US Pat. No. 9,254,496

ARTICLES FOR MANIPULATING IMPINGING LIQUIDS AND METHODS OF MANUFACTURING SAME

Massachusetts Institute o...

1. An article comprising a non-wetting surface having a dynamic contact angle of at least about 90°, said surface comprising
non-wetting features, said surface patterned with macro-scale features having a length scale Lm that is larger than a length scale Ln of the non-wetting features, the macro-scale features being configured to induce controlled asymmetry in a liquid film produced
by impingement of a droplet onto the surface, thereby reducing contact time tc between the droplet and the surface to a value lower than
2.2((?R?3)/?)?(½)(1+?/4)
where the droplet has a radius R, density ?, surface tension ?, and the patterned surface having a pinning fraction ? of zero.

US Pat. No. 9,434,736

COMPOUNDS, COMPOSITIONS AND METHODS OF AGELASTATIN ALKALOIDS

Massachusetts Institute o...

1. A method comprising:
administering to a subject in need thereof a therapeutically effective amount of a compound of formula I:
or a pharmaceutically acceptable salt thereof,
wherein:
R1 is —H or —CH3;

R2 is —OH or —OCH3;

R3 is —H or —OH; and

R4 is —H when R1 is H, or —Br when R1 is —CH3; and

wherein said method treats blood cancer, inhibits growth of blood cancer cells, inhibits proliferation of blood cancer cells,
promotes apoptosis of blood cancer cells, arrests cell cycle in blood cancer cells, or induces arrest in G2/M phase in blood
cancer cells, or any combination thereof.

US Pat. No. 9,112,329

THULIUM LASER

Massachusetts Institute o...

1. A method of generating light from a gain medium comprising crystalline material doped with thulium, the thulium having
a 3H4 manifold, a 3H6 manifold, and a 3F4 manifold, the method comprising:
(A) pumping the gain medium with a pump beam at a pump wavelength of less than about 820 nm so as to stimulate emission of
light from the thulium at an output wavelength of about 800 nm to about 850 nm via a laser transition in the thulium from
the 3H4 manifold to the 3H6 manifold; and

(B) limiting a population of the thulium in the 3F4 manifold to a predetermined level so as to mitigate accumulation of the thulium in the 3F4 manifold via relaxation of the thulium from the 3H4 manifold.

US Pat. No. 9,359,198

CARRIER-SUBSTRATE ADHESIVE SYSTEM

Massachusetts Institute o...

20. A method of detaching a membrane attached to a permeable carrier with a bonding agent, comprising:
causing said bonding agent to transition from a solid to a gas in order to release said membrane from said permeable carrier,
wherein gasses from said bonding agent pass into or through said permeable carrier.

US Pat. No. 9,352,258

LIQUID COLLECTING PERMEABLE STRUCTURES

MASSACHUSETTS INSTITUTE O...

12. A method of making a device for collecting droplets of a liquid from an aerosol, comprising:
identifying aerosol conditions, wherein the conditions include an average droplet size of the aerosol and a wind velocity
of the aerosol;

selecting a characteristic radius, a characteristic spacing, and a characteristic spacing for strands of an aerosol-permeable
structure, so as to provide efficient droplet collection for the identified conditions;

selecting a material having a low contact angle hysteresis for the liquid; and
applying the material to form the outermost surface of the strands,
wherein the material and the characteristic spacing are selected such that liquid droplets adhered to the structure will drain
from the structure under gravity.

US Pat. No. 9,067,955

COPPER-CATALYZED FORMATION OF CARBON-HETEROATOM AND CARBON—CARBON BONDS

Massachusetts Institute o...

1. A method comprising the step of reacting Z-X with
in the presence of a catalyst, a base, and a solvent, thereby forming

wherein
X represents I, Cl, alkylsulfonate, or arylsulfonate;
Z represents optionally substituted aryl, heteroaryl or alkenyl;
L represents H or a negative charge;
catalyst comprises a copper atom or ion, and a chelating ligand, wherein the chelating ligand is an optionally substituted
aryl alcohol, alkyl amine, 1,2-diamine, 1,2-aminoalcohol, or 1,10-phenanthroline; and the chelating ligand is not the solvent;

base is a carbonate, phosphate, oxide, hydroxide, alkoxide, aryloxide, amine, metal amide, fluoride, or guanidine;
R represents H, optionally substituted alkyl, cycloalkyl, aralkyl, aryl, or heteroaryl;
R? represents independently for each occurrence H, alkyl, cycloalkyl, aralkyl, aryl, or heteroaryl, formyl, acyl, —CO2R?, —C(O)N(R)2, sulfonyl, —P(O)(OR?)2, —CN, or —NO2, provided that at least one occurrence of R? represents formyl, acyl, —CO2R?, —C(O)N(R)2, sulfonyl, —P(O)(OR?)2, —CN, or —NO2;

R? represents independently for each occurrence optionally substituted alkyl, cycloalkyl, aralkyl, aryl, or heteroaryl; and
C(R?)2(R) taken together may represent nitrile.

US Pat. No. 9,324,005

COMPLEX-VALUED PHASE-BASED EULERIAN MOTION MODULATION

Massachusetts Institute o...

1. A method of amplifying temporal variation in at least two images, the method comprising:
converting at least two images to a transform representation in a transform domain;
for each particular spatial position within the at least two images, examining a plurality of coefficient values representing
a neighborhood of the spatial position, the neighborhood of the spatial position being spatially the same across each of the
at least two images;

calculating a first vector in the transform domain based on the plurality of coefficient values representing the particular
spatial position, the first vector representing change from a first image to a second image of the at least two images describing
deformation;

modifying the first vector to create a second vector in the transform domain representing amplified movement at the particular
spatial position between the first and second images;

calculating a second plurality of coefficients based on the second vector of the transform domain; and
from the second plurality of coefficients, generating an output image showing motion amplified according to the second vector
for each particular spatial position and alternatively amplified color variation between the first and second images.

US Pat. No. 9,065,093

CONTROLLED POROSITY IN ELECTRODES

Massachusetts Institute o...

1. An electrode, comprising:
a matrix material comprising high-tortuosity pores having tortuosities of at least 2; and
a plurality of low-tortuosity pores having tortuosities of less than 1.5 extending through the matrix material and from a
first external geometric surface of the electrode to a second external geometric surface of the electrode, wherein:

the electrode has a total porosity of from 20% to 60%, and
the percentage of the total porosity that is occupied by the low-tortuosity pores is from 20% to 80%.
US Pat. No. 9,132,197

SILK FIBROIN MATERIALS AND USE THEREOF

Massachusetts Institute o...

1. A method of preparing a porous article comprising silk fibroin, the method comprising: (a) casting a solution comprising
silk fibroin into a mold, wherein the mold contains a water soluble porogen; (b) removing solvent from the solution in the
mold, thereby forming a porogen/silk fibroin composite; and (c) leaching out the porogen from said porogen/silk fibroin composite.

US Pat. No. 9,484,489

ENGINEERED BAND GAPS

Massachusetts Institute o...

1. An optoelectronic device comprising:
a first semiconducting atomically thin layer having a first lattice direction;
a second semiconducting atomically thin layer having a second lattice direction, wherein the second semiconducting atomically
thin layer is proximate the first semiconducting atomically thin layer, and wherein an angular difference between the first
lattice direction and the second lattice direction is between about 0.000001° and 0.5°, or about 0.000001° and 0.5° of a Vicnal
angle of the first and second semiconducting atomically thin layers;

a first charge carrier conductor in electrical communication with the first semiconducting atomically thin layer; and
a second charge carrier conductor in electrical communication with the second semiconducting atomically thin layer.
US Pat. No. 9,434,985

METHODS OF IDENTIFYING INTERACTIONS BETWEEN GENOMIC LOCI

University of Massachuset...

1. A method for identifying interaction frequencies, comprising:
a) providing;
i) a nuclear matrix comprising a first genomic region and a second genomic region; and
ii) a junction marker labeled with an affinity marker for selective purification of a ligation product;
b) fragmenting said first genomic region and said second genomic region into a plurality of first genomic region fragments
and a plurality of second genomic region fragments;

c) ligating said junction marker between at least one of said first genomic region fragments and at least one of said second
genomic region fragments to create said ligation product;

d) purifying said ligation product with said affinity marker;
and
e) analyzing said ligation product under conditions such that a genomic interaction frequency for said ligation product is
identified.

US Pat. No. 9,512,039

OLIGOCRYSTALLINE CERAMIC STRUCTURES FOR ENHANCED SHAPE MEMORY AND PSEUDOELASTIC EFFECTS

Massachusetts Institute o...

1. A mechanical structure comprising:
a crystalline ceramic material that is capable of undergoing a reversible martensitic transformation and forming martensitic
domains, during such martensitic transformation, that have an average elongated domain length; and the crystalline ceramic
material being configured as an oligocrystalline ceramic material structure having a total structural surface area that is
greater than a total grain boundary area in the oligocrystalline ceramic material structure, the oligocrystalline ceramic
material structure including an oligocrystalline ceramic structural feature having an extent that is less than the average
elongated domain length of the crystalline ceramic material.

US Pat. No. 9,385,538

WIRELESS ENERGY TRANSFER

Massachusetts Institute o...

1. A wireless power system comprising:
a source resonator and a power supply coupled to the source resonator to provide power to the source resonator, the source
resonator having a resonant frequency ?1, an intrinsic loss rate ?1, and an intrinsic quality factor Q1=?1/(2?1), the source resonator comprising at least one loop of conductive material; and

a device resonator and a load coupled to the device resonator to receive power from the device resonator and provide power
to the load, the device resonator having a resonant frequency ?2, an intrinsic loss rate ?2, and an intrinsic quality factor Q2=?2/(2?2), the device resonator comprising at least one loop of conductive material,

wherein the device resonator is configured to be movable relative to the source resonator over a range of distances D between
the source resonator and the device resonator,

wherein the source resonator and the device resonator are configured to resonantly and wirelessly couple electromagnetic power
from the source resonator to the device resonator using non-radiative electromagnetic induction having a coupling coefficient
?, and wherein the intrinsic loss rates satisfy ?/?{square root over (?1?2)}>1 over the range of distances D, and

wherein the power provided to the load from the device resonator defines a work drainage rate ?w, and wherein the work drainage rate?w, is configured to be set such that ?w=?2?{square root over (1+wp·(?2/?1·?2))} for some value of the coupling coefficient ? in the range of distances D, wherein wp is a parameter satisfying wp>1.

US Pat. No. 9,446,031

COMPOSITIONS AND METHODS FOR NEOVASCULARIZATION

National University of Si...

1. A method of inducing angiogenesis at a site in an individual in need thereof comprising administering locally to the site
an effective amount of ciclopirox olamine (CPX) and sphingosine 1-phosphate (S1P).

US Pat. No. 9,072,984

BUBBLE-COLUMN VAPOR MIXTURE CONDENSER

Massachusetts Institute o...

1. A method for condensing a fluid from a carrier-gas stream, comprising:
bubbling a carrier-gas stream comprising a condensable fluid in vapor phase through a first bath of the fluid in liquid phase
in a first stage of a bubble-column condenser, wherein the carrier-gas stream contacts the first bath, and wherein some of
the fluid in vapor phase in the carrier-gas stream condenses into the first bath;

exhausting the carrier-gas stream with a reduced content of the fluid in vapor phase from the first stage of the bubble-column
condenser; and

passing a coolant through a conduit that passes through the liquid in the first stage to recover energy from condensation
in the condenser to the coolant passing through the conduit.

US Pat. No. 9,284,541

METHODS AND COMPOSITIONS FOR PROTEIN LABELING USING LIPOIC ACID LIGASES

Massachusetts Institute o...

1. An isolated lipoic acid ligase mutant that uses resorufin as a substrate, the mutant comprising an amino acid sequence
that is at least 85% identical to SEQ ID NO:11 and includes mutations at residues corresponding to E20 and F147 in SEQ ID
NO:11.
US Pat. No. 9,333,179

AMPHIPHILIC COMPOUND ASSISTED NANOPARTICLES FOR TARGETED DELIVERY

Massachusetts Institute o...

1. A nanoparticle comprising:
a first covalent conjugate having the following formula: lipid—hydrophilic polymer—targeting moiety;
a second covalent conjugate having the following formula: lipid—hydrophilic polymer;
wherein the hydrophilic polymer of the first and second conjugates is a poly(ethylene glycol) polymer;
a hydrophobic core comprising a polyester and an agent selected from the group consisting of a therapeutic agent, a diagnostic
agent, and a prophylactic agent;

an amphiphilic layer around the hydrophobic core, the layer comprising at least three amphiphilic components,
wherein a first amphiphilic component of the layer is a phospholipid, and
wherein a second amphiphilic component and a third amphiphilic component of the layer are the lipid portions of the first
and second covalent conjugates;

a hydrophilic outer layer comprising the hydrophilic polymer—targeting moiety portion of the first covalent conjugate and
the hydrophilic polymer portion of the second covalent conjugate;

wherein the weight ratio of the amphiphilic components of the amphiphilic layer to the polyester is about 0.05 to 0.34; and
wherein the diameter of the nanoparticle is between about 40 and 500 nanometers.

US Pat. No. 9,254,500

AEROSOL GENERATION FOR STABLE, LOW-CONCENTRATION DELIVERY

Massachusetts Institute o...

19. An aerosol generator for generating a stable, low-concentration aerosol, the aerosol generator comprising:
a source of a feed aerosol;
a source of a diluting gas;
a mix-enhancing swirler in communication both with the source of feed aerosol along a first axis and with the source of diluting
gas along a second axis oriented at an angle distinct from that of the first axis, wherein the mix-enhancing swirler is configured
to generate a swirling low-concentration aerosol formed of the feed aerosol and the diluting gas;

a mixing chamber in communication with the mix-enhancing swirler and configured to mix and dry the low-concentration aerosol;
a flow straightener in connection with the mixing chamber and configured to straighten flow of the low-concentration aerosol
from the mixing chamber;

a delivery conduit configured to receive the straightened flow of the low-concentration aerosol from the flow straightener;
and

a particle detector configured to detect and count particles in the low-concentration aerosol flow through the delivery conduit,
wherein the particle detector is in electronic communication with the source of feed aerosol and with the source of diluting
gas to control flow of the feed aerosol and the diluting gas based on a count of the particles by the particle detector.

US Pat. No. 9,068,199

THERAPEUTIC RETROVIRAL VECTORS FOR GENE THERAPY

Bluebird Bio, Inc., Camb...

1. A self-inactivating (SIN)lentiviral vector comprising:
a) a modified 5? long terminal in (LTR), wherein the promoter of the modified 5? LTR is replaced with a heterologous promoter;
b) an RNA export element;
c) a lentiviral central polyurine tract or DNA FLAP (cPPT/FLAP);
d) a ?-globin promoter;
e) a ?-globin locus control region (LCR), wherein the ?-globin promoter and ?-globin LCR are operatively linked to a gene
of interest; and

f) a modified 3? LTR, wherein the modified 3? LTR comprises at least one deletion compared to the wild-type 3? LTR.
US Pat. No. 9,452,198

LECTIN CONJUGATES FOR MUCIN HYDRATION

Massachusetts Institute o...

1. A method of treating dehydration of a mucosal surface of a human in need thereof, comprising contacting the mucosal surface
with an effective amount of a composition that includes a conjugate of a hydratable polymer and a mucin-binding fragment of
a lectin, thereby rehydrating the mucosal surface of the human.

US Pat. No. 9,285,290

LEAK DETECTION APPARATUS

Massachusetts Institute o...

1. Leak detection apparatus for deployment in a pipe comprising;
a carrier disposed for motion along the pipe;
a detector connected to move within the carrier in an axial direction, the detector comprising;
a drum mounted for rotation about pitch and yaw axes;
flexible material mounted on, and extending from, the drum; and
at least two sensors responsive to drum rotation;
wherein the flexible material will be drawn into contact with a wall of the pipe at a leak location thereby producing a torque
on the drum causing the drum to rotate and the at least two sensors to generate signals from which leak location is determined.

US Pat. No. 9,353,150

SUBSTITUTED PYRAZINO[1?,2?:1 ,5]PYRROLO[2,3-B]-INDOLE-1,4-DIONES FOR CANCER TREATMENT

Massachusetts Institute o...

1. A compound having the structure of formula I-a:

or a pharmaceutically acceptable salt thereof, wherein:
is a single bond or a double bond, as valency permits;
R1 is R, —C(O)R, —C(O)N(R)2—S(O)R, —S(O)2R, —S(O)2OR, —C(R)2OR, or —S(O)2N(R)2;

each R is independently hydrogen or a group selected from C1-20 aliphatic, C1-20 heteroalkyl, phenyl, a 3-7 membered saturated or partially unsaturated carbocyclic ring, an 8-14 membered bicyclic or polycyclic
saturated, partially unsaturated or aryl ring, a 5-6 membered mono cyclic heteroaryl ring having 1-4 heteroatoms independently
selected from nitrogen, oxygen, or sulfur, a 3-7 membered saturated or partially unsaturated heterocyclic ring having 1-3
heteroatoms independently selected from nitrogen, oxygen, or sulfur, a 7-14 membered bicyclic or polycyclic saturated or partially
unsaturated heterocyclic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, or sulfur, or an 8-14 membered
bicyclic or polycyclic heteroaryl ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, or sulfur; or:

two R groups are optionally taken together with their intervening atoms to form a 3-14 membered, saturated, partially unsaturated,
or aryl ring having, in addition to the intervening atoms, 0-4 heteroatoms independently selected from nitrogen, oxygen, or
sulfur;

R2 is hydrogen, —[C(R)2]q—OR, —[C(R)2]q—N(R)2, —[C(R)2]q—SR, —[C(R)2]q—OSi(R)3, —[C(R)2]q—OC(O)R, —[C(R)2]q—OC(O)OR, —[C(R)2]q—OC(O)N(R)2, —[C(R)2]q—OC(O)N(R)—SO2R or —[C(R)2]q—OP(OR)2;

each q is independently 0, 1, 2, 3, or 4;
R3 is —SO2R or —COCF3;

R4 is absent when is a double bond or is R or halogen;

R5 is absent when is a double bond or is hydrogen or a C1-6 aliphatic group;

each of R6 and R6? is independently R, halogen, —CN, —NO2, —OR, —SR, —N(R)2, —S(O)2R, —S(O)2N(R)2, —S(O)R, —C(O)R, —C(O)OR, —C(O)N(R)2, —C(O)N(R)—OR, —N(R)C(O)OR, —N(R)C(O)N(R)2, —N(R)S(O)2R, or —OSi(R)3; or

R6 and R6? are taken together to form ?O, ?C(R)2 or ?NR;

n is 0, 1, 2, 3, or 4;
each R7 is independently R, halogen, —CN, —NO2, —OR, —OSi(R)3, —SR, —N(R)2, —S(O)2R, —S(O)2OR, —S(O)2N(R)2, —S(O)R, —C(O)R, —C(O)OR, —C(O)N(R)2, —C(O)N(R)—OR, —N(R)C(O)OR, —N(R)C(O)N(R)2, —N(R)S(O)2R, —P(R)2, —P(OR)2, —P(O)(R)2, —P(O)(OR)2, —P(O)[N(R)2]2—B(R)2, —B(OR)2, or —Si(R)3;

R8 is —(S)m—Rx wherein m is 1, 2, or 3, and Rx is R, —SR, —C(O)R, —C(O)OR, —C(O)N(R)2, —C(S)R, —S(O)R, —S(O)2R, or —S(O)2N(R)2; and

R9 is —(S)p—Ry wherein p is 1, 2, or 3, such that the sum of m and p is 2, 3, or 4, and Ry is R, —SR, —C(O)R, —C(O)OR, —C(O)N(R)2, —C(S)R, —S(O)R, —S(O)2R, or —S(O)2N(R)2; or

R8 and R9 are taken together to form —S—, —(S)m—[C(R)2]q—(S)p—, —(S)m—(S)p—, —(S)m—C(O)—(S)p—, —(S)m—C(S)—(S)p—, —(S)m—S(O)—(S)p—, or —(S)m—S(O)2—(S)p—.

US Pat. No. 9,251,424

ASSISTED VIDEO SURVEILLANCE OF PERSONS-OF-INTEREST

Massachusetts Institute o...

1. A computer-implemented method for analyzing surveillance video data, the method comprising:
detecting one or more moving persons in a frame for each frame in a plurality of frames of the video data;
creating a record including image data from a subsection of the frame associated with the detected moving person for each
detected moving person and for each frame;

calculating values for a plurality of attributes characterizing each detected moving person by employing a probabilistic model
that matches attributes to image data in the record associated with the detected moving person;

receiving an attribute profile including a value for at least one attribute of a person, wherein the plurality of attributes
comprises the at least one attribute;

calculating a score for each record based on a comparison of the received attribute profile with the calculated values for
the plurality of attributes for the record; and

identifying one or more records as candidate matches to the person of interest based on the calculated scores.

US Pat. No. 9,306,145

METHODS OF SYNTHESIZING THERMOELECTRIC MATERIALS

The Trustees of Boston Co...

1. A method of fabricating a thermoelectric material comprising:
generating a plurality of nanoparticles from a starting material comprising one or more chalcogens and one or more transition
metals;

consolidating the nanoparticles under elevated pressure and temperature, wherein the nanoparticles are heated and cooled at
a controlled rate; and

annealing consolidated nanoparticles at a temperature lower than an elevated temperature of the consolidating step.

US Pat. No. 9,284,825

GAS-LIFT SAFETY VALVE ACTUATED BY A SENSOR

Massachusetts Institute o...

1. A valve actuator comprising:
a shape memory alloy element attachable to a valve body, capable of use with a valve to cause movement of the valve between
first and second positions responsive to at least a threshold amount of temperature change of the shape memory alloy element;

a sensor located within a well, the sensor capable of detecting the presence of a fluid based on a fluid property of the fluid;
and

a power supply electrically connected to the sensor and the shape memory alloy element, the power supply capable of applying
an electric current to the shape memory alloy element in response to the sensor detecting the presence of the fluid, the electric
current causing a temperature of the shape memory alloy element to increase beyond a threshold temperature at which the shape
memory alloy element actuates, thereby causing movement of the valve between the first and second positions, when the shape
memory alloy element cools to below the threshold temperature, the shape memory alloy element causes the valve to be in an
open position using a negative differential spring.

US Pat. No. 9,464,136

ANTIBODY-BASED CONSTRUCTS DIRECTED AGAINST TYROSINE KINASE RECEPTORS

Massachusetts Institute o...

1. A bispecific antibody that specifically binds a first epitope on EGFR recognized by cetuximab and specifically binds a
second, non-overlapping epitope on EGFR recognized by monoclonal antibody 806 (mAb 806), wherein the bispecific antibody comprises,
an IgG and a scFv, wherein the IgG comprises a heavy chain comprising the three heavy chain complementarity determining regions
(CDRs) of cetuximab and a light chain comprising the three light chain CDRs of cetuximab, wherein the scFv comprises the three
heavy and three light chain CDRs of mAb 806, and wherein
(i) the scFv is fused, directly or indirectly, to the carboxy terminus of the IgG heavy chain; or
(ii) the scFv is fused, directly or indirectly, to the carboxy terminus of the IgG light chain.

US Pat. No. 9,099,601

THERMOELECTRIC MATERIALS AND METHODS FOR SYNTHESIS THEREOF

The Trustees of Boston Co...

1. A thermoelectric material having a general formula Tl0.02Pb0.98Te1-xSexSi0.02Naz, where
x has a value from 0 to 1,
and
z has a value of 0.015, 0.020, or 0.025.
US Pat. No. 9,463,160

DOSAGE FORM EXHIBITING RAPID DISPERSE PROPERTIES, METHODS OF USE AND PROCESS FOR THE MANUFACTURE OF SAME

Massachusetts Institute o...

3. A pharmaceutical composition comprising:
a dispersing non-compressed solid matrix comprising a bulk powder material, a water soluble binder material and one or more
active ingredients, wherein:

at least one of the binder material and/or the one or more active ingredients are three-dimensionally printed within the matrix
according to one or more predetermined patterns, wherein the matrix has a hardness of about 1 to about 20 kp, the pharmaceutical
composition has a porosity of 10%-90%, and the composition disperses within about ninety seconds upon contact of said composition
with moisture, wherein:

a) the matrix is made according to a process comprising:
a1) providing one or more layers comprising a mixture of bulk powder material and water soluble binder material;
a2) according to the one or more predetermined patterns, applying binding fluid to the one or more layers using a three-dimensional
printing technique, the binding fluid comprising a mixture of at least one active ingredient, pharmaceutically acceptable
solvent and water soluble binder, and

a3) evaporating the solvent to provide the dispersing non-compressed solid matrix; or
b) the matrix is made according to a process comprising:
b1) providing one or more layers comprising a mixture of bulk powder material and at least one active ingredient;
b2) according to the one or more predetermined patterns, applying binding fluid to the one or more layers using a three-dimensional
printing technique, the binding fluid comprising a mixture of water soluble binder and pharmaceutically acceptable solvent;
or comprising a mixture of water soluble binder, pharmaceutically acceptable solvent and at least one active ingredient; and

b3) evaporating the solvent to provide a rapidly dispersing non-compressed solid matrix.

US Pat. No. 9,360,611

SYSTEM, METHOD AND APPARATUS FOR CONTRAST ENHANCED MULTIPLEXING OF IMAGES

Massachusetts Institute o...

1. A microscope comprising:
an objective lens for receiving and collimating electromagnetic radiation emitted or scattered from an object of interest;
a volume hologram with one or more multiplexed holographic gratings to receive and diffract the collimated electromagnetic
radiation;

a relay system to receive and relay the diffracted collimated electromagnetic radiation from the volume hologram to a relayed
conjugate plane of the volume hologram's pupil;

a pupil filter located at the relayed conjugate plane of the volume hologram's pupil to receive and filter the relayed collimated
electromagnetic radiation from the relay system; and

a focusing lens to focus onto an imaging plane the collimated electromagnetic radiation that passes through the pupil filter,
and

wherein the pupil filter is disposed along the optical path between the relay system and the focusing lens.

US Pat. No. 9,478,229

METHODS AND APPARATUS FOR RECORDING IMPULSIVE SOUNDS

Massachusetts Institute o...

1. A portable system for continuously recording sound pressure due to both continuous noise and impulse noise in an environment,
the portable system comprising:
a first microphone to produce a first analog signal representative of impulse noise sound pressure in a first amplitude range
from about 100 dB to about 180 dB;

a second microphone to produce a second analog signal representative of continuous noise sound pressure in a second amplitude
range from about 20 dB to about 140 dB, the second amplitude range being different from the first amplitude range;

at least one analog-to-digital converter (ADC), operably coupled to the first microphone and the second microphone, to sample:
the first analog signal at a first sampling rate equal to or greater than twice the reciprocal of a minimum impulse noise
rise time in the first analog signal, thereby generating a first digital signal; and

the second analog signal at a second sampling rate equal to or greater than twice the reciprocal of a minimum impulse noise
rise time in the second analog signal, thereby generating a second digital signal;

a combining node, operably coupled to the at least one ADC, to combine the first digital signal and the second digital signal
into a combined digital signal having a combined amplitude range, the combined amplitude range being larger than the first
amplitude range, larger than the second amplitude range, and less than or about equal to the sum of the first amplitude range
and the second amplitude range, the combined digital signal representing both the continuous noise and the impulse noise in
the environment; and

a processor, operably coupled to the combining node, to store a representation of the combined digital signal in a nonvolatile
memory.

US Pat. No. 9,289,946

AUTOMATED THREE-DIMENSIONAL PRINTER PART REMOVAL

Massachusetts Institute o...

1. Three-dimensional printing system comprising:
a printing surface on which a part is made;
a printing device supported for controlled movement with respect to the printing surface to print the part on the printing
surface; and

a blade supported for motion only across the printing surface while remaining in contact with the printing surface throughout
the motion to traverse the printing surface and to engage and release the part from the printing surface.

US Pat. No. 9,263,614

IN-FIBER FILAMENT PRODUCTION

Massachusetts Institute o...

1. A structure comprising:
a fiber preform, having a preform diameter, the fiber preform including a fiber matrix material and a continuous layer of
filament material having first and second faces and arranged with the fiber matrix material adjacent to each of the first
and second faces, the continuous filament material layer having a thickness and a viscosity that enforce breakup of the continuous
filament material layer into an array of in-fiber filaments upon drawing of the preform into a fiber;

a draw-down region connecting the fiber preform and a fiber; and
the fiber, having a fiber length and a fiber diameter that is less than the preform diameter, the fiber including an array
of in-fiber filaments extending the fiber length, each filament in the array consisting of the filament material and circumferentially
separated from other filaments by the fiber matrix material of the fiber preform.

US Pat. No. 9,395,286

DEVICE AND METHOD FOR SAMPLING BODILY FLUID FOR MEDICAL ANALYTES IN ULTRA LOW CONCENTRATIONS

Massachusetts Institute o...

1. A trapping device for capturing a medical analyte, comprising:
a structural substrate which has a twisted coil configuration; and
at least one binding agent affixed as part of a coating on the structural substrate, the binding agent being capable of binding
or attaching with the medical analyte,

wherein the trapping device is dimensioned and adapted for placement in a blood vessel in a patient, the trapping device being
configured to trap at least a portion of the medical analyte present in blood flowing through the blood vessel, and

wherein, following said placement, the twisted coil comprises loops that cross back and forth across a lumen of the blood
vessel.

US Pat. No. 9,265,764

USES OF CHEMICALS TO MODULATE GSK-3 SIGNALING FOR TREATMENT OF BIPOLAR DISORDER AND OTHER BRAIN DISORDERS

Massachusetts Institute o...

9. A method for treating bipolar disorder in a subject, comprising administering a GSK-3 inhibitor having an IC50 of less than 1 mM to a subject in an effective amount to treat the bipolar disorder based on said subject being indicated
or diagnosed to have bipolar disorder, wherein the subject is non-responsive to lithium.

US Pat. No. 9,140,649

INFLATABLE MEMBRANE HAVING NON-UNIFORM INFLATION CHARACTERISTIC

Massachusetts Institute o...

1. A device comprising:
an inflatable membrane having a proximal end with an opening, a distal end disposed away from the opening, and an interior
accessible through the opening, wherein the inflatable membrane has an inflation characteristic that is non-uniform, thereby
causing the membrane to inflate in a predetermined manner, the predetermined manner including inflation at the distal end
before inflation at the proximal end;

a supply of a medium coupled to the interior through the opening; and
a three-dimensional scanning system including at least one scanner element disposed within the interior to capture data from
the interior and a processor programmed to calculate a three-dimensional shape of the interior based upon the data.

US Pat. No. 9,125,931

POST-TRANSCRIPTIONAL REGULATION OF RNA-RELATED PROCESSES USING ENCODED PROTEIN-BINDING RNA APTAMERS

MASSACHUSETTS INSTITUTE O...

1. A method comprising:
a) providing:
i) a biological cell comprising a ribonucleic acid sequence encoding an open reading frame for a protein of interest;
ii) an aptamer sequence ligated within one hundred bases of a 5? cap of said ribonucleic acid sequence, wherein said aptamer
sequence comprises a tetracycline inducible protein binding site and a stem loop, wherein said binding site is in a loop portion
of said stem loop, wherein said binding site comprises a first nucleotide sequence comprising the 5?-C/U-A/G/U-G/A-A/C/G-A-U/A-G/A-U/A-3?
consensus sequence and a second nucleotide sequence comprising the 5?-C/G/U-A/U/G-G-A-G-A-A-3? consensus sequence;

iii) a tetracycline repressor protein comprising a tetracycline binding site; and
iv) a tetracycline-based compound, wherein said compound is capable of binding to said tetracycline binding site;
b) binding said tetracycline repressor protein to said protein binding site wherein translation of said protein of interest
is reduced; and

c) contacting said tetracycline binding site with said tetracycline-based compound under conditions that relieves the translation
reduction of said protein of interest.

US Pat. No. 9,469,083

INVERTED NANOCONE STRUCTURES FOR MULTIFUNCTIONAL SURFACE AND ITS FABRICATION PROCESS

Massachusetts Institute o...

1. Method of fabricating nanotextured structures comprising:
making a roaster mold having an array of tapered structures to be replicated;
pressing the master mold, utilizing vacuum assisted wetting, into a curable polymer supported on a substrate;
curing the polymer; and
detaching the mold from the cured polymer to form the nanotextured structure further including forming re-entrant textured
surfaces on the nanotextured structure by pressing a rotating plate into the nanotextured structure.

US Pat. No. 9,198,568

METHODS AND SYSTEMS OF MATCHING VOICE DEFICITS WITH A TUNABLE MUCOSAL IMPLANT TO RESTORE AND ENHANCE INDIVIDUALIZED HUMAN SOUND AND VOICE PRODUCTION

The General Hospital Corp...

1. A method of providing a customized vocal treatment to a subject having a vocal dysfunction caused by a diminished pliability
or absence of phonatory mucosa, the method comprising
assessing both a cause of the subject's vocal dysfunction and the subject's vocal needs;
selecting a specific vocal implant to provide a mucosal tissue with sufficient pliability to produce an approximate desired
level of dynamic variation of vocal parameters of pitch or phonation threshold pressure, or both and vocal control in the
subject based on both the cause of the subject's vocal dysfunction and the subject's vocal needs, wherein the vocal implant
is a liquid, a gel, or a solution of one or more polymers; and

implanting the selected vocal implant in a location within glottal, supraglottal, subglottal, or pharyngeal mucosal tissue
in the subject that achieves the desired level of dynamic variation of vocal parameters and vocal control to provide a customized
vocal treatment specific to the subject's vocal dysfunction and needs.

US Pat. No. 9,272,022

COMPOSITIONS AND METHODS FOR TREATING CANCER AND MODULATING STRESS GRANULE FORMATION

Massachusetts Institute o...

1. A method of inhibiting stress granule formation in a subject comprising administering to said subject a therapeutically
effective amount of one or more poly-ADP-ribose polymerase (PARP)12 inhibitor(s) and/or one or more PARP13 inhibitor(s) wherein:
(a) said one or more PARP12 inhibitor(s) is (i) an antibody or an antibody fragment that selectively binds PARP12, or (ii)
an RNA aptamer comprising the sequence of any one of SEQ ID NOs: 99-106; and/or

(b) said one or more PARP13 inhibitor(s) is (i) an antibody or an antibody fragment that selectively binds PARP13.1 and/or
PARP13.2, or (ii) an RNA aptamer comprising the sequence of any one of SEQ ID NOs: 40 and 107-113, and

wherein said administering results in the inhibition of stress granule formation in said subject.

US Pat. No. 9,244,071

COMPOSITIONS AND METHODS FOR ASSESSING CYTOTOXICITY OF SINGLE CELLS

Massachusetts Institute o...

1. A method of assessing cytotoxicity of single cells using arrays of microwells, the method comprising steps of:
monitoring lysis of target cells in microwells that contain a single effector cell and at least one target cell; and
simultaneously profiling activation markers or secreted soluble mediators,
wherein the monitoring comprises a step of detecting lysis of said target cells by said single effector cell using a fluorescent
indicator; and

wherein the profiling comprises a step of contacting the microwells with a substrate, wherein a surface of the substrate contains
thereon agents that bind to said activation markers or secreted soluble mediators.

US Pat. No. 9,096,942

ELECTROPHORETIC-DEPOSITED SURFACES

Massachusetts Institute o...

18. A method of altering a property of a surface of a substrate comprising:
suspending a plurality of particles in a solvent;
agglomerating the particles in the suspension;
subjecting the suspension of agglomerated particles to electrophoretic deposition onto the substrate; and
drying the substrate with the agglomerated particles deposited thereon after the subjecting step, so as to form a superhydrophilic
surface on the substrate.

US Pat. No. 9,089,407

ANTIBACTERIAL COATINGS THAT INHIBIT BIOFILM FORMATION ON IMPLANTS

Massachusetts Institute o...

1. An implant comprising a polymeric coating on an outer surface of the implant, wherein the implant is selected from the
group consisting of prosthetic implants, orthopedic implants, ear, nose, and throat implants, and cardiovascular implants,
wherein the polymer forming the coating is an antimicrobial hydrophobic polycationic polymer selected from the group consisting
of poly(4-vinyl-N-alkylpyridine), N,N-dialkylated branched polyethylene iminie, and N,N-dialkylated linear polyethylene imine
polymers.

US Pat. No. 9,603,190

INTEGRATED CIRCUIT ADAPTED FOR MOBILE COMMUNICATION AND RELATED MOBILE COMPUTING DEVICE

MASSACHUSETTS INSTITUTE O...

1. An integrated circuit adapted for mobile communication, comprising:
a first device layer formed of a first semiconductor material and having at least a first circuit portion; and
a second device layer formed of a second semiconductor material different to the first semiconductor material and having at
least a second circuit portion,

wherein the first and second device layers are integrally formed, and the first circuit portion is electrically coupled to
the second circuit portion to enable the mobile communication using first and second wireless communication protocols,

wherein the first circuit portion further includes a transceiver and a digital baseband processor, and wherein the digital
baseband processor is configured to adaptively operate between first and second clock frequencies, the first clock frequency
used when the circuit is configured to perform communication via the first wireless communication protocol, and the second
clock frequency used when the circuit is configured to perform communication via the second wireless communication protocol.

US Pat. No. 9,491,859

GRID ARRAYS WITH ENHANCED FATIGUE LIFE

Massachusetts Institute o...

1. An electronic assembly comprising:
a printed circuit board having an array of connecting pads and a board coefficient of thermal expansion; and
an electronic component having an array of connecting lands, the electronic component having a different coefficient of thermal
expansion than the board coefficient of thermal expansion, an array of conducting posts connecting the electronic component
from the array of connecting lands to respective pads of the array of connecting pads on the printed circuit board through
solder, angled conducting posts of the array of conducting posts having an angular tilt outwardly away from a center of the
electronic component to the circuit board at 20 degrees Celsius and over a temperature range of 0 degrees Celsius to 100 degrees
Celsius,

a first plurality of connecting pads of the array of connecting pads outside of a centered region of the printed circuit board
being connected from a first plurality of connecting lands of the array of connecting lands of the electronic component by
a first plurality of conducting posts of the array of conducting posts outside of a centered region of the electronic component,
the first plurality of connecting pads having a same lesser pad thickness than

a second plurality of the connecting pads of the array of connecting pads in the centered region of the printed circuit board
being connected from a second plurality of connecting lands of the array of connecting lands of the electronic component by
a second plurality of conducting posts of the array of conducting posts inside of the centered region of the electronic component
having a same higher pad thickness,

each of the conducting posts of the second plurality of the conducting posts connected through solder to the second plurality
of connecting pads being vertical, and each of the conducting posts of the first plurality of the conducting posts connected
through solder to the first plurality of connecting pads having an angular tilt,

pads of the first plurality of connecting pads being spaced outwardly with respect to lands of the first plurality of connecting
lands joined by respective conducting posts,

adjacent pads of the second plurality of connecting pads having a same pad pitch spacing between each other that matches a
land pitch spacing between corresponding adjacent lands of the second plurality of connecting lands, and

pad pitch spacing of the second plurality of connecting pads being less than pad pitch spacing of the first plurality of connecting
pads.

US Pat. No. 9,370,551

COMPOSITIONS AND METHODS OF TREATING HEAD AND NECK CANCER

The Broad Institute, Inc....

1. A method of altering expression of a genomic locus of interest in a mammalian cell,
comprising contacting the genomic locus with a non-naturally occurring or engineered composition comprising a deoxyribonucleic
acid (DNA) binding polypeptide comprising:

(a) a N-terminal capping region
(b) a DNA binding domain comprising at least five or more TALE monomers and at least one or more half-monomers specifically
ordered to target the genomic locus of interest, and

(c) a C-terminal capping region
wherein (a), (b) and (c) are arranged in a predetermined N-terminus to C-terminus orientation,
wherein the polypeptide includes at least one or more effector domains, and
wherein the polypeptide is encoded by and translated from a codon optimized nucleic acid molecule so that the polypeptide
preferentially binds to DNA of the genomic locus; and

wherein the genomic locus of interest is associated with TP63, CCND1, CCNE1, YAP1, HRAS, PIK3CA, PIK3CG, NOTCH1, NOTCH 2,
NOTCH 3, IRF6, CDKN2A, TP53, CASP8, PTEN, FAT1, RIPK4, EZH1, EZH2, MED1, MLL2, CDH1, FBXW7, PCLO, RIMS2, RB1, NSD1 or NFE2L2.

US Pat. No. 9,193,753

RNA SEQUENCE-SPECIFIC MEDIATORS OF RNA INTERFERENCE

University of Massachuset...

1. A method of mediating RNA interference of an mRNA in a cell or organism, comprising:
(a) introducing a double-stranded RNA molecule of from about 21 to 23 nucleotides which targets the mRNA for degradation into
the cell or organism;

(b) maintaining the cell or organism produced in (a) under conditions under which degradation of the mRNA occurs, thereby
mediating RNA interference of the mRNA in the cell or organism.

US Pat. No. 9,447,030

INHIBITORS OF HISTONE DEACETYLASE

Massachusetts Institute o...

1. A compound of formula I:
or a pharmaceutically acceptable salt, hydrate, solvate, or prodrug thereof, wherein:
J? is selected from NH2, OH, and SH;

each X is independently selected from hydrogen, deuterium, methyl, CF3, and halogen;

R5 is selected from C2-C8 alkenyl; (CH2)u-5-6 membered, saturated, unsaturated, or partially unsaturated heterocyclic ring: (CH2)v—C4-C8 cycloalkyl ring; (C1-C8-alkyl)w-C4-C8cycloalkenyl ring; (CH2)s-aromatic ring; and (CH2)s-heteroaromatic ring; wherein said heterocyclic ring, cycloalkyl ring, cycloalkenyl ring, heteroaromatic ring, and aromatic
ring are unsubstituted or substituted with one or more Ry, and said alkenyl is substituted with one or more RT;

R2aR2bR2cV(CH2)tU— is


b is selected from 0, 1, 2, and 3;
a is selected from 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10;
each Rx is independently selected from (CH2)zNH2, (CH2)zNHR3, (CH2)zNR3R3, OR3, OCF3, OCH2F, OCHF2, (CH2)z-aromatic ring, (CH2)z-heterocyclic ring, hydroxyl, halogen, C1-C8 alkyl, (C1-C8 alkyl)CF3, (C1-C8 alkyl)OH, C(O)R3, (CH2)zC(O)NH2, (CH2)zC(O)NHR3, (CH2)zC(O)NR3R3, (CH2)zNHC(O)R4, and (CH2)zNR4C(O)R4;

or taken together two Rx attached to the same carbon atom form ?O;

or taken together two Rx form a C3-C8 cycloalkyl ring, C4-C8 cycloalkenyl ring, or 3 to 8 membered, saturated or partially unsaturated heterocyclic ring, wherein said cycloalkyl ring,
cycloalkenyl ring, and heterocyclic ring are unsubstituted or substituted with one or more Rz;

or taken together two Rx form an aromatic ring or heteroaromatic ring, wherein said aromatic ring and heteroaromatic ring are unsubstituted or substituted
with one or more Rz;

each Rz is independently selected from halogen, C1-C4 alkyl, OH, OR3, CF3, OCF3, OCH2F, OCHF2, NH2, NHR3, NR3R3, and C(O)CH3;

each R3 is independently selected from C1-C8 alkyl and O(C1-C8 alkyl);

each R4 is independently selected from C1-C8 alkyl and CF3;

each Ry is independently selected from halogen, OR6, NH2, NHR6, NR6R6, OH, CF3, aromatic ring, C(O)R6, C1-C8 alkyl, C2-C8 alkenyl, and C2-C8 alkynyl, wherein each R6 is independently C1-C8 alkyl;

each RT is independently selected from hydrogen, halogen, Si(R3)3, phenyl, and C1-C8 alkyl;

u is selected from 0, 1, and 2;
v? is selected from 0, 1, and 2;

w is selected from 0, 1, and 2;
s is selected from 0, 1, and 2; and
each z is independently selected from 0, 1, 2, and 3.

US Pat. No. 9,360,403

METHODS FOR FABRICATING ELECTROKINETIC CONCENTRATION DEVICES

MASSACHUSETTS INSTITUTE O...

1. A method of concentrating a species of interest in a liquid, the method comprising applying said liquid comprising said
species of interest to a concentrating device comprising:
a fluidic chip comprising a planar array of channels through which a liquid comprising a species of interest can be made to
pass;

at least one rigid substrate connected thereto such that at least a portion of a surface of said substrate bounds said channels;
and

a high aspect ratio ion-selective membrane embedded within said chip, attached to at least a portion of said channels.
US Pat. No. 9,327,010

COMPOSITIONS AND METHODS FOR PROMOTING HEMOSTASIS AND OTHER PHYSIOLOGICAL ACTIVITIES

Massachusetts Institute o...

1. A formulation for making an in vivo barrier structure, comprising:
self-assembling peptides,
wherein the self-assembling peptides consist of a sequence of from 8 to 16 amino acid residues conforming to one or more of
Formulas I-IV:

((Xaaneu-Xaa+)x(Xaaneu-Xaa?)y)n  (I)

((Xaaneu-Xaa?)x(Xaaneu-Xaa+)y)n  (II)

((Xaa+-Xaaneu)x(Xaa?Xaaneu)y)n  (III)

((Xaa?-Xaaneu)x(Xaa+Xaaneu)y)n  (IV)

wherein Xaaneu represents alanine or leucine; Xaa+ represents arginine or lysine; Xaa? represents aspartic acid or glutamic acid; x and y are integers having a value of 1 or 2, or 4, independently; and n is an
integer having a value of 1-4,

wherein the self-assembling peptides are in an effective concentration to self-assemble upon contact with physiological fluids
at an exposed surgical incision site or an exposed wound site of an animal to form a macroscopic structure that inhibits or
prevents passage of bodily fluid through the structure,

wherein the barrier structure is formed by application of a powder or an aqueous solution of the self-assembling peptides
to the exposed surgical incision site or exposed wound site,

wherein the solution has a total concentration of less than 5 mM Li+, Na+, K+, and Cs+ ions and a concentration of self-assembling
peptides between 1.0% weight to volume and 4.0% weight to volume inclusive.

US Pat. No. 9,308,280

TARGETING OF ANTIGEN PRESENTING CELLS WITH IMMUNONANOTHERAPEUTICS

Massachusetts Institute o...

1. A composition comprising:
(a) polymeric particles formed from the self-assembly of a mixture of amphiphilic (hydrophobic-hydrophilic) polymers and amphiphilic
polymers having at least one moiety bound to the hydrophilic ends of the amphiphilic polymers;

(b) a B cell or T cell antigen;
(c) an immunostimulatory agent to promote tolerance to the antigen; and
(d) a pharmaceutically acceptable excipient.

US Pat. No. 9,286,312

DATA CORESET COMPRESSION

Massachusetts Institute o...

1. A computer-implemented method comprising:
accepting first data representing a first plurality of data samples acquired from a set of one or more sensor, the first plurality
of data samples having a first number of points in a data space;

applying a computer-implemented compression procedure to the first data to form second data representing a second plurality
of points having a second number of points substantially smaller than the first number of points, and to provide a bound on
an error associated with representing the first plurality of data samples by the second plurality of data samples, wherein
applying the compression procedure includes

determining a first plurality of line segments in the data space according to a procedure with a property that the number
of line segments in the first plurality of line segments grows at most as a logarithm of the first number of points,

partitioning the first plurality of data samples into a plurality of parts each part being associated with a corresponding
different line segment of the first plurality of line segments in the data space,

for each part of the plurality of parts, selecting a subset of data samples of the part, and
combining the selected subsets of data samples to form the second plurality of points;
providing the second data representing the second plurality of points as a compressed representation of the acquired first
plurality of data samples.

US Pat. No. 9,227,917

AMINE-CONTAINING LIPIDOIDS AND USES THEREOF

Massachusetts Institute o...

1. A compound of Formula (I):
or a salt thereof,
wherein
each L is, independently, branched or unbranched C1-6 alkylene, wherein L is optionally substituted with one or more fluorine radicals;

each RA is, independently, branched or unbranched C1-6 alkyl, C3-7 cycloalkyl, or branched or unbranched C4-12 cycloalkylalkyl, wherein RA is optionally substituted with one or more fluorine radicals;

each R is, independently, hydrogen, or —CH2CH2C(?O)ORB, provided that at least three R groups are —CH2CH2C(?O)ORB;

each RB is, independently, C10-14 alkyl, wherein RB is optionally substituted with one or more fluorine radicals; and

q is 1, 2, or 3;
provided that the compound is not

US Pat. No. 9,048,727

POWER CONVERTER WITH CAPACITIVE ENERGY TRANSFER AND FAST DYNAMIC RESPONSE

Massachusetts Institute o...

1. A converter circuit comprising:
a switched capacitor transformation stage having a transformation stage input port and a transformation stage output port,
said switched capacitor transformation stage comprising one or more switches and one or more capacitors and said switched
capacitor transformation stage configured to accept an input voltage at the transformation stage input port and provide an
intermediate output voltage at the transformation stage output port;

an auxiliary converter stage having an input coupled to said switched capacitor transformation stage, said auxiliary converter
stage comprising one or more switches and one or more magnetic energy storage components configured to recover energy normally
dissipated in capacitors of said switched capacitor transformation stage via said one or more magnetic energy storage components.

US Pat. No. 9,446,394

Z-SELECTIVE RING-CLOSING METATHESIS REACTIONS

Trustees of Boston Colleg...

21. A composition comprising a metal complex of formula II-c:

wherein:
M is molybdenum or tungsten;
R8 is R1, or phenyl optionally substituted with one to five R9;

each R9 is independently halogen or R1;

R1 is an optionally substituted group selected from C1-20 aliphatic, C1-20 heteroaliphatic having 1-3 heteroatoms independently selected from nitrogen, oxygen, or sulfur, phenyl, a 3-7 membered saturated
or partially unsaturated carbocyclic ring, an 8-10 membered bicyclic saturated, partially unsaturated or aryl ring, a 5-6
membered monocyclic heteroaryl ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur, a 4-7
membered saturated or partially unsaturated heterocyclic ring having 1-3 heteroatoms independently selected from nitrogen,
oxygen, or sulfur, a 7-10 membered bicyclic saturated or partially unsaturated heterocyclic ring having 1-5 heteroatoms independently
selected from nitrogen, oxygen, or sulfur, or an 8-10 membered bicyclic heteroaryl ring having 1-5 heteroatoms independently
selected from nitrogen, oxygen, or sulfur;

each of R2 and R3 is independently R?, —OR?, —SR?, —N(R?)2, —OC(O)R?, —SOR?, —SO2R?, —SO2N(R?)2, —C(O)N(R?)2, —NR?C(O)R?, or —NR?SO2R?, provided that R2 and R3 are not simultaneously hydrogen;

each R7 is independently optionally substituted —Ar?;

Ar? is of the following formula:

wherein:
t is 0-4;
p is 0-6;
each Ring B? and Ring C? is independently an optionally substituted group selected from phenyl, a 3-7 membered saturated or
partially unsaturated carbocyclic ring, an 8-10 membered bicyclic saturated, partially unsaturated or aryl ring, a 5-6 membered
monocyclic heteroaryl ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur, a 4-7 membered
saturated or partially unsaturated heterocyclic ring having 1-3 heteroatoms independently selected from nitrogen, oxygen,
or sulfur, a 7-10 membered bicyclic saturated or partially unsaturated heterocyclic ring having 1-5 heteroatoms independently
selected from nitrogen, oxygen, or sulfur, or an 8-10 membered bicyclic heteroaryl ring having 1-5 heteroatoms independently
selected from nitrogen, oxygen, or sulfur; and

each Rs is independently halogen, R?, —OR?, —SR?, —S(O)R?, —S(O)2R?, —OSi(R?)3, —N(R?)2, —NR?C(O)R?, —NR?C(O)OR?, —NR?C(O)N(R?)2, —NR?SO2R?, —NR?SO2N(R?)2, or —NR?OR?;

each R? is independently hydrogen or an optionally substituted group selected from C1-6 aliphatic, phenyl, a 3-7 membered saturated or partially unsaturated carbocyclic ring, an 8-10 membered bicyclic saturated,
partially unsaturated or aryl ring, a 5-6 membered monocyclic heteroaryl ring having 1-4 heteroatoms independently selected
from nitrogen, oxygen, or sulfur, a 4-7 membered saturated or partially unsaturated heterocyclic ring having 1-3 heteroatoms
independently selected from nitrogen, oxygen, or sulfur, a 7-10 membered bicyclic saturated or partially unsaturated heterocyclic
ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, or sulfur, or an 8-10 membered bicyclic heteroaryl
ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, or sulfur, wherein:

two R? groups on the same nitrogen atom are optionally taken together with the nitrogen atom to form an optionally substituted
3-8 membered, saturated, partially unsaturated, or aryl ring having 1-4 heteroatoms independently selected from nitrogen,
oxygen, or sulfur;

wherein the molar ratio of ligand —OR7 to M is about 10:1, 9:1, 8:1, 7:1, 6:1, 5:1, 4:1, 3:1 or 2:1 within the composition.

US Pat. No. 9,409,938

TUNGSTEN OXO ALKYLIDENE COMPLEXES FOR ZSELECTIVE OLEFIN METATHESIS

Massachusetts Institute o...

1. A method for performing an olefin metathesis reaction, comprising providing a compound of formula I-c:

wherein:
each of R1 and R2 is independently R, —OR, —SR, —N(R)2, —OC(O)R, —SOR, —SO2R, —SO2N(R)2, —C(O)N(R)2, —NRC(O)R, or —NRSO2R;

R3? is R3 or —OSi(R)3;

R3 is R, —N(R)2, —NRC(O)R, —NRC(O)OR, —NRC(O)N(R)2, —NRSO2R, —NRSO2N(R)2, —NROR, NR3, —OR, O(R)2, or an optionally substituted group selected from a 5-6 membered monocyclic heteroaryl ring having at least one nitrogen
and 0-3 additional heteroatoms independently selected from nitrogen, oxygen, or sulfur, a 4-7 membered saturated or partially
unsaturated heterocyclic ring having at least one nitrogen and 0-2 additional heteroatoms independently selected from nitrogen,
oxygen, or sulfur, a 7-10 membered bicyclic saturated or partially unsaturated heterocyclic ring having at least one nitrogen
and 0-4 additional heteroatoms independently selected from nitrogen, oxygen, or sulfur, or an 8-10 membered bicyclic heteroaryl
ring having at least one nitrogen and 0-4 additional heteroatoms independently selected from nitrogen, oxygen, or sulfur;

R4 is halogen, R, —N(R)2, —NRC(O)R, —NRC(O)OR, —NRC(O)N(R)2, —NRSO2R, —NRSO2N(R)2, —NROR, NR3, —OR, O(R)2, a phosphorus-containing ligand, or an optionally substituted group selected from a 5-6 membered monocyclic heteroaryl ring
having at least one nitrogen and 0-3 additional heteroatoms independently selected from nitrogen, oxygen, or sulfur, a 4-7
membered saturated or partially unsaturated heterocyclic ring having at least one nitrogen and 0-2 additional heteroatoms
independently selected from nitrogen, oxygen, or sulfur, a 7-10 membered bicyclic saturated or partially unsaturated heterocyclic
ring having at least one nitrogen and 0-4 additional heteroatoms independently selected from nitrogen, oxygen, or sulfur,
or an 8-10 membered bicyclic heteroaryl ring having at least one nitrogen and 0-4 additional heteroatoms independently selected
from nitrogen, oxygen, or sulfur;

each R is independently hydrogen or an optionally substituted group selected from C1-20 aliphatic, C1-20 heteroaliphatic having 1-3 heteroatoms independently selected from nitrogen, oxygen, or sulfur, phenyl, ferrocene, a 3-7 membered
saturated or partially unsaturated carbocyclic ring, an 8-10 membered bicyclic saturated, partially unsaturated or aryl ring,
a 5-6 membered monocyclic heteroaryl ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur,
a 4-7 membered saturated or partially unsaturated heterocyclic ring having 1-3 heteroatoms independently selected from nitrogen,
oxygen, or sulfur, a 7-10 membered bicyclic saturated or partially unsaturated heterocyclic ring having 1-5 heteroatoms independently
selected from nitrogen, oxygen, or sulfur, or an 8-10 membered bicyclic heteroaryl ring having 1-5 heteroatoms independently
selected from nitrogen, oxygen, or sulfur, or:

two or three R groups on the same nitrogen atom are taken together with the nitrogen to form an optionally substituted 3-12
membered saturated, partially unsaturated, or aryl ring having 0-5 additional heteroatoms not including the same nitrogen
atom independently selected from nitrogen, oxygen, or sulfur; or:

two R groups on the same oxygen atom are taken together with the oxygen to form an optionally substituted 3-12 membered saturated,
partially unsaturated, or aryl ring having 0-5 additional heteroatoms not including the same oxygen atom independently selected
from nitrogen, oxygen, or sulfur;

n is 0, 1, or 2;
each R5 is independently a monodentate ligand, or two R5 are taken together with their intervening atoms to form an optionally substituted bidentate group; and

two or more of R1, R2, R3, R4 and R5 may be taken together with their intervening atoms to form an optionally substituted polydentate ligand;

wherein the compound is other than WO(CH-t-Bu)(O-2,6-Ph2C6H3)2(R5)n, WO(CH-t-Bu)(O-t-Bu)2(R5)n, W(O)(CHCMe3)(Me2Pyr)2(PMe2Ph)n, and

WO(CH—CH?C(Ph)2)(OC(CH3)(CF3)2)2(R5), wherein Me2Pyr is 2,5-dimethylpyrrolyl.

US Pat. No. 9,233,072

ADJUVANT INCORPORATION IN IMMUNONANOTHERAPEUTICS

Massachusetts Institute o...

1. A composition comprising:
(1) polymeric synthetic nanocarriers formed from the self-assembly of a mixture of amphiphilic polymers comprising a hydrophilic
and a hydrophobic polymer, and amphiphilic polymers having a moiety attached thereto prior to self-assembly into nanocarriers

wherein the moiety is a targeting moiety that binds markers on dendritic cells or subcapsular sinus macrophages or is an immunostimulatory
agent for dendritic cells or subcapsular sinus macrophages; and

(2) a pharmaceutically acceptable excipient.

US Pat. No. 9,110,221

ATHERMAL PHOTONIC WAVEGUIDE WITH REFRACTIVE INDEX TUNING

Massachusetts Institute o...

1. A photonic waveguide comprising:
an undercladding layer;
a waveguide core having a cross-sectional height and width disposed on the undercladding layer and comprising a waveguide
core material having a thermo-optic coefficient;

a refractive index tuning cladding layer disposed on top of the waveguide core and comprising a refractive index tuning cladding
material having an adjustable refractive index and an absorption length at a refractive index tuning radiation wavelength;
and

a thermo-optic coefficient compensation cladding layer disposed on top of the refractive index tuning cladding layer and comprising
a thermo-optic coefficient compensation material having a thermo-optic coefficient that is of opposite sign to the thermo-optic
coefficient of the waveguide core material and that provides at least partial compensation for the waveguide core thermo-optic
coefficient.

US Pat. No. 9,327,281

CARBON-DIOXIDE COMPOUND AND CATALYST

Massachusetts Institute o...

12. A method for carbon dioxide fixation comprising:
exposing carbon dioxide to a molybdate in the presence of a mild nucleophile to produce a carbon dioxide-transformed product.

US Pat. No. 9,198,154

METHOD AND APPARATUS FOR CONSTRUCTING A USER-GENERATED GEOGRAPHICAL SYSTEM

Massachusetts Institute o...

1. A method comprising:
receiving a new bound space that comprises an observed wireless fingerprint at a mobile apparatus and a corresponding geographical
location for a given bound space;

determining whether to at least one of accept and decline the new bound space based upon the observed wireless fingerprint
compared to previously measured wireless fingerprints and locations;

analyzing an average signal distance between the geographical location and a plurality of nearest neighbors that comprise
existing bound spaces stored in a database wherein, when accepting the new bound space to a fingerprint of a current bound
space for the mobile apparatus, an increase in the average signal distance improves the accuracy of the existing bound spaces
stored in the database;

accepting the new bound space to the fingerprint of the current bound space for the mobile apparatus in an instance in which
adding the new bind to the database increases the current average signal distance between the geographical location and the
plurality of nearest neighbors that comprise existing bound spaces stored in the database;

declining the new bound space from the fingerprint of the current bound space for the mobile apparatus in an instance in which
adding the new bind to the database decreases the current average signal distance between the geographical location and the
plurality of nearest neighbors that comprise existing bound spaces stored in the database;

and failing to associate the new bind with the geographic location in response to declining the new bound space.

US Pat. No. 9,360,604

BROAD WAVELENGTH RANGE CHEMICALLY-TUNABLE PHOTONIC MATERIALS

Massachusetts Institute o...

1. A photonic material, comprising:
a polymeric article including a periodic structure of a plurality of periodically occurring separate domains able to interact
with and affect electromagnetic radiation, with at least a first and a second domain each having an electromagnetic radiation-affecting
dimension of at least 5 nm, and each having a dielectric constant such that the domains define a dielectric constant ratio
of at least 1.001 or about 1.001 for at least one range of continuous wavelengths lying within a range of from 10 nm to 10
microns or about 10 nm to about 10 microns,

wherein, in the presence of an altering stimulus, the electromagnetic radiation-affecting dimension of one of the domains
changes relative to that of the other due to swelling and/or de-swelling of at least one of the domains, and a diffracted
wavelength of electromagnetic radiation changes by at least 45% at a set point of observation relative to the photonic material.

US Pat. No. 9,295,397

METHOD AND APPARATUS FOR BEAT-SPACE FREQUENCY DOMAIN PREDICTION OF CARDIOVASCULAR DEATH AFTER ACUTE CORONARY EVENT

Massachusetts Institute o...

1. A method for the machine generation of a model for predicting death within a predetermined period following the occurrence
of a cardiac event, the method comprising the steps of:
obtaining an ECG of interest from a plurality of patients having a plurality of outcomes, the ECG having a plurality of ECG
characteristics;

obtaining a time series of one of the ECG characteristics of the plurality of ECG characteristics;
dividing the time series into a plurality of window segments;
converting the time series from time-space to beat-space;
computing the power in various frequency bands of each window segment;
computing the 90th percentile of the spectral energies across all window segments for each frequency band to generate spectral
energy data; and

inputting the spectral energy data into a machine learning program to obtain a weighted risk vector.

US Pat. No. 9,264,147

METHOD AND APPARATUS FOR PHASE SHIFT KEYED OPTICAL COMMUNICATIONS

Massachusetts Institute o...

1. An optical communications system, comprising:
an optical transmitter/receiver pair configured, or operable to be configured, to communicate via a dedicated communications
path extending an entire distance between a transmitter and a receiver of the optical transmitter/receiver pair in a given
direction along the dedicated communications path, the transmitter/receiver pair being further configured, or operable to
be configured, to operate at a selectable data rate with data transmitted in bursts, the data rate being a function of a burst-on
duty cycle, and the transmitter being average power limited.

US Pat. No. 9,216,188

HYDROGELS FOR VOCAL CORD AND SOFT TISSUE AUGMENTATION AND REPAIR

The General Hospital Corp...

1. A method of treating a subject having phonatory mucosa with decreased pliability causing diminished functional vibratory
capacity and diminished phonation, the method comprising
locating a phonatory mucosa with diminished functional vibratory capacity in the subject; and
injecting into the phonatory mucosa a hydrogel material that comprises an elastic shear modulus ranging from about 15 to about
121 Pa measured at a frequency of 10 Hz in an amount effective to increase pliability of the phonatory mucosa sufficiently
to allow the phonatory mucosa to vibrate and improve phonation;

wherein the hydrogel material comprises a first cross-linked synthetic polymer and a second polymer,
wherein the first cross-linked synthetic polymer comprises a cross-linked form of polyethylene glycol, polylysine, polyvinyl
alcohol, or hyaluronic acid, and

wherein the second polymer is selected from the group consisting of polyethers, polyacrylates, polyesters, polyanhydrides,
polyols, polypeptides, polyvinyl alcohols, proteins, polysaccharides, gelatins, elastins, collagens, celluloses, methylcelluloses,
hyaluronic acid, dextrans, alginates, and derivatives thereof, and

wherein the hydrogel material comprises an interpenetrating or semi-interpenetrating network of the first and second polymers.

US Pat. No. 9,209,378

FABRICATION OF STABLE ELECTRODE/DIFFUSION BARRIER LAYERS FOR THERMOELECTRIC FILLED SKUTTERUDITE DEVICES

UNIVERSITY OF HOUSTON SYS...

1. A method of manufacturing a thermoelectric component comprising:
thermo-mechanically processing a ball-milled first powder and a second powder, wherein the ball-milled first powder comprises
at least two of iron (Fe), chromium (Cr), cobalt (Co), and nickel (Ni), and wherein the second powder is disposed between
a first layer of the ball-milled first powder and a second layer of the ball-milled first powder prior to thermo-mechanical
processing; and

wherein, subsequent to the thermo-mechanical processing, a specific contact resistance between the first layer of the ball-milled
first powder and the second powder is less than about 10.0 ??·cm2, and wherein a specific contact resistance between the second layer of the ball-milled first powder and the second powder
is less than about 10.0 ??·cm2.

US Pat. No. 9,198,952

COMPOSITIONS OF AND METHODS OF USING LIGAND DIMERS

Massachusetts Institute o...

1. A method of controlling Her-3 receptor dimerization, comprising:
contacting cells that express Her-3 receptors with a ligand dimer that comprises two Her-3 ligands and a linker in an amount
effective to cause the dimerization of a Her-3 receptor pair.

US Pat. No. 9,143,175

RATELESS AND RATED CODING USING SPINAL CODES

Massachusetts Institute o...

1. A method to decode comprising:
receiving encoded constellation symbols from an encoder configured to encode message bits using a spinal code which uses a
function to encode the message bits to symbols and map the symbols to constellation points using a constellation mapping to
form the encoded constellations symbols for transmission;

mapping the encoded constellation symbols to points on an I-Q plane; and
decoding the points on the I-Q plane using the constellation mapping to generate a decoded message.

US Pat. No. 9,110,291

ULTRA-HIGH EFFICIENCY COLOR MIXING AND COLOR SEPARATION

Massachusetts Institute o...

1. A high-efficiency LCD comprising:
a. a source of polarizing backlighting;
b. a plurality of LCD pixels disposed substantially in a plane;
c. a polychromat disposed between the source of polarized backlighting and the plane of LCD pixels for separating the backlight
into spatially distinct and spectrally overlapping components; and

d. a diffuser disposed distal to the polychromat with respect to the source of polarizing backlighting.
US Pat. No. 9,447,378

METHOD FOR DIFFERENTIATING HUMAN EMBRYONIC STEM CELLS INTO ?-CELLS FOR THE TREATMENT OF TYPE I DIABETES

Massachusetts Institute o...

1. A method for producing insulin+ and/or C-peptide+ cells, comprising
(1) differentiating human pluripotent stern cells to posterior foregut endoderm in vitro, at an oxygen partial pressure to
which cells are exposed (pO2 cell) that is greater than 7 mmHg and less than 142 mmHg, in the presence of a TGF-? superfamily member and a retinoic acid receptor
agonist, and

(2) differentiating posterior foregut endoderm to insulin+ and/or C-peptide+ cells at a pO2 cell that is 142 mmHg or higher.

US Pat. No. 9,312,117

METHODS, APPARATUS, AND SYSTEM FOR MASS SPECTROMETRY

The Massachusetts Institu...

1. A mass spectrometer, comprising:
a vacuum housing defining a vacuum cavity in which a pressure of about 10?5 mm Hg or less is maintained;

an electrode, disposed within the vacuum cavity and configured to be charged to an electrode potential, to control acceleration
of a charged particle propagating through the vacuum cavity;

a digital controller, disposed within the vacuum cavity and in electrical communication with the electrode, to control the
electrode potential at the electrode and a heater, in thermal communication with at least one component within the vacuum
cavity, to heat the at least one component so as to drive gas off the at least one component.

US Pat. No. 9,301,926

LOCAL DRUG DELIVERY DEVICES AND METHODS FOR TREATING CANCER

Massachusetts Institute o...

1. A method of treating a tumor of the pancreas, biliary system, gallbladder, liver, small bowel, or colon, comprising:
deploying a drug-eluting device into a tissue site of a patient in need of treatment, the device comprising:
a film which comprises a mixture of a degradable polymer and a chemotherapeutic drug, wherein the film has a thickness from
about 2 ?m to about 1000 ?m; and

a flexible biocompatible substratum to which the film is adhered, the substratum comprising a patch or mesh; and
releasing a therapeutically effective amount of the chemotherapeutic drug from the film to the tissue site to treat the tumor,
wherein the release of the therapeutically effective amount of the chemotherapeutic drug from the film is controlled by in
vivo degradation of the polymer at the tissue site,

wherein deploying the device comprises implanting the device directly onto the tumor.

US Pat. No. 9,274,047

METHODS AND APPARATUS FOR IMAGING OF OCCLUDED OBJECTS

Massachusetts Institute o...

1. A method comprising, in combination:
(a) using an active imaging system to generate structured illumination, which active imaging system includes a light sensor
and a light source;

(b) using the light sensor to capture transient light response data regarding reflections of light that is emitted by the
light source and reflected from an occluded surface; and

(c) using one or more processors to process the transient light response data and data regarding the structured illumination
to calculate a reflectance spectra map of the occluded surface;

wherein the light source is wavelength-resolved and wavelength-tunable.

US Pat. No. 9,380,221

METHODS AND APPARATUS FOR LIGHT FIELD PHOTOGRAPHY

Massachusetts Institute o...

2. A method comprising, in combination:
(a) using an imaging sensor to take measurements of light from a first scene, which light has, after leaving the first scene,
passed through or been reflected from a SLM; and

(b) using one or more computer processors to use the measurements of the light as inputs to perform calculations to compute
a first light field function of the light;

wherein
(i) the calculations include multiplying a light field dictionary matrix or multiplying a light field atom in the light field
dictionary matrix, which light field dictionary matrix has, before the imaging sensor takes the measurements, been computed
from training sets, which training sets comprise or were extracted from light field functions of light from other scenes,
the first scene being at least partially different in appearance than the other scenes, and

(ii) the SLM is an Optimized SLM with respect to the light field dictionary matrix.

US Pat. No. 9,320,751

MODIFIED SAPONINS FOR THE TREATMENT OF FUNGAL INFECTIONS

The General Hospital Corp...

1. A method of treating a fungal infection in a subject, the method comprising administering to the subject a therapeutically
effective amount of a compound of Formula II:

or a pharmaceutically acceptable salt thereof, wherein:
R1 is H or OC(O)RA;

R2 is H or OH;

R3 is H, C(O)ORA, CH2ORA, CH2OC(O)RA;

R4 and R5 are each independently H or OC(O)RB;

RA is H or C1-6 alkyl;

RB is C2-6 alkenyl; and

Gly is

US Pat. No. 9,144,770

REVERSIBLE SORBENT FOR WARM CO2 CAPTURE BY PRESSURE SWING ADSORPTION

Massachusetts Institute o...

1. Method for capture of CO2 by reversible pressure swing adsorption comprising contacting CO2 in a temperature range of 200-300° C. with a material selected from the group consisting of activated carbon, metal-organic
frameworks, zeolites, activated alumina, and mesoporous silica impregnated with at least 5% by weight MgO.
US Pat. No. 9,445,994

LIPID VESICLE COMPOSITIONS AND METHODS OF USE

Massachusetts Institute o...

1. A multilamellar lipid vesicle comprising at least one terminal-cysteine-bearing antigen, and having covalent crosslinks
between lipid bilayers, wherein at least two lipid bilayers in the multilamellar lipid vesicle are covalently crosslinked
to each other through headgroups that react with covalent crosslinkers to form the covalent crosslinks between lipid bilayers,
and wherein the terminal-cysteine-bearing antigen is an immunostimulatory agent or an immunoinhibitory agent.
US Pat. No. 9,181,539

STRAINS FOR THE PRODUCTION OF FLAVONOIDS FROM GLUCOSE

Massachusetts Institute o...

1. An isolated cell that recombinantly expresses genes encoding tyrosine ammonia lyase (TAL), 4-coumarate:CoA ligase (4CL),
chalcone synthase (CHS), and chalcone isomerase (CHI), and wherein the cell produces one or more flavonoids or naringenin
from glucose without additional precursor supplementation, and wherein the expression of the genes encoding TAL, 4CL, CHS
and CHI is balanced in the cell by constitutive expression of CHS and CHI.

US Pat. No. 9,376,623

COMPOSITIONS INCLUDING POLYMERS ALIGNED VIA INTERCHAIN INTERACTIONS

Massachusetts Institute o...

1. A composition, comprising:
a polymeric network comprising the assembly of a plurality of polymer molecules, wherein each polymer molecule has the structure:

wherein n is at least 1, A and C are optionally substituted aromatic groups; B and D are absent, alkene, alkyne, heteroalkene,
or heteroalkyne; and E1 and E2 can be the same or different and are intermolecular interacting groups,

wherein at least 50% of the polymer molecules are connected to an adjacent polymer molecule via at least one of the intermolecular
interacting groups, and

wherein the polymeric network has a greater dichroic ratio than a dichroic ratio of an individual polymer molecule of the
polymeric network, when the polymeric network and the individual polymer molecule are placed under essentially identical conditions.

US Pat. No. 9,359,624

MICROBIAL ENGINEERING FOR THE PRODUCTION OF CHEMICAL AND PHARMACEUTICAL PRODUCTS FROM THE ISOPRENOID PATHWAY

Massachusetts Institute o...

1. A method for making a terpenoid compound, the method comprising:
creating or obtaining a library of E. coli cells that each produce isopentyl pyrophosphate (IPP) and dimethylallyl pyrophosphate (DMAPP) through an upstream methylerythritol
pathway (MEP) and convert the IPP and DMAPP to a terpenoid through a recombinantly expressed downstream terpenoid synthesis
pathway, wherein the cells in the library express genes in the downstream pathway with varying expression levels and genes
in the upstream pathway with varying expression levels;

selecting an E. coli cell based on a higher level of terpenoid production, a lower level of indole accumulation, or both a higher level of terpenoid
production and a lower level of indole accumulation, said cell having balanced upstream and downstream pathway expression;

culturing a cell having the balanced upstream and downstream pathway expression to produce said terpenoid.

US Pat. No. 9,358,556

ELECTRICALLY-DRIVEN FLUID FLOW AND RELATED SYSTEMS AND METHODS, INCLUDING ELECTROSPINNING AND ELECTROSPRAYING SYSTEMS AND METHODS

Massachusetts Institute o...

1. An emitter configured for use in electrospraying and/or electrospinning systems, comprising:
an array of protrusions extending from an emitter substrate, at least a portion of the protrusions in the array comprising
a plurality of microstructures extending from external surfaces of the protrusions,

wherein the microstructures are arranged on the surfaces of the protrusions in an ordered fashion.
US Pat. No. 9,719,142

METASTASIS SPECIFIC SPLICE VARIANTS OF MENA AND USES THEREOF IN DIAGNOSIS, PROGNOSIS AND TREATMENT OF TUMORS

Albert Einstein College o...

10. A kit comprising a pair of primers wherein the forward primer for the +++ isoform of Mena consists of SEQ ID NO: 7 and
the reverse primer consists of SEQ ID NO: 10, wherein the nucleic acid is labeled with a fluorescent label or a radiolabel
attached to the nucleic acid.

US Pat. No. 9,201,968

SYSTEM AND METHOD FOR FINDING MOOD-DEPENDENT TOP SELLING/RATED LISTS

Massachusetts Institute o...

1. A method for determining multiple rankings from a set of partial preferences comprising the steps of:
receiving, by a computer, a plurality of partial preferences reflecting the preferences of a population;
forming a plurality of preference lists, where each preference list is a collection of partial preferences collected from
a sub population of said population;

learning sparse distribution over all possible ranked lists or preference lists that is consistent with the formed plurality
of preference lists such that the resulting distribution assigns positive probability to the fewest possible ranked lists;
and

processing said learned sparse distribution over ranked lists to produce multiple popular ranked lists by identifying the
ranked list that have positive probability under the learned sparse distribution over ranked lists,

wherein each ranked list of said plurality of ranked lists is said to correspond to a mood or type of a sub population of
said population.

US Pat. No. 9,290,579

COVALENTLY IMMOBILIZED PROTEIN GRADIENTS IN THREE-DIMENSIONAL POROUS SCAFFOLDS

Trustees of Tufts College...

1. A method for forming at least one immobilized agent gradient within a 3-dimensional porous scaffold comprising:
(a) providing a 3-dimensional porous silk fibroin scaffold;
(b) contacting the scaffold with an aqueous solution containing an agent to allow dispersion of the solution through at least
a portion of the scaffold to form a linear gradient of the agent; and

(c) forming a covalent link between the agent and at least the surface of pores of said scaffold, whereby a first gradient
of covalently linked immobilized agent is formed in said 3-dimensional porous scaffold.

US Pat. No. 9,160,399

SYSTEM AND APPARATUS FOR DECODING TREE-BASED MESSAGES

Massachusetts Institute o...

1. A system for decoding messages comprising:
a receiver capable of receiving an encoded message;
sorting module configured to organize candidate messages into a number of bins, sort the candidate messages within each bin,
and output group of candidate messages, the group comprising a number of most likely candidate messages from each message
bin; and

a traceback module configured to receive the most likely candidate message, and walk through a tree of candidate messages
to generate a decoded message;

wherein the sorting module is configured to organize B candidate messages into ? bins having ?*2k candidate message each,
and to choose the most likely ? messages from each bin, where B=?*?, the total candidate messages per generation is B*2?k,
and k is a length in bits of the candidate message or a portion thereof, where ?, ?, and B are non-negative integers and k
is a non-negative integer.

US Pat. No. 9,295,388

METHODS AND APPARATUS FOR RETINAL IMAGING

Massachusetts Institute o...

1. A method of imaging a retina of a first eye of a human, which method comprises, in combination:
(a) a camera capturing multiple images of different areas of the retina during a time period in which the first eye rotates
through different rotational positions; and

(b) one or more processors processing the multiple images to create a mosaiced image of a region of the retina;wherein
(i) a lens that is exterior to and not part of the first eye includes a first region of the lens and a second region of the
lens, and

(ii) the method includes
(A) when the eye is in a first rotational position, the camera capturing a first image of a first area of the retina but not
a second area of the retina, such that light forming the first image passes through the pupil of the first eye and travels
through the first region but not the second region of the lens, and

(B) when the eye is in a second rotational position, the camera capturing a second image of the second area but not the first
area of the retina, such that light forming the second image passes through the pupil of the eye and travels through the second
region but not the first region of the lens,

(iii) the first and second rotational positions are different from each other, and
(iv) the multiple images include the first and second images.

US Pat. No. 9,052,434

ZERO GROUP-VELOCITY MODES IN CHALCOGENIDE HOLEY PHOTONIC CRYSTAL FIBERS

Massachusetts Institute o...

1. A fiber structure for propagating one or more zero group-velocity modes comprising:
a cladding arrangement comprising a two-dimensional photonic crystal that includes a holey fiber configuration having a complete
bandgap with a chalcogenide-glass refractive index contrast below 3.3:1, the holey fiber configuration includes a defect having
a specified diameter, said crystal supports TE and TM polarized solutions at a propagation constant ?=0; and

a core formed in a selective region of the cladding arrangement, said core allowing the propagation of the one or more zero
group-velocity modes by an overlapping TE/TM gap at ?=0 that also extends into a non-zero ? region with index contrasts attainable
of said chalcogenide-glass for fiber drawing, the specified diameter of the defect is sized so as to allow confinement of
field patterns in the core.

US Pat. No. 9,340,465

ALKALI METAL ION SOURCE WITH MODERATE RATE OF ION RELEASE AND METHODS OF FORMING

Massachusetts Institute o...

29. An alkali metal ion source with a moderate rate of ion release, formed by a method comprising the steps of:
a) combining a first component particulate alkali metal ion-bearing framework silicate with a second component that includes
at least one of an oxide and a hydroxide of at least one of an alkaline earth metal and an alkali metal to form a solid mixture,
wherein the molar ratio of the silicon to the at least one of the alkaline earth metal and alkali metal of the second component
is in a range of between about 1.0:0.1 and about 1.0:0.3; and

b) exposing the solid mixture to a hydrothermal treatment to form a gel that includes the silica and the alkali metal of the
first component, thereby forming the alkali metal ion source, comprised of the alkali metal ion bearing silicate gel in amount
of not less than 10 wt. %, wherein the alkali metal ion source has a specific surface area (BET) between about 8 m2/g and about 50 m2/g, wherein the alkali metal ion source releases not less than 1 g of potassium per 1 kg of the alkali metal ion source and
not less than 1 wt. % of silica acid within 24 hours upon exposure to aqueous solution that is undersaturated with respect
to potassium and silica.

US Pat. No. 9,458,489

MICROFLUIDICS SORTER FOR CELL DETECTION AND ISOLATION

Massachusetts Institute o...

1. A method of isolating one or more circulating tumor cells comprising:
introducing a sample into a microfluidic device, the sample comprising a whole blood sample or a maternal whole blood sample,
wherein the whole blood sample or the maternal whole blood sample comprises one or more circulating tumor cells to be isolated
and smaller blood cells, the microfluidic device comprising a channel having a length, Lc, and a cross-section of a height in the range of between about 10 ?m and about 200 ?m and a width in the range of between
about 100 ?m and about 500 ?m defining an aspect ratio adapted to isolate circulating cells along portions of the cross-section
of the channel based on cell size,

the channel comprising one or more spiral channels and having a hydraulic diameter, h, such that a cell diameter, ac, of the circulating tumor cells to be isolated satisfies the ratio: ac/h˜0.1, whereas the smaller blood cells have a smaller cell diameter than ac such that the ratio ac/h˜0.1 is not satisfied for those cells,

introducing a sheath fluid into the microfluidic device,
flowing the sample through the channel at an average flow velocity, Uf, that causes the smaller blood cells to have undergone a transverse one-half Dean cycle migration across the channel at an
outlet end of the channel such that the relation


is satisfied, where Lc is the length of the channel, Uf is the average flow velocity, UDean is Dean velocity and LDC is a length for a complete Dean cycle migration around the channel, and

detecting and isolating the one or more circulating tumor cells from the sample,
wherein the introducing the sample and the introducing the sheath fluid comprises simultaneously introducing the sample and
the sheath fluid into the microfluidic device via a radially innermost inlet and a radially outermost inlet, respectively,
to confine the sample to a radially innermost portion of the channel at the inlet, and

wherein the detecting and isolating comprises the one or more circulating tumor cells flowing along a radially innermost portion
of the channel to a first outlet and the smaller blood cells in the sample flowing along a radially outermost portion of the
channel to a second outlet.

US Pat. No. 9,629,804

LIPID FORMULATIONS FOR DELIVERY OF MESSENGER RNA

Shire Human Genetic Thera...

1. A method of delivery of messenger RNA (mRNA) in vivo, comprising administering to a subject in need of delivery a composition
comprising an mRNA encoding a cystic fibrosis transmembrane conductance regulator (CFTR) protein, encapsulated within a liposome
such that the administering of the composition results in the expression of the protein encoded by the mRNA in vivo;
wherein the liposome comprises a cationic lipid of formula I-c:

or a pharmaceutically acceptable salt thereof,
wherein:
p is an integer of between 1 and 9, inclusive;
each instance of R2 is independently hydrogen or optionally substituted C1-6 alkyl;

each instance of L is independently an optionally substituted alkylene, optionally substituted alkenylene, optionally substituted
alkynylene, optionally substituted heteroalkylene, optionally substituted heteroalkenylene, optionally substituted heteroalkynylene,
optionally substituted carbocyclylene, optionally substituted heterocyclylene, optionally substituted arylene, or optionally
substituted heteroarylene, or combination thereof;

each instance of R6 and R7 is independently a group of the formula (i), (ii), or (iii);

Formulae (i), (ii), and (iii) are:

wherein:
each instance of R? is independently hydrogen or optionally substituted alkyl;
X is O, S, or NRX, wherein RX is hydrogen, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted alkynyl, optionally substituted
carbocyclyl, optionally substituted heterocyclyl, optionally substituted aryl, optionally substituted heteroaryl, or a nitrogen
protecting group;

Y is O, S, or NRY, wherein RY is hydrogen, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted alkynyl, optionally substituted
carbocyclyl, optionally substituted heterocyclyl, optionally substituted aryl, optionally substituted heteroaryl, or a nitrogen
protecting group;

RP is hydrogen, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted alkynyl, optionally substituted
carbocyclyl, optionally substituted heterocyclyl, optionally substituted aryl, optionally substituted heteroaryl, an oxygen
protecting group when attached to an oxygen atom, a sulfur protecting group when attached to a sulfur atom, or a nitrogen
protecting group when attached to a nitrogen atom; and

RL is optionally substituted C1-50 alkyl, optionally substituted C2-50 alkenyl, optionally substituted C2-50 alkynyl, optionally substituted heteroC1-50 alkyl, optionally substituted heteroC2-50 alkenyl, optionally substituted heteroC2-50 alkynyl, or a polymer.

US Pat. No. 9,291,549

PATHOGEN DETECTION BIOSENSOR

Massachusetts Institute o...

1. A method for detecting an antigen in a sample comprising:
a) spraying emitter cells onto a sample, wherein the emitter cell comprises a receptor and an emitter molecule that emits
a photon in response to binding of a target antigen in the sample to the receptor;

b) detecting photon emission, wherein photon emission is indicative of the antigen in the sample.

US Pat. No. 9,422,517

MICROSCALE AND NANOSCALE STRUCTURES FOR MANIPULATING PARTICLES

The General Hospital Corp...

1. A method of manipulating particles in a fluid sample, the method comprising:
introducing a fluid sample comprising first particles having a first diameter, second particles having a second diameter that
is less than the first diameter, and third particles having a third diameter that is less than the second diameter into a
fluidic device comprising:

a fluid path; and
an array of obstacles disposed in the fluid path, each obstacle comprising a plurality of aligned nanostructures comprising
nanotubes or nanorods or both nanotubes and nanorods, wherein gaps between the obstacles in the array permit particles having
diameters less than the first diameter to flow through the gaps between obstacles, and wherein spaces between the nanostructures
render each obstacle porous such that the porosity of the obstacles permits particles having diameters less than the second
diameter to flow through the obstacle;

flowing the fluid sample through the device;
capturing the first particles with the array of obstacles;
capturing at least some of the second particles within the array of obstacles at obstacle outer boundaries defined by a plurality
of obstacles in the array; and

capturing at least some of the third particles within one or more obstacles in the array.

US Pat. No. 9,175,945

EVALUATING FIT OF AN EARPIECE BASED ON DYNAMIC DATA

MASSACHUSETTS INSTITUTE O...

1. A method comprising:
obtaining static data from an ear canal of a subject with a three-dimensional scanner, the static data including a three-dimensional
image of a surface of the ear canal at a predetermined pressure;

obtaining dynamic data from the ear canal of the subject with a three-dimensional scanner, the dynamic data including data
from the ear canal characterizing changes in a shape of the ear canal related to a compliance of the ear canal to changes
in pressurization and a shape change of the ear canal in response to a musculoskeletal movement of a head of the subject;

providing a three-dimensional model of an earpiece;
evaluating a fit of the three-dimensional model of the earpiece to the ear canal with a simulation executing on a processor
based on the static data and the dynamic data; and

modifying a characteristic of the three-dimensional model to improve the fit based on the evaluation of the fit by the processor.
US Pat. No. 9,084,837

COMPOSITIONS AND METHODS FOR AFFECTING MOVEMENT OF CONTAMINANTS, BODILY FLUIDS OR OTHER ENTITIES, AND/OR AFFECTING OTHER PHYSIOLOGICAL CONDITIONS

Massachusetts Institute o...

1. An in vivo barrier structure, comprising:
a composition comprising self-assembled peptidomimetics comprising alternating hydrophobic and hydrophilic residues and alternating
positively-charged and negatively-charged residues,

wherein the peptidomimetics are selected from the group consisting of ?-peptides, ?-peptides, ?-peptides, and ?-peptides,
wherein the ?-peptide peptidomimetics are selected from the group consisting of N,N?-linked oligoureas, oligopyrrolinones,
oxazolidin-2-ones, azatides and azapeptides, and

wherein the barrier structure is formed following contact of the peptidomimetics with a bodily fluid and/or contaminant of
a tissue.

US Pat. No. 9,786,955

ASSEMBLY METHODS FOR LIQUID METAL BATTERY WITH BIMETALLIC ELECTRODE

Massachusetts Institute o...

1. A method of assembling an electrochemical cell having a housing and positive and negative current collectors, the method
comprising:
providing a binary alloy formed from an anodic metal of group IA or IIA of the periodic table of the elements and a cathodic
metal other than the anodic metal;

placing the binary alloy in a solid phase in the housing with a metalloid in a solid phase and an electrolyte in a solid phase,
the electrolyte comprising a salt of the anodic metal;

heating the binary alloy, the metalloid and the electrolyte to form two liquid layers, wherein a first layer comprises the
electrolyte, and a second layer comprises an alloy of the anodic metal, the cathodic metal and the metalloid;

contacting the negative current collector with the electrolyte and the positive current collector with the alloy; and
charging the electrochemical cell to drive the anodic metal in the alloy to the negative current collector.
US Pat. No. 9,320,750

COMPOSITIONS AND METHODS OF TREATMENT OF DRUG RESISTANT CANCERS

Massachusetts Institute o...

1. A method for treating a cancer in a subject in need thereof, wherein the cancer is resistant to a DNA-damaging chemotherapeutic
agent, the method comprising:
administering to the patient an effective amount of a pharmaceutical composition comprising a liposome in a pharmaceutically
effective excipient,

wherein the liposome includes an aqueous interior layer and a lipophilic exterior layer, the lipophilic exterior layer including
a hydrophobic inhibitor of an EGFR pathway, and the aqueous interior layer including a hydrophilic DNA-damaging chemotherapeutic
agent,

wherein the pharmaceutical composition further comprises a controlled release excipient, and wherein a therapeutically effective
amount of the EGFR inhibitor is released at the time of administration, and a therapeutically effective amount of the DNA
damaging agent is released at least four hours later.

US Pat. No. 9,213,916

COMPRESSIVE SENSING WITH LOCAL GEOMETRIC FEATURES

THE CHARLES STARK DRAPER ...

1. A method of compressive sensing, comprising:
compressing a first image into a first sketch and a second sketch at least in part by partitioning the first image into a
first plurality of non-overlapping subsections and linearly combining pixel values from each subsection of the first plurality
of non-overlapping subsections, the first sketch and the second sketch each being undersampled representations of and smaller
in size than the first image;

compressing a second image into a third sketch and a fourth sketch at least in part by partitioning the second image into
a plurality of non-overlapping subsections and linearly combining pixel values from each subsection of the second plurality
of non-overlapping subsections, the third sketch and the fourth sketch each being undersampled representations of and smaller
in size than the second image; and

determining a translation between the first image and the second image, using a processor, based on the first sketch, the
second sketch, the third sketch and the fourth sketch, without reconstructing each of the first image and the second image.

US Pat. No. 9,352,959

METHOD AND APPLICATIONS OF THIN-FILM MEMBRANE TRANSFER

Massachusetts Institute o...

1. A solvent-free method to form a micro-electromechanical structure, comprising
forming a receiving substrate, the receiving substrate having one or more ridges adjacent a cavity;
forming a parylene layer over a supporting substrate, the parylene layer having a thickness of about 200 nm-1 micron;
depositing a plurality of secondary layers over the parylene layer to form a composite membrane;
removing the composite membrane from the supporting substrate by directly delaminating the parylene layer integrated with
the composite membrane from the supporting substrate; and

positioning the composite membrane over the receiving substrate to cover at least a portion of the cavity.

US Pat. No. 9,333,060

PLAQUE REMOVAL AND DIFFERENTIATION OF TOOTH AND GUM

Massachusetts Institute o...

62. A tooth treatment device comprising:
a liquid ejector that ejects a liquid jet against teeth, the liquid jet being a continuous stream of uninterrupted liquid
between the liquid ejector and the teeth, the liquid ejector comprising a Lorentz-force electromagnetic actuator including
a magnet assembly providing a magnetic field and a coil assembly;

a transducer generating a signal, the signal propagating only through the liquid jet between the liquid ejector and the tissue;
a sensor that senses a reflected signal reflected from tissue back through the liquid jet, the reflected signal propagating
only through the liquid jet between the liquid ejector and the tissue; and

a servo controller controlling pressure of ejected liquid in response to a sensed surface condition, the surface condition
being sensed based on the reflected signal.

US Pat. No. 9,628,272

PUF AUTHENTICATION AND KEY-EXCHANGE BY SUBSTRING MATCHING

WILLIAM MARSH RICE UNIVER...

1. A method for operating a device to verify the authenticity of a communicating party, the method comprising:
receiving a data string from the communicating party, wherein the data string is generated by the communicating party by:
(a) submitting a challenge to a physical unclonable function to obtain a response string,
(b) selecting a substring of predetermined length from the response string,
(c) injecting the selected substring onto a continuous range of bit positions within the data string, wherein a start position
of the selected substring within the data string is determined by a variable number that is not communicated to said device,
and

(d) injecting random bits into bit positions of the data string not assigned to the selected substring, wherein said generating
the data string also includes randomly selecting the variable number;

generating an estimated response string by evaluating a computational model of the physical unclonable function based on the
challenge;

performing a search process to identify the selected substring within the data string using the estimated response string;
determining whether the communicating party is authentic based on a measure of similarity between the identified selected
substring and a corresponding substring of the estimated response string, wherein said generating, said performing and said
determining are performed by digital circuitry.

US Pat. No. 9,613,285

COMPRESSIVE SENSING WITH LOCAL GEOMETRIC FEATURES

THE CHARLES STARK DRAPER ...

1. An apparatus for compressive sensing comprising:
a lens;
a focal plane array (FPA) coupled to the lens so as to receive an image, the FPA being configured to generate a compressed
image at least in part by folding the image, the compressed image including at least one folded image; and

a decoder configured to receive the compressed image and to recover at least one feature of the image based on the compressed
image and without reconstructing the image.

US Pat. No. 9,428,404

WATER EXTRACTION USING A DIRECTIONAL SOLVENT

Massachusetts Institute o...

1. A method for continuous water extraction, comprising:
(a) flowing a directional solvent in a continuous and substantially closed circuit;
(b) introducing a liquid composition including water and at least one dissolved component into the circuit where the liquid
composition mixes with the directional solvent;

(c) heating the directional solvent before or after the introduction of the liquid composition;
(d) dissolving water from the liquid composition into the directional solvent to form a water-solvent solution, while substantially
excluding from the directional solvent a concentrated remainder including the component that was dissolved in the liquid composition;

(e) separating the concentrated remainder from the water-solvent solution with a first physical partition positioned to split
a majority of the water-solvent solution from the concentrated remainder orthogonally to an incoming flow direction of the
water-solvent solution and the concentrated remainder and removing the concentrated remainder from the circuit with the first
physical partition;

(f) cooling the water-solvent solution to precipitate the water from the directional solvent;
(g) separating the water in a purified form from the directional solvent by electro-coalescence or dielectrophoresis and removing
a majority of the purified water with a second physical partition orthogonally to an incoming flow direction of the purified
water and the directional solvent following the electro-coalescence or dielectrophoresis; and

(h) recirculating the directional solvent in the circuit and repeating steps (b)-(g).
US Pat. No. 9,408,890

MULTIVALENT LIPOSOME FORMULATIONS

The Charles Stark Draper ...

1. A composition comprising:
a first population of lipids, a second population of lipids, cholesterol, and two or more influenza A binding targets, wherein
the influenza A binding targets are linked to the first population of lipids to form BT-lipids, wherein the BT-lipids, the
second population of lipids, and cholesterols form a liposome, wherein the binding targets are displayed on the outer surface
of the liposome, wherein the first population of lipids and the second population of lipids in the liposome have a phase transition
temperature below 41° C., wherein the cholesterol comprises 15 to 30 mol % of the liposome.

US Pat. No. 9,085,595

TUNGSTEN OXO ALKYLIDENE COMPLEXES FOR Z SELECTIVE OLEFIN METATHESIS

Massachusetts Institute o...

1. A compound of formula I-c:
wherein:
each of R1 and R2 is independently R, —OR, —SR, —N(R)2, —OC(O)R, —SOR, —SO2R, —SO2N(R)2, —C(O)N(R)2, —NRC(O)R, or —NRSO2R;

R3? is R3 or —OSi(R)3;

R3 is R, —N(R)2, —NRC(O)R, —NRC(O)OR, —NRC(O)N(R)2, —NRSO2R, —NRSO2N(R)2, —NROR, NR3, —OR, O(R)2, or an optionally substituted group selected from a 5-6 membered monocyclic heteroaryl ring having at least one nitrogen
and 0-3 additional heteroatoms independently selected from nitrogen, oxygen, or sulfur, a 4-7 membered saturated or partially
unsaturated heterocyclic ring having at least one nitrogen and 0-2 additional heteroatoms independently selected from nitrogen,
oxygen, or sulfur, a 7-10 membered bicyclic saturated or partially unsaturated heterocyclic ring having at least one nitrogen
and 0-4 additional heteroatoms independently selected from nitrogen, oxygen, or sulfur, or an 8-10 membered bicyclic heteroaryl
ring having at least one nitrogen and 0-4 additional heteroatoms independently selected from nitrogen, oxygen, or sulfur;

R4 is halogen, R, —N(R)2, —NRC(O)R, —NRC(O)OR, —NRC(O)N(R)2, —NRSO2R, —NRSO2N(R)2, —NROR, NR3, —OR, O(R)2, a phosphorus-containing ligand, or an optionally substituted group selected from a 5-6 membered monocyclic heteroaryl ring
having at least one nitrogen and 0-3 additional heteroatoms independently selected from nitrogen, oxygen, or sulfur, a 4-7
membered saturated or partially unsaturated heterocyclic ring having at least one nitrogen and 0-2 additional heteroatoms
independently selected from nitrogen, oxygen, or sulfur, a 7-10 membered bicyclic saturated or partially unsaturated heterocyclic
ring having at least one nitrogen and 0-4 additional heteroatoms independently selected from nitrogen, oxygen, or sulfur,
or an 8-10 membered bicyclic heteroaryl ring having at least one nitrogen and 0-4 additional heteroatoms independently selected
from nitrogen, oxygen, or sulfur;

each R is independently hydrogen or an optionally substituted group selected from C1-20 aliphatic, C1-20 heteroaliphatic having 1-3 heteroatoms independently selected from nitrogen, oxygen, or sulfur, phenyl, ferrocene, a 3-7 membered
saturated or partially unsaturated carbocyclic ring, an 8-10 membered bicyclic saturated, partially unsaturated or aryl ring,
a 5-6 membered monocyclic heteroaryl ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur,
a 4-7 membered saturated or partially unsaturated heterocyclic ring having 1-3 heteroatoms independently selected from nitrogen,
oxygen, or sulfur, a 7-10 membered bicyclic saturated or partially unsaturated heterocyclic ring having 1-5 heteroatoms independently
selected from nitrogen, oxygen, or sulfur, or an 8-10 membered bicyclic heteroaryl ring having 1-5 heteroatoms independently
selected from nitrogen, oxygen, or sulfur, or:

two or three R groups on the same nitrogen atom are taken together with the nitrogen to form an optionally substituted 3-12
membered saturated, partially unsaturated, or aryl ring having 0-5 additional heteroatoms not including the same nitrogen
atom independently selected from nitrogen, oxygen, or sulfur; or:

two R groups on the same oxygen atom are taken together with the oxygen to form an optionally substituted 3-12 membered saturated,
partially unsaturated, or aryl ring having 0-5 additional heteroatoms not including the same oxygen atom independently selected
from nitrogen, oxygen, or sulfur;

n is 0, 1, or 2;
each R5 is independently a monodentate ligand, or two R5 are taken together with their intervening atoms to form an optionally substituted bidentate group; and

two or more of R1, R2, R3, R4 and R5 may be taken together with their intervening atoms to form an optionally substituted polydentate ligand; and
wherein the compound is other than WO(CH-t-Bu)(O-2,6-Ph2C6H3)2(R5)n, WO(CH-t-Bu)(O-t-Bu)2(R5)n, W(O)(CHCMe3)(Me2Pyr)2(PMe2Ph)n, andWO(CH—CH?C(Ph)2)(OC(CH3)(CF3)2)2(R5), wherein Me2Pyr is 2,5-dimethylpyrrolyl.

US Pat. No. 9,073,801

Z-SELECTIVE RING-CLOSING METATHESIS REACTIONS

Massachusetts Institute o...

4. A method comprising reacting a suitable diene with a catalyst or metal complex to form a compound of formula I-a:

wherein the double bond depicted therein is in the Z configuration, and wherein:
Ring A is an optionally substituted 8-30 membered saturated or partially unsaturated ring wherein 0-6 methylene units of Ring
A are optionally and independently replaced by —O—, —N(R)—, —S—, —C(O)—, —OC(O)—, —C(O)O—, —OC(O)O—, —S(O)—, or —S(O)2—, —OSO2O—, —N(R)C(O)—, —C(O)N(R)—, —N(R)C(O)O—, —OC(O)NR—, —N(R)C(O)NR—, or —Cy1—, wherein:

each —Cy1— is independently:

a bivalent optionally substituted monocyclic ring independently selected from phenylene, a 3-8 membered saturated or partially
unsaturated carbocyclylene, a 5-6 membered heteroarylene having 1-4 heteroatoms independently selected from nitrogen, oxygen,
or sulfur, or a 3-8 membered saturated or partially unsaturated heterocyclylene having 1-4 heteroatoms independently selected
from nitrogen, oxygen, or sulfur; or

a bivalent optionally substituted bicyclic ring independently selected from an 8-10 membered arylene, a 7-10 membered saturated
or partially unsaturated carbocyclylene, an 8-10 membered heteroarylene having 1-5 heteroatoms independently selected from
nitrogen, oxygen, or sulfur, or a 7-10 membered saturated or partially unsaturated heterocyclylene having 1-5 heteroatoms
selected from nitrogen, oxygen, or sulfur; or

a bivalent optionally substituted tricyclic ring independently selected from 14 membered arylene, a 9-20 membered saturated
or partially unsaturated carbocyclylene, a 9-14 membered heteroarylene having 1-8 heteroatoms independently selected from
nitrogen, oxygen, or sulfur, or a 9-20 membered saturated or partially unsaturated heterocyclylene having 1-8 heteroatoms
independently selected from nitrogen, oxygen, or sulfur; or

a bivalent optionally substituted tetracyclic ring independently selected from a 16-18 membered arylene, an 11-30 membered
saturated or partially unsaturated carbocyclylene, a 15-18 membered heteroarylene having 1-8 heteroatoms independently selected
from nitrogen, oxygen, or sulfur, or an 11-30 membered saturated or partially unsaturated heterocyclylene having 1-12 heteroatoms
independently selected from nitrogen, oxygen, or sulfur;

n is 0-20;
each R is independently hydrogen or an optionally substituted group selected from C1-6 aliphatic, phenyl, a 3-7 membered saturated or partially unsaturated carbocyclic ring, an 8-10 membered bicyclic saturated,
partially unsaturated or aryl ring, a 5-6 membered monocyclic heteroaryl ring having 1-4 heteroatoms independently selected
from nitrogen, oxygen, or sulfur, a 4-7 membered saturated or partially unsaturated heterocyclic ring having 1-3 heteroatoms
independently selected from nitrogen, oxygen, or sulfur, a 7-10 membered bicyclic saturated or partially unsaturated heterocyclic
ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, or sulfur, or an 8-10 membered bicyclic heteroaryl
ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, or sulfur, wherein:

two R groups on the same nitrogen atom are optionally taken together with the nitrogen atom to form an optionally substituted
3-8 membered, saturated, partially unsaturated, or aryl ring having 1-4 heteroatoms independently selected from nitrogen,
oxygen, or sulfur; or

two R groups on the same carbon atom are optionally taken together with their intervening atoms to form an optionally substituted
3-8 membered saturated or partially unsaturated spirocycle ring having 0-4 heteroatoms independently selected from nitrogen,
oxygen, or sulfur; or

two R groups on adjacent atoms are optionally taken together with their intervening atoms form an optionally substituted 3-8
membered, saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen,
or sulfur;

each RA is independently selected from —R, —QR, —OR, a suitably protected hydroxyl group, —SR, a suitably protected thiol group, —S(O)R,
—SO2R, —OSO2R, —N(R)2, a suitably protected amino group, —N(R)C(O)R, —N(R)C(O)C(O)R, —N(R)C(O)N(R)2, —N(R)C(O)OR, —C(O)OR, —OC(O)R, —C(O)N(R)2, or —OC(O)N(R)2, wherein:

two RA on the same carbon atom are optionally taken together to form an oxo moiety, an oxime, an optionally substituted hydrazone,
an optionally substituted imine, an optionally substituted C2-6 alkylidene, or an optionally substituted 3-8 membered saturated or partially unsaturated spirocycle having 0-4 heteroatoms
independently selected from nitrogen, oxygen, or sulfur, or:

two RA on adjacent atoms are optionally taken together to form an optionally substituted 3-8 membered, saturated, partially unsaturated,
or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur;

RB is —R, —QR, —OR, a suitably protected hydroxyl group, —SR, a suitably protected thiol group, —S(O)R, —SO2R, —OSO2R, —N(R)2, a suitably protected amino group, —N(R)C(O)R, —N(R)C(O)C(O)R, —N(R)C(O)N(R)2, —N(R)C(O)OR, —C(O)OR, —OC(O)R, —C(O)N(R)2, or —OC(O)N(R)2;

each Q is independently an optionally substituted bivalent C1-10 hydrocarbon chain wherein one, two, or three methylene units of Q are optionally and independently replaced by —O—, —S—, —C(O)—,
—OC(O)—, —C(O)O—, —OC(O)O—, —S(O)—, —S(O)2—, —OSO2O—, —N(R)C(O)—, —C(O)N(R)—, —N(R)C(O)O—, —OC(O)NR—, —N(R)C(O)NR—, or —Cy2—;

each —Cy2— is independently a bivalent optionally substituted ring selected from phenylene, a 3-8 membered saturated or partially unsaturated
monocyclic carbocyclylene, a 5-6 membered monocyclic heteroarylene having 1-4 heteroatoms independently selected from nitrogen,
oxygen, or sulfur, a 3-8 membered saturated or unsaturated monocyclic heterocyclylene having 1-4 heteroatoms independently
selected from nitrogen, oxygen, or sulfur, an 8-10 membered bicyclic arylene, a 7-10 membered saturated or partially unsaturated
bicyclic carbocyclylene, an 8-10 membered bicyclic heteroarylene having 1-5 heteroatoms independently selected from nitrogen,
oxygen, or sulfur, or a 7-10 membered saturated or partially unsaturated bicyclic heterocyclylene having 1-5 heteroatoms independently
selected from nitrogen, oxygen, or sulfur;

wherein the catalyst or metal complex is of formula II-a:

wherein:
M is molybdenum or tungsten;
R1 is an optionally substituted group selected from C1-20 aliphatic, C1-20 heteroaliphatic having 1-3 heteroatoms independently selected from nitrogen, oxygen, or sulfur, phenyl, a 3-7 membered saturated
or partially unsaturated carbocyclic ring, an 8-10 membered bicyclic saturated, partially unsaturated or aryl ring, a 5-6
membered monocyclic heteroaryl ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur, a 4-7
membered saturated or partially unsaturated heterocyclic ring having 1-3 heteroatoms independently selected from nitrogen,
oxygen, or sulfur, a 7-10 membered bicyclic saturated or partially unsaturated heterocyclic ring having 1-5 heteroatoms independently
selected from nitrogen, oxygen, or sulfur, or an 8-10 membered bicyclic heteroaryl ring having 1-5 heteroatoms independently
selected from nitrogen, oxygen, or sulfur;

each of R2 and R3 is independently R?, —OR?, —SR?, —N(R?)2, —OC(O)R?, —SOR?, —SO2R?, —SO2N(R?)2, —C(O)N(R?)2, —NR?C(O)R?, or —NR?SO2R?, provided that R2 and R3 are not simultaneously hydrogen;

R4 is an optionally substituted group selected from —Ar, C1-20 aliphatic, C1-20 heteroaliphatic having 1-3 heteroatoms independently selected from nitrogen, oxygen, or sulfur, phenyl, a 3-7 membered saturated
or partially unsaturated carbocyclic ring, an 8-10 membered bicyclic saturated, partially unsaturated or aryl ring, a 5-6
membered monocyclic heteroaryl ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur, a 4-7
membered saturated or partially unsaturated heterocyclic ring having 1-3 heteroatoms independently selected from nitrogen,
oxygen, or sulfur, a 7-10 membered bicyclic saturated or partially unsaturated heterocyclic ring having 1-5 heteroatoms independently
selected from nitrogen, oxygen, or sulfur, or an 8-14 membered bicyclic or tricyclic heteroaryl ring having 1-5 heteroatoms
independently selected from nitrogen, oxygen, or sulfur;

Ar is of the following formula:

wherein:
m is 0-3;
Ring B is an optionally substituted group selected from phenyl or a 5-6 membered monocyclic heteroaryl ring having 1-4 heteroatoms
independently selected from nitrogen, oxygen, or sulfur;

p and q are independently 0-6;
each of Ring C and Ring D is independently optionally substituted groups selected from phenyl, a 3-7 membered saturated or
partially unsaturated carbocyclic ring, an 8-10 membered bicyclic saturated, partially unsaturated or aryl ring, a 5-6 membered
monocyclic heteroaryl ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur, a 4-7 membered
saturated or partially unsaturated heterocyclic ring having 1-3 heteroatoms independently selected from nitrogen, oxygen,
or sulfur, a 7-10 membered bicyclic saturated or partially unsaturated heterocyclic ring having 1-5 heteroatoms independently
selected from nitrogen, oxygen, or sulfur, or an 8-10 membered bicyclic heteroaryl ring having 1-5 heteroatoms independently
selected from nitrogen, oxygen, or sulfur;

each Rx, Ry, and Rz is independently halogen, —OR?, —N(R?)2, —NR?C(O)R?, —NR?C(O)OR?, —NR?C(O)N(R?)2, —NR?SO2R?, —NR?SO2N(R?)2, —NR?OR?, or an optionally substituted group selected from C1-20 aliphatic, C1-20 heteroaliphatic having 1-3 heteroatoms independently selected from nitrogen, oxygen, or sulfur;

R5 is —N(R?)2, —NR?C(O)R?, —NR?C(O)OR?, —NR?C(O)N(R?)2, —NR?SO2R?, —NR?SO2n(R?)2, or —NR?OR?, or an optionally substituted group selected from a 5-6 membered monocyclic heteroaryl ring having at least one
nitrogen and 0-3 heteroatoms independently selected from nitrogen, oxygen, or sulfur, a 4-7 membered saturated or partially
unsaturated heterocyclic ring having at least one nitrogen and 0-2 heteroatoms independently selected from nitrogen, oxygen,
or sulfur, a 7-10 membered bicyclic saturated or partially unsaturated heterocyclic ring having at least one nitrogen and
0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur, or an 8-10 membered bicyclic heteroaryl ring having
at least one nitrogen and 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur, wherein R5 is coordinated to M via a nitrogen;

R6 is an optionally substituted group selected from C1-20 aliphatic, C1-20 heteroaliphatic having 1-3 heteroatoms independently selected from nitrogen, oxygen, or sulfur, phenyl, a 3-7 membered saturated
or partially unsaturated carbocyclic ring, an 8-10 membered bicyclic saturated, partially unsaturated or aryl ring, a 5-6
membered monocyclic heteroaryl ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur, a 4-7
membered saturated or partially unsaturated heterocyclic ring having 1-3 heteroatoms independently selected from nitrogen,
oxygen, or sulfur, a 7-10 membered bicyclic saturated or partially unsaturated heterocyclic ring having 1-5 heteroatoms independently
selected from nitrogen, oxygen, or sulfur, or an 8-14 membered bicyclic or tricyclic heteroaryl ring having 1-5 heteroatoms
independently selected from nitrogen, oxygen, or sulfur; and

each R? is independently hydrogen or an optionally substituted group selected from C1-6 aliphatic, phenyl, a 3-7 membered saturated or partially unsaturated carbocyclic ring, an 8-10 membered bicyclic saturated,
partially unsaturated or aryl ring, a 5-6 membered monocyclic heteroaryl ring having 1-4 heteroatoms independently selected
from nitrogen, oxygen, or sulfur, a 4-7 membered saturated or partially unsaturated heterocyclic ring having 1-3 heteroatoms
independently selected from nitrogen, oxygen, or sulfur, a 7-10 membered bicyclic saturated or partially unsaturated heterocyclic
ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, or sulfur, or an 8-10 membered bicyclic heteroaryl
ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, or sulfur, wherein:

two R? groups on the same nitrogen atom are optionally taken together with the nitrogen atom to form an optionally substituted
3-8 membered, saturated, partially unsaturated, or aryl ring having 1-4 heteroatoms independently selected from nitrogen,
oxygen, or sulfur;

or wherein the catalyst or metal complex is of formula II-b:

wherein:
M is molybdenum or tungsten;
R1 is an optionally substituted group selected from C1-20 aliphatic, C1-20 heteroaliphatic having 1-3 heteroatoms independently selected from nitrogen, oxygen, or sulfur, phenyl, a 3-7 membered saturated
or partially unsaturated carbocyclic ring, an 8-10 membered bicyclic saturated, partially unsaturated or aryl ring, a 5-6
membered monocyclic heteroaryl ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur, a 4-7
membered saturated or partially unsaturated heterocyclic ring having 1-3 heteroatoms independently selected from nitrogen,
oxygen, or sulfur, a 7-10 membered bicyclic saturated or partially unsaturated heterocyclic ring having 1-5 heteroatoms independently
selected from nitrogen, oxygen, or sulfur, or an 8-10 membered bicyclic heteroaryl ring having 1-5 heteroatoms independently
selected from nitrogen, oxygen, or sulfur;

R2? and R3? are taken together with their intervening metal atom to form an optionally substituted 3-8 membered saturated or partially
unsaturated ring having, in addition to the intervening metal atom, 0-4 heteroatoms independently selected from nitrogen,
oxygen, or sulfur;

R4 is an optionally substituted group selected from —Ar, C1-20 aliphatic, C1-20 heteroaliphatic having 1-3 heteroatoms independently selected from nitrogen, oxygen, or sulfur, phenyl, a 3-7 membered saturated
or partially unsaturated carbocyclic ring, an 8-10 membered bicyclic saturated, partially unsaturated or aryl ring, a 5-6
membered monocyclic heteroaryl ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur, a 4-7
membered saturated or partially unsaturated heterocyclic ring having 1-3 heteroatoms independently selected from nitrogen,
oxygen, or sulfur, a 7-10 membered bicyclic saturated or partially unsaturated heterocyclic ring having 1-5 heteroatoms independently
selected from nitrogen, oxygen, or sulfur, or an 8-14 membered bicyclic or tricyclic heteroaryl ring having 1-5 heteroatoms
independently selected from nitrogen, oxygen, or sulfur; wherein:

Ar is of the following formula:

wherein:
m is 0-3;
Ring B is an optionally substituted group selected from phenyl or a 5-6 membered monocyclic heteroaryl ring having 1-4 heteroatoms
independently selected from nitrogen, oxygen, or sulfur;

each of Ring C and Ring D is independently optionally substituted groups selected from phenyl, a 3-7 membered saturated or
partially unsaturated carbocyclic rind, an 8-10 membered bicyclic saturated, partially unsaturated or aryl ring, a 5-6 membered
monocyclic heteroaryl ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur, a 4-7 membered
saturated or partially unsaturated heterocyclic ring having 1-3 heteroatoms independently selected from nitrogen, oxygen,
or sulfur, a 7-10 membered bicyclic saturated or partially unsaturated heterocyclic ring having 1-5 heteroatoms independently
selected from nitrogen, oxygen, or sulfur, or an 8-10 membered bicyclic heteroaryl ring having 1-5 heteroatoms independently
selected from nitrogen, oxygen, or sulfur;

p and q are independently 0-6;
each Rx, Ry, and Rz is independently halogen, —OR6, —N(R?)2, —NR?C(O)R?, —NR?C(O)OR?, —NR?C(O)N(R?)2, —NR?SO2R?, —NR?SO2N(R?)2, —NR?OR?, or an optionally substituted group selected from C1-20 aliphatic, C1-20 heteroaliphatic having 1-3 heteroatoms independently selected from nitrogen, oxygen, or sulfur;

R5 is halogen, —OR6, —N(R?)2, —NR?C(O)R?, —NR?C(O)OR?, —NR?C(O)N(R?)2, —NR?SO2R?, —NR?SO2N(R?)2, or —NR?OR?, or an optionally substituted group selected from a 5-6 membered monocyclic heteroaryl ring having at least one
nitrogen and 0-3 heteroatoms independently selected from nitrogen, oxygen, or sulfur, a 4-7 membered saturated or partially
unsaturated heterocyclic ring having at least one nitrogen and 0-2 heteroatoms independently selected from nitrogen, oxygen,
or sulfur, a 7-10 membered bicyclic saturated or partially unsaturated heterocyclic ring having at least one nitrogen and
0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur, or an 8-10 membered bicyclic heteroaryl ring having
at least one nitrogen and 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur, wherein R5 is coordinated to M via a nitrogen;

R6 is an optionally substituted group selected from C1-20 aliphatic, C1-20 heteroaliphatic having 1-3 heteroatoms independently selected from nitrogen, oxygen, or sulfur, phenyl, a 3-7 membered saturated
or partially unsaturated carbocyclic ring, an 8-10 membered bicyclic saturated, partially unsaturated or aryl ring, a 5-6
membered monocyclic heteroaryl ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur, a 4-7
membered saturated or partially unsaturated heterocyclic ring having 1-3 heteroatoms independently selected from nitrogen,
oxygen, or sulfur, a 7-10 membered bicyclic saturated or partially unsaturated heterocyclic ring having 1-5 heteroatoms independently
selected from nitrogen, oxygen, or sulfur, or an 8-14 membered bicyclic or tricyclic heteroaryl ring having 1-5 heteroatoms
independently selected from nitrogen, oxygen, or sulfur; and

each R? is independently hydrogen or an optionally substituted group selected from C1-6 aliphatic, phenyl, a 3-7 membered saturated or partially unsaturated carbocyclic ring, an 8-10 membered bicyclic saturated,
partially unsaturated or aryl ring, a 5-6 membered monocyclic heteroaryl ring having 1-4 heteroatoms independently selected
from nitrogen, oxygen, or sulfur, a 4-7 membered saturated or partially unsaturated heterocyclic ring having 1-3 heteroatoms
independently selected from nitrogen, oxygen, or sulfur, a 7-10 membered bicyclic saturated or partially unsaturated heterocyclic
ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, or sulfur, or an 8-10 membered bicyclic heteroaryl
ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, or sulfur, wherein:

two R? groups on the same nitrogen atom are optionally taken together with the nitrogen atom to form an optionally substituted
3-8 membered, saturated, partially unsaturated, or aryl ring having 1-4 heteroatoms independently selected from nitrogen,
oxygen, or sulfur;

or wherein the catalyst or metal complex is of formula II-c:

wherein:
M is molybdenum or tungsten;
R8 is R1, or phenyl optionally substituted with one to five R9;

each R9 is independently halogen or R1;
R1 is an optionally substituted group selected from C1-20 aliphatic, C1-20 heteroaliphatic having 1-3 heteroatoms independently selected from nitrogen, oxygen, or sulfur, phenyl, a 3-7 membered saturated
or partially unsaturated carbocyclic ring, an 8-10 membered bicyclic saturated, partially unsaturated or aryl ring, a 5-6
membered monocyclic heteroaryl ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur, a 4-7
membered saturated or partially unsaturated heterocyclic ring having 1-3 heteroatoms independently selected from nitrogen,
oxygen, or sulfur, a 7-10 membered bicyclic saturated or partially unsaturated heterocyclic ring having 1-5 heteroatoms independently
selected from nitrogen, oxygen, or sulfur, or an 8-10 membered bicyclic heteroaryl ring having 1-5 heteroatoms independently
selected from nitrogen, oxygen, or sulfur;

each of R2 and R3 is independently R?, —OR?, —SR?, —N(R?)2, —OC(O)R?, —SOR?, —SO2R?, —SO2N(R?)2, —C(O)N(R)2, —NR?C(O)R?, or —NR?SO2R?, provided that R2 and R3 are not simultaneously hydrogen;

each R7 is independently an optionally substituted group selected from —Ar?, C1-20 aliphatic, C1-20 heteroaliphatic having 1-3 heteroatoms independently selected from nitrogen, oxygen, or sulfur, phenyl, a 3-7 membered saturated
or partially unsaturated carbocyclic ring, an 8-10 membered bicyclic saturated, partially unsaturated or aryl ring, a 5-6
membered monocyclic heteroaryl ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur, a 4-7
membered saturated or partially unsaturated heterocyclic ring having 1-3 heteroatoms independently selected from nitrogen,
oxygen, or sulfur, a 7-10 membered bicyclic saturated or partially unsaturated heterocyclic ring having 1-5 heteroatoms independently
selected from nitrogen, oxygen, or sulfur, or an 8-14 membered bicyclic or tricyclic heteroaryl ring having 1-5 heteroatoms
independently selected from nitrogen, oxygen, or sulfur; and two R7 are optionally taken together with the oxygen atoms to which they are attached to form a bidentate ligand;

Ar? is of the following formula:

wherein:
t is 0-4;
p is 0-6;
each Ring B? and Ring C? is independently an optionally substituted group selected from phenyl, a 3-7 membered saturated or
partially unsaturated carbocyclic ring, an 8-10 membered bicyclic saturated, partially unsaturated or aryl ring, a 5-6 membered
monocyclic heteroaryl ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur, a 4-7 membered
saturated or partially unsaturated heterocyclic ring having 1-3 heteroatoms independently selected from nitrogen, oxygen,
or sulfur, a 7-10 membered bicyclic saturated or partially unsaturated heterocyclic ring having 1-5 heteroatoms independently
selected from nitrogen, oxygen, or sulfur, or an 8-10 membered bicyclic heteroaryl ring having 1-5 heteroatoms independently
selected from nitrogen, oxygen, or sulfur; and

each Rs is independently halogen, R?, —OR?, —SR?, —S(O)R?, —S(O)2R?, —OSi(R?)3, —N(R?)2, —NR?C(O)R?, —NR?C(O)OR?, —NR?C(O)N(R?)2, —NR?SO2R?, —NR?SO2N(R?)2, or —NR?OR?;

each R? is independently hydrogen or an optionally substituted group selected from C1-6 aliphatic, phenyl, a 3-7 membered saturated or partially unsaturated carbocyclic ring, an 8-10 membered bicyclic saturated,
partially unsaturated or aryl ring, a 5-6 membered monocyclic heteroaryl ring having 1-4 heteroatoms independently selected
from nitrogen, oxygen, or sulfur, a 4-7 membered saturated or partially unsaturated heterocyclic ring having 1-3 heteroatoms
independently selected from nitrogen, oxygen, or sulfur, a 7-10 membered bicyclic saturated or partially unsaturated heterocyclic
ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, or sulfur, or an 8-10 membered bicyclic heteroaryl
ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, or sulfur, wherein:

two R? groups on the same nitrogen atom are optionally taken together with the nitrogen atom to form an optionally substituted
3-8 membered, saturated, partially unsaturated, or aryl ring having 1-4 heteroatoms independently selected from nitrogen,
oxygen, or sulfur;

and wherein the catalyst or metal complex is other than Mo(CHG)(N(2,6-(i-Pr)2C6H3))(OCMe(CF3)2)2, wherein G is —tBu or CMe2Ph

wherein the catalyst or metal complex is other than Mo(CHG)(N(2,6-(i-Pr)2C6H3))(OCMe(CF3)2)2, wherein G is —tBu or —CMe2Ph, and

US Pat. No. 9,056,899

ENGINEERED BACTERIOPHAGES AS ADJUVANTS FOR ANTIMICROBIAL AGENTS AND COMPOSITIONS AND METHODS OF USE THEREOF

Trustees of Boston Univer...

1. An engineered bacteriophage comprising a nucleic acid operatively linked to a promoter, wherein the nucleic acid encodes:
a bacterial porin or porin-like protein of the OMP superfamily.

US Pat. No. 9,181,297

CYSTEINE ARYLATION DIRECTED BY A GENETICALLY ENCODABLE ?-CLAMP

Massachusetts Institute o...

1. A method according to Scheme 1:
wherein, independently for each occurrence,
base is a Bronsted base;
A1 is H, an amine protecting group, a natural or unnatural alpha amino acid, a peptide, an oligopeptide, a polypeptide, or a
protein;

A5 is OH, —O(carboxylate protecting group), a natural or unnatural alpha amino acid, a peptide, an oligopeptide, a polypeptide,
or a protein;

x is 0, 1, 2, 3, 4, 5, or 6;
R is H or alkyl;
R2 is aralkyl or heteroaralkyl;

R3 is aralkyl or heteroaralkyl;

B is a perfluorinated aryl radical; and
is a perfluorinated aryl para-substituted diradical.

US Pat. No. 9,447,129

SUPRAMETALLOGELS AND USES THEREOF

Massachusetts Institute o...

1. A supramolecular complex comprising:
(a) two or more instances of a nanostructure, wherein each instance of the nanostructure comprises:
(i) x instances of a transition metal ion, wherein x is an integer between 2 and 60, inclusive; and
(ii) 2x instances of a ligand of Formula (A):

wherein:
Ring A is a substituted or unsubstituted phenyl ring or a substituted or unsubstituted, 5- or 6-membered, monocyclic heteroaryl
ring;

each instance of XA, XB, XC, and XD is independently O, S, N, NRA1, C, or CRA2;

XE is absent, N, or CRA2;

each instance of RA1 is independently hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted
alkynyl, substituted or unsubstituted carbocyclyl, substituted or unsubstituted heterocyclyl, substituted or unsubstituted
aryl, substituted or unsubstituted heteroaryl, —C(?O)Ra, —C(?O)ORa, —C(?O)N(Ra)2, or a nitrogen protecting group;

each instance of RA2 is independently hydrogen, halogen, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted
or unsubstituted alkynyl, substituted or unsubstituted carbocyclyl, substituted or unsubstituted heterocyclyl, substituted
or unsubstituted aryl, substituted or unsubstituted heteroaryl, —ORa, —N(Ra)2, —SRa, —CN, —SCN, —C(?NRa)Ra, —C(?NRa)ORa, —C(?NRa)N(Ra)2, —C(?O)Ra, —C(?O)ORa, —C(?O)N(Ra)2, —NO2, —NRaC(?O)Ra, —NRaC(?O)ORa, —NRaC(?O)N(Ra)2, —OC(?O)Ra, —OC(?O)ORa, or —OC(?O)N(Ra)2;

each instance of Ra is independently hydrogen, substituted or unsubstituted acyl, substituted or unsubstituted alkyl, substituted or unsubstituted
alkenyl, substituted or unsubstituted alkynyl, substituted or unsubstituted carbocyclyl, substituted or unsubstituted heterocyclyl,
substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, a nitrogen protecting group when attached to a
nitrogen atom, an oxygen protecting group when attached to an oxygen atom, or a sulfur protecting group when attached to a
sulfur atom, or two instances of Ra are joined to form a substituted or unsubstituted heterocyclic or substituted or unsubstituted heteroaryl ring;

each instance of RB is independently halogen, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted
alkynyl, substituted or unsubstituted carbocyclyl, substituted or unsubstituted heterocyclyl, substituted or unsubstituted
aryl, substituted or unsubstituted heteroaryl, —ORa, —N(Ra)2, —SRa, —CN, —SCN, —C(?NRa)Ra, —C(?NRa)ORa, —C(?NRa)N(Ra)2, —C(?O)Ra, —C(?O)ORa, —C(?O)N(Ra)2, —NO2, —NRaC(?O)Ra, —NRaC(?O)ORa, —NRaC(?O)N(Ra)2, —OC(?O)Ra, —OC(?O)ORa, or —OC(?O)N(Ra)2;

m is 0, 1, 2, 3, or 4;
each instance of RC is independently halogen, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted
alkynyl, substituted or unsubstituted carbocyclyl, substituted or unsubstituted heterocyclyl, substituted or unsubstituted
aryl, substituted or unsubstituted heteroaryl, —N(Ra)2, —SRa, —CN, —SCN, —C(?NRa)Ra, —C(?NRa)ORa, —C(?NRa)N(Ra)2, —C(?O)Ra, —C(?O)ORa, —C(?O)N(Ra)2, —NO2, —NRaC(?O)Ra, —NRaC(?O)ORa, —NRaC(?O)N(Ra)2, —OC(?O)Ra, —OC(?O)ORa, or —OC(?O)N(Ra)2;

n is 0, 1, 2, 3, or 4;
ZA is a bond or a substituted or unsubstituted C1-4 hydrocarbon chain, optionally wherein one or more chain atoms are independently replaced with —O—, —S—, —NRZA—, —N?, or ?N—, wherein each instance of RZA is independently hydrogen, substituted or unsubstituted C1-6 alkyl, or a nitrogen protecting group;

ZB is a bond or a substituted or unsubstituted C1-4 hydrocarbon chain, optionally wherein one or more chain atoms are independently replaced with —O—, —S—, or —NRZB—, wherein each instance of RZB is independently hydrogen, substituted or unsubstituted C1-6 alkyl, or a nitrogen protecting group;

wherein each instance of the transition metal ion and two instances of the ligand of Formula (A) form through coordination
bonds a coordination complex;

wherein the x instances of the transition metal ion and the 2x instances of the ligand of Formula (A) form through the coordination
bonds a substantially spherical structure or paddlewheel structure;

wherein each of the coordination bonds is formed between an instance of the transition metal ion and the nitrogen atom labeled
with 1? or 1? of an instance of the ligand of Formula (A); and

wherein the average outer diameter of the nanostructure is between about 1 nm and about 100 nm, inclusive; and
(b) at least one instance of Y, wherein:
each instance of Y is independently a substituted or unsubstituted, saturated or unsaturated C30-3000 hydrocarbon chain, optionally wherein one or more chain atoms are independently replaced with —O—, —S—, —NRY—, ?N—, or —N?, wherein each instance of RY is independently hydrogen, substituted or unsubstituted C1-6 alkyl, or a nitrogen protecting group;

each instance of Y is independently directly covalently attached to an instance of the ligand of Formula (A) and directly
covalently attached to another instance of the ligand of Formula (A); and

at least two instances of the nanostructure are directly covalently connected by at least one instance of Y.
US Pat. No. 9,404,130

MICROBIAL ENGINEERING FOR THE PRODUCTION OF CHEMICAL AND PHARMACEUTICAL PRODUCTS FROM THE ISOPRENOID PATHWAY

Massachusetts Institute o...

1. A method for making a product containing steviol or steviol glycoside, the method comprising:
providing an Escherichia coli (E. coli) that produces isopentyl pyrophosphate (IPP) and dimethylallyl pyrophosphate (DMAPP) through an upstream methylerythritol
pathway (MEP) and converts the IPP and DMAPP to steviol or steviol glycoside through a recombinantly expressed downstream
synthesis pathway comprising geranylgeranylpyrophosphate synthase, ent-copalyl diphosphate synthase, ent-kaurene synthase,
ent-kaurene oxidase, and ent-kaurenoic acid 13-hydroxylase, and optionally one or more UDP glycosyltransferases;

culturing the E. coli to produce the steviol or steviol glycoside, wherein the accumulation of indole in the culture is controlled to below 100
mg/L to thereby increase steviol or steviol glycoside production; and

incorporating the steviol or steviol glycoside into a food product, food additive, beverage, chewing gum, candy, or oral care
product.

US Pat. No. 9,115,053

ACTIVATORS OF CLASS I HISTONE DEACETLYASES (HDACS) AND USES THEREOF

Massachusetts Institute o...

1. A compound of Formula (C-VII):
or a pharmaceutically acceptable salt, tautomer, stereoisomer, or prodrug thereof, wherein:
each instance of RC1 and RC2 is independently selected from the group consisting of halogen, optionally substituted alkyl, optionally substituted alkenyl,
optionally substituted alkynyl, optionally substituted carbocyclyl, optionally substituted heterocyclyl, optionally substituted
aryl, optionally substituted heteroaryl, —ORC2a, —N(RC2b)2, —SRC2a, —C(?O)RC2a, —C(?O)ORC2a, —C(?O)SRC2a, —C(?O)N(RC2b)2, —OC(?O)RC2a, —OC(?O)ORC2a, —OC(?O)SRC2a, —OC(?O)N(RC2b)2, —NRC2bC(?O)RC2b, —NRC2bC(?O)ORC2a, —NRC2bC(?O)SRC2a, —NRC2bC(?O)N(RC2b)2, —SC(?O)RC2a, —SC(?O)ORC2a, —SC(?O)SRC2a, —SC(?O)N(RC2b)2, —C(?NRC2b)RC2a, —C(?NRC2b)ORC2a, —C(?NRC2b)SRC2a, —C(?NRC2b)N(RC2b)2, —OC(?NRC2b)RC2a, —OC(?NRC2b)ORC2a, —OC(?NRC2b)SRC2a, —OC(?NRC2b)N(RC2b)2, —NRC2bC(?NRC2b)RC2b, —NRC2bC(?NRC2b)ORC2a, —NRC2bC(?NRC2b)SRC2a, —NRC2bC(?NRC2b)N(RC2b)2, —SC(?NRC2b)RC2a, —SC(?NRC2b)ORC2a, —SC(?NRC2b)SRC2a, —SC(?NRC2b)N(RC2b)2, —C(?S)RC2a, —C(?S)ORC2a, —C(?S)SRC2a, —C(?S)N(RC2b)2, —OC(?S)RC2a, —OC(?S)ORC2a, —OC(?S)SRC2a, —OC(?S)N(RC2b)2, —NRC2bC(?S)RC2b, —NRC2bC(?S)ORC2a, —NRC2bC(?S)SRC2a, —NRC2bC(?S)N(RC2b)2, —SC(?S)RC2a, —SC(?S)ORC2a, —SC(?S)SRC2a, —SC(?S)N(RC2b)2, —S(?O)RC2a, —SO2RC2a, —NRC2bSO2RC2a, —SO2N(RC2b)2, —CN, —SCN, and —NO2, wherein each occurrence of RC2a is independently hydrogen, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted alkynyl, optionally
substituted carbocyclyl, optionally substituted heterocyclyl, optionally substituted aryl, or optionally substituted heteroaryl,
and each occurrence of RC2b is independently hydrogen, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted alkynyl, optionally
substituted carbocyclyl, optionally substituted heterocyclyl, optionally substituted aryl, optionally substituted heteroaryl,
or a nitrogen protecting group, or two RC2b groups are joined to form an optionally substituted heterocyclic ring;

q is 0, 1, 2, 3, or 4; and
v is 0, 1, 2, or 3;
provided that the compound is not of the formula:
or a pharmaceutically acceptable salt thereof.

US Pat. No. 9,091,183

DOUBLE PINCH CRITERION FOR OPTIMIZATION OF REGENERATIVE RANKINE CYCLES

Massachusetts Institute o...

1. A method of operating a power generation system, comprising:
heating a working fluid in a steam generator;
directing the heated working fluid into a turbine to rotate the turbine, the working fluid forming a feed after exiting the
turbine;

extracting a bleed from the turbine and using the bleed to heat the feed in a feedwater heater configured to exchange heat
between a first flow path through which the feed flows and a second flow path through which the bleed flows; and

adjusting at least one of a mass flow rate of the bleed and an extraction pressure of the bleed such that a double pinch is
obtained in the feedwater heater, the double pinch comprising a first pinch point at an onset of condensation of the bleed
and a second pinch point at a bleed outlet of the feedwater heater.

US Pat. No. 9,708,648

HIC: METHOD OF IDENTIFYING INTERACTIONS BETWEEN GENOMIC LOCI

University of Massachuset...

1. A method for identifying an interaction frequency, comprising;
a) providing;
i) a cell comprising at least one chromosome, wherein said at least one chromosome comprises a first region and a second region;
and

ii) a junction marker;
b) extracting said at least one chromosome from said cell;
c) incorporating said junction marker into said extracted chromosome; and
d) identifying an interaction frequency between said first region and said second region.

US Pat. No. 9,553,268

CATHODE BUFFER MATERIALS AND RELATED DEVICES AND METHODS

Massachusetts Institute o...

1. An electromagnetic radiation absorbing and/or emitting device, comprising:
a conductive polymer as a cathode buffer material, wherein the conductive polymer is formed by oxidative chemical vapor deposition,
wherein the device comprises a substrate, a cathode, the cathode buffer material, a photoactive material, and an anode
wherein the cathode is disposed between the substrate and the cathode buffer material, the cathode buffer material is disposed
between the cathode buffer material and the anode, and

wherein the conductive polymer is reduced poly(3,4-ethylenedioxythiophene).

US Pat. No. 9,325,140

PHOTONIC DEVICES AND METHODS OF USING AND MAKING PHOTONIC DEVICES

Massachusetts Institute o...

1. A photonic device comprising:
a substrate;
a dielectric layer, disposed on the substrate, having a first refractive index;
at least one dielectric strip, disposed within the dielectric layer, having a second refractive index greater than the first
refractive index; and

a gain layer, disposed in contact with the dielectric layer, having a third refractive index greater than the first refractive
index to guide an optical pump beam and an optical signal beam in a propagation direction parallel to a longitudinal axis
of the at least one dielectric strip so as to amplify the optical signal beam via stimulated emission,

wherein a majority of the optical pump beam is confined within the gain layer.

US Pat. No. 9,125,577

EXTRACTION OF FETAL CARDIAC SIGNALS

MASSACHUSETTS INSTITUTE O...

1. A method for processing an input signal that includes a pseudo-periodic signal present with another signal, the method
comprising:
accepting the input signal, the input signal being representable as a vector signal in a multidimensional vector space;
forming a phase signal representing a time-varying periodicity of the pseudo-periodic signal;
identifying a subspace of the vector space that exhibits correlation at the time-varying periodicity;
forming a component of the input signal according to the identified subspace; and
processing the input signal to either enhance or to mitigate an effect of the formed component to produce a processed signal.

US Pat. No. 9,114,009

NANOWIRED THREE DIMENSIONAL TISSUE SCAFFOLDS

Massachusetts Institute o...

1. A three dimensional macroporous nanocomposite comprising electrically conductive nanowires having a diameter of 50 nm or
less and a wire length longer than 500 nm embedded within a porous, polymeric non-conductive matrix which allows cellular
ingrowth or seeding of cells, wherein the pore size is between 50 ?m and 100 ?m in diameter, and wherein the nanowires bridge
the pore walls of the non-conductive matrix to enable electrical communication between cells on either side of the pore walls.

US Pat. No. 9,382,281

NICKEL PRE-CATALYSTS AND RELATED COMPOSITIONS AND METHODS

Massachusetts Institute o...

20. A compound selected from the group consisting of trans-(PPh3)2Ni(o-tolyl)Cl, trans-(PCyPh2)2Ni(o-tolyl)Cl, trans-(PCy2Ph)2Ni(o-tolyl)Cl, trans-(PCy3)2Ni(o-tolyl)Cl, trans-(PCy3)2Ni(o-tolyl)Cl, trans-(PCy3)2Ni(o-tolyl)Cl, trans-(PCyp3)2Ni(o-tolyl)Cl, trans-(PCyp3)2Ni(o-tolyl)Cl, trans-(PBn3)2Ni(o-tolyl)Cl, trans-(PBn3)2Ni(o-tolyl)Cl, trans-(PMe2Ph)2Ni(o-tolyl)Cl, trans-(PMe2Ph)2Ni(2,4,6-triisopropylphenyl)Br, trans-(PMe2Ph)2Ni(2,6-dimethoxyphenyl)Br, trans-(PEt3)2Ni(2-mesityl)Br, trans-(PnBu3)2Ni(2-mesityl)Br, cis-[dppe]Ni(o-tolyl)Cl, cis-[dppp]Ni(2-mesityl)Br, trans-[dppb]Ni(2-mesityl)Br, cis-[(S)-BINAP]Ni(o-tolyl)Cl,
cis-[dppf]Ni(o-tolyl)Cl, trans-[dcpf]Ni(o-tolyl)Cl, trans-[xantphos]Ni(o-tolyl)Cl, and cis-[pyphos]Ni(o-tolyl)Cl, wherein:
Cy is cyclohexyl,
Cyp is cyclopentyl,
Bn is benzyl,
dppe is 1,2-bis(diphenylphosphino)ethane,
dppp is 1,3-bis(diphenylphosphino)propane,
dppb is 1,4-bis(diphenylphosphino)butane,
BINAP is 2,2?-bis(diphenylphosphino)-1,1?-binaphthyl,
dppf is 1,1?-bis(diphenylphosphino)ferrocene,
dcpf is 1,1?-bis(dicyclohexylphosphino)ferrocene,
xantphos is 9,9-dimethyl-4,5-bis(diphenylphosphino)xanthene, and
pyphos is 2-[2-(diphenylphosphino)ethyl]pyridine.

US Pat. No. 9,321,466

CONTROLLABLE NORMAL FORCE MECHANISM WITH MINIMUM ENERGY CONSUMPTION

Massachusetts Institute o...

1. Force control system comprising;
a plurality of first rotor permanent magnets symmetrically disposed around a rotor, each first rotor magnet spaced apart from
corresponding first stator permanent magnets mounted for radial motion, the first rotor and stator magnets having the same
polarity resulting in repulsive forces between the first rotor and stator permanent magnets forming a first rotor/stator magnet
pair;

a plurality of second rotor permanent magnets symmetrically disposed around the rotor at a location apart from the first rotor
permanent magnets, each second rotor magnets spaced apart from corresponding second stator permanent magnets, the second rotor
and stator magnets having opposite polarity resulting in attractive forces between the second rotor and stator permanent magnets
to form a second rotor/stator magnet pair; and

means for rotating the rotor, whereby force on the first stator permanent magnets in a radial direction is controlled as the
rotor rotates through a selected angular range while the torque required to rotate the rotor is reduced by the second rotor/stator
magnet pair.

US Pat. No. 9,289,506

SURFACE BINDING OF NANOPARTICLE BASED DRUG DELIVERY TO TISSUE

Massachusetts Institute o...

1. A method for delivering a first active agent to a connective tissue in a subject, comprising
administering to a subject, a microparticle having an average particle size of greater than 10 nm and less than or equal to
500 nm, wherein the microparticle is comprised of a connective tissue binding peptide that is not gelatin, wherein the connective
tissue binding peptide has a net positive charge, wherein the net positive charge is due at least in part to lysines and arginines
in the connective tissue binding peptide, and wherein the microparticle includes a first active agent, wherein the first active
agent is delivered to the connective tissue as it is released from the microparticle, wherein the first active agent is a
therapeutic agent for the treatment of a musculoskeletal disease or injury; and

further comprising administering to the subject a nanoparticle comprising a peptide having an average particle size of 1-10
nm.

US Pat. No. 9,159,446

METHODS AND APPARATUS FOR IN-PIXEL FILTERING IN FOCAL PLANE ARRAYS INCLUDING APPARATUS AND METHOD FOR COUNTING PULSES REPRESENTING AN ANALOG SIGNAL

Massachusetts Institute o...

1. An apparatus for counting pulses representing an analog signal, the apparatus comprising:
(A) a photodetector array comprising at least one photodetector to produce a photocurrent in response to detection of light;
and

(B) an integrated circuit operably coupled to the photodetector array, the integrated circuit comprising a plurality of unit
cells, wherein at least one unit cell in the plurality of unit cells comprises:

(i) a converter to convert the photocurrent from the at least one photodetector in the photodetector array to series of pulses;
(ii) a first counter to count first pulses in the series of pulses in response to a first clock selection signal; and
(iii) a second counter to count second pulses in the series of pulses in response to a second clock selection signal.
US Pat. No. 9,114,072

DOSAGE FORM EXHIBITING RAPID DISPERSE PROPERTIES, METHODS OF USE AND PROCESS FOR THE MANUFACTURE OF SAME

Massachusetts Institute o...

1. A process for preparing a pharmaceutical rapidly dispersing non-compressed solid matrix comprising one or more active ingredients
and bound particles of bulk material, the process comprising:
a) providing one or more layers of powdered bulk material comprising a mixture of a pharmaceutically acceptable compound,
one or more active ingredients and a water soluble pharmaceutically acceptable binder;

b) applying a first binding fluid, comprising a pharmaceutically acceptable solvent or a mixture of a pharmaceutically acceptable
solvent and a water soluble pharmaceutically acceptable binder which is the same as or different than the binder in the powdered
bulk material, to the one or more layers of bulk material using three-dimensional printing technique; and

c) evaporating the solvent to provide a rapidly dispersing non-compressed solid matrix having a three-dimensional shape, wherein
the solid matrix: 1) is able to maintain its three dimensional shape in the absence of moisture; 2) is able to exhibit hardness
and friability characteristics adequate for storage and handling; and 3) is dispersed completely within a time period of less
than about ninety seconds upon contact of said solid matrix with water in an environment of use.

US Pat. No. 9,834,791

CRISPR-RELATED METHODS AND COMPOSITIONS WITH GOVERNING GRNAS

Editas Medicine, Inc., C...

1. A method of silencing a component of a CRISPR/Cas system in a eukaryotic cell, the method comprising:
contacting the eukaryotic cell with:
(a) a nucleic acid encoding a Cas9 molecule and a nucleic acid encoding a first guide RNA (gRNA) molecule; and
(b) a governing gRNA molecule that comprises a nucleotide sequence targeting domain that targets the nucleic acid encoding
the Cas9 molecule and/or the nucleic acid encoding said first gRNA molecule,
wherein
(i) the Cas9 molecule and the first gRNA molecule form a complex that cleaves a target nucleic acid of the eukaryotic cell,
(ii) the Cas9 molecule and the governing gRNA molecule form a complex that cleaves and thereby silences the nucleic acid encoding
the Cas9 molecule and/or the nucleic acid encoding the first gRNA, and

(iii) the nucleotide sequence targeting domain of the governing gRNA molecule is selected from the group consisting of:
a nucleotide sequence targeting domain that provides a Cas9 molecule-mediated cleavage event in the Cas9 molecule-amino acid
coding sequence of the nucleic acid sequence;

a nucleotide sequence targeting domain that provides a Cas9 molecule-mediated cleavage event in a non-coding sequence of the
nucleic acid encoding the Cas9 molecule;

a nucleotide sequence targeting domain that provides a Cas9 molecule-mediated cleavage event in an untranslated sequence of
the nucleic acid encoding the Cas9 molecule;

a nucleotide sequence targeting domain that provides a Cas9 molecule-mediated cleavage event 5? of the Cas9 molecule-coding
region of the nucleic acid encoding the Cas9 molecule;

a nucleotide sequence targeting domain that provides a Cas9 molecule-mediated cleavage event 3? of the Cas9 molecule-coding
region of the nucleic acid encoding the Cas9 molecule;

a nucleotide sequence targeting domain that provides a Cas9 molecule-mediated cleavage event in the promoter region of the
nucleic acid encoding the Cas9 molecule, wherein the promoter region is functionally linked to the Cas9 molecule amino acid
coding region; and

a nucleotide sequence targeting domain that provides a Cas9 molecule-mediated cleavage event in an intronic sequence of the
nucleic acid encoding the Cas9 molecule.

US Pat. No. 9,622,550

METHODS AND APPARATUS FOR ROBOTIC ZIPPER

Massachusetts Institute o...

1. A robotic zipper system for joining and separating zipper halves of a zipper tape with a zipper slide geometry, the robotic
zipper system comprising:
a chassis;
an actuator retained by the chassis wherein the actuator drives the zipper slide geometry along the zipper tape thereby to
join or separate the zipper tape; and

a sensor for determining a position of the zipper slide geometry along the zipper tape.

US Pat. No. 9,353,678

REFORMER ENHANCED ALCOHOL ENGINE

MASSACHUSETTS INSTITUTE O...

1. Reformer-enhanced alcohol engine system comprising:
a spark ignition engine;
a source of alcohol;
a reformer including a low-temperature reforming catalyst in a heat transfer relation with exhaust gas from the engine and
arranged to receive alcohol from the alcohol source for reforming the alcohol into a hydrogen-rich gas;

means for introducing the hydrogen-rich gas into the engine;
means for injecting the alcohol into the engine;
a fuel management control unit to apportion the ratio of alcohol injected into the engine to hydrogen-rich gas introduced
into the engine so as to provide a sufficient amount of alcohol to prevent knock at high load; and

a knock sensor that detects the knock and serves as an input to the fuel management control unit permitting the fuel management
control unit to apportion the amount of alcohol from an alcohol tank that is either introduced into the engine so as to provide
evaporative cooling or delivered to the reformer for generating hydrogen-rich gas for introduction into the engine, wherein
a closed-loop feed-back control circuit or an open loop control determines the ratio of direct injected alcohol to the amount
of alcohol that is sent to the reformer in order to prevent knock as load on the engine increases.

US Pat. No. 9,335,233

IN-PIPE LEAK DETECTION BASED ON PRESSURE GRADIENT

Massachusetts Institute o...

1. Leak detection system comprising:
structure sized to fit within a pipe conveying water for smooth sliding within the pipe while maintaining a uniform clearance
in the range of 1 to 3 mm with an inside wall of the pipe for supporting at least one sensing element near the inside wall
of the pipe, whereby a pressure gradient in the water at a leak in the pipe will cause the sensing element to respond to the
pressure gradient in the water to indicate a leak while the structure is moving within the pipe.

US Pat. No. 9,232,289

ACOUSTIC BANDGAP STRUCTURES FOR INTEGRATION OF MEMS RESONATORS

Massachusetts Institute o...

1. An acoustic bandgap device formed using a semiconductor fabrication tool, the semiconductor fabrication tool having a minimal
feature thickness and an allowable via width based on a design rule check of the semiconductor fabrication tool, the device
comprising:
a substrate lying in an x-y plane defining an x-direction and a y-direction;
an acoustic resonant cavity disposed over the substrate;
a phononic crystal disposed over the acoustic resonant cavity, the phononic crystal comprising a plurality of unit cells disposed
in a periodic arrangement, each unit cell comprising:

(i) at least one higher acoustic impedance structure having a longitudinal axis oriented in the y-direction and a thickness
in the x-direction greater than or about equal to the minimal feature thickness of the semiconductor fabrication tool, the
at least one higher acoustic impedance structure comprising at least one of:

at least one via structure, each via structure having a width in the x-direction about equal to the allowable via width of
the semiconductor fabrication tool; and

at least one longitudinal bar, each longitudinal bar having a width in the x-direction greater than the width of the at least
one via structure; and

(ii) at least one lower acoustic impedance material bordering at least a portion of the at least one higher acoustic impedance
structure and forming at least a portion of a remainder of the respective unit cell;

wherein a ratio of an acoustic impedance of the higher acoustic impedance structure to an acoustic impedance of the lower
acoustic impedance material is greater than 1.0; and

wherein the phononic crystal suppresses phononic excitations in at least one frequency band, thereby providing at least one
phononic bandgap.

US Pat. No. 9,203,441

PARTIAL PACKET RECOVERY IN WIRELESS NETWORKS

MASSACHUSETTS INSTITUTE O...

1. A method for data recovery in a wireless network, the method comprising:
receiving a plurality of coded packets; and
performing data recovery of partial packets of the plurality of coded packets across the plurality of coded packets, the partial
packets of the plurality of coded packets each containing at least one erroneous bit, the plurality of coded packets including
the partial packets being buffered in a memory and at least one of the partial packets of the plurality of coded packets being
used in performing the data recovery.

US Pat. No. 9,156,938

COMPOSITIONS, METHODS, AND SYSTEMS COMPRISING FLUOROUS-SOLUBLE POLYMERS

Massachusetts Institute o...

1. A polymer, comprising:
a conjugated pi-backbone, the pi-backbone comprising a plane of atoms; and
a first group and a second group attached to the pi-backbone, the first group having a first fixed height above the plane
and the second group having a second fixed height below the plane wherein the sum of the first and second heights is at least
4.5 Å,

wherein the polymer has a fluorine content of greater than 60% by mass.
US Pat. No. 9,499,851

WOUND HEALING METAKARYOTIC STEM CELLS AND METHODS OF USE THEREOF

Massachusetts Institute o...

1. A method for detecting bell-shaped nuclei in metakaryotic stem cells in a subject, the method comprising:
a) obtaining a vascular tissue sample from the subject suspected of having neointimal hyperplasia or restenosis;
b) partially dissociating the tissue sample by macerating and spreading the tissue sample by a method that substantially preserves
the integrity of bell-shaped nuclei of metakaryotic stem cells in the tissue sample, the nuclei having maximum diameters from
about 10-50 microns;

c) fixing and staining the tissue sample to visualize the bell-shaped nuclei of the metakaryotic stem cells;
d) detecting the presence and/or absence of metakaryotic stem cells in the subject tissue sample and in a control tissue sample.

US Pat. No. 9,404,835

MICROFLUIDIC BUBBLE LOGIC DEVICES

Massachusetts Institute o...

1. A platform for collection of samples, comprising:
a fluidic bubble logic collection circuit, comprising:
an extraction circuit that collects at least one sample from a stream of material; and
a bubble generator that encapsulates the collected sample inside a bubble or droplet of inert material dispersed in an immiscible
fluid;

at least one fluidic bubble logic memory element for storing the collected sample for analysis; and
a fluidic bubble logic routing circuit for routing the collected sample from the collection circuit to the memory element.

US Pat. No. 9,397,587

MULTI-ACTUATOR DESIGN AND CONTROL FOR A HIGH-SPEED/LARGE-RANGE NANOPOSITIONING SYSTEM

Massachusetts Institute o...

1. Multi-actuator system for nanopositioning control comprising:
at least two nanopositioners having different ranges and bandwidths located in cascaded series form to contact and move an
object; and

a control system to combine the at least two nanopositioners so as to apportion actuation responsibilities among the at least
two nanopositioners and to compensate for their coupled dynamics while moving the object, the system including a separate
controller for controlling separately each of the at least two nanopositioners and wherein parameters of the separate controllers
are determined by minimizing output error.

US Pat. No. 9,148,649

METHODS AND APPARATUS FOR IMAGING OF OCCLUDED OBJECTS FROM SCATTERED LIGHT

Massachusetts Institute o...

11. A method of estimating a 3D surface of an object, wherein:
(a) a pulse source emits wave pulses that travel to the object, reflect off of the object, and then travel from the object
to a sensor by one or more diffuse reflections;

(b) an occluder prevents the wave pulses from traveling in a direct line from the object to the sensor;
(c) each respective wave pulse has a direction immediately before the wave pulse first diffusely reflects after being emitted
by the pulse source;

(d) the direction of the respective wave pulses varies from wave pulse to wave pulse;
(e) the sensor captures streak images while the wave pulses arrive at the sensor after the one or more diffuse reflections;
(f) a processor performs a calculation to estimate the 3D surface, wherein the calculation includes
(i) calculating a voxel grid for a volume in which the object is located,
(ii) for each respective voxel in a set of voxels in the voxel grid, initializing a variable associated with the respective
voxel to zero or to a reference value,

(iii) for each respective pixel of the sensor for each of the respective streak images, incrementing the variable for each
voxel that is a candidate of being an origin of measured intensity at the respective pixel, the increment being calculated
based at least in part on measured intensity at the respective pixel, and

(iv) filtering data that results from step (iii).
US Pat. No. 9,080,014

POLYMERS FOR FUNCTIONAL PARTICLES

Massachusetts Institute o...

1. A method of making nanoparticles, comprising:
providing a solution comprising a first population of amphiphilic macromolecules comprising a first hydrophobic portion and
a second hydrophilic portion and a second population of amphipilic macromolecules comprising a first hydrophobic portion,
a second hydrophilic portion, and a third portion comprising a moiety selected from the group consisting of a targeting moiety,
an imaging moiety, a chelating moiety, a moiety having multiple charge groups, and a diagnostic or therapeutic moiety,

wherein the first, second, or both portions of the amphiphilic macromolecules comprise a biodegradable polymer;
contacting the solution with a polymer nonsolvent under conditions wherein the macromolecules orient to form the nanoparticles
having the hydrophobic portion on the inside of the particles and the hydrophilic portions and moieties on the surface of
the nanoparticle.

US Pat. No. 9,635,761

SLEEVED COAXIAL PRINTED CIRCUIT BOARD VIAS

Massachusetts Institute o...

1. A printed circuit board,
comprising: a plurality of layers, stacked on top of one another,
comprising two outer layers and at least one interior ground layer disposed between said outer layers;
and a via passing through at least two of said layers,
wherein said via comprises: an annular metal sleeve disposed around an inner circumference of said via;
a conductive path disposed in said via connecting a first signal trace on a first layer of said plurality of layers to a second
signal trace disposed on a second layer of said plurality of layers;

and an insulating material disposed in said via between said annular metal sleeve and said conductive path,
wherein said annular metal sleeve extends from said first layer to said second layer,
is in physical contact with and is electrically connected to said at least one interior ground layer,
and comprises a first notch, disposed near said first layer, to allow said first signal trace to connect to said conductive
path

and a second notch, disposed near said second layer, to allow said second signal trace to connect to said conductive path,
and wherein a ratio of a diameter of the annular metal sleeve to a diameter of the conductive path and a dielectric constant
of the insulating material define an impedance of the via and are dimensioned such that the impedance of the via matches an
impedance of the first and second signal traces.

US Pat. No. 9,136,667

HIGH PEAK POWER OPTICAL AMPLIFIER

MASSACHUSETTS INSTITUTE O...

1. An optical amplifier system comprising:
a plurality of seed laser sources each configured to generate an optical beam having a unique wavelength to provide a plurality
of wavelengths;

a wavelength division multiplexer configured to spatially overlap the plurality of wavelengths to form a first beam;
an amplitude modulator configured to receive the first beam and to amplitude modulate the first beam to form a modulated beam;
a wavelength division de-multiplexer configured to receive the modulated beam and to spatially spectrally disperse the modulated
beam into a plurality of modulated wavelengths;

first delay optics optically coupled to the wavelength division de-multiplexer and configured to receive and uniquely delay
each wavelength of the plurality of modulated wavelengths to provide a waveform comprising a first time series of the plurality
of modulated wavelengths;

an amplifier configured to receive the waveform and to amplify each wavelength of the plurality of modulated wavelengths to
provide an amplified waveform comprising a second time series of a corresponding plurality of amplified modulated wavelengths;
and

second delay optics configured to temporally overlap the plurality of amplified modulated wavelengths to provide an output
beam.

US Pat. No. 9,625,444

ARTIFICIAL IMMUNE SYSTEM: METHODS OF USE

SANOFI PASTEUR VAXDESIGN ...

1. A method for generating dendritic cells, comprising:
(a) culturing endothelial cells on an upper surface of a porous membrane, wherein said membrane is housed in an upper chamber
of a cell culture well that is suspended over, and is separable from, a lower chamber of the well;

(b) applying peripheral blood mononuclear cells (PBMCs) to the endothelial cells on the porous membrane of (a);
(c) removing the upper chamber housing the porous membrane and endothelial cells from the well about 48 hours after application
of the PBMCs; and

(d) isolating dendritic cells from the lower chamber of the well.

US Pat. No. 9,455,114

SYSTEMS AND METHODS FOR PARTICLE PULSE MODULATION

Massachusetts Institute o...

1. A method for modulating a particle pulse, the method comprising:
A) propagating the particle pulse at a velocity ? along a first direction; and
B) propagating an electromagnetic pulse along a second direction at an oblique angle ? with respect to the first direction
in a laboratory frame of reference so as to cause the electromagnetic pulse to at least partially overlap with the particle
pulse, the electromagnetic pulse having an intensity profile with a minimum along at least one line passing through a center
of the electromagnetic pulse,

wherein the oblique angle ? is based at least in part on the velocity ? of the particle pulse;
wherein the oblique angle ? is substantially equal to arctan(1/??), ?=(?/c), ?=(1??2)?1/2, and c is a speed of light in a vacuum.

US Pat. No. 9,381,528

ARTICLES FOR MANIPULATING IMPINGING LIQUIDS AND METHODS OF MANUFACTURING SAME

Massachusetts Institute o...

1. An atomizer comprising a non-wetting surface having a dynamic contact angle with a liquid of at least about 90°, said surface
comprising non-wetting features, said surface patterned with macro-scale features having a length scale Lm that is larger than a length scale Ln of the non-wetting features, the macro-scale features being configured to induce controlled asymmetry in a liquid film produced
by impingement of a droplet onto the surface, thereby reducing contact time tc between the droplet and the surface to a value lower than
where the droplet has a radius R, density ?, surface tension ?, and the patterned surface having a pinning fraction ? of zero.

US Pat. No. 9,320,984

HUMIDIFICATION-DEHUMIDIFICATION SYSTEM WITH A BUBBLE-COLUMN VAPOR MIXTURE CONDENSER AND INTERMEDIATE GAS EXTRACTION

Massachusetts Institute o...

1. A humidification-dehumidification system comprising:
a source of liquid including a vaporizable component;
a humidifier including a carrier-gas inlet and a carrier-gas outlet; a liquid inlet and a liquid outlet, wherein the liquid
inlet is coupled with the source of the liquid; and a chamber in which liquid introduced from the liquid inlet can contact
a carrier gas containing a condensable fluid in vapor phase that is introduced from the carrier-gas inlet in a counterflow
arrangement and in which a portion of the liquid can vaporize into the carrier gas;

a bubble-column vapor mixture condenser including at least a first stage and a second stage, each stage including a carrier-gas
inlet, a bubble generator in fluid communication with the carrier-gas inlet, a carrier-gas outlet and a chamber containing
a liquid bath in fluid communication with the carrier-gas inlet and the carrier-gas outlet, wherein the liquid bath comprises
the vaporizable component in liquid phase, wherein the carrier-gas inlet of the first stage is in fluid communication with
the carrier-gas outlet of the humidifier, wherein the carrier-gas outlet of the first-stage is in fluid communication with
the carrier gas inlet of the second stage to facilitate bubbling flow of the carrier gas from the humidifier through the liquid
bath in the chamber of the first stage and then through the liquid bath in the chamber of the second stage, and wherein the
bubble generator is configured to generate bubbles of the carrier gas in the liquid bath;

a conduit passing from the source of the liquid through the chamber of each stage of the bubble-column condenser to recover
energy from condensation; and

an intermediate exchange conduit coupled with (a) the bubble-column vapor mixture condenser and (b) the humidifier chamber
at intermediate stages of each for transfer of the carrier gas therebetween.

US Pat. No. 9,309,302

WATER SOLUBLE MEMBRANE PROTEINS AND METHODS FOR THE PREPARATION AND USE THEREOF

Massachusetts Institute o...

1. A water-soluble variant of a G-protein coupled receptor (GPCR), wherein in said variant, 7-transmembrane ?-helical hydrophobic
residues Leucine (L), isoleucine (I), valine (V), and phenylalanine (F) in hydrophilic surface ?-helical positions b, c, and
f but not positions a, d, e, and g of the GPCR have been substituted by glutamine (Q), threonine (T), threonine (T), and tyrosine
(Y), respectively, optionally further comprising conservative substitutions at other parts of the variant.

US Pat. No. 9,298,264

METHODS AND APPARATUS FOR ACTUATED 3D SURFACE WITH GESTURAL INTERACTIVITY

Massachusetts Institute o...

1. A method of moving segments of a physical surface, which method comprises, in combination:
(a) one or more sensors gathering sensor data indicative of human input, which human input comprises gestures made while not
in contact with the surface;

(b) one or more processors
(i) recognizing, based at least in part on the sensor data, the human input, and
(ii) generating, based at least in part on the human input, control signals for controlling motion of the segments; and
(c) one or more actuators selectively moving, in accordance with the control signals, at least some of the segments, wherein
(A) each of the respective segments is adapted to be moved independently of the remainder of the segments,
(B) the surface is adapted to be discontinuous, at least between some of the segments in at least some spatial arrangements
of the segments, and

(C) the human input further comprises direct physical manipulation of the surface or of a malleable component that is adjacent
to the surface.

US Pat. No. 9,294,113

ENERGY-EFFICIENT TIME-STAMPLESS ADAPTIVE NONUNIFORM SAMPLING

Massachusetts Institute o...

1. A sampling method comprising:
(a) obtaining M samples of a signal using an analog-to-digital converter (ADC);
(b) computing a next sample time as a function of previously obtained samples of the signal wherein the sampling function
is adaptive and time-stampless; and

(c) recovering sampling times using sample values and sample times from the M samples obtained from the signal.
US Pat. No. 9,267,118

METHODS FOR IDENTIFYING BACTERIAL STRAINS THAT PRODUCE L-TYROSINE

Massachusetts Institute o...

1. A method for identifying bacterial strains that produce L-tyrosine, comprising:
culturing in a medium one or more bacterial strains capable of L-tyrosine production and which heterologously express a tyrosinase,
wherein the tyrosinase comprises the amino acid sequence of SEQ ID NO: 4, and wherein the tyrosinase has the ability to convert
L-tyrosine into melanin, and

determining the amount of melanin produced by the one or more bacterial strains, wherein production of melanin by a strain
indicates that the strain produces L-tyrosine.

US Pat. No. 9,205,904

MULTI-AXIS WATER JET PROPULSION USING COANDA EFFECT VALVES

Massachusetts Institute o...

1. A Coanda jet propulsion system comprising:
one or more pumps that form a jet for propulsion; and
a plurality of Coanda jet devices (CJDs) coupled to the one or more pumps, each CJD having a single solenoid, the CJDs are
arranged so to allow for a multi-axis underwater control of an underwater robot, the CJDs incorporate a set of compact valves
allowing an operator to choose which direction and axis to apply force and moments, said one or more pumps ingest fluid through
an inlet before said fluid is ejected through an exit of said CJDs by operation of said one or more pumps and configuration
of said plurality of CJDs, each of said CJDs include a plurality of control ports to switch directions of said fluid to exit
through said CJDs using said single solenoid and a plastic piece coupled to a pushrod, said plastic piece covers either a
first control port or a second control port while exposing the uncovered control port to ambient pressure producing a pressure
differential that causes the jet to switch directions, wherein when the solenoid is inactive the first control port is covered
and the jet exits out of the second control port, and when the solenoid is activated the pushrod moves the plastic piece to
cover the second control port and the jet exits out of the first control port.

US Pat. No. 9,119,226

ARCHITECTURE FOR CONTENT AND HOST-CENTRIC INFORMATION DISSEMINATION IN DELAY-TOLERANT MANETS

Massachusetts Institute o...

1. A mobile device for use with a mobile ad-hoc network (MANET), comprising:
a processing element;
a circuit allowing wireless communications using IEEE 802.11;
a storage element, comprising instructions, which when executed by the processing element, allow said mobile device to engage
in either host-centric or content-centric communications over said MANET, wherein the instructions cause the device to utilize
different routing algorithms for the host-centric and content-centric communications, such that the device utilizes optimized
link state routing (OLSR) protocol for content-centric communications to discover and disseminate link state information throughout
the MANET, and utilizes a variation of store-and-forward to transmit messages through the MANET for host-centric communications.

US Pat. No. 9,448,061

SELECTING AN EARPIECE BASED ON DYNAMIC DATA

Massachusetts Institute o...

1. A computer program product comprising computer executable code embodied in a non-transitory computer readable medium that,
when executing on one or more computing devices, performs the steps of:
accessing a library of earpieces, the library including three-dimensional shape data for a plurality of preexisting earpiece
types;

obtaining dynamic data from an ear canal of a subject, the dynamic data including data from the ear canal characterizing three-dimensional
changes in a shape of the ear canal related to at least one of (i) a compliance of the ear canal to changes in pressurization
as measured using one or more images of a surface of an inflatable membrane inserted into the ear canal and inflated at two
or more pressures, or (ii) a shape change of the ear canal in response to a musculoskeletal movement of a head of the subject
that identifies a surface region of the ear canal where the shape change due to the musculoskeletal movement meets or exceeds
a predetermined threshold; and

selecting one of the plurality of preexisting earpiece types from the library that provides a best fit to the ear canal based
on the dynamic data, thereby providing a selected type.

US Pat. No. 9,336,611

MULTI-CONTRAST IMAGE RECONSTRUCTION WITH JOINT BAYESIAN COMPRESSED SENSING

Massachusetts Institute o...

1. A method for reconstructing images of a subject with a magnetic resonance imaging (MRI) system, the steps of the method
comprising:
a) acquiring with the MRI system, multiple image data sets with different contrast characteristics;
b) estimating from the multiple image data sets, hyperparameters related to a prior distribution;
c) producing a posterior distribution of image gradient coefficients using the estimated hyperparameters; and
d) producing multiple images using the posterior distribution and the multiple image data sets, each of the multiple images
having an image contrast associated with a contrast characteristic of the respective one of the multiple image data sets.

US Pat. No. 9,480,404

METHOD FOR IMAGING BIOMATERIAL EROSION IN VIVO

Massachusetts Institute o...

1. A method for noninvasively imaging erosion of a biomaterial in vivo within a subject, the method comprising the steps of:
a) preparing an in vivo biomaterial sample by tagging a sample of the biomaterial with a marker that bonds to the biomaterial;
b) introducing the tagged biomaterial sample to an in vivo environment, wherein the in vivo environment is within the subject;
c) acquiring imaging data using a luminescence imaging system from the in vivo environment within the subject including the
tagged sample of the biomaterial over a selected time period;

d) reconstructing a series of images from the imaging data using an image processor, each image characterizing a luminescent
property of the in vivo biomaterial sample at a given time in the selected time period; and

e) determining, from the images, changes in the luminescent property of the biomaterial sample over the selected time period;
f) determining an in vivo marker characteristic based on the changes in the luminescent property of the biomaterial sample,
the in vivo marker characteristic indicative of the erosion of the biomaterial in vivo.

US Pat. No. 9,248,421

PARALLEL INTEGRATED BIOREACTOR DEVICE AND METHOD

Massachusetts Institute o...

1. A bioreactor device comprising:
a growth chamber with an internal volume of less than approximately 10 mL;
a mixer integrated into an internal surface of the growth chamber;
at least one integrated fluid injector system to pass metered amounts of a fluid into the growth chamber wherein the fluid
affects an environmental variable of the growth chamber;

at least one sensor located within the growth chamber to measure the environmental variable; and
a controller configured to control the environmental variable by controlling the at least one integrated fluid injector system,
wherein the at least one integrated fluid injector system comprises:
a fluid reservoir;
a microchannel for providing fluidic communication between the reservoir and the growth chamber;
a pressure chamber adjacent to the reservoir;
a flexible membrane, wherein the membrane fluidically isolates the pressure chamber from the reservoir; and
a valve system for metering fluid into the growth chamber.

US Pat. No. 9,427,679

SYSTEMS AND METHODS FOR UNIPOLAR SEPARATION OF EMULSIONS AND OTHER MIXTURES

MASSACHUSETTS INSTITUTE O...

1. A method for separating two or more phases of an emulsion mixture, the method comprising the steps of:
(a) providing the mixture with a net and unipolar charge, thereby enhancing coalescence of like-phase and like-charge droplets
therein and producing, or enhancing the production of, two or more consolidated phases,

wherein the charge densities of a first and a second coalescing like-phase and like-charge droplet are different such that
Qa/ra>>Qb/rb, wherein Qa is the charge of droplet a, Qb is the charge of droplet b, ra is the radius of droplet a, and rb is the radius of droplet b, wherein step (a) comprises bombarding the mixture with ions via corona discharge; and

(b) collecting the two or more consolidated phases.

US Pat. No. 9,307,790

POROUS CATALYTIC MATRICES FOR ELIMINATION OF TOXICANTS FOUND IN TOBACCO COMBUSTION PRODUCTS

Massachusetts Institute o...

1. A method of reducing the quantity of a toxicant in a fluid, comprising:
contacting the fluid with a hybrid MOF matrix,
wherein:
the hybrid MOF matrix comprises (i) an MOF matrix, wherein the MOF matrix comprises metal ions or clusters coordinated to
polydentate organic ligands, and the metal ions or clusters comprise Cr, Fe, Zn, Al, Ni, or Cu, and (ii) a dopant, wherein
the dopant is a supernucleophilic amine;

the fluid is a gas; and
the toxicant is a carbonylic compound or a phenolic compound.

US Pat. No. 9,242,240

OLEFIN METATHESIS CATALYSTS AND RELATED METHODS

Massachusetts Institute o...

25. A method for synthesizing a metal complex, comprising:
providing a compound having the structure of formula I:
wherein:
M is Mo or W;
R1 is alkyl, heteroalkyl, aryl, or heteroaryl, optionally substituted;

R2 and R3 can be the same or different and are hydrogen, alkyl, heteroalkyl, aryl, or heteroaryl, optionally substituted;

R4 and R5 can be the same or different and are heteroalkyl or heteroaryl, optionally substituted, or R4 and R5 are joined together to form a bidentate ligand with respect to M, optionally substituted; and wherein R4 and R5 each comprise at least one nitrogen atom; and

reacting the compound with an oxygen-containing ligand such that the oxygen-containing ligand replaces R4 and R5; wherein:

R4 and R5 each coordinate M via nitrogen;

the oxygen-containing ligand coordinates M via oxygen; and
the compound having the structure of formula I is other than:
Mo(NAr)(CHR')(NPh2)2,

Mo(NAr')(CHCMe2Ph)(NPh2)2,

Mo(NAr)(CHR')[N(t-Bu)(3,5-C6H3Me2)]2, and

Mo(NAr)(CHR')[N(i-Pr)(3,5-C6H3Me2)]2,

wherein R' is t-Bu or CMe2Ph, Ar 2,6-i-Pr2C6H3, and Ar'=2,6-Me2C6H3.

US Pat. No. 9,217,755

METHOD AND APPARATUS FOR BUILDING THREE-DIMENSIONAL MEMS ELEMENTS

Massachusetts Institute o...

1. A method for causing post-release deformation in a microbridge, the method comprising:
forming a microbridge between a first support and a second support, the microbridge defining a MEMS structure constrained
by a microbridge support structure;

removing a portion of the microbridge support structure to allow an out-of-plane buckling of the microbridge; and
attaching a tether to the microbridge at a point of substantially maximum slope on the buckling microbridge, the tether having
a gradient stress and stiffness value so as to control the direction of microbridge buckling, where in the method further
comprising 3shaping the tether to bias the post-release deformation in the microbridge, wherein the method further comprising
forming a connector between the first support and the second support, the connector being parallel to the microbridge and
having a substantially planar surface.

US Pat. No. 9,187,983

DOWNHOLE ELECTRICAL ENERGY CONVERSION AND GENERATION

Schlumberger Technology C...

1. A system for converting electrochemical energy to electrical energy downhole comprising:
an acidic fluid delivered downhole as part of a downhole wellbore treatment;
a first electrode;
a second electrode, the first and second electrodes being adapted and arranged to be deployed downhole and to form an anode
and a cathode respectively upon exposure to the acidic fluid in a downhole environment, thereby generating electrical energy;

a downhole device adapted and arranged to be energized by the generated electrical energy while in the downhole environment;
and

wherein the downhole device is arranged such that it is located between the first and second electrodes and is untethered
with the surface such that electrical power from the surface is unavailable to the downhole device.

US Pat. No. 9,087,212

METHODS AND APPARATUS FOR SECURING A DATABASE

Massachusetts Institute o...

1. A method for processing database queries, comprising:
encrypting a database in a database system using two or more encryption schemes, with each data item in the database encrypted
using at least one of the two or more encryption schemes;

selecting for each data item specified in an input query from an application, one of the encryption schemes;
transforming the input query to an encrypted query using the selected encryption scheme for each data item specified in the
query;

determining the input query requests a join between a stored first column initially encrypted with a first key and a stored
second column encrypted with a second key different from the first key;

providing a token to the database system for adjusting an encryption of the first stored column to an encryption with the
second key to match an encryption of the stored second column, wherein subsequent join queries between the stored first column
and the stored second column can be executed without re-adjusting encryption of the first or second stored columns;

executing the encrypted query at the database system, without decrypting any of the encrypted data items to plaintext at the
database system, to produce one or more encrypted results;

decrypting the encrypted results using the selected decryption scheme for each data item in the encrypted results to generate
decrypted results; and

returning the decrypted results to the application.

US Pat. No. 9,046,427

SYSTEM FOR DUAL PRESSURE SENSING

Massachusetts Institute o...

1. Pressure sensor comprising:
a deformable diaphragm responsive to applied pressure; and
a rigid beam mounted to more as the diaphragm deforms; wherein the rigid beam includes a mirrored surface for receiving light
from and reflecting light into an optical fiber thereby forming a Fabry-Perot cavity to detect changes in the position of
the rigid beam;

and wherein the rigid beam further includes first inter-digital fingers extending from the mirrored surface and moving with
the rigid beam with respect to second, fixed inter-digital fingers, the first and second inter-digital fingers overlapping
to create a change in electrical charges in the fingers to detect changes in the position of the rigid beam thereby providing
two measures of rigid beam displacement which are measures of pressure.

US Pat. No. 9,043,994

CRE-LOX BASED GENE KNOCKDOWN CONSTRUCTS AND METHODS OF USE THEREOF

Massachusetts Institute o...

1. A vector comprising
a. a first pair of loxP sequences inverted in orientation with respect to each other,
b. a nucleic acid cassette comprising a first nucleic acid encoding
(i) at least one nucleotide sequence that can form a hairpin structure comprising at least one miRNA agent, and
(ii) miRNA sequences flanking the at least one nucleotide sequence, wherein the miRNA sequences flanking the at least one
nucleotide sequence are derived from endogenous miRNA sequences that flank wild-type hairpin structures, and

wherein the nucleic acid cassette is positioned in an antisense orientation between the first pair of loxP sequences,
c. a second pair of loxP sequences distinct from the first pair of the loxP sequences, inverted in orientation with respect
to each other, wherein the first pair of loxP sequences and the second pair of loxP sequences are configured such that flipping
of the first pair results in excision of the sequences between the second pair.

US Pat. No. 9,448,219

ELECTRO-MECHANICAL SWITCHES AND METHODS OF USE THEREOF

Massachusetts Institute o...

1. An apparatus comprising: a first element having a top and bottom; and a second element having a top and bottom;
wherein the bottom of the first element is positioned facing the top of the second element with a gap therebetween; the bottom
of the first element is coated with a polymer having a thickness of between about 0.1 ?m and about 500 ?m the polymer is electrically
conducting or is coated with an electrically conductive material; the top of the second element is electrically insulating
and comprises on its surface non-contiguous electrically conducting material connected to at least two electrical leads; and
upon contact with an analyte the polymer closes the gap as a result of swelling or stressing of the polymer, thereby electrically
connecting the non-contiguous electrically conducting material.

US Pat. No. 9,391,255

MULTISTAGE THICK FILM THERMOELECTRIC DEVICES

MASSACHUSETTS INSTITUTE O...

1. A multistage thermoelectric cooler, comprising
a plurality of p-type legs each having a longitudinal axis and a plurality of n-type legs each having a longitudinal axis,
the longitudinal axes of the plurality of p-type legs being non-parallel to the longitudinal axes of the plurality of the
n-type legs, the plurality of p-type legs and the plurality of n-type legs being coupled at a plurality of p-n junctions to
form a plurality of thermoelectric cooling stages in which at least a portion of a current flowing, during operation of the
cooler, through one stage is coupled into a subsequent stage,

wherein at least one of said p or n-type legs is a unitary continuous leg spanning a plurality of cooling stages;
wherein each of the plurality of cooling stages includes a p-n junction; wherein the plurality of n-type legs are oriented
at an oblique angle with respect to the plurality of p-type legs such that the p-type legs and the n-type legs are arranged
in a cross-bar configuration in which at least one of the n-type legs forms contact p-n junctions with three different ones
of the p-type legs at a first end region, a central region, and a second end region of the at least one of the n-type legs
and at least one of the p-type legs forms contact p-n junctions with three different ones of the n-type legs at a first end
region, a central region, and a second end region of the at least one of the p-type legs;

wherein the plurality of n-type legs are arranged entirely in a first single layer such that the longitudinal axes of the
n-type legs are parallel to one another and entirely disposed in a first plane; and

wherein the plurality of p-type legs are arranged entirely in a second single layer such that the longitudinal axes of the
p-type legs are parallel to one another and entirely disposed in a second plane, the second plane being parallel to the first
plane and distinct from the first plane and the second single layer being distinct from the first single layer.

US Pat. No. 9,271,123

WIRELESS RELIABILITY ARCHITECTURE AND METHODS USING NETWORK CODING

MASSACHUSETTS INSTITUTE O...

1. A method for use in providing reliable data transfer in a wireless network, the method comprising:
receiving coded segments from a remote wireless node, each coded segment being associated with a specific coding thread and
being coded with a random linear network code (RLNC);

reading thread identifiers within the received coded segments and directing the coded segments to corresponding decoder worker
threads based thereon, each decoder worker thread having a corresponding encoder worker thread associated with the remote
wireless node, wherein the coded segments for each decoder worker thread are received in rounds, with Nm coded segments per
round and a nominal delay of Tr between rounds;

using the coded segments within the corresponding decoder worker threads to recover original data elements;
receiving uncoded segments from the remote wireless node, each uncoded segment being associated with a specific coding thread,
wherein the uncoded segments are received before the corresponding coded segments for each decoder worker thread;

reading thread identifiers within the received uncoded segments and directing the uncoded segments to corresponding decoder
worker threads based thereon;

wherein using the coded segments within the corresponding decoder worker threads to recover original data elements includes
using the coded segments as redundant information to the uncoded segments within the decoder worker threads to recover the
original data elements using systematic RLNC; and

sending an acknowledgement (ACK) message from a decoder worker thread to a corresponding encoder worker thread associated
with the remote wireless node in response to recovery of all original data elements associated with corresponding segments.

US Pat. No. 9,149,224

SYSTEM AND METHOD FOR MEASURING SKIN MOVEMENT AND STRAIN AND RELATED TECHNIQUES

Massachusetts Institute o...

1. A system to measure skin movement and strain on a body under test, the system comprising:
a data collection system which collects data from the body under test wherein the data collection system is adapted to collect
data from the body under test while the body is at rest and while the body is undergoing a motion;

a processing system coupled to receive data from said data collection system, said processing system for processing the data
to model and quantify skin movement and to derive strain fields, contours and three-dimensional patterns of skin on the body
under test;

wherein said data collection system comprises:
a motion capture system which obtains position data at locations identified by a plurality of markers disposed on the surface
of the skin of the body under test; and
a tracking system corresponding to a three-dimensional laser tracker system wherein said processing system comprises a lines
of non-extension (LONEs) processor coupled to receive data from said data collection system and to analyze changes in distance
between position data at each marker point and its closest neighbors from initial position to deformation;
wherein said LONEs processor calculates second order Lagrangian strains in accordance with:
In which:
l is the new distance between two points;
lo is the original length between two points; and

Dl is the difference between the two.

US Pat. No. 9,148,804

METHOD AND APPARATUS FOR MAKING OPTIMAL USE OF AN ASYMMETRIC INTERFERENCE CHANNEL IN WIRELESS COMMUNICATION SYSTEMS

Massachusetts Institute o...

1. A method for radio frequency (RF) communication between a plurality of nodes in a network, the network having one or more
first users on a channel (FUOCs) and one or more second users on a channel (SUOCs), the method comprising:
identifying, in a multiuser detection (MUD) receiver at a SUOC node, an interference channel;
determining a rate at which a FUOC node is operating in the interference channel;
determining, based at least upon the rate at which the FUOC node is operating, a rate and a MUD receiver algorithm that allow
the SUOC node to operate in the identified interference channel; and

operating in the identified interference channel using the determined rate and MUD receiver algorithm that allow the SUOC
node to operate in the identified interference channel.

US Pat. No. 9,926,601

ALTERNATIVELY SPLICED MRNA ISOFORMS AS PROGNOSTIC INDICATORS FOR METASTATIC CANCER

Massachusetts Institute o...

1. A method for identifying the proportion of alternatively spliced mRNA isoforms or expression products in a gene set relative to the total mRNA isoforms or expression products in the set in a tumor from a subject, comprising:treating a sample of the tumor obtained from the subject so as to permit a determination of mRNA levels or determination of gene expression product levels in the sample; detecting (1) the proportion of alternatively spliced mRNA isoforms of one of the following sets of human genes relative to the total mRNA isoforms of the following human genes in the sample or (2) the proportion of alternatively spliced gene expression products of one of the following sets of human genes relative to the total gene expression products of the following human genes in the sample:
(a) CD44, NUMB, FAM62B, SLK, ENAH, H2AFY, and OSBPL8;
(b) SCRIB, CLSTN1, MLPH, TXNDC14 and CTNND1;
(c) SCRIB, CLSTN1, MLPH, and TXNDC14; or
(d) SCRIB, CLSTN1, MLPH, and CTNND1, wherein the alternatively spliced mRNA isoforms are detected by (1) contacting the mRNA with a labeled nucleic acid that hybridizes under high stringency conditions to the isoform mRNA or cDNA or (2) by contacting the gene expression products with an antibody that binds specifically to an isoform gene expression product,
measuring the amount of labeled nucleic acid hybridization or amount of protein-antibody complex formed, and
determining the proportion of alternatively spliced mRNA isoforms or expression products in the gene set relative to the total mRNA isoforms or expression products in the set in the tumor.

US Pat. No. 9,283,242

USES OF DIHYDRO BASES

Massachusetts Institute o...

1. A method of treating a viral infection in a subject in need thereof, the method comprising administering to the subject
a therapeutically effective amount of a pharmaceutical composition comprising:
a compound of the formula:
or a pharmaceutically acceptable salt thereof; and
optionally a pharmaceutically acceptable excipient.

US Pat. No. 9,222,881

VIBRATIONAL SPECTROSCOPY FOR QUANTITATIVE MEASUREMENT OF ANALYTES

Massachusetts Institute o...

1. A method for measuring a conformational structure of an analyte comprising:
processing two-dimensional spectral data of an analyte with a data processor to determine a plurality of conformational components
of the analyte in a sample, the analyte comprising at least one protein having a plurality of residues, and wherein the spectral
data includes amplitude and phase of a signal emitted by the analyte in response to a plurality of incident light pulses;

determining, with the data processor, a first quantitative value of a first conformational component of the analyte, the first
quantitative value including a first fraction of a first residue for the first conformational component; and

determining, with the data processor, a second quantitative value of a second conformational component of the analyte, the
second quantitative value including a second fraction of the first residue for the second conformational component.

US Pat. No. 9,097,512

LAYERED MEDIUM FOR THREE-DIMENSIONAL IMAGING

Massachusetts Institute o...

1. A device comprising:
a luminescent layer of a material adapted to form a conforming layer when placed over a target surface of an object, the luminescent
layer configured to emit light at a first wavelength and a second wavelength;

a sensor positioned to capture an intensity of the first wavelength and an intensity of the second wavelength in a direction
of a location on the target surface;

an absorbing medium, the medium positioned between the sensor and the luminescent layer and the medium absorbing the first
wavelength more than the second wavelength; and

a processor programmed to calculate a thickness of the medium in the direction of the location based upon a function of the
intensity of the first wavelength and the intensity of the second wavelength.

US Pat. No. 9,982,009

METHODS FOR TREATING POLYCYSTIC KIDNEY DISEASE AND POLYCYSTIC LIVER DISEASE

Massachusetts Institute o...

1. A method of treating polycystic kidney disease in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a compound, wherein the compound is of the formula:or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition of said compound.

US Pat. No. 9,557,423

DIRECTION SENSITIVE NEUTRON DETECTOR

Trustees of Boston Univer...

1. A neutron detector, comprising:
a pressure vessel having a pressurized gas mixture of CF4, 3He and 4He at respective partial pressures, a first partial pressure ratio of CF4 to 3He being substantially 1:1 or greater, and a second partial pressure ratio of 4He to CF4 being substantially 15:1 or greater, the pressure vessel having first and second opposite ends, the first end having an optically
transparent window;

an electrically conductive field cage assembly within the pressure vessel, the field cage assembly being configured and operative
to establish first and second electric field regions in the pressure vessel, the first electric field region being a relatively
large drift region of relatively low field strength in which ionization electrons generated by neutron-He interactions are
directed toward the second electric field region, the second electric field region being a substantially smaller region of
substantially higher field strength at the second end of the pressure vessel in which the ionization electrons undergo avalanche
multiplication resulting in scintillation of the CF4 along scintillation tracks; and

an imaging subsystem including (1) a camera at the optically transparent window of the first end of the pressure vessel, the
camera being operative in response to scintillation light from the amplification region to generate camera output signals
representative of a sequence of images captured by the camera, and (2) an image processor operative to process the camera
output signals in real time to (a) identify the scintillation tracks and (b) based on the identification of the scintillation
tracks, estimate a rate and direction of incident neutrons.

US Pat. No. 9,458,472

DETECTION AND DESTRUCTION OF CANCER CELLS USING PROGRAMMED GENETIC VECTORS

Massachusetts Institute o...

1. A composition comprising a vector for transfecting a cell, the vector comprising:
a) a first nucleic acid sequence encoding an antisense agent, said antisense agent comprising a first RNA interference target
for a transcript of a gene endogenous to the cell, and

b) a second nucleic acid sequence comprising
i) a third nucleic acid sequence encoding a cell-killing agent, and
ii) a fourth nucleic acid sequence comprising a second RNA interference target that is substantially complementary to said
first RNA interference target,
wherein said third nucleic acid sequence is fused to said fourth nucleic acid sequence, and wherein said antisense agent does
not alter protein translation by said second RNA interference target, and wherein
1) said first RNA interference target is selected from the group consisting of GATA3 antisense sequences CGAGTCGCTGAAGAGGTTCTG
(SEQ ID NO:1), CGAGTCGCTGAAGAGGTTCTGCUUCAAGAGAGCAGAACCTCTTCAGC GACTCG (SEQ ID NO:3), GTAAGTGGTATAATTGTCTGG (SEQ ID NO:6),
and

GTAAGTGGTATAATTGTCTGGCUUCAAGAGAGCCAGACAATTATACCA CTTAC (SEQ ID NO:8),
2) said cell-killing agent is selected from the group consisting of BAK protein and BAX protein, and
3) said second RNA interference target is selected from the group consisting of GATA3 mRNA sequences CAGAACCTCTTCAGCGACTCG
(SEQ ID NO:5) and CCAGACAATTATACCACTTAC (SEQ ID NO:10).

US Pat. No. 9,451,141

METHODS AND APPARATUS FOR DEMULTIPLEXING ILLUMINATION

Massachusetts Institute o...

1. A method comprising, in combination:
(a) a set of multiple light sources illuminating a scene;
(b) a signal generator generating a reference signal and a set of multiple modulation signals, such that, while the light
sources illuminate the scene

(i) the modulation signals control amplitude of light emitted by the light sources, causing the amplitude of light emitted
by each light source to vary over time,

(ii) the modulation signal for each light source is different than the modulation signal for the other light sources, and
(iii) the modulation signals overlap in time and cause two or more of the light sources to simultaneously emit light during
multiple time intervals of the modulation signals;

(c) each pixel in the camera
(i) measuring an incident intensity, which incident intensity is intensity of light that reflects from the scene and is incident
on the pixel, and

(ii) outputting data indicative of a cross-correlation of the incident intensity and the reference signal; and
(d) a computer taking the data as an input and estimating, for each pixel of the camera
(i) a separate intensity for each respective light source, out of the set of light sources, which separate intensity is intensity
of light that (A) is emitted by the respective light source and not by other light sources, (B) then reflects from the scene
and (C) then travels to the pixel, and

(ii) depth of a point in the scene that reflects light to the pixel.

US Pat. No. 9,365,013

MULTIMATERIAL THERMALLY DRAWN PIEZOELECTRIC FIBERS

Massachusetts Institute o...

1. A fiber comprising a composite of at least three different materials,
said at least three different materials comprising a conductor, an insulator, and a material that is in a microscopic non-centrosymmetric
crystalline phase,

each material being disposed in one or more different cross-sectional regions of the fiber, with each region extending along
a common length of the fiber,

said conductor comprising a conductive material disposed in direct contact with the non-centrosymmetric crystalline phase
material; and

wherein at a common fiber draw temperature said conductive material has a viscosity that is higher than that of the material
in a non-centrosymmetric crystalline phase.

US Pat. No. 9,333,097

ARTIFICIAL HUMAN LIMBS AND JOINTS EMPLOYING ACTUATORS, SPRINGS, AND VARIABLE-DAMPER ELEMENTS

Massachusetts Institute o...

1. A prosthetic, orthotic or exoskeletal device comprising:
a mechanical ankle joint;
a motor adapted to impart a torque on the ankle joint; and
a spring arranged in parallel with the motor;
wherein the spring only engages when the ankle joint rotates past a predetermined position, wherein the predetermined position
is an ankle angle of 90° or less, within the range of angles of the ankle joint where the ankle is in a position of dorsiflexion,
and wherein energy stored in the spring during dorsiflexion is released to cause the ankle joint to rotate and propel powered
plantarflexion.

US Pat. No. 9,315,806

MASSIVELY PARALLEL COMBINATORIAL GENETICS

Massachusetts Institute o...

1. A genetic construct comprising:
a DNA element;
a first compatible end element and a second compatible end element flanking the DNA element, wherein the first and second
compatible end elements are capable of annealing to each other;

a barcode element;
a third compatible end element and a fourth compatible end element flanking the barcode element, wherein the third and fourth
compatible end elements are capable of annealing to each other but are not capable of annealing to the first or second compatible
end elements; and

a separation site located between the fourth compatible end element and the first compatible end element, wherein the DNA
element, first compatible end element and second compatible end element are on one side of the separation site, and the barcode
element, third compatible end element and fourth compatible end element are on the other side of the separation site.

US Pat. No. 9,152,147

LOCATION BASED ACCESS CONTROL OF MATERIAL TRANSPORTATION VEHICLE RESOURCES

MASSACHUSETTS INSTITUTE O...

1. A method for transportation of material comprising:
operating a material transportation vehicle according to a material transportation plan, the material transportation plan
including

a representation of one or more regions within a geographical area, each of the regions being associated with a group of one
or more communication stations;

a representation of a route of travel within the geographical area, the route of travel traversing a first region of the one
or more regions within the geographical area;

the operating including:
causing the material transportation vehicle to travel along the route of travel including causing the material transportation
vehicle to enter the first region;

accepting control information originating from a first communication station of the group of one or more communication stations
associated with the first region, the first communication station being authorized to control a material transportation resource
of the material transportation vehicle in the first region, and

causing an exchange of the material according to the accepted control information.

US Pat. No. 9,070,556

PATTERNING OF NANOSTRUCTURES

Massachusetts Institute o...

1. A method for forming a structure, the method comprising:
introducing a plurality of at least one of molecular-size scale and nanoscale building blocks to a region proximate a substrate;
and

simultaneously scanning a pattern on the substrate with an energy beam, wherein the energy beam causes a change in at least
one physical property of at least a portion of the building blocks, such that a probability of the portion of the building
blocks adhering to the pattern scanned by the energy beam is increased, and wherein the building blocks adhere to the pattern
to form the structure.

US Pat. No. 9,598,598

DEVELOPMENT OF ZWITTERIONIC COATINGS THAT CONFER ULTRA ANTI-BIOFOULING PROPERTIES TO COMMERCIAL REVERSE OSMOSIS MEMBRANES

Massachusetts Institute o...

12. A method for treating water comprising
passing an aqueous solution through an article comprising a composition of claim 9, wherein said aqueous solution comprises water and a first quantity of a substance, thereby producing a second aqueous solution;
the second aqueous solution comprises water and a second quantity of the substance; and the second quantity is substantially
lower than first quantity.

US Pat. No. 9,498,934

GRAFTED POLYMER SURFACES FOR DROPWISE CONDENSATION, AND ASSOCIATED METHODS OF USE AND MANUFACTURE

Massachusetts Institute o...

1. A condenser comprising a substrate and a polymeric film covalently grafted thereupon, wherein the polymeric film comprises
a grafting layer having a thickness no greater than 5 nm and a bulk film layer, and wherein the polymeric film is cross-linked
with divinyl benzene, has a thickness no greater than 1500 nm, and has a surface with low contact angle hysteresis of no greater
than 50° for water.