 9,724,408



1. A compound of the formula
where R1 and R2 are each H,or a pharmaceutically acceptable salt thereof.