US Pat. No. 9,485,734

WIRELESS COMMUNICATION SYSTEM METHOD FOR SYNCHRONIZING BLUETOOTH DEVICES BASED ON RECEIVED BEACON SIGNALS

Intel Corporation, Santa...

7. A system to synchronize a Low-Energy Bluetooth (BLE) device, comprising:
a memory;
a first radio to communicate in compliance with a first wireless communication protocol and a second radio to communicate
in compliance with second wireless communication protocol;

one or more processors and circuitry to synchronize communication with another apparatus in compliance with a first wireless
communication protocol, the circuitry configured to:

determine a first time-offset value from an Access Point broadcast beacon signal in compliance with a second wireless communication
protocol;

select an event time window as a function of the first time-offset value; and
conduct communication with the other apparatus in compliance with the first wireless communication protocol during the event
time window;

wherein the circuitry is further configured to determine the first time-offset as a function of one or more least significant
bits of a shared time data (N0) communicated by the broadcast beacon signal.

US Pat. No. 9,499,467

ORTHO-FLUORO SUBSTITUTED COMPOUNDS FOR THE TREATMENT OF METABOLIC DISEASES

CALDAN THERAPEUTICS LIMIT...

1. A compound of the formula (I)
or a salt thereofwherein
Ar is an optionally substituted monocyclic or fused aromatic or heteroaromatic ring system;
n is an integer of 0-1;
X is —C(R4R5);

m is an integer of 0-2;
R1, R4, and R6 are independently selected from the group consisting of hydrogen, optionally substituted (C1-C10)alkyl, optionally substituted (C2-C10)alkenyl, optionally substituted (C2-C10)alkynyl, optionally substituted (C1-C10)alkylene, optionally substituted (C1-C10)alkoxy, hydroxy, optionally substituted (C2-C10)dialkylamino, optionally substituted (C1-C10)alkylthio, optionally substituted (C2-C10)heteroalkyl, optionally substituted (C2-C10)heteroalkylene, optionally substituted (C3-C10)cycloalkyl, optionally substituted (C3-C10)heterocycloalkyl, optionally substituted (C3-C10)cycloalkylene, optionally substituted (C3-C10)heterocycloalkylene, halo, nitrile, (C1-C10)alkylsulfenyl, (C1-C10)alkylsulfinyl, optionally substituted (C1-C10)alkylsulfonyl, optionally substituted (C1-C10)haloalkyl, optionally substituted (C1-C10)perhaloalkyl, (C2-C10)-alkenyloxy, (C3-C10)-alkynyloxy, aryloxy, arylalkyloxy, heteroaryloxy, heteroarylalkyloxy, (C1-C6)alkyloxy-(C1-C4)alkyl optionally substituted aryl, optionally substituted heteroaryl, and optionally substituted arylalkyl;

R2 is selected from the group consisting of hydrogen, optionally substituted (C1-C10)alkyl, optionally substituted (C2-C10)alkenyl, optionally substituted (C2-C10)alkynyl, optionally substituted (C1-C10)alkylene, optionally substituted (C2-C10)heteroalkyl, optionally substituted (C2-C10)heteroalkenyl, optionally substituted (C2-C10)heteroalkylene, optionally substituted (C3-C10)cycloalkyl, optionally substituted (C3-C10)cycloalkenyl, optionally substituted (C3-C10)cycloalkylene, optionally substituted (C3-C10)heterocycloalkyl, optionally substituted (C3-C10)heterocycloalkenyl, optionally substituted (C3-C10)heterocycloalkylene, optionally substituted (C1-C10)haloalkyl, optionally substituted (C1-C10)haloalkenyl, optionally substituted (C1-C10)haloalkylene, optionally substituted (C1-C10)perhaloalkyl, optionally substituted (C1-C10)perhaloalkenyl, optionally substituted (C1-C10)perhaloalkylene, and optionally substituted arylalkyl;

Ar and R2 may be further substituted by R6;

R3 is selected from hydrogen and halogen;

R5 is selected from hydrogen and optionally substituted (C1-C3)alkyl;

wherein substituted means one or more substituents selected from: —OR?, ?O, ?NR?, ?N—OR?, —NR?R?, —SR?, halogen, —OC(O)R?,
—C(O)R?, —CO2R?, —CONR?R?, —OC(O)NR?R?, —NR?—C(O)NR?R??, —NR?—SO2NR?R??, —NH—C(NH2)?NH, —NR?C(NH2)?NH, —NH—C(NH2)?NR?, —SiR?R?R??, —S(O)R?, —SO2R?, —SO2NR?R?, —NR?SO2R, —CN, —(C2-C5)alkynyl, —(C2-C5)alkenyl, and —NO2, said R?, R? and R? each independently refer to hydrogen, unsubstituted (C1-C6)alkyl and (C2-C6)heteroalkyl, unsubstituted aryl, aryl substituted with one to three halogens, unsubstituted (C1-C4)-alkyl, (C1-C4)-alkoxy or (C1-C4)-thioalkoxy groups, halo(C1-C4)alkyl, or aryl-(C1-C4)alkyl groups, provided that when R? and R? are attached to the same nitrogen atom, they can be combined with the nitrogen
atom to form a 5-, 6- or 7-membered ring;

with the proviso that the following compound is excluded from protection:
(S)-2-tert-butoxycarbonylamino-3-(4-{(R)-4-[1-(5-chloropyrimidin-2-yl)-piperidin-4-yl]pent-1-ynyl}-2-fluorophenyl)propionic
acid.

US Pat. No. 9,401,941

SONG LYRIC PROCESSING WITH USER INTERACTION

CBS Interactive Inc., Sa...

1. A method for processing user interactions with song lyrics, the method comprising:
providing, to a client device, the song lyrics for presentation on a display of the client device, the display presenting
a menu of options for the user to interact with a segment of the song lyrics selected by the user, the menu of options comprising
a portion for the user to enter text;

receiving, from the client device, song lyric interaction data describing a user interaction with the selected segment of
the song lyrics using a selected lyric interaction option from the menu of options, the song lyric interaction data comprising
user-entered text relating to the selected segment of the song lyrics;

updating a user interaction database to store a song lyric interaction entry corresponding to the song lyric interaction data,
the song lyric interaction entry identifying the user, the song lyrics, the selected segment of the song lyrics, the selected
lyric interaction option, and the user-entered text;

retrieving user-inputted text previously input by other users relating to the selected segment of the song lyrics from the
user interaction database;

grouping, by a processor, similar user-inputted text from the retrieved user-inputted text;
identifying a set of most commonly input text relating to the selected segment of the song lyrics from a ranking of the grouped
user-inputted text according to commonality in the user interaction database; and

providing, to the client device, the set of most commonly input text relating to the selected segment of the song lyrics along
with the user-entered text for presentation on the display of the client device.

US Pat. No. 9,306,552

HIGH VOLTAGE MAXIMUM VOLTAGE SELECTOR CIRCUIT WITH NO QUIESCENT CURRENT

Linear Technology Corpora...

1. A maximum voltage selection circuit comprising:
multiple inputs, each for receiving a different input voltage;
an output for delivering the highest of the input voltages; and
a voltage selection circuit that:
automatically selects the input having the largest voltage magnitude;
automatically delivers the voltage at the selected input to the output; and
does not draw quiescent operating current from any of the inputs,
wherein for each and every unique combination of two of the multiple inputs, the voltage selection circuit comprises:
an enhancement mode FET with a channel connected in series between a first input of the unique combination of the two inputs
and the output, the enhancement mode FET also having a gate;

a connection between the gate of the enhancement mode FET and the second input of the unique combination of the two inputs
through the channel of a depletion mode FET;

an additional enhancement mode FET with a channel connected in series between the second of the unique combination of the
two inputs and the output, the additional enhancement mode FET having a gate; and

a connection between the gate of the additional enhancement mode FET and the first of the unique combination of the two inputs
through the channel of an additional depletion mode FET.

US Pat. No. 9,142,864

ELECTROLYTES FOR RECHARGEABLE BATTERIES

Amprius, Inc., Sunnyvale...

1. A lithium ion battery comprising:
an electrode comprising an electrochemically active material selected from the group consisting of a silicon containing material,
a tin containing material, a germanium containing material, and an aluminum containing material;

an electrolyte comprising a lithium containing salt, a pyrocarbonate, and one or more fluorinated carbonate solvents;
and a solid electrolyte interphase (SEI) layer that includes fluorine, wherein the electrode comprising an electrochemically
active material includes core-shell nanostructures that include an inner shell and an outer shell; and wherein the SEI layer
is formed on the outer shell, the nanostructures having at least one cross-sectional dimension between 1 and 1000 nm.

US Pat. No. 9,068,786

HYBRID UPPER RECEIVER FOR A RIFLE

American Tactical Imports...

1. A combination metal/polymer upper receiver for use in a rifle, the upper receiver comprising:
a) a polymeric upper receiver housing defining a chamber; and
b) a metal insert secured within said polymeric upper receiver housing wherein said metal insert is configured to threadably
engage a barrel nut to detachably secure a rifle barrel to said combination metal/polymer upper receiver.

US Pat. No. 9,211,470

PITCH-PROPELLED VEHICLE

Equalia LLC., Sunnyvale,...

1. A vehicle for carrying a user comprising:
a board for supporting the user;
a ground-contacting member coupled with the board;
a motorized drive assembly coupled with the ground-contacting member; and
one or more sensors coupled with the drive assembly, wherein the drive assembly adjusts the velocity of the ground-contacting
member based on one or more distances of the board from a surface below the board as detected by the sensors by using the
distances to calculate a pitch of the board with respect to the surface and applying a force to the ground-contacting member
in order to achieve a predefined velocity of the ground-contacting member that corresponds to the pitch.

US Pat. No. 9,285,477

3D DEPTH POINT CLOUD FROM TIMING FLIGHT OF 2D SCANNED LIGHT BEAM PULSES

Apple Inc., Cupertino, C...

1. A light detection and ranging system comprising:
an emitter which produces an outgoing pulse sequence of coherent collimated light;
a mirror system having a scanning mirror that is positioned to deflect the outgoing pulse sequence;
a compensation mirror positioned to further deflect the outgoing pulse sequence after it is deflected by the scanning mirror,
the compensation mirror having a surface with a first curvature at an edge of the compensation mirror that is different from
a second curvature at a center of the compensation mirror;

a detector collocated with the emitter and aimed to detect an incoming pulse sequence that is a reflection of the outgoing
pulse sequence; and

electronic circuitry that is coupled to communicate with the emitter and the detector and to control the scanning mirror,
so that the outgoing pulse sequence scans a scene and the electronic circuitry computes a radial distance for each pair of
outgoing and incoming pulses and uses the computed radial distance to provide a scanned 3D depth map of objects in the scene.

US Pat. No. 9,451,566

POWER AMPLIFIER TRANSMISSION MODE SWITCHING IN WIRELESS COMMUNICATION DEVICES

QUALCOMM Incorporated, S...

1. A method of performing a tune-away from a first subscription to a second subscription on a wireless communication device,
the wireless communication device having a transmitter, the method comprising:
determining whether the first subscription will utilize the transmitter during the tune-away to the second subscription when
the transmitter is operating in envelope tracking mode; and

switching the transmitter from envelope tracking mode to average power tracking mode during the tune-away in response to determining
that the first subscription will utilize the transmitter during the tune-away to the second subscription.

US Pat. No. 9,447,164

ENGINEERED NUCLEIC ACIDS AND METHODS OF USE THEREOF

Moderna Therapeutics, Inc...

1. A pharmaceutical formulation comprising:
i) an effective amount of a messenger ribonucleic acid (mRNA) sequence encoding a melanocyte-stimulating hormone polypeptide,
wherein the mRNA sequence is at least 90% identical to the sequence of SEQ ID NO: 19, and wherein the mRNA sequence comprises
an open reading frame encoding SEQ ID NO: 10; and

ii) a pharmaceutically acceptable carrier,
wherein the formulation is suitable for repeated administration to a mammalian subject in need thereof.

US Pat. No. 9,485,242

ENDPOINT SECURITY SCREENING

LinkedIn Corporation, Mo...

1. A computer-implemented method for performing a security screen to identify website requests requiring remedial action,
the method comprising:
receiving, at a computer, a first request for information associated with a website, wherein the first request is associated
with an authorized user authorized to access the information associated with the website;

receiving, at the computer, a first response to the first request;
in response to determining that the first response comprises non-empty data, generating, at the computer, a second request
for the information associated with the website, wherein the second request includes credentials for an unauthorized user
who lacks authorization to access the information associated with the website;

receiving a second response to the second request; and
in response to determining that the second response includes non-empty data:
identifying the second request as requiring remedial action; and
storing the second response.

US Pat. No. 9,069,189

EYEWEAR DEVICE AND SYSTEM

THINOPTICS, INC., Palo A...

1. An eyewear system comprising lenses interconnected via a lens bridge and a pair of nose pads attachable to said eyewear,
said pair of nose pads having a skin contact layer for enhancing friction with a nose of a wearer, the eyewear being adapted
to bend at the bendable bridge to provide a pinch force of less than 50 grams from the nosepads to a nose of a user over a
variation in distance between the nosepads of up to 8 mm.

US Pat. No. 9,287,196

RESONANT CLOCKING FOR THREE-DIMENSIONAL STACKED DEVICES

Intel Corporation, Santa...

1. An apparatus comprising:
a stack including a plurality of integrated circuit die layers including at least a first die layer and an adjacent second
die layer, each die layer including an active metal side and an opposite RDL (re-distribution layer); and

a plurality of through silicon vias including a first set of through silicon vias formed through the first die layer and a
second set of through silicon vias formed through the second die layer, wherein each of the first set of through silicon vias
includes an inductive structure and each of the second set of through silicon vias includes a capacitive structure;

wherein the apparatus includes a plurality of resonant circuits to carry clock signals, each of the resonant circuits including
a first through silicon via of the first set of through silicon vias used as an inductive circuit element of the resonant
circuit and a second through silicon via of the second set of through silicon vias used as a capacitive circuit element of
the resonant circuit, the first through silicon via of each resonant circuit being coupled with the respective second through
silicon via of the resonant circuit via the RDL of the first die layer;

wherein each of the first set of through silicon vias is utilized both for transport of the clock signals between die layers,
including transport of clock signals from the first die layer to the second die layer, and for the generation of inductance
for the respective resonant circuit; and

wherein each of the resonant circuits is shared between the first die layer and the second die layer, a clock grid of the
first die layer resonating at a same frequency and being synchronous with a clock grid of the second die layer.

US Pat. No. 9,221,027

CURING SYSTEMS FOR MATERIALS THAT CONSUME CARBON DIOXIDE AND METHOD OF USE THEREOF

SOLIDIA TECHNOLOGIES, INC...

1. A curing system for curing a material which requires CO2 as a curing reagent, comprising:
a curing chamber configured to contain a material that consumes CO2 as a reagent and that does not cure in the absence of CO2 during curing, said curing chamber having at least one port configured to allow said material to be introduced into said curing
chamber and to be removed from said curing chamber, and having at least one closure for said port, said closure configured
to provide an atmospheric seal when closed so as to prevent contamination of a gas present in said curing chamber by gas outside
said curing chamber;

a source of carbon dioxide configured to provide gaseous carbon dioxide to said curing chamber by way of a gas entry port
in said curing chamber, said source of carbon dioxide having at least one flow regulation device configured to control a flow
rate of said gaseous carbon dioxide into said curing chamber;

a gas flow subsystem configured to circulate said gas through said curing chamber during a time period when said material
that consumes CO2 as a reagent is being cured;

a temperature control subsystem configured to control a temperature of said gas within said chamber;
a humidity control subsystem configured to control a humidity in said gas within said chamber; and
at least one controller in communication with at least one of said source of carbon dioxide, said gas flow subsystem, said
temperature control subsystem, and said humidity control subsystem, said at least one controller configured to control independently
during a time period when said material that consumes CO2 as a reagent is being cured at least a respective one of said flow rate of said gaseous carbon dioxide, said circulation of
said gas through said curing chamber, said temperature of said gas, and said humidity in said gas.

US Pat. No. 9,202,496

COMPENSATING FOR VOICE COIL MOTOR AND MICROACTUATOR DISTURBANCE IN A HARD DRIVE

Seagate Technology LLC, ...

1. A method comprising:
applying a voice coil motor (VCM) input signal to a voice coil motor and a microactuator (PZT) input signal to a microactuator
in response to positioning a read/write head of a hard drive;

determining a position signal in response to positioning the read/write head;
decoupling a PZT component from the position signal to determine an estimated VCM response, the estimated VCM response used
to determine an estimated VCM disturbance;

decoupling a VCM component from the position signal to determine an estimated PZT response, the estimated PZT response used
to determine an estimated PZT disturbance; and

modifying the VCM input signal and the PZT input signal respectively to compensate for the estimated VCM disturbance and the
estimated PZT disturbance.

US Pat. No. 9,119,824

METHODS OF USE FOR IL-22 PROMOTING REJUVENATION OF THYMIC AND BONE MARROW FUNCTION

MEMORIAL SLOAN-KETTERING ...

1. A method of treatment for increasing thymic epithelial cell (TEC) function, comprising:
a) contacting thymic epithelial cells at least a portion of which have reduced function with IL-22 wherein IL-22 improves
the function of said portion of thymic epithelial cells having reduced function.

US Pat. No. 9,382,126

PROCESSES FOR PREPARING LITHIUM CARBONATE

1. A process for preparing lithium carbonate, said process comprising:
reacting an aqueous composition comprising lithium hydroxide with CO2 by sparging said CO2 into said composition, said sparging being carried out while pH is at least substantially maintained at a value of about 10
to about 11.5, thereby obtaining a slurry comprising said lithium carbonate;

inserting at least a portion of said slurry into a clarifier and obtaining a supernatant comprising lithium bicarbonate and
a solid comprising said lithium carbonate, separating said solid from said supernatant; and

heating said supernatant at a temperature of at least 85° C. so as to at least partially convert said lithium bicarbonate
into lithium carbonate.

US Pat. No. 9,486,426

METHOD OF ADMINISTRATION OF GAMMA HYDROXYBUTYRATE WITH MONOCARBOXYLATE TRANSPORTERS

Jazz Pharmaceuticals Irel...

1. A method for the treatment of cataplexy in narcolepsy or excessive daytime sleepiness in narcolepsy in a patient who is
currently taking gamma-hydroxybutyrate (GHB) or a salt thereof comprising: administering to the patient a dose of divalproex
sodium concomitant to a dose of GHB or salt thereof; and reducing the daily dosage amount of GHB or salt thereof administered
to the patient between about 5% and about 50% wherein the daily dosage amount of GHB or salt thereof in the absence of concomitant
administration of divalproex sodium is between 4.5 g to 9 g.

US Pat. No. 9,444,719

REMOTE DETECTION AND MEASUREMENT OF DATA SIGNAL LEAKAGE

Comcast Cable Communicati...

15. A method comprising:
detecting, on a wired communication path, a presence of a first wireless transmission received by a first computing device
and a second computing device at a first location and a second location;

identifying expected signal strengths at the first location and the second location with respect to a first transmission device
generating the first wireless transmission;

identifying actual signal strengths at which the first wireless transmission was received over the wired communication path
at the first location and the second location;

identifying a first area at which the first wireless transmission is entering the wired communication path based on a comparison
of the expected and actual signal strengths at the first location; and

identifying a second area at which the first wireless transmission is entering the wired communication path based on a comparison
of the expected and actual signal strengths at the second location.

US Pat. No. 9,460,332

CAPACITIVE FINGERPRINT SENSOR INCLUDING AN ELECTROSTATIC LENS

Apple Inc., Cupertino, C...

1. A capacitive fingerprint sensor, comprising:
a dielectric structure having a contact surface and a sensor surface;
an array of capacitive sensing elements held on or near the sensor surface of the dielectric structure; and
an electrostatic lens formed within the dielectric structure.

US Pat. No. 9,415,105

METHODS FOR USING EXTRACELLULAR ADENOSINE INHIBITORS AND ADENOSINE RECEPTOR INHIBITORS TO ENHANCE IMMUNE RESPONSE AND INFLAMMATION

The United States of Amer...

1. A method for reducing tumor volume and/or tumor size in a subject, comprising:
administering to the subject
(a) a therapeutically effective dose of an adenosine A2a receptor antagonist, or a therapeutically effective dose of an agent
at inhibits accumulation of extracellular adenosine, or combinations thereof, and

(b) a therapeutically effective dose of an anti-neoplastic agent, thereby reducing the volume and/or size of the tumor.

US Pat. No. 9,288,672

METHOD FOR CONFIGURING A REMOTE STATION WITH A CERTIFICATE FROM A LOCAL ROOT CERTIFICATE AUTHORITY FOR SECURING A WIRELESS NETWORK

QUALCOMM Incorporated, S...

1. A method for configuring a remote station with a certificate from a local root certificate authority for securing a wireless
network, comprising:
forwarding a station public key to the local root certificate authority, wherein the station public key is forwarded out-of-band
of the wireless network;

receiving a certificate and a root public key from the local root certificate authority, wherein the certificate comprises
the forwarded station public key and a device identifier, and the certificate and the root public key are received out-of-band
of the wireless network; and

securely communicating, using the wireless network, with another station based on the certificate and the root public key
configured in the another station, and based on verifying, using the root public key configured in the remote station, a validity
of another certificate received from the another station.

US Pat. No. 9,163,583

SYSTEM, APPARATUS, AND METHOD FOR THRUST VECTORING

ROHR, INC., Chula Vista,...

1. A thrust reverser system, comprising:
a translating sleeve configured to expose a flow path in response to the thrust reverser system being activated;
a movable shelf comprising a body having a length in a longitudinal direction, the body disposed between a forward edge and
an aft edge,

wherein the body is configured to divert a flow through the flow path to the forward edge and the aft edge,
wherein the forward edge at least partially defines a first reverse port located forward of the movable shelf, and
wherein the aft edge at least partially defines a second reverse port located aft of the movable shelf and forward of the
translating sleeve;

a track configured to position the body in a transverse orientation relative to the flow path and carry and translate the
movable shelf; and

a bucket door configured to inhibit airflow through a fan air duct, the bucket door being capable of directing the airflow
to interact with the movable shelf.

US Pat. No. 9,063,549

LIGHT DETECTION AND RANGING DEVICE WITH OSCILLATING MIRROR DRIVEN BY MAGNETICALLY INTERACTIVE COIL

Google Inc., Mountain Vi...

11. An autonomous vehicle system comprising:
a light detection and ranging (LIDAR) device including:
a rotating mirror system including:
a mirror body with a reflective side and a back side opposite the reflective side, wherein the mirror body is arranged to
rotate about an axis of rotation substantially parallel to the reflective side such that a change in angle of rotation creates
a corresponding change in orientation of a normal direction of the reflective side;

a conductive coil coupled to the mirror body, wherein the conductive coil is oriented in a plane substantially perpendicular
to the axis of rotation, and wherein the conductive coil is arranged such that the axis of rotation is between the reflective
side and the conductive coil;

a driving circuit configured to create a current through the conductive coil; and
at least one magnet with an associated magnetic field arranged such that current flowing through the conductive coil urges
the conductive coil in a direction perpendicular to both the magnetic field and the direction of current flow so as to generate
a torque on the mirror body;

a light source configured to emit light pulses directed toward the rotating mirror system such that the light pulses are reflected
by the reflective side and emitted from the LIDAR device according to the orientation of the reflective side; and

a sensor configured to receive returning reflected signals corresponding to the light pulses emitted from the LIDAR device;
and

a controller configured to:
instruct the LIDAR device to scan a scanning zone while emitting light pulses;
identify obstacles surrounding the autonomous vehicle based on returning reflected light signals corresponding to the emitted
light pulses; and

control the autonomous vehicle to avoid the identified obstacles.

US Pat. No. 9,247,713

AUTOMATED FEEDING APPARATUS

CAVADISTRIB. INC., Batis...

1. An automated feeding apparatus for animals comprises an inlet hopper having a discharge outlet provided with a feeder actuable
in accordance with a predetermined feeding regime, wherein the invention consists in the feeder having the discharge outlet
of variable and adjustable size, the discharge outlet being adjustable in telescopic manner horizontally and vertically and
being adapted thereby to enable variation of volumetric flow therethrough wherein
the feeder is in the form of a screw feeder adapted to be driven by a motor, the screw feeder being associated with and disposed
within the discharge outlet of variable and adjustable size.

US Pat. No. 9,340,830

OPTIMIZATION OF MULTIGENE ANALYSIS OF TUMOR SAMPLES

FOUNDATION MEDICINE, INC....

1. A method of analyzing a tumor sample for a somatic mutation, comprising:
(a) acquiring a library comprising a plurality of tumor members from the tumor sample;
(b) contacting the library with at least two bait sets to provide selected tumor members, wherein said bait sets hydridize
with the tumor members, thereby providing a library catch;

(c) sequencing by a next generation sequencing method a subgenomic interval comprising the somatic mutation from a tumor member
from said library or library catch, thereby acquiring a read for the subgenomic interval;

(d) aligning said read by an alignment method; and
(e) assigning a nucleotide value from said read for a preselected nucleotide position,thereby analyzing said tumor sample,wherein the at least two bait sets of step (b) are chosen from two of the following bait sets:
(i) a first bait set that selects a high-level target chosen from one or more tumor nucleic acid molecules that comprise a
subgenomic interval comprising a somatic mutation that appears at a frequency of about 5% or less of the cells from the tumor
sample;

(ii) a second bait set that selects a mid-level target chosen from one or more tumor nucleic acid molecules that comprise
a subgenomic interval comprising a somatic mutation that appears at a frequency of about 10% or higher of the cells from the
tumor sample;

(iii) a third bait set that selects a low-level target chosen from one or more nucleic acid molecules that comprise a subgenomic
interval chosen from one or more of:

a) a pharmacogenomic (PGx) single nucleotide polymorphism (SNP) that distinguishes the ability of a patient to metabolize
different drugs,

b) a plurality of genomic SNPs that uniquely identify (fingerprint) a patient, or
c) a genomic SNP or locus that is used to assess copy number gains or losses of genomic DNA and loss-of-heterozygosity (LOH);
(iv) a fourth bait set that selects a nucleic acid molecule that comprises an intron sequence that detects a structural breakpoint;
or

(v) a fifth bait set that selects a one-copy deletion of several terminal exons, wherein each bait set of said plurality has
a unique preselected efficiency for selection for its target as compared with the other bait sets in the plurality.

US Pat. No. 9,510,077

EARPHONE HAVING A CONTROLLED ACOUSTIC LEAK PORT

Apple Inc., Cupertino, C...

1. An earphone comprising:
an earphone housing having a wall comprising (1) a front side that joins (2) an end portion in which a primary output opening
is formed, which joins (3) a face portion in which a secondary output opening is formed, which joins (4) a back side which
joins the front side and encloses a driver, wherein the primary output opening is dimensioned to output sound generated by
a diaphragm of the driver contained within the earphone housing into the ear and the secondary output opening is dimensioned
to vent the ear to a surrounding environment, and

wherein portions of the end portion and the face portion in which the primary output opening and the secondary output opening
are formed, respectively, are positioned over a sound output face of the driver and the primary output opening and the secondary
output opening face different directions.

US Pat. No. 9,203,619

ONLINE DATA TRANSFORMATION

Vormetric, Inc., San Jos...

1. A method for data transformation, comprising:
interleaving input/output (I/O) processing of files and rekeying of the files;
blocking from the rekeying the portion of the file while the portion of the file is subjected to the I/O processing;
blocking from the I/O processing the portion of the file while the portion of the file is subjected to the rekeying; and
writing metadata regarding status of the rekeying of the portion of the file, and regarding a key applied in the rekeying
of the portion of the file, wherein the metadata supports data integrity across concurrent rekeying of a plurality of files
and I/O processing of the plurality of files, wherein the I/O processing and the rekeying are multithreaded, and wherein at
least one method operation is performed by a hardware processor.

US Pat. No. 9,402,856

PHARMACEUTICAL COMPOSITION FOR PREVENTING OR TREATING DIABETES CONTAINING TENC1 EXPRESSION OR ACTIVITY SUPPRESSOR

Postech Academy-Industry ...

1. A method for treating type 2 diabetes or complications of type 2 diabetes comprising administering to a subject in need
thereof a pharmaceutical composition comprising:
an inhibitor of expression of TENC1 (Tensin like C1 domain containing phosphatase) as an active ingredient, wherein the inhibitor
of expression of TENC1 is an siRNA comprising a sequence of SEQ ID NO. 8 or SEQ ID NO. 9.

US Pat. No. 9,471,402

SYSTEMS AND METHODS FOR FACILITATING DEPENDENCY-ORDERED DELIVERY OF DATA SETS TO APPLICATIONS WITHIN DISTRIBUTED SYSTEMS

Juniper Networks, Inc., ...

1. A method comprising:
receiving, at a queue of an application running on a node within a distributed system, a data set from at least one other
application running on another node within the distributed system via an Optimal Flooding Protocol (OFP);

obtaining metadata of the data set that is:
described in a domain-specific language; and
hoisted outside of the data set;
determining, based at least in part on the metadata of the data set, that the data set received from the other application
running on the other node has a dependency on at least one other data set that has yet to arrive at the queue of the application,
wherein the dependency requires a most up-to-date version of the other data set;

gating, due at least in part to the dependency, the data set at the queue of the application running on the node at least
until the most up-to-date version of the other data set arrives at the queue of the application running on the node;

receiving, at the queue of the application running on the node, the other data set from the other application running on the
other node within the distributed system;

determining that the dependency has been satisfied based at least in part on receiving the other data set at the queue of
the application running on the node; and

in response to determining that the dependency has been satisfied, delivering the data set and the other data set to the application
running on the node to enable the application to process the data set and the other data set in accordance with the dependency.

US Pat. No. 9,473,121

SCANNABLE FLIP-FLOP AND LOW POWER SCAN-SHIFT MODE OPERATION IN A DATA PROCESSING SYSTEM

FREESCALE SEMICONDUCTOR, ...

1. A scannable flip-flop comprising:
a flip-flop for receiving an input signal, and for generating a flip-flop output signal; and
a voltage selection circuit coupled to the flip-flop, the voltage selection circuit for supplying a first voltage to the flip-flop
during a first state of a voltage selection signal, and for supplying a second voltage to the flip-flop during a second state
of the voltage selection signal, the voltage selection circuit comprising:

a P-channel transistor having a first current electrode coupled to a VDD voltage supply, a control electrode coupled to the
voltage selection signal, and a second current electrode for providing the first voltage; and

an N-channel transistor having a first current electrode coupled to a VDD voltage supply, a control electrode coupled to the
voltage selection signal, and a second current electrode for providing the second voltage.

US Pat. No. 9,175,258

MICROBIAL COMPOSITIONS AND METHODS

Inocucor Technologies, In...

1. A method of increasing growth of a plant, comprising,
(a) applying to the foliage of a plant or to a plant growing medium an effective amount of a composition consisting of fermentation
broth and microorganisms consisting of isolated microorganisms of IN-M1, Accession No. PTA-12383,

so that a treated plant has increased growth compared to an untreated plant.

US Pat. No. 9,066,946

P2X7 MODULATORS

Janssen Pharmaceutica NV,...

1. A compound of Formula I:

wherein:
R1 is

(a) phenyl, optionally substituted with zero to four groups selected from the group consisting of: halo, C1-C4alkyl, alkoxy, perhaloalkyl and perhaloalkoxy; or

(b) heteroaryl, selected from the group consisting of:

wherein Rk is selected from the group consisting of: H, halo, C1-C3alkyl and alkoxy;

Rj is H or C1-C3alkyl; wherein C1-C3alkyl is optionally substituted with halo, OH and alkoxy; and

n is an integer from 0-3;
X is N or CR2;

R2 is H, perhaloalkyl or C1-C3 lower alkyl;

R3 is H, perhaloalkyl, C1-C4 alkyl, alkalkoxy, CH2Ri, —C(O)Re or phenyl; wherein phenyl is optionally substituted with zero to two groups selected from the group consisting of: halo, C1-C3alkyl, alkoxy, perhaloalkyl and perhaloalkoxy;

Ri is OH, OC1-C3 alkyl, NC3H6, N(C1-C3alkyl)2 or halo;

Re is OH, OC1-C3 alkyl, N(C1-C3alkyl)2, or NC3H6;

R4 and R5 are H or C1-C3 alkyl; and

R8 is phenyl or pyridyl; optionally substituted with zero to four Rm substituents wherein Rm is selected from the group consisting of: halo, C1-C3alkyl, alkoxy, perhaloalkyl and perhaloalkoxy; or

R8 is selected from the group consisting of:


 and
pharmaceutically acceptable salts of compounds of Formula (I).

US Pat. No. 9,495,633

RECURRENT NEURAL NETWORKS FOR MALWARE ANALYSIS

CYLANCE, INC., Irvine, C...

1. A method comprising:
receiving or accessing data encapsulating a sample of at least a portion of one or more files;
feeding at least a portion of the received or accessed data as a time-based sequence into a recurrent neural network (RNN)
trained using historical data;

extracting, by the RNN, a final hidden state hi in a hidden layer of the RNN in which i is a number of elements of the sample; and

determining, using the RNN and the final hidden state, whether at least a portion of the sample is likely to comprise malicious
code.

US Pat. No. 9,426,519

SYNCHRONIZED ADVERTISEMENT PLAYBACK ACROSS NAVIGATION EXPERIENCES AND TRANSITIONAL STATES

Google Inc., Mountain Vi...

1. A system, comprising:
a memory device that stores computer executable instructions;
at least one processor that executes the computer executable instructions stored in the memory which causes the at least one
processor to:

receive, from a client device, a request for a first media item;
in response to the request for the first media item, cause a pre-roll media advertisement associated with the first media
item to be sent to the client device;

cause the client device to play, in a media player provided within a graphical user interface displayed by the client device,
the pre-roll media advertisement prior to playback of the first media item;

in response to the request for the first media item, cause the first media item to be sent to the client device during playback
of the pre-roll media advertisement such that the client device buffers at least a portion of the first media item during
playback of the pre-roll media advertisement;

cause a plurality of selectable user interface elements each corresponding to at least one media item, including a selectable
user interface element corresponding to a second media item, to be displayed within the graphical user interface during playback
of the pre-roll advertisement;

to receive, from the client device, a request for the second media item prior to completion of the pre-roll media advertisement
that was made via the selectable user interface element corresponding to the second media item;

in response to the request for the second media item, cause the second media item to be sent to the client device during playback
of the pre-roll media advertisement such that the client device buffers at least a portion of the second media item during
playback of the pre-roll media advertisement;

identify a restriction related to content of a media advertisement for playing in association with the second media item;
in response to the pre-roll advertisement not satisfying the restriction and the pre-roll media advertisement not having been
played back for a minimum duration when the request for the second media item is received, replace the pre-roll media advertisement
with a new pre-roll media advertisement that satisfies the restriction; and

in response to the pre-roll advertisement satisfying the restriction, cause the client device to continue to play the pre-roll
media advertisement prior to playing of the second media item; and

cause the client device to play the second media item upon completion of the pre-roll advertisement or the new pre-roll advertisement.

US Pat. No. 9,102,331

MULTI-FUNCTIONAL ELECTRIC MODULE FOR A VEHICLE

GM Global Technology Oper...

1. A multi-functional electric module (eModule) for use with a vehicle having a chassis, a master controller, and a drive
wheel having a propulsion-braking module, the eModule comprising:
a steering control assembly having a steering motor and at least one steering controller, wherein each of the at least one
steering controller includes a first printed circuit board assembly (PCBA) operable to control the steering motor in response
to control signals from the master controller;

a mounting bracket positioned with respect to the steering control assembly, and having a mounting feature that is engageable
with the chassis;

a propulsion control assembly having a propulsion controller including a second PCBA that is in communication with the propulsion-braking
module;

a brake controller in communication with the propulsion-braking module, wherein the brake controller includes a third PCBA;
a housing that rotates with respect to the mounting bracket, wherein the housing includes an upper portion positioned adjacent
to the mounting bracket and containing the propulsion control assembly, and a lower portion which contains the brake controller;
and

a lower control arm connected to the lower portion of the housing, wherein the control arm contains a suspension system, and
wherein the lower control arm is connectable to the drive wheel via a wheel input/output block;

wherein the pair of steering controllers, the propulsion controller, and the brake controller are in communication with each
other and with the master controller, and are responsive to commands from the master controller to thereby control a respective
steering, propulsion, and braking function of the eModule.

US Pat. No. 9,222,968

MONITORING SYSTEM FOR DETECTING DEGRADATION OF INTEGRATED CIRCUIT

FREESCALE SEMICONDUCTOR, ...

1. A system for detecting stress degradation of a semiconductor circuit, the system comprising:
a primary semiconductor circuit that has a plurality of monitor nodes;
an amplifier circuit with at least one amplifier output terminal;
at least one degradation test transistor; and
a plurality of multiplexers each having an output coupled to a respective electrode of the degradation test transistor, and
each of the multiplexers having an input coupled to one of the monitor nodes and a respective node of the amplifier circuit,

wherein in operation the multiplexers selectively insert the degradation test transistor into either the primary semiconductor
circuit or the amplifier circuit so that when inserted into the primary semiconductor circuit the degradation test transistor
is subjected to stress degradation voltages in the primary semiconductor circuit and wherein when inserted into the amplifier
circuit an output signal at the output terminal is indicative of stress degradation of the primary semiconductor circuit,

wherein the amplifier circuit includes a differential amplifier and the degradation test transistor forms part of a first
branch of the differential amplifier and part of a second branch of the differential amplifier is formed by a reference transistor.

US Pat. No. 9,335,910

SYSTEM AND METHOD FOR REDUCTION OF INADVERTENT ACTIVATION OF MEDICAL DEVICE DURING MANIPULATION

Tandem Diabetes Care, Inc...

1. An ambulatory infusion pump, comprising:
a housing;
a delivery mechanism at least partially contained within the housing and adapted to facilitate delivery of fluid to a user;
a user interface comprising a touchscreen disposed on a surface of the housing; and
a processor disposed in the housing and configured to generate menu screens for display on the touchscreen and to receive
and process touch input from the touchscreen for navigation between or among the menu screens and for setting pump parameters,
the processor further configured to:

receive touch input through the touchscreen indicating that a specific task is to be performed on the pump, the specific task
being an operation in which the user directly modifies a physical state of the pump and being selected from the group consisting
of replacement of an infusion cartridge, filling the infusion cartridge with fluid and filling infusion tubing with fluid;

automatically lock the touchscreen during the operation in response to the indication of the specific task to be performed
such that touch input received at the touchscreen is not processed by the processor to navigate between or among menu screens
or set pump parameters; and

unlock the touchscreen following completion of the operation.

US Pat. No. 10,565,136

CONTROL SYSTEM AND CONTROL METHOD FOR CONTROLLING MEMORY MODULES

Kingston Digital, Inc., ...

1. A control system for controlling memory modules, comprising:a plurality of memory modules, each of the memory modules comprising a memory unit, a display unit and a micro control unit configured to control the display unit; and
a central processing unit connected to the micro control units through a bus, being configured to instruct the micro control units to initialize the display units, and configured to transmit a control signal to the micro control units according to a preset bus address to instruct the micro control units to synchronously control the display units after the initialization of the display units is completed;
wherein each of the micro control units comprises a bus address that is the same as the preset bus address; and
wherein the central processing unit is configured to further transmit a resynchronization signal to the micro control units according to the preset bus address to instruct the micro control units to synchronously restart the control of the display units based on the control signal while the micro control units are controlling the display units based on the control signal.

US Pat. No. 9,563,420

METHODS AND APPARATUS FOR ANALYZING SOFTWARE INTERFACE USAGE

Time Warner Cable Enterpr...

1. A method of analyzing first software for software interface usage via second software, said first software comprising at
least one file path and referencing a library, said method comprising:
generating, using at least said second software, a data structure comprising a listing of all software application programming
interfaces (APIs) that can be called by said first software wherein said generating said data structure further comprises
generating a listing of all public methods on all public classes;

recursively examining, using at least said second software, all classes on a file path to identify library calls made by said
first software, wherein said recursively examining further comprises identifying constituent methods associated with each
class on said file path, and disassembling each of said constituent methods that reference calls within said listing into
a plurality of instructions to identify one or more API calls therein;

generating, using at least said second software, a call report including least said identified library calls; and
marking based on the call report, using at least said second software, one or more APIs of said listing for impending removal.

US Pat. No. 9,280,039

EXTENDIBLE L-PLATE FOR CAMERA EQUIPMENT

Really Right Stuff, LLC, ...

1. A mounting assembly for mounting photographic equipment on a receiving apparatus, said mounting assembly including:
(a) a base member including a portion defining a retention feature engageable and securable by said receiving apparatus, a
photographic equipment interface portion and a first engagement portion;

(b) a side member including a portion defining another retention feature engageable and securable by said receiving apparatus
and a leg projecting substantially normal to said another retention feature and comprising a second engagement portion slidably
engageable with said first engagement portion;

(c) said side member and said leg maintained in a fixed relationship with respect to one another in such a manner that said
side member and said leg are free from being readily detachable from one another and being free from being readily movable
with respect to one another;

(d) a portion of a peripheral edge portion of said photographic equipment interface portion projecting upward from a longitudinal
center of said photographic equipment interface portion to define a shallow receptacle suitable for mounting said photographic
equipment where said portion of said peripheral edge is configured such that said portion of said peripheral edge extends
upward along a portion of said photographic equipment supported by said photographic equipment interface portion;

(e) said side member defining a lower support and an upper aperture, said lower support being located closer to said leg than
said upper aperture, said lower support defining a maximum offset width defined by the distance from a first point on a central
axis of said upper aperture at a location defined by said lower support that does not include material comprising said lower
support to a first interior periphery edge of said lower support and a maximum offset height along said central axis of said
upper aperture, where said first point is further defined as the mid-point of said maximum offset height along said central
axis, said upper aperture defining a maximum upper aperture width and a maximum upper aperture height, said maximum lower
support offset width is greater than half of said maximum upper aperture width, said maximum lower support offset height is
less than said maximum upper aperture height.

US Pat. No. 9,452,345

RIDER DETECTION SYSTEM

Future Motion, Inc., San...

1. An electric vehicle, comprising:
a board including first and second deck portions each configured to receive a left or right foot of a rider oriented generally
perpendicular to a longitudinal axis of the board;

a wheel assembly including a ground-contacting element disposed between and extending above the first and second deck portions;
a motor assembly mounted to the board and configured to rotate the ground-contacting element around an axle to propel the
electric vehicle;

at least one orientation sensor configured to measure orientation information of the board;
a first sensing region disposed in the first deck portion, the first sensing region including two pressure-sensing transducers
laterally spaced from each other, such that a first of the two pressure-sensing transducers registers with a first portion
of the foot of the rider and a second of the two pressure-sensing transducers registers with a second portion of the same
foot of the rider; and

a motor controller configured to receive board orientation information measured by the orientation sensor and rider presence
information based on outputs of the two pressure-sensing transducers, and to cause the motor assembly to propel the electric
vehicle based on the board orientation information and the rider presence information;

wherein the motor controller is further configured to halt the motor assembly in response to activation of exactly zero or
exactly one of the two pressure-sensing transducers when a speed of the electric vehicle is below a threshold value.

US Pat. No. 9,466,653

ELECTRONIC DEVICES WITH DISPLAY-INTEGRATED LIGHT SENSORS

Apple Inc., Cupertino, C...

1. A display, comprising:
light-generating layers;
a transparent cover layer;
an additional layer having conductive traces, wherein the additional layer is interposed between the light-generating layers
and the transparent cover layer; and

a light sensor at least partially interposed between the light generating layers and the transparent cover layer, wherein
the light sensor is electrically coupled to at least one of the light-generating layers.

US Pat. No. 9,183,983

MODULAR EQUIPMENT CENTER INTEGRATED TRUSS SENSORS

THE BOEING COMPANY, Chic...

1. A system for powering a line replaceable unit (LRU) without exposed electrical connectors, the system comprising:
a truss assembly comprising a plurality of transfer layers;
a primary coil of an inductive power coupling system within one or more of the transfer layers of the truss assembly; and
a secondary coil of the inductive power coupling system within the LRU, wherein the primary coil induces a current in the
secondary coil when the secondary coil within the LRU is in proximity of the primary coil within the truss assembly.

US Pat. No. 9,149,547

PROCESS FOR PRODUCTION OF HETERODIMERS OF GLUTAMIC ACID

MOLECULAR INSIGHT PHARMAC...

1. A compound of formula (II):

wherein
R is lower alkyl, optionally substituted with one or more fluorine atoms;
Q is C(O), O, NR?, S, S(O)2, C(O)2, or (CH2)p;

Y is O, NR?, S, S(O)2, C(O)2, or (CH2)p;

or Q and Y together are —NR?C(O)NR?—;
R? is H, C(O), S(O)2, or C(O)2;

Z is H, C1-C4 alkyl, benzyl, substituted benzyl or trialkylsilyl;

m is 1,2,3,4 or 5;
n is 0, 1, 2, 3, 4, 5 or 6; and
p is 2, 3, 4, 5 or 6.

US Pat. No. 9,417,204

ANALYTE SENSOR

Senova Systems, Inc., Su...

1. A matrix material comprising a sol-gel or other polymer covalently attached to at least one of an analyte-sensitive material
(ASM) and an analyte-insensitive material (AIM), wherein said sol-gel or other polymer is formed by crossing an ASM silane
precursor compound having the structure of Formula (IV):

wherein at least two of R1, R2 and R3 are independently alkoxy, aryloxy, or methoxy, and the third is selected from the group consisting of alkyl, aryl, alkoxy,
aryloxy, and methoxy; X1 is —O— or a chemical bond; L is a linker; Y1? is —OCONR4—, —O—, —NR4CO—, —COR5—, —P(O)(OR6)O—, —CO2—, —O2C—, —NO2R4, —CO2NR4—, —N?N—, —CONH—, —NH—, or a chemical bond; ASM1 is an ASM or an AIM; and R4, R5 and R6 are independently hydrogen, alkyl, or aryl.

US Pat. No. 9,254,496

ARTICLES FOR MANIPULATING IMPINGING LIQUIDS AND METHODS OF MANUFACTURING SAME

Massachusetts Institute o...

1. An article comprising a non-wetting surface having a dynamic contact angle of at least about 90°, said surface comprising
non-wetting features, said surface patterned with macro-scale features having a length scale Lm that is larger than a length scale Ln of the non-wetting features, the macro-scale features being configured to induce controlled asymmetry in a liquid film produced
by impingement of a droplet onto the surface, thereby reducing contact time tc between the droplet and the surface to a value lower than
2.2((?R?3)/?)?(½)(1+?/4)
where the droplet has a radius R, density ?, surface tension ?, and the patterned surface having a pinning fraction ? of zero.

US Pat. No. 9,396,950

LOW THERMAL BUDGET SCHEMES IN SEMICONDUCTOR DEVICE FABRICATION

GLOBALFOUNDRIES Inc., Gr...

1. A method of fabricating a semiconductor device, comprising:
providing a gate structure over a semiconductor substrate;
performing a pre-amorphization implant process for forming amorphous regions adjacent said gate structure;
performing a first implantation process for forming source/drain extension regions entirely in said amorphous regions;
performing a second implantation process for forming source/drain regions entirely in said amorphous regions; and
performing a rapid thermal anneal process after forming of said source/drain regions, wherein no process step performed between
providing said gate structure and performing said rapid thermal anneal process has a temperature greater than 450° C.

US Pat. No. 9,473,372

CONNECTIVITY PROTOCOL DELEGATION

Juniper Networks, Inc., ...

1. A method comprising:
receiving, by a network device situated on a bidirectional forwarding path connecting a server and a client of the server,
a delegation request from the server, the delegation request specifying parameters for a connectivity protocol session for
monitoring connectivity for an application-layer communication session between an application executing on the server and
an application executing on the client, the parameters including a unique identifier for the application executing on the
server;

sending, by the network device to the client in response to the receiving the delegation request and in accordance with the
parameters for the connectivity protocol session, application-layer data that includes connectivity protocol messages for
the connectivity protocol session with the client to determine a connectivity status for the application-layer communication
session, wherein each of the connectivity protocol messages specifies the unique identifier; and

sending, by the network device, a summary report message that includes the connectivity status for the application-layer communication
session to the server.

US Pat. No. 9,204,757

ADJUSTABLE PITCH COOKING GRATE

Yohannes Atlaw, Fremont,...

1. An adjustable pitch cooking grate comprising:
a plurality of parallel rods having first and second rows of rod ends;
first and second scissors linkage operably coupling the first and second rows of rod ends;
each of the first and second scissors linkage comprising links pivotally secured to one another and to the rod ends;
each of the first and second scissors linkage placeable in a first orientation causing the rods to be placed in a closed configuration
with the rods at a first pitch and adjacent to one another;

each of the first and second scissors linkage placeable in a plurality of second orientations causing the rods to be placed
in a plurality of open configurations at a plurality of pitches, the rods defining a plurality of different width gaps between
the rods in the plurality of open configurations;

each scissors linkage having a first length when in the first orientation and a plurality of different second lengths when
in the plurality of second orientations, the first length being shorter than the second lengths.

US Pat. No. 9,400,826

METHOD AND SYSTEM FOR AGGREGATE CONTENT MODELING

Outside Intelligence, Inc...

1. A method for content extraction and modeling by a computer system for incorporating the content into a domain model, the
method comprising:
extracting, by an acquisition module, content stored on a computer readable medium of at least one data source;
determining whether said content is structured or unstructured; wherein structured content has a first content model associated
therewith defining at least a format of said structured content and unstructured content has no model associated therewith;

upon a condition in which said content is structured, incorporating said structured content into said domain model;
upon a condition in which said content is unstructured, determining by said computer system a second content model to transform
said unstructured content into newly structured content, transforming said unstructured data into newly structured content,
storing by said computer system said second content model, and incorporating said newly structured content into said domain
model;

extracting by said acquisition module additional content;
determining an equality of said additional content and said domain model for determining whether said additional content is
relevant to said domain model, said determining comprising:

developing a statistical summary of said domain model and said additional content;
determining a similarity measure from said statistical summary and identifying a minimum score of said similarity measure
required to identify said equality; and

determining said equality if said minimum score is met; and
upon determining said equality, incorporating said additional content into said domain model.
US Pat. No. 9,228,002

LEISHMANIA VACCINE USING SAND FLY SALIVARY IMMUNOGEN

MERIAL, INC., Duluth, GA...

1. A composition comprising an expression vector, wherein the vector comprises a polynucleotide encoding one or more polypeptides
encoding one or more LJM17 polypeptides having at least 80% sequence identity to a polypeptide having the sequence as set
forth in SEQ ID NO: 5, 7, 15, or 17, and wherein the expression vector is selected from the group consisting of pVR2001-TOPO,
pVR2001-TOPA and ALVAC.

US Pat. No. 9,353,019

COATED SEEDS

OMS Investments, Inc., L...

1. A seed comprising a coating, wherein said coating comprises:
(a) a water-swellable polymer;
(b) one or more controlled-release fertilizers; and
(c) bone meal, wherein the bone meal comprises less than 15% protein content and less than 5% fat content.

US Pat. No. 9,508,660

MICROELECTRONIC DIE HAVING CHAMFERED CORNERS

Intel Corporation, Santa...

1. A microelectronic device, comprising:
a microelectronic die having an active surface, an opposing back surface, and at least two adjacent sides, wherein each of
the adjacent sides extend between the microelectronic die active surface and the microelectronic die back surface;

wherein the microelectronic die includes a chamfered corner comprising at least one chamfering side extending between the
at least two adjacent sides; and

wherein the microelectronic die includes a build-up layer comprising a plurality of dielectric layers with a plurality of
conductive traces between the plurality of dielectric layer and a plurality of conductive vias extending between the plurality
of conductive traces through the plurality of dielectric layers and wherein the at least one chamfering side extends between
the microelectronic die active surface and the microelectronic die back surface including extending through the build-up layer.

US Pat. No. 9,071,995

METHODS, SYSTEMS, AND COMPUTER READABLE MEDIA FOR LONG TERM EVOLUTION (LTE) UPLINK DATA PROCESSING

Ixia, Calabasas, CA (US)...

1. A method for performing long term evolution (LTE) uplink data processing, the method comprising:
at an LTE multi-UE simulator:
receiving at least one transport data block containing uplink data to be transmitted to a device under test, wherein the at
least one transport data block includes multiple transport data blocks associated with user devices simulated by the LTE multi-UE
simulator; and

dynamically assigning, for a transmission time interval and using processing information associated with the at least one
transport data block, two or more assignable uplink data processing resources from a plurality of dynamically assignable uplink
data processing resources for processing the at least one transport block, wherein each of the two or more assignable uplink
data processing resources is configured to process a different code block of code blocks associated with the at least one
transport data block.

US Pat. No. 9,057,069

COMPOSITIONS AND METHODS FOR INHIBITING EXPRESSION OF EG5 GENE

Alnylam Pharmaceuticals, ...

1. A composition comprising a double-stranded ribonucleic acid (dsRNA) for inhibiting expression of a human kinesin family
member 11 (Eg5) gene in a cell, wherein the dsRNA comprises a sense strand comprising a first sequence and an antisense strand
comprising a second sequence complementary to 19-24 nucleotides of nucleotides 1066-1101 of NM—004523 (5? UUCCUUAUCGAGAAUCUAAACUAACUAGAAUCCUCC 3? SEQ ID NO:1534), wherein the first sequence is complementary to the second
sequence and wherein the dsRNA is between 19 and 30 base pairs in length.

US Pat. No. 9,489,478

SIMPLIFYING MODES OF AN ELECTRONIC CIRCUIT BY REDUCING CONSTRAINTS

Synopsys, Inc., Mountain...

1. A computer-implemented method for simplifying modes of a circuit design, the method using a computer processor to execute
steps including:
receiving, by the computer processor, a description of a mode of a circuit, the description comprising a netlist and timing
constraints associated with the netlist, the netlist comprising timing nodes connected by timing paths, and the timing constraints
comprising one or more clocks and corresponding timing exceptions associated with one or more timing paths;

identifying, by the computer processor, a set of timing nodes of the circuit, each timing node in the identified set of timing
nodes associated with timing paths reaching the timing node;

selecting, by the computer processor, critical clock pairs, the selecting comprising, for each timing node in the identified
set of timing nodes:

determining a set of clock pairs, each clock pair from the determined set of clock pairs associated with a particular timing
path reaching the timing node, each clock pair including a launch clock and a capture clock associated with the particular
timing path;

for each clock pair from the determined set of clock pairs, determining a time interval between an edge of the launch clock
and an edge of the capture clock;

identifying a clock pair with a smallest time interval in the determined set of clock pairs; and
marking the identified clock pair as a selected critical clock pair;
modifying, by the computer processor, the description of the mode by eliminating one or more clocks that do not occur in the
selected critical clock pairs; and

performing a timing analysis of the circuit using the modified description of the mode.
US Pat. No. 9,155,775

PROCESS FOR MANUFACTURING GLATIRAMER ACETATE PRODUCT

TEVA PHARMACEUTICAL INDUS...

1. A process of preparing a pharmaceutical preparation of glatiramer acetate and mannitol in a suitable container comprising
the steps of:
(i) obtaining an aqueous pharmaceutical solution of glatiramer acetate and mannitol;
(ii) filtering the aqueous pharmaceutical solution at a temperature of above 0° C. to 17.5° C. to produce a filtrate, wherein
the filterability of the aqueous pharmaceutical solution is improved compared to the filterability of the solution at controlled
room temperature; and

(iii) filling the suitable container with the filtrate obtained after performing step (ii), so as to thereby prepare the pharmaceutical
preparation of glatiramer acetate and mannitol in the suitable container.

US Pat. No. 9,448,973

FILTERING FONTS BASED ON A SELECTION OF GLYPHS

Adobe Systems Incorporate...

1. A computer implemented method, comprising:
displaying digital content comprising a plurality of characters displayed as glyphs;
receiving, via a user interface provided by a computing system, a selection of one or more of the plurality of characters,
wherein each of the selected characters can be rendered as a corresponding glyph, such that the selection corresponds to selection
of one or more glyphs of interest from amongst the displayed glyphs;

identifying, from a set of available fonts provided by the computing system, a first subset of available fonts that contain
each of the one or more glyphs of interest, and a second subset of available fonts that do not contain each of the one or
more glyphs of interest;

generating a filtered list of the set of available fonts, wherein the filtered list includes the first subset of available
fonts but excludes the second subset of available fonts;

displaying the filtered list for user selection of a desired font from the filtered list; and
applying the desired font to the digital content when a selection from the filtered list is received.

US Pat. No. 9,119,162

PARALLEL ARRANGEMENT OF ASYNCHRONOUS BUCK CONVERTERS FOR ADVANCED POWER CAPABILITY

QUALCOMM Incorporated, S...

1. A method for extending driving capacity of a power management device, comprising:
determining an energy requirement for operation of a load via the power management device;
comparing the energy requirement for the operation of the load with a capability of a first power device included in a power
management integrated circuit (PMIC);

switching energy delivery to a second power device of higher capacity if the energy requirement is greater than the capability
of the first power device, wherein the second power device is external to the PMIC; and

utilizing the first power device without the second power device for the operation of the load if the energy requirement is
not greater than the capability of the first power device,

wherein the second power device is held in standby mode at a low voltage level when frequent switching is required.

US Pat. No. 9,063,890

EXECUTING PROGRAM TO PROTECTED MEMORY IN TRANSPONDER USING WIRELESS BASE STATION

Atmel Corporation, San J...

1. A method comprising:
receiving, via a wireless transmission from a base station, an access instruction for accessing a protected memory area of
a transponder;

identifying, in response to receiving the access instruction via the wireless transmission from the base station, the access
instruction as being a forbidden instruction, a forbidden instruction comprising an instruction operable to execute an unallowed
access to a protected memory area, an instruction space of the transponder lacking a dedicated instruction for starting, in
response to receiving an access instruction for accessing the protected memory area of the transponder, a first authentication
process;

executing, in response to identifying the access instruction as being a forbidden instruction, a program initiating a second
authentication process between the transponder and the base station such that execution of the program is started in the transponder
in response to identifying the access instruction as being a forbidden instruction; and

enabling, based on the second authentication process, communication between the transponder and the base station.

US Pat. No. 9,059,037

METHODS FOR OVERLAY IMPROVEMENT THROUGH FEED FORWARD CORRECTION

GLOBALFOUNDRIES Inc., Gr...

1. A method, comprising:
obtaining a device after at least one laser annealing process is completed, the device including a substrate surface and at
least one layer over the substrate surface;

performing lithography on the at least one layer;
positioning a first contact-to-gate layer over the at least one layer;
checking alignment of electrical connections between the substrate surface and the first contact-to-gate layer;
determining if an overlay error is present;
adjusting at least one subsequent fabrication process;and
determining a rework threshold for use in adjusting the at least one subsequent fabrication process;
wherein the overlay error and the rework threshold are used to determine an overlay correction.

US Pat. No. 9,241,588

NON-SPILL DRINKING CONTAINER

Munchkin, Inc., Van Nuys...

1. A non-spill collar and valve assembly, comprising:
a collar comprising:
a fastener assembly disposed adjacent to a bottom end of the collar provided to securely fasten to a container; and
an internal frustoconical wall with an open circular upper end that extends downward and inwardly into a closed lower end,
the closed lower end having a projection extending outward from a center of the collar, the internal frustoconical wall further
comprising:

a support surface arranged along an inner surface of the open circular upper end;
a plurality of passages disposed in the internal frustoconical wall to channel a fluid; and
a plurality of protrusions disposed radially adjacent to the support surface defining various channels; and
an annular seal having a first frustoconical surface substantially similar to a shape of the internal frustoconical wall,
the annular seal having a blind bore recess on a lower surface at the center for receiving and securing onto the projection.

US Pat. No. 9,090,357

METHOD OF ASSEMBLING PANELIZED AIRCRAFT FUSELAGES

The Boeing Company, Chic...

1. A method of assembling a panelized aircraft fuselage, the method comprising:
loading a keel structure on a cradle;
attaching stanchions to a floor grid;
positioning the floor grid and stanchions over the keel structure and attaching the stanchions to the keel structure;
obtaining a full fuselage contour including locating lower panels on the floor grid while using the cradle, the floor grid,
and the keel structure to support the lower panels, and locating upper panels on the lower panels; and

fastening the lower panels to the keel structure and the upper panels,
wherein the fuselage is assembled upright from the keel structure without changing orientation of the fuselage.

US Pat. No. 9,278,465

SYSTEM AND METHOD FOR 3D PRINTING OF AEROGELS

Lawrence Livermore Nation...

13. A method of forming an aerogel including:
providing a graphene oxide powder;
mixing the graphene oxide powder with an aqueous solution;
performing a sonication operation on the mixture of the graphene oxide powder and the aqueous solution to form an ink;
using a 3D printing technique to write the ink into a catalytic solution, wherein the catalytic solution is contained in a
fluid containment member;

performing the 3D printing technique to apply the ink to form a plurality of ink layers, one on top of another, to form a
wet three dimensional part having a desired shape and desired dimensions;

curing the wet three dimensional part in a sealed container for a predetermined period of time at a predetermined temperature
to produce a cured wet three dimensional part; and

supercritically drying the cured wet three dimensional part to form a finished aerogel part.

US Pat. No. 9,159,035

FRAMEWORK FOR COMPUTER APPLICATION ANALYSIS OF SENSITIVE INFORMATION TRACKING

FireEye, Inc., Milpitas,...

1. A method comprising:
instrumenting, by a static instrumentation engine within software executed by a processor, an application of a handheld computing
device with one or more monitoring functions, at least one of the one or more monitoring functions operating in a run time
environment during virtual execution of the instrumented application;

tracking, by the one or more monitoring functions, movement of data associated with the application, the data being at least
partially identified by a storage location;

determining whether movement of the data from a first storage location to a second storage location is suspicious; and
reporting suspicious movement of the data.

US Pat. No. 9,271,390

SEMICONDUCTOR DEVICE WITH ACTIVE SHIELDING OF LEADS

FREESCALE SEMICONDUCTOR, ...

1. A semiconductor device, comprising:
a die having a multi-site bond pad;
a multi-wire lead;
at least one shielding wire extending from the multi-wire lead to the multi-site bond pad; and
a guarded wire extending from the multi-wire lead to the multi-site bond pad, wherein the at least one shielding wire and
the guarded wire simultaneously transmit the same signals between the multi-site bond pad and the multi-wire lead.

US Pat. No. 9,364,435

LIPID FORMULATIONS FOR NUCLEIC ACID DELIVERY

PROTIVA BIOTHERAPEUTICS, ...

1. A nucleic acid-lipid particle comprising:
(a) a nucleic acid;
(b) a cationic lipid comprising from 50 mol % to 85 mol % of the total lipid present in the particle;
(c) a non-cationic lipid comprising from 13 mol % to 49.5 mol % of the total lipid present in the particle; and
(d) a conjugated lipid that inhibits aggregation of particles comprising from 0.5 mol % to 2 mol % of the total lipid present
in the particle.

US Pat. No. 9,092,270

METHOD OF SOA PERFORMANCE TUNING

ORACLE INTERNATIONAL CORP...

1. A method of performance tuning processing stages in a computer system, the method comprising:
monitoring a plurality of processing stages to determine a thread rate for each processing stage and a number of threads enabled
for each processing stage, wherein the thread rate is a number of messages which can be processed by a thread in a specified
time period;

calculating a processing speed for each of the processing stages by multiplying the thread rate by the number of threads enabled
for each processing stage;

tuning a slowest processing stage of the plurality of processing stages, wherein tuning comprises
calculating a new number of threads to be allocated to the slowest processing stage;
dividing the processing speed for a fastest processing stage by the thread rate for the slowest processing stage; and
allocating the new number of threads to the slowest processing stage; and
processing messages by the slowest processing stage utilizing the allocated threads.

US Pat. No. 9,445,211

METHODS FOR MANUFACTURING HIGH INTENSITY ULTRASOUND TRANSDUCERS

St. Jude Medical, Atrial ...

1. A method of manufacturing an ultrasound transducer, comprising:
providing an ultrasound transducer;
activating the ultrasound transducer;
sensing an activity of the ultrasound transducer other than frequency;
detecting a location on the ultrasound transducer which does not meet an acceptance criteria; and
modifying at least part of the ultrasound transducer to modify the activity at the location which does not meet the acceptance
criteria.

US Pat. No. 9,440,159

RECHARGEABLE TOY VEHICLES

Shoot the Moon Products I...

1. A toy vehicle comprising:
a toy vehicle body having front and back ends;
four elastic tires, at least one elastic tire having a raised annular area on a side of the tire, the raised area having a
diameter that is less than an outer diameter of the tire;

four wheels, each wheel having an elastic tire thereon;
front and rear axles, each axle having first and second wheels fastened onto respective ends thereof, the raised annular area
on the side of the tire being arranged to face the opposite wheel;

the front and rear axles being mounted to the toy vehicle body with the axles being parallel to each other; and
a motor within the toy vehicle body, the motor including a motor shaft that contacts the raised annular area on the side of
one tire to drive the tire by frictional forces on the side of the tire.

US Pat. No. 9,480,261

INSECTICIDAL STRAIN OF SERRATIA FOR CONTROL OF BROWN MARMORATED STINK BUG (BMSB), HALYOMORPHA HALYS

The United States of Amer...

1. A method for killing insects, comprising treating an object or area with an insect killing effective amount of a composition
comprising a biologically pure culture of Serratia strain NRRL B-50575, and optionally a carrier or carrier material; wherein the identifying characteristics of Serratia strain NRRL B-50575 include produces diffusible pigment, grows on D-serine and D-galactose as sole carbon source, makes acid
from trehalose, pigment not produced by growth on sugars, produces urease and lipase, and pathogenic to Halyomorpha halys; wherein said insects are Halyomorpha halys.

US Pat. No. 9,469,261

CAN NETWORK SPOOFING

Intermotive, Inc., Aubur...

1. A system to allow an aftermarket electronic control module to alter or control an automotive vehicle response by special
controller area network messages only, the system comprising:
a) at least one microprocessor based memory; and
b) at least one processor configured by the memory to perform the steps of:
(i) receiving a first electronic control broadcast message directed to at least one receiving module; and
(ii) causing a subsequent electronic control broadcast message to alter a specific data characteristic of the first electronic
control broadcast message to spoof or mimic a condition that will cause the at least one receiving module to function differently
than it would have under the first electronic control broadcast message.

US Pat. No. 9,423,895

DUAL TOUCH SURFACE MULTIPLE FUNCTION INPUT DEVICE

Intel Corporation, Santa...

1. An apparatus comprising:
a first housing;
a second housing coupled to the first housing, the first housing and the second housing being rotatable between an open configuration
and a closed configuration; and

a touch input device supported by the first housing, wherein the touch input device includes a first touch surface layer configured
to have a first active touch surface responsive to the first housing and the second housing being in the open configuration,
and a second touch surface layer configured to have a second active touch surface responsive to the first housing and the
second housing being in the closed configuration, wherein the first active touch surface is configured to be smaller than
the second active touch surface, wherein the first active touch surface is configured to include a touchpad area, and wherein
the touchpad area is marked on the first touch surface layer by a change in surface texture on the first touch surface layer;
and

wherein the touchpad area includes a touchpad activation area smaller than the touchpad area, and wherein the touchpad area
is activated responsive to a user touch within the touchpad activation area; and

wherein the first touch surface layer is further configured to include a gesture area separate from the touchpad area and
positioned along an outside edge of the first touch surface layer and wherein the gesture area is separate from the touchpad
area by a distance greater than a width of the gesture area.

US Pat. No. 9,397,019

INTEGRATED CIRCUIT PACKAGE CONFIGURATIONS TO REDUCE STIFFNESS

Intel IP Corporation, Sa...

1. An integrated circuit (IC) package comprising:
a die having a first side and a second side disposed opposite to the first side; and
an encapsulation material encapsulating at least a portion of the die and having a first surface that is adjacent to the first
side of the die and a second surface disposed opposite to the first surface;

wherein the second surface has one or more trenches formed therein that have a length as measured in a plane parallel to the
second surface that is greater than a width that is measured in a plane parallel to the second surface and perpendicular to
the length such that one or more cross-section areas of the IC package as measured at a trench are thinner than one or more
other cross-section areas of the IC package as measured at a portion of the IC package that does not intersect with a trench.

US Pat. No. 9,045,800

METHODS AND COMPOSITIONS FOR IDENTIFYING, CLASSIFYING AND MONITORING SUBJECT HAVING BCL-2 FAMILY INHIBITOR-RESISTANT TUMORS AND CANCERS

AbbVie Inc., North Chica...

1. A method for identifying a patient with small-cell lung carcinoma or a lymphoma as eligible to receive N-(4-(4-((2-(4-chlorophenyl)-5,5-dimethyl-1-cyclohex-1-en-1-yl)methyl)
piperazin-1-yl)benzoyl)-4-(((1R)-3-(morpholin-4-yl)-1-((phenylsulfanyl)methyl)propyl)amino)-3-((trifluoromethyl)sulfonyl)benzenesulfonamide
therapy or an anti-sense agent designed to bind to one of Bcl-2, Bcl-w, and Bcl-xL comprising:
(a) providing a tissue sample from a patient;
(b) determining if expression of a Bcl-xL gene is amplified relative to a baseline control level determined before the administration of N-(4-(4-((2-(4-chlorophenyl)-5,5-dimethyl-1-cyclohex-1-en-1-yl)methyl)piperazin-1-yl)benzoyl)-4-(((1R)-3-(morpholin-4-yl)-1-((phenylsulfanyl)methyl)propyl)amino)-3-((trifluoromethyl)sulfonyl)benzenesulfonamide;

(c) identifying the patient as eligible to receive N-(4-(4-((2-(4-chlorophenyl)-5,5-dimethyl-1-cyclohex-1-en-1-yl)methyl)piperazin-1-yl)benzoyl)-4-(((1R)-3-(morpholin-4-yl)-1-((phenylsulfanyl)methyl)propyl)amino)-3-((trifluoromethyl)sulfonyl)benzenesulfonamide
or the anti-sense agent designed to bind to one of Bcl-2, Bcl-w, and Bcl-xL if the Bcl-xL gene is not amplified; and

(d) administering N-(4-(4-((2-(4-chlorophenyl)-5,5-dimethyl-1-cyclohex-1-en-1-yl)methyl)piperazin-1-yl)benzoyl)-4-(((1R)-3-(morpholin-4-yl)-1-((phenylsulfanyl)methyl)propyl)amino)-3-((trifluoromethyl)sulfonyl)benzenesulfonamide
or the anti-sense agent designed to bind to one of Bcl-2, Bcl-w, and Bcl-xL to the patient identified as being eligible to receive N-(4-(4-((2-(4-chlorophenyl)-5,5-dimethyl-1-cyclohex-1-en-1-yl)methyl)piperazin-1-yl)benzoyl)-4-(((1R)-3-(morpholin-4-yl)-1-((phenylsulfanyl)methyl)propyl)amino)-3-((trifluoromethyl)sulfonyl)benzenesulfonamide
or the anti-sense agent designed to bind to one of Bcl-2, Bcl-w, and Bcl-xL.

US Pat. No. 9,499,715

NANOPARTICLE AND GELATION STABILIZED FUNCTIONAL COMPOSITES OF AN IONIC SALT IN A HYDROPHOBIC POLYMER MATRIX

TURKIYE PETROL RAFINERILE...

1. A controlled release composite membrane comprising:
a hydrophobic styrene-butadiene-styrene block copolymer as a hydrophobic continuous medium, and
Pickering emulsion droplets comprising at least one anti-icing agent surrounded and stabilized by a hydrophilic dispersed
medium comprising hydrophobic silica nanoparticles.

US Pat. No. 9,468,464

METHODS FOR TREATING THE SKIN USING VACUUM

Axia MedSciences, LLC, T...

1. A method of treating a skin surface of a subject, comprising:
positioning a handheld device against a skin surface of the subject, the handheld device comprising:
a body comprising a housing;
a working end portion positioned along a first end of the body, the working end portion comprising a distal end configured
to contact the skin surface, wherein the working end portion comprises a perimeter along the distal end;

a first aperture arrangement comprising at least one first port located along or near the working end portion, the at least
one first port being in fluid communication with a vacuum source via at least one passageway; and

a second aperture arrangement comprising at least one second port located along or near the working end portion, the at least
one second port being in fluid communication with a treatment media source;

activating the vacuum source to simultaneously deliver a treatment media to the skin surface through the at least second port,
wherein the treatment media comprises a liquid, and to aspirate spent treatment media through the at least one first port
and the at least one passageway, thereby selectively providing a volume of the treatment media to the skin surface of the
subject;

wherein activating the vacuum source facilitates delivery of treatment media to subsurface skin tissue of the subject and
causes adjacent skin surface to at least partially puff up to facilitate the treatment method.

US Pat. No. 9,447,159

IMMUNOCONJUGATES

Roche Glycart AG, Schlie...

1. An immunoconjugate comprising a first and a second antigen binding moiety, and an Fc domain consisting of two subunits,
and an effector moiety, wherein the effector moiety is a cytokine, wherein not more than one effector moiety is present, and
further wherein said Fc domain comprises a modification promoting heterodimerization of two non-identical polypeptide chains.

US Pat. No. 9,402,489

PORTABLE BLANKET WITH FOLDING GUIDE

Clearman Labs LLC, Redwo...

1. A portable blanket, comprising flexible material and having opposed front and back faces bounded by perimeter edges, and
having a first surface area in an unfolded condition, the flexible material incorporating a folding guide thereon, the folding
guide comprising marked lines which represent a series of sequential half folds disposed in a spiral pattern, wherein each
fold is along a line perpendicular to the previous fold in the series, the series of sequential half folds defining a folded
condition of the blanket, the folded condition having a second surface area smaller than the first surface area.

US Pat. No. 9,305,287

SCORE AND SUGGESTION GENERATION FOR A JOB SEEKER WHERE THE SCORE INCLUDES AN ESTIMATED DURATION UNTIL THE JOB SEEKER RECEIVES A JOB OFFER

LinkedIn Corporation, Mo...

1. A method comprising:
receiving, over a network, a data object that is associated with a user who is engaged in a search for employment, wherein
the data object includes a résumé of the user and a requirement that is associated with the search;

calculating, based on the data object, a score that indicates a likelihood of receiving an offer for an employment position
that satisfies the requirement, wherein the score includes an estimated duration until the user receives the offer;

generating a suggestion that identifies how the score may be increased; and
sending the suggestion over the network to a computing device of the user;
wherein the method is performed by one or more computing devices.

US Pat. No. 9,062,092

MACROCYCLIC INHIBITORS OF FLAVIVIRIDAE VIRUSES

Gilead Sciences, Inc., F...

1. A compound of Formula I:

or a pharmaceutically acceptable salt, isotope, stereoisomer, mixture of stereoisomers, tautomer, ester or prodrug thereof,
wherein:

A is a bond, —O—, —S(O)n—, —NH—, —N((C1-C4)alkyl)- or (C1-C2)alkylene;

A1 is (C1-C5)alkylene, (C2-C5)alkenylene, (C2-C5)alkynylene, arylene, heteroarylene, cycloalkylene, heterocycloalkylene, aryl(C1-C2)alkylene, heteroaryl(C1-C2)alkylene, cycloalkyl(C1-C2)alkylene or heterocycloalkyl(C1-C2)alkylene, wherein a sp3 carbon atom of A1 is optionally replaced by —O—, —S(O)n—, —NH— or —N((C1-C4)alkyl)-, and wherein a sp3 or sp2 carbon atom of A1 is optionally substituted with one or more groups selected from the group consisting of halo, (C1-C8)alkyl, (C2-C8)alkenyl, (C2-C8)alkynyl, aryl, heterocycloalkyl, cycloalkyl, aryl(C1-C4)alkyl, cycloalkyl(C1-C4)alkyl, heterocycloalkyl(C1-C4)alkyl, arylheterocycloalkyl(C1-C4)alkyl, —OR9, —SR9, —S(O)R9, —S(O)2R9 and —N(R9)2;

A2 is —CH(R8)-arylene, —CH(R8)-heteroarylene, —CH(R8)-heterocycloalkylene, —CH(R8)-cycloalkylene, arylene, cycloalkylene, (C1-C3)alkylene, (C2-C3)alkenylene or (C2-C3)alkynylene, wherein A2 is optionally substituted with one or more substituents selected from the group consisting of —OR9, —SR9, —S(O)R9, —S(O)2R9, —N(R9)2, halo, halo(C1-C4)alkyl, halo(C1-C4)alkoxy, cyano and (C1-C8)alkyl;

L1 is —O—C(O)—, —O—CH2, —NR11—CH2—, —NH—C(R10)2— or —NH—S(O)2—, wherein each R10 is independently H, (C1-C4)alkyl, halo(C1-C4)alkyl, (C1-C4)alkenyl or cycloalkyl; and R11 is (C1-C4)alkyl, halo(C1-C4)alkyl, (C1-C4)alkenyl or cycloalkyl;

X1 is a bond, —O—, —NH—, —N((C1-C4)alkyl)- or heterocycloalkylene;

R1 and R2 are independently H, (C1-C4)alkyl, (C2-C4)alkenyl, (C2-C4)alkynyl, halo, cyano or —C(O)—(C1-C4)alkyl; or

R1 and R2, when taken together with the carbon to which they are both attached, form —C(?O)—, —C(?S)— or —C(?N(C1-C4)alkyl)-;

R3 is H or (C1-C4)alkyl which is optionally substituted with halo, cyano, hydroxyl or (C1-C4)alkoxy;

R4a and R4b are independently H, (C1-C8)alkyl, aryl, aryl(C1-C4)alkyl, heterocycloalkyl, heterocycloalkyl(C1-C4)alkyl, cycloalkyl or cycloalkyl(C1-C4)alkyl, wherein each R4a and R4b is optionally substituted with one or more substituents selected from the group consisting of cyano, —COOH, halo, hydroxyl,
amino, (C1-C8)alkoxy, mono(C1-C8)alkylamino, di(C1-C8)alkylamino, aryl and heteroaryl;

R5a and R5b are independently H, (C1-C8)alkyl, (C2-C8)alkenyl, (C2-C8)alkynyl, (C1-C8)alkoxy, aryl, heterocycloalkyl, cycloalkyl, aryl(C1-C4)alkyl, cycloalkyl(C1-C4)alkyl or heterocycloalkyl(C1-C4)alkyl, wherein each R5a and R5b is optionally substituted with one or more substituents selected from the group consisting of —N3, cyano, —COOH, halo, hydroxyl, amino, mono(C1-C8)alkylamino, di(C1-C8)alkylamino, (C1-C8)alkoxy, aryl and heteroaryl, or

R5a and R5b together form a spirocycle having Formula (a):


wherein one or more carbon ring atoms of Formula (a) is optionally replaced by a nitrogen, oxygen or sulfur atom, and wherein
a ring atom of Formula (a) optionally has one or more substituents selected from the group consisting of oxo, ?N(C1-C4)alkoxy, halo, hydroxyl, —NH2, (C1-C4)alkyl, halo(C1-C4)alkyl, (C1-C4)alkoxy, —OC(O)R9, —C(O)2R9, and —S(O)2R9;

R6a and R6b are independently H, hydroxyl, (C1-C8)alkyl, (C2-C8)alkenyl, (C2-C8)alkynyl, (C1-C8)alkoxy, —CH2CH2CR9(?N(C1-C4)alkoxy), aryl, heterocycloalkyl, cycloalkyl, —SR9, —S(O)R9, —S(O)2R9 and —N(R9)2, wherein each of R6a and R6b is optionally substituted with one or more substituents selected from the group consisting of halo, hydroxyl, cyano, (C1-C4)alkyl, (C1-C4)alkoxy, halo(C1-C4)alkoxy, aryl, cycloalkyl, heterocycloalkyl, mono(C1-C8)alkylamino, di(C1-C8)alkylamino, —NHS(O)R9, —NHC(O)R9 and (C1-C8)alkanoyl; or R6a and R6b together form a spirocycle having Formula (a);

each R8 is independently H, (C1-C4)alkyl, halo(C1-C4)alkyl, (C2-C4)alkenyl, (C2-C4)alkynyl, aryl, heteroaryl, heterocycloalkyl or cycloalkyl, wherein R8 is optionally substituted with —OR, —N(R9)2, —CON(R9)2, or cyano;

each R9 is independently H, (C1-C4)alkyl, halo(C1-C4)alkyl, (C2-C4)alkenyl or (C2-C4)alkynyl;

each n is independently 0, 1 or 2; and
m is 1, 2, 3, 4 or 5.

US Pat. No. 9,183,877

DATA STORAGE DEVICE COMPRISING TWO-DIMENSIONAL DATA DEPENDENT NOISE WHITENING FILTERS FOR TWO-DIMENSIONAL RECORDING

Western Digital Technolog...

1. A data storage device comprising:
a disk comprising a plurality of data tracks;
a head actuated over the disk, wherein the head comprises a first read element and a second read element; and
control circuitry operable to:
position the first read element over a first data track k?1 and position the second read element over a second data track
k;

sample a first read signal from the first read element to generate first signal samples;
sample a second read signal from the second read element to generate second signal samples;
a first two-dimensional (2D) equalizer configured to perform 2D equalization of the first signal samples and the second signal
samples to generate first 2D equalized samples;

a second 2D equalizer configured to perform 2D equalization of the first signal samples and the second signal samples to generate
second 2D equalized samples;

a first 2D data dependent noise whitening (DDNW) filter configured to perform 2D DDNW of the first and second 2D equalized
samples to generate first 2D noise whitened samples;

a second 2D DDNW filter configured to perform 2D DDNW of the first and second 2D equalized samples to generate second 2D noise
whitened samples; and

a 2D sequence detector configured to detect a first data sequence recorded in the first data track from the first and second
2D noise whitened samples and to detect a second data sequence recorded in the second data track from the first and second
2D noise whitened samples.

US Pat. No. 9,056,383

PATH FOR PROBE OF SPECTROGRAPHIC METROLOGY SYSTEM

Applied Materials, Inc., ...

1. A method of operating a polishing system, comprising:
polishing a substrate at a polishing station, the substrate held by a carrier head during polishing;
transporting the substrate to an in-sequence optical metrology system positioned between the polishing station and another
polishing station or a transfer station;

measuring a plurality of spectra reflected from the substrate with a probe of the optical metrology system while moving the
carrier head to cause the probe to traverse a path across the substrate and while the probe remains stationary, the path across
the substrate comprising either a plurality of concentric circles or a plurality of substantially radially aligned arcuate
segments; and

adjusting a polishing endpoint or a polishing parameter of the polishing system based on one or more characterizing values
generated based on at least some of the plurality of spectra.

US Pat. No. 9,166,801

INTRINSICALLY SAFE CONNECTION UNIT WITH A NETWORK INTERFACE, INTRINSICALLY SAFE APPLIANCE AND NETWORK INTERFACE FOR IT

Caterpillar Global Mining...

1. An intrinsically safe connection unit with a network interface for intrinsically safe appliances in explosion-risk areas,
the connection unit comprising:
a housing;
a voltage supply connection on the housing and including a central feed connection;
at least one plug connection on the housing for connection of a transmission cable for an intrinsically safe appliance to
the connection unit; and

a decoupling circuit connected upstream of each plug connection and arranged in the housing, each decoupling circuit including
a resistance network in each signal path of the decoupling circuit for radio-frequency power limiting,

wherein the central feed connection includes separate supply cores for each plug connection, each plug connection including
at least two plug contacts for data communication and at least two plug contacts connected to the associated supply cores
for supplying power to each appliance via the transmission cable.

US Pat. No. 9,234,412

TOOLS AND METHODS FOR USE IN COMPLETION OF A WELLBORE

NCS Multistage, LLC, (CA...

1. A method for shifting a sliding sleeve in a horizontal or deviated wellbore, comprising:
providing a deviated wellbore having a sleeve slidably disposed therein providing a work string for use in engaging the sleeve,
the work string comprising: a sealing element; and sleeve location means operatively associated with the sealing element;

deploying said work string within the wellbore to position the sealing element proximal to said sleeve;
setting the sealing element across the wellbore to engage the sleeve;
applying a downward force to the sealing element by the application of hydraulic pressure to the wellbore annulus to shift
the sliding sleeve.

US Pat. No. 9,187,747

RNAI MODULATION OF APOB AND USES THEREOF

Alnylam Pharmaceuticals, ...

1. An isolated iRNA agent comprising a sense strand and an antisense strand, wherein the agent is targeted to at least 15
contiguous nucleotides of the target sequence of AL-DUP 5098 (SEQ ID NO:155 and SEQ ID NO:156) within the ApoB mRNA, and wherein
each strand is between 15 and 30 nucleotides in length.

US Pat. No. 9,304,189

SYSTEMS AND METHODS FOR DETECTING RADAR SIGNALS

Qualcomm, Incorporated, ...

1. A wireless communications device configured to detect radar signals, comprising:
a receiver having a Fast Fourier Transform (FFT) unit for receiving an incoming signal, wherein the FFT unit generates a first
FFT capture including a signal magnitude for a plurality of frequency bins; and

a radar unit configured to:
perform an initial signal analysis on the first FFT capture;
identify a candidate radar signal based at least in part on whether the signal magnitude of at least one of the frequency
bins exceeds an initial threshold;

perform a secondary signal analysis on the incoming signal; and
determine the candidate radar signal is a false detection based at least in part on the secondary signal analysis.

US Pat. No. 9,069,578

DYNAMIC USER INTERFACE ELEMENTS

Adobe Systems Incorporate...

1. A computer implemented method comprising:
determining a current context for a particular user using an application having a plurality of user interface elements, wherein
the current context is based in part on a current locale of the particular user, a current attribute of the particular user,
a current time, or a current date, the current context automatically and dynamically determined by the computer while the
particular user uses the application;

ranking the user interface elements based on the current context; and
displaying one or more of the plurality of user interface elements based at least in part on the ranking of user interface
elements.

US Pat. No. 9,260,573

DYNAMIC MECHANICAL POLYMER NANOCOMPOSITES

CASE WESTERN RESERVE UNIV...

1. A polymer nanocomposite, comprising:
a nanoparticle network incorporated into a host matrix polymer, wherein the nanoparticle network is a formation of a substantially
three-dimensional network of substantially dispersed nanoparticles, wherein in a first switched state, the nanocomposite has
a first modulus, and wherein in a second unswitched state, the nanocomposite has a second modulus, wherein the first modulus
is greater than the second modulus by a factor greater than 2.5, wherein the switchable modulus function is inducable by a
chemical stimulus, or an electrical stimulus or an optical stimulus or a combination thereof.

US Pat. No. 9,239,907

TECHNIQUES FOR IDENTIFYING MISLEADING APPLICATIONS

Symantec Corporation, Mo...

1. A method for identifying misleading applications comprising:
receiving a request for network data;
parsing the request for network data, using a misleading application identification device, to determine if one or more portions
of the request match a suspicious indicator, wherein parsing the request for network data comprises matching a portion of
the request for network data against one or more keywords, and wherein the suspicious indicator is a portion of the request
other than a source address and a connection port;

identifying, using the misleading application identification device, the suspicious indicator without using a known malware
domain, a known malware signature, or a known malware network indicia, wherein identification is performed prior to receiving
any network data from a target of the request; and

performing a specified action in the event one or more portions of the request match the suspicious indicator.

US Pat. No. 9,230,825

METHOD OF TUNGSTEN ETCHING

Lam Research Corporation,...

1. A method for etching a tungsten containing layer in an etch chamber, comprising:
placing a substrate with a tungsten containing layer in the etch chamber;
provide a plurality of cycles, wherein each cycle comprises:
a passivation phase for forming a passivation layer of silicon oxide on sidewalls and bottoms of features in the tungsten
containing layer; and

an etch phase for etching features in the tungsten containing layer.
US Pat. No. 9,212,235

PROCESS OF PREPARATION OF CATALYTIC SUPPORT AND SUPPORTED BIMETALIC CATALYSTS FOR PRODUCTION OF HOMOPOLYMERS AND COPOLYMERS OF ETHYLENE WITH ALPHA-OLEFINS OF HIGH AND ULTRA HIGH MOLECULAR WEIGHT AND WITH BROAD MOLECULAR WEIGHT DIS

Braskem America, Inc., P...

1. Process of producing a supported bimetallic catalyst, involving the reaction among (1) catalytic support comprising a silica,
an aluminum alkyl compound selected from the group consisting of triethylaluminum (TEAL) and tri-isobutylaluminum (TIBA),
magnesium chloride (MgCl2) and tetrahydrofuran (THF) and (2) the reaction product between a first transition metal complex of the groups 4 or 5 of
the Periodic Table containing ligands chosen from at least one of monocyclopentadienyl, monoindenyl or monofluorenyl group,
substituted or not, derived from [L]-MQ3, where M is a transition metal of the groups 4 or 5, Q, which can be equal or different, is a chloride radical, aryl radical,
alkyl radical containing between 1 and 5 carbon atoms or alkoxy radical containing between 1 and 5 carbon atoms and L, is
a bulky ligand of the cyclopentadienyl, indenyl or fluorenyl group, substituted or not by hydrogen, alkyl, cycloalkyl, aryl,
alkenyl, alkylaryl, arylalkyl or arylalkenyl, linked to the transition metal by ? bond, and a second transition metal compound
of the groups 4 or 5 of the Periodic Table containing ligands chosen from at least one of halocarbon, alkyl or alkoxy groups
or monocyclopentadienyl, monoindenyl or monofluorenyl group, substituted or not, derived from [L?]-MQ3, where M is a transition metal of the groups 4 or 5, Q, which can be equal or different, is a chloride radical, aryl radical,
alkyl radical containing between 1 and 5 carbon atoms or alkoxy radical containing between 1 and 5 carbon atoms and L? is
a bulky ligand of the cyclopentadienyl, indenyl or fluorenyl group, substituted or not by hydrogen, alkyl, cycloalkyl, aryl,
alkenyl, alkylaryl, arylalkyl or arylalkenyl, linked to the transition metal by ? bond, in an inert organic solvent, an aluminum
alkyl compound selected from the group consisting of triethylaluminum (TEAL) and tri-isobutylaluminum (TIBA) and (3) an activator
selected from the group consisting of triethylaluminum (TEAL) and tri-isobutylaluminum (TIBA), wherein the catalyst is optionally
put in contact with tetrachloride (SiCl4);
wherein the compounds which represent [L]-MQ3 are selected from the group consisting of CpTiCl3, CpZrCl3, CpHfCl3, CpVCl3, CpTi(Me)3, CpZr(Me)3, CpHf(Me)3, CpTi(OMe)3, CpZr(OMe)3, CpHf(OMe)3, CpTi(OEt)3, CpZr(OEt)3, CpHf(OEt)3, IndTiCl3, IndZrCl3, IndHfCl3, IndVCl3, IndTi(Me)3, IndZr(Me)3, IndHf(Me)3, IndTi(Me)3, IndZr(OMe)3, IndHf(OMe)3, IndTi(OEt)3, IndZr(OEt)3, IndHf(OEt)3, FluTiCl3, FluZrCl3, FluHfCl3, FluVCl3, FluTi(Me)3, FluZr(Me)3, FluHf(Me)3, FluTi(OMe)3, FluZr(OMe)3, FluHf(OMe)3, FluTi(OEt)3, FluZr(OEt)3, FluHf(OEt)3, (MeCp)TiCl3, (MeCp)ZrCl3, (MeCp)HfCl3, (MeCp)VCl3, (MeCp)Ti(Me)3, (MeCp)Zr(Me)3, (MeCp)Hf(Me)3, (MeCp)Ti(OMe)3, (MeCp)Zr(OMe)3, (MeCp)Hf(OMe)3, (MeCp)Ti(OEt)3, (MeCp)Zr(OEt)3, (MeCp)Hf(OEt)3, (nBuCp)TiCl3, (nBuCp)ZrCl3, (nBuCp)HfCl3, (nBuCp)VCl3, (nBuCp)Ti(Me)3, (nBuCp)Zr(Me)3, (nBuCp)Hf(Me)3, (nBuCp)Ti(OCH3)3, (nBuCp)Zr(OCH3)3, (nBuCp)Hf(OCH3)3, (nBuCp)Ti(OEt)3, (nBuCp)Zr(OEt)3, (nBuCp)Hf(OEt)3, (Me5Cp)TiCl3, (Me5Cp)ZrCl3, (Me5Cp)HfCl3, (Me5Cp)VCl3, (Me5Cp)Ti(Me)3, (Me5Cp)Zr(Me)3, (Me5Cp)Hf(Me)3, (Me5Cp)Ti(OMe)3, (Me5Cp)Zr(OMe)3, (Me5Cp)Hf(OMe)3, (Me5Cp)Ti(OEt)3, (Me5Cp)Zr(OEt)3, (Me5Cp)Hf(OEt)3, (4,7-Me2Ind)TiCl3, (4,7-Me2Ind)ZrCl3, (4,7-Me2Ind)HfCl3, (4,7-Me2Ind)VCl3, (4,7-Me2Ind)Ti(Me)3, (4,7-Me2Ind)Zr(Me)3, (4,7-Me2Ind)Hf(Me)3, (4,7-Me2Ind)Ti(OMe)3, (4,7-Me2Ind)Zr(OMe)3, (4,7-Me2Ind)Hf(OMe)3, (4,7-Me2Ind)Ti(OEt)3, (4,7-Me2Ind)Zr(OEt)3, (4,7-Me2Ind)Hf(OCH2CH3)3, (2-MeInd)TiCl3, (2-MeInd)ZrCl3, (2-MeInd)HfCl3, (2-MeInd)VCl3, (2-MeInd)Ti(Me)3, (2-MeInd)Zr(Me)3, (2-MeInd)Hf(Me)3, (2-MeInd)Ti(OMe)3, (2-MeInd)Zr(OMe)3, (2-MeInd)Hf(OMe)3, (2-MeInd)Ti(OEt)3, (2-MeInd)Zr(OEt)3, (2-MeInd)Hf(OEt)3, (2-aryllnd)TiCl3, (2-aryllnd)ZrCl3, (2-aryllnd)HfCl3, (2-aryllnd)VCl3, (2-aryllnd)Ti(Me)3, (2-aryllnd)Zr(Me)3, (2-aryllnd)Hf(Me)3, (2-aryllnd)Ti(OMe)3, (2-aryllnd)Zr(OMe)3, (2-aryllnd)Hf(OMe)3, (2-aryllnd)Ti(OEt)3, (2-aryllnd)Zr(OEt)3, (2-aryllnd)Hf(OEt)3, (4,5,6,7-H4Ind)TiCl3, (4,5,6,7-H4Ind)ZrCl3, (4,5,6,7-H4Ind)HfCl3, (4,5,6,7-H4Ind)VCl3, (4,5,6,7-H4Ind)Ti(Me)3, (4,5,6,7-H4Ind)Zr(Me)3, (4,5,6,7-H4Ind)Hf(Me)3, (4,5,6,7-H4Ind)Ti(OMe)3, (4,5,6,7-H4Ind)Zr(OMe)3, (4,5,6,7-H4Ind)Hf(OMe)3, (4,5,6,7-H4Ind)Ti(OEt)3, (4,5,6,7-H4Ind)Zr(OEt)3, (4,5,6,7-H4Ind)Hf(OEt)3, (9-MeFlu)TiCl3, (9-MeFlu)ZrCl3, (9-MeFlu)HfCl3, (9-MeFlu)VCl3, (9-MeFlu)Ti(Me)3, (9-MeFlu)Zr(Me)3, (9-MeFlu)Hf(Me)3, (9-MeFlu)Ti(OMe)3, (9-MeFlu)Zr(OMe)3, (9-MeFlu)Hf(OMe)3, (9-MeFlu)Ti(OEt)3, (9-MeFlu)Zr(OEt)3 and (9-MeFlu)Hf(OEt)3;

and wherein the compounds which represent [L?]-MQ3 are selected from the group consisting of Ti(OnBu)4, Ti(OiPr)4, Ti(OMe)4, Ti(OBu)2Cl2, Ti(OiPr)2Cl2, Ti(OMe)2Cl2, Zr(OnBu)4, Zr(OiPr)4, Zr(OMe)4, Zr(OnBu)2Cl2, Zr(OiPr)2Cl2, Zr(OMe)2Cl2, CpTiCl3, CpZrCl3, CpHfCl3, CpVCl3, CpTi(Me)3, CpZr(Me)3, CpHf(Me)3, CpTi(OMe)3, CpZr(OMe)3, CpHf(OMe)3, CpTi(OEt)3, CpZr(OEt)3, CpHf(OEt)3, IndTiCl3, IndZrCl3, IndHfCl3, IndVCl3, IndTi(Me)3, IndZr(Me)3, IndHf(Me)3, IndTi(Me)3, IndZr(OMe)3, IndHf(OMe)3, IndTi(OEt)3, IndZr(OEt)3, IndHf(OEt)3, FluTiCl3, FluZrCl3, FluHfCl3, FluVCl3, FluTi(Me)3, FluZr(Me)3, FluHf(Me)3, FluTi(OMe)3, FluZr(OMe)3, FluHf(OMe)3, FluTi(OEt)3, FluZr(OEt)3, FluHf(OEt)3, (MeCp)TiCl3, (MeCp)ZrCl3, (MeCp)HfCl3, (MeCp)VCl3, (MeCp)Ti(Me)3, (MeCp)Zr(Me)3, (MeCp)Hf(Me)3, (MeCp)Ti(OMe)3, (MeCp)Zr(OMe)3, (MeCp)Hf(OMe)3, (MeCp)Ti(OEt)3, (MeCp)Zr(OEt)3, (MeCp)Hf(OEt)3, (nBuCp)TiCl3, (nBuCp)ZrCl3, (nBuCp)HfCl3, (nBuCp)VCl3, (nBuCp)Ti(Me)3, (nBuCp)Zr(Me)3, (nBuCp)Hf(Me)3, (nBuCp)Ti(OCH3)3, (nBuCp)Zr(OCH3)3, (nBuCp)Hf(OCH3)3, (nBuCp)Ti(OEt)3, (riBuCp)Zr(OEt)3, (nBuCp)Hf(OEt)3, (Me5Cp)TiCl3, (Me5Cp)ZrCl3, (Me5Cp)HfCl3, (Me5Cp)VCl3, (Me5Cp)Ti(Me)3, (Me5Cp)Zr(Me)3, (Me5Cp)Hf(Me)3, (Me5Sp)Ti(OMe)3, (Me5Cp)Zr(OMe)3, (Me5Cp)Hf(OMe)3, (Me5Cp)Ti(OEt)3, (Me5Cp)Zr(OEt)3, (Me5Cp)Hf(OEt)3, (4,7-Me2Ind)TiCl3, (4,7-Me2Ind)ZrCl3, (4,7-Me2Ind)HfCl3, (4,7-Me2Ind)VCl3, (4,7-Me2Ind)Ti(Me)3, (4,7-Me2Ind)Zr(Me)3, (4,7-Me2Ind)Hf(Me)3, (4,7-Me2Ind)Ti(OMe)3, (4,7-Me2Ind)Zr(OMe)3, (4,7-Me2Ind)Hf(OMe)3, (4,7-Me2Ind)Ti(OEt)3, (4,7-Me2Ind)Zr(OEt)3, (4,7-Me2Ind)Hf(OCH2CH3)3, (2-MeInd)TiCl3, (2-MeInd)ZrCl3, (2-MeInd)HfCl3, (2-MeInd)VCl3, (2-MeInd)Ti(Me)3, (2-MeInd)Zr(Me)3, (2-MeInd)Hf(Me)3, (2-MeInd)Ti(OMe)3, (2-MeInd)Zr(OMe)3, (2-MeInd)Hf(OMe)3, (2-MeInd)Ti(OEt)3, (2-MeInd)Zr(OEt)3, (2-MeInd)Hf(OEt)3, (2-aryllnd)TiCl3, (2-aryllnd)ZrCl3, (2-aryllnd)HfCl3, (2-aryllnd)VCl3, (2-aryllnd)Ti(Me)3, (2-aryllnd)Zr(Me)3, (2-aryllnd)Hf(Me)3, (2-aryllnd)Ti(OMe)3, (2-aryllnd)Zr(OMe)3, (2-aryllnd)Hf(OMe)3, (2-aryllnd)Ti(OEt)3, (2-aryllnd)Zr(OEt)3, (2-aryllnd)Hf(OEt)3, (4,5,6,7-H4Ind)TiCl3, (4,5,6,7-H4Ind)ZrCl3, (4,5,6,7-H4Ind)HfCl3, (4,5,6,7-H4Ind)VCl3, (4,5,6,7-H4Ind)Ti(Me)3, (4,5,6,7-H4Ind)Zr(Me)3, (4,5,6,7-H4Ind)Hf(Me)3, (4,5,6,7-H4Ind)Ti(OMe)3, (4,5,6,7-H4Ind)Zr(OMe)3, (4,5,6,7-H4Ind)Hf(OMe)3, (4,5,6,7-H4Ind)Ti(OEt)3, (4,5,6,7-H4Ind)Zr(OEt)3, (4,5,6,7-H4Ind)Hf(OEt)3, (9-MeFlu)TiCl3, (9-MeFlu)ZrCl3, (9-MeFlu)HfCl3, (9-MeFlu)VCl3, (9-MeFlu)Ti(Me)3, (9-MeFlu)Zr(Me)3, (9-MeFlu)Hf(Me)3, (9-MeFlu)Ti(OMe)3, (9-MeFlu)Zr(OMe)3, (9-MeFlu)Hf(OMe)3, (9-MeFlu)Ti(OEt)3, (9-MeFlu)Zr(OEt)3 and (9-MeFlu)Hf(OEt)3.

US Pat. No. 9,057,483

THREADED INSERT FOR COMPACT CRYOGENIC-CAPABLE PRESSURE VESSELS

Lawrence Livermore Nation...

1. An apparatus consisting of:
a pressure container having an interior cavity fabricated from a cavity material and an outer surface spaced away from said
interior cavity;

a cryogenic gas in said interior cavity,
external components outside of said pressure container;
an internally threaded opening in said pressure container connecting said interior cavity to said external components, said
opening having an end interfacing with said outer surface of said pressure container; and

an insert threaded into said opening;
a weld proximate said end of said internally threaded opening extending circumferentially around said insert, said weld located
between said outer surface of said pressure container and said insert providing a seal between said outer surface of said
pressure container and said insert;

an inlet port tube connecting the external components with said interior cavity;
an inlet port tube opening in said insert with said inlet port tube positioned in said inlet port tube opening;
a circumferential inlet port tube weld connecting said inlet port tube to said insert that provides a seal between said inlet
port tube and said insert;

an outlet port tube connecting said interior cavity with the external components;
an outlet port tube opening in said insert with said outlet port tube positioned in said outlet port tube opening; and
a circumferential outlet port tube weld connecting said outlet port tube to said insert that provides a seal between said
outlet port tube and said insert;

wherein said circumferential inlet port tube weld is directly exposed to said cryogenic gas in said interior cavity and said
circumferential outlet port tube weld is directly exposed to said cryogenic gas in said interior cavity.

US Pat. No. 9,589,281

OBTAINING DATA FROM INCOMPLETE ELECTRONIC FORMS

MOV-OLOGY, LLC, Anaheim,...

1. A method to obtain data from incomplete electronic forms, the method comprising:
determining that an electronic form accessed by a user is incomplete, the electronic form associated with at least one webpage,
the electronic form having one or more fields configured to accept user-entered text, the electronic form comprising at least
one hypertext markup language (HTML) element associated with the one or more fields;

obtaining data from the incomplete electronic form by obtaining a protocol of the at least one webpage, writing a script tag
associated with a script file to the at least one webpage according to the protocol, the script tag configured to place the
script file onto the at least one webpage, the script file configured to locate the at least one HTML element, building a
data structure based on the incomplete electronic form, and parsing the data structure to obtain the at least one HTML element;

storing one or more of the at least one HTML element and the user-entered text obtained from the incomplete electronic form;
and

sending a personalized message to the user based at least in part on the one or more of the at least one HTML element and
the user-entered text obtained from the incomplete electronic form to entice the user to complete the incomplete electronic
form.

US Pat. No. 9,254,588

PROTECTIVE LAYERING PROCESS FOR CIRCUIT BOARDS

The United States of Amer...

1. A method for encapsulating a populated circuit board assembly having an imprecise three-dimensional geometry, with at least
one protective layer that is tightly fit to the imprecise geometry of the populated circuit board assembly, the method comprising:
making a mold of the populated circuit board assembly;
using the mold to encapsulate the populated circuit board assembly with said at least one protective layer;
wherein making the mold includes:
scanning the populated circuit board assembly to create a surface file of the populated circuit board assembly;
enlarging the surface file to accommodate for variations of the mold and said at least one protective layer;
using the enlarged surface file to create a positive mold;
wherein encapsulating the populated circuit board assembly with said at least one protective layer includes:
using the positive mold to create a multi-layer compliant mold;
heating a first protective layer of said at least one protective layer;
drawing the heated first protective layer within the compliant mold, in order to pre-form an envelope with a substantially
precise representation of the populated circuit board assembly;

pressing the positive mold against the pre-formed envelope within the compliant mold to form the envelope;
releasing the formed envelope from the positive mold and the compliant mold; and
placing the formed envelope onto the populated circuit board assembly to be encapsulated.
US Pat. No. 9,243,182

HYDRAULIC FRACTURING WITH IMPROVED VISCOSITY LIQUEFIED INDUSTRIAL GAS BASED SOLUTION

American Air Liquide Inc....

1. A cryogenic subterranean fracturing fluid, comprising a liquefied industrial gas and a viscosity increasing additive, wherein
said liquefied industrial gas comprises between 98% and 99.56% of the cryogenic subterranean fracturing fluid.

US Pat. No. 9,460,746

CREATING A SUB-MICRON PATTERN PROXIMATE A NEAR-FIELD TRANSDUCER USING IN-SLIDER WAVEGUIDE AND LASER

SEAGATE TECHNOLOGY LLC, ...

1. A method, comprising:
coating an air-bearing surface of a slider with a photoresist having high optical absorbance at or near an operational wavelength
of the slider;

directing light at a target wavelength through an entry of a waveguide integrated into the slider, wherein the light exiting
the waveguide forms a feature through the photoresist, the feature proximate a near-field transducer of the slider; and

forming a sub-micron pattern using the feature.

US Pat. No. 9,237,842

COMPUTERIZED REFRACTION AND ASTIGMATISM DETERMINATION

OPTERNATIVE, INC., Chica...

1. A method for determining a corrective lenses prescription for a patient comprising, separately, for each eye of the patient:
determining an astigmatism prescription for the patient via a computerized screen and without the use of a refractor lens
assembly, wherein determining the astigmatism prescription for the patient comprises testing for a cylinder component by sequentially
presenting at least two cylinder diagrams to the patient via the computerized screen and enabling the patient to select at
least one input per cylinder diagram, wherein the at least one input per cylinder diagram corresponds to a cylinder measurement
used to determine the corrective lenses prescription for the patient.

US Pat. No. 9,199,737

BAGGAGE COMPARTMENT FOR AN AIRCRAFT AND AIRCRAFT HAVING THE BAGGAGE COMPARTMENT

DIEHL AIRCABIN GMBH, Lau...

1. A baggage compartment for an aircraft, comprising:
a housing and a baggage container, wherein the baggage container is mounted in the housing to be pivotable about a pivot axis,
wherein the baggage container is moveable from an open position into a closed position by the pivotal movement of the baggage
container with respect to the housing,

a pulling arrangement, wherein the pulling arrangement comprises at least one pulling means for transferring a pulling force
to the baggage container to move the baggage container from the open position into the closed position,

a drive arrangement, wherein the drive arrangement transfers the pulling force to the pulling means,
wherein the drive arrangement comprises a linear drive and a sliding device movable in a first linear direction,
wherein the at least one pulling means is coupled to the sliding device, such that the moving of the sliding device in the
first linear direction transfers the pulling force to the at least one pulling means, thereby moving the baggage container
from the open position into the closed position.

US Pat. No. 9,046,794

CLEANING MODULE, EUV LITHOGRAPHY DEVICE AND METHOD FOR THE CLEANING THEREOF

Carl Zeiss SMT GmbH, Obe...

1. A cleaning module for cleaning a component inside an extreme-ultraviolet lithography device, comprising:
a source of molecular gas,
a heating unit configured to convert the molecular gas at least partially into ions and producing a byproduct comprising a
thermal beam, wherein the ions and the byproduct flow in a given flow direction,

at least one electromagnetic deflection unit arranged to deflect the ions in a flow direction of the ions to an ion destination
within the extreme-ultraviolet lithography device, wherein the flow direction of the ions differs from the given flow direction,
and

an element establishing a flow direction of the byproduct to a predetermined byproduct destination and physically segregating
the byproduct destination from the ion destination, wherein the flow direction of the byproduct differs from the flow direction
of the ions.

US Pat. No. 9,421,195

METHODS OF TREATING HEPATIC ENCEPHALOPATHY

Salix Pharmaceuticals, Lt...

1. A method of reducing the risk of hepatic encephalopathy (HE) recurrence in an adult subject in need thereof comprising:
orally administering between about 1000 mg to about 1200 mg of rifaximin daily to the adult subject for a period of 12 months
or longer, thereby reducing the risk of hepatic encephalopathy (HE) recurrence.

US Pat. No. 9,262,698

METHOD AND APPARATUS FOR RECOGNIZING OBJECTS VISUALLY USING A RECURSIVE CORTICAL NETWORK

Vicarious FPC, Inc., Uni...

1. A computer-implemented method for object recognition using a recursive cortical network comprising:
receiving an input image at a training module;
applying a trained recursive cortical network (RCN) to the image using an inference module to activate child features of the
RCN;

selecting pools of the RCN containing the activated child features; and
propagating the selection of the pools to identify probabilities of one or more higher-level features matching one or more
objects in the input image.

US Pat. No. 9,251,498

FACILITATING DEPLOYMENT OF CUSTOMIZATIONS OF ENTERPRISE APPLICATIONS

Oracle International Corp...

1. A non-transitory machine readable medium storing one or more sequences of instructions for causing a management system
to facilitate deployment of a plurality of customizations of an enterprise application, a plurality of software modules constituting
entire software instructions of said enterprise application, wherein said plurality of software modules includes a first software
module pre-installed in a state suitable for execution on a first server and a second server of said plurality of servers,
wherein execution of said one or more sequences of instructions by one or more processors contained in said management system
causes said management system to perform the actions of:
receiving a plurality of deployment units, each of said plurality of deployment units containing data defining a manner of
configuration of at least some of said software modules already installed on corresponding servers to attain said plurality
of customizations of said enterprise application according to the requirements of an enterprise, wherein said plurality of
deployment units includes a first deployment unit for customizing said first software module;

receiving an enterprise profile indicating a corresponding set of deployment units to be used in customizing said enterprise
application in corresponding one of said plurality of servers according to the requirements of said enterprise, wherein a
portion of said enterprise profile indicates that said first deployment unit is to be used to customize said enterprise application
in both of said first server and said second server; and

orchestrating the configuration of said plurality of software modules already installed on said plurality of servers according
to the data specified in said plurality of deployment units and said enterprise profile, wherein said orchestrating orchestrates
the configuration of said first software module already installed on both of said first server and said second server in the
corresponding manner according to the data specified in said first deployment unit and said portion of said enterprise profile,
such that said enterprise application having said plurality of software modules pre-installed in said state suitable for execution
is further adapted according to the requirements of said enterprise, said orchestrating comprises:

receiving a level of parallelism specifying a number of deployment units that may be simultaneously deployed on said plurality
of servers;

examining a dependency data indicating a first set of deployment units which need to be deployed prior to deployment of a
first deployment unit, wherein said first set of deployment unit and said first deployment unit are contained in said plurality
of deployment units; and

performing configuration of said plurality of software modules based on said first set of deployment units before performing
configuration based on said first deployment unit in response to said examining,

wherein said performing ensures that the maximum number of deployment units deployed simultaneously on said plurality of servers
does not exceed said number of deployment units.

US Pat. No. 9,209,143

DIE EDGE SIDE CONNECTION

Intel IP Corporation, Sa...

1. An apparatus comprising:
a first integrated circuit (IC) die including a top layer, a bottom surface, a sidewall surface extending from a top surface
of the top layer to the bottom surface, and at least one multi-surface contact pad, wherein the at least one multi-surface
contact pad includes a top surface substantially in the same plane as the top surface of the top layer of the first IC die
and a side surface substantially in the same plane as the sidewall surface of the first IC die;

a second IC die including a top layer, a bottom surface, a sidewall surface extending from a top surface of the top layer
to the bottom surface, and at least one multi-surface contact pad, wherein the second IC die is arranged adjacent to the first
IC die;

a substrate, wherein the bottom surfaces of the first IC die and the second IC die are in contact with the substrate; and
an electrically conductive bond including the top surface and the side surface of the multi-surface contact pad of the first
IC die and at least one of the top surface and the side surface of the multi-surface contact pad of the second IC die.

US Pat. No. 9,104,469

SUSPEND-RESUME OF VIRTUAL MACHINES USING DE-DUPLICATION

VMware, Inc., Palo Alto,...

1. A method for suspending a virtual machine executing in a physical host, the method comprising:
suspending execution of a virtual machine having data stored in a virtual memory space allocated for the virtual machine;
dividing the data in the virtual memory space into a plurality of blocks;
determining a plurality of keys corresponding to data in the plurality of blocks;
storing the plurality of keys in a key-data map that associates each of the plurality of keys with corresponding data from
the plurality of blocks; and

generating, on a storage device, a saved state file comprising the plurality of keys, wherein the saved state file represents
a state of the virtual memory space of the suspended virtual machine.

US Pat. No. 9,067,961

THIOCARBON-PROTECTING GROUPS FOR RNA SYNTHESIS

Agilent Technologies, Inc...

1. A compound having the structure of formula (II):
wherein:
BP is a protected or unprotected heterocyclic group having a 3 to 20 membered ring system;

one of R1 and R2 is a protecting group, and the other of R1 and R2 is a phosphoramidite group;

W is —NH2, —NH—R4 or —NR4—R5, —NH—O—R4 or —NR4—O—R5, wherein R4 and R5 are independently selected from a hydrocarbyl, a substituted hydrocarbyl, an aryl or a substituted aryl, wherein R4 and R5 are optionally cyclically linked, provided that W is not imidazole.

US Pat. No. 9,291,466

DEFINING TRAVEL PATHS IN PARKING AREAS

UNITED PARCEL SERVICE OF ...

1. A method for defining travel paths in parking areas, the method comprising:
for a parking area in which there is at least one travel path for the parking area that is not represented on a digital map,
defining, by one or more processors, a first set of one or more travel paths in the parking area by identifying one or more
paths traversed by one or more vehicles in the parking area based at least in part on telematics data collected while the
one or more vehicles were traversing the parking area; and

updating, via the one or more processors, the digital map to include a representation of the first set of one or more travel
paths in the parking area.

US Pat. No. 9,058,480

DIRECTIONAL TOUCH UNLOCKING FOR ELECTRONIC DEVICES

Google Inc., Mountain Vi...

1. A computer implemented method, comprising:
receiving, by one or more processors, an input pattern from a touch based input device, the input pattern comprising one or
more directional changes corresponding to directional changes of user gestures made on the input device, wherein the directional
changes are based on an end movement of each of the user gestures, and wherein a first portion of the input pattern is formed
with one finger and a second portion of the input pattern is formed with a plurality of fingers;

determining, by one or more processors, if the directional changes of the input pattern match directional changes of a security
pattern associated with a user's security profile, wherein the determining does not compare a size or a specific location
of the input pattern on the touch based input device with the security pattern; and

providing an unlock signal if the directional changes of the input pattern match the directional changes of the security pattern,
the unlock signal granting user access to a user device or a user account.

US Pat. No. 9,058,824

DEVICES INCLUDING A GAS BARRIER LAYER

Seagate Technology LLC, ...

1. A device comprising:
a near field transducer (NFT);
a gas barrier layer positioned on at least a portion of the NFT; and
a wear resistance layer positioned on at least a portion of the gas barrier layer wherein the gas barrier layer comprises:
a) tantalum oxide (TaO), titanium oxide (TiO), chromium oxide (CrO), silicon oxide (SiO), aluminum oxide (AlO), titanium oxide
(TiO), zirconium oxide (ZrO), yttrium oxide (YO), magnesium oxide (MgO), beryllium oxide (BeO), niobium oxide (NbO), hafnium
oxide (Hf), vanadium oxide (VO), strontium oxide (SrO), or combinations thereof;

b) silicon nitride (SiN), aluminum nitride (Al), boron nitride (BN), titanium nitride (TiN), zirconium nitride (ZrN), niobioum
nitride (NbN), hafnium nitride (HfN), chromium nitride (CrN), or combinations thereof;

c) silicon carbide (SiC), titanium carbide (TiC), zirconium carbide (ZrC), niobioum carbide (NbC), chromium carbide (CrC),
vanadium carbide (VC), boron carbide (BC), or combinations thereof; or

d) combinations of any of a), b), and c).

US Pat. No. 9,265,466

X-RAY RADIOGRAPHIC APPARATUS, METHOD OF MEASURING HEAD TILT IN TAKING RADIOGRAPH, STAND FOR X-RAY RADIOGRAPHIC APPARATUS, CHAIR FOR X-RAY RADIOGRAPHIC APPARATUS, AND HEAD TILT SETTING DEVICE

Cephmedical Corporation, ...

1. An X-ray radiographic apparatus, comprising:
a pair of arms provided facing each other and connected to an arm control device,
ear rods respectively provided on inside surfaces facing each of the pair of arms,
a head tilt setting device for setting a tilt in a front-rear direction of a head of a subject which is provided at at least
one of the pair of arms, having a transparent plate provided vertically to a central axis of the ear rods integrally with
the arm, or provided vertically to the central axis of the ear rods on an exterior surface of the arm; and

a horizontal plane verification mechanism that recognizes a horizontal plane when setting the head tilt using the head tilt
setting device.

US Pat. No. 9,340,678

PROCESS TO FORM AQUEOUS PRECURSOR AND ALUMINUM OXIDE FILM

State of Oregon acting by...

1. A method for forming a thin film of Al2O3 on a substrate, the method comprising:
forming a layer of precursor coating material comprising water, Al13(OH)24(H2O)24](NO3)15, or a combination of Al13(OH)24(H2O)24](NO3)15 and Al(NO3)3, on a substrate, thereby forming a coated substrate;

heating the coated substrate to remove ligands and at least a portion of the water; and
heating the coated substrate at a temperature within a temperature range of between about 100° C. and about 900° C. to eliminate
water and to form and densify a thin film of Al2O3 having a thickness of 0.5 nm to 2,000 nm on the substrate.

US Pat. No. 9,237,341

IMAGE DECODING METHOD, IMAGE CODING METHOD, IMAGE DECODING APPARATUS, IMAGE CODING APPARATUS, AND IMAGE CODING AND DECODING APPARATUS

Panasonic Intellectual Pr...

1. An image decoding method of decoding, on a per-block basis, a coded image included in a bitstream, the image decoding method
comprising:
performing arithmetic decoding on a current block to be decoded;
determining whether or not the current block is at an end of a slice;
determining whether or not the current block is at an end of a sub-stream when it is determined that the current block is
not at the end of the slice, the sub-stream being a structural unit of the image that is different from the slice; and

performing arithmetic decoding on a sub-last bit indicating the end of the sub-stream and being different from the current
block when it is determined that the current block is at the end of the sub-stream;

performing arithmetic decoding termination as first termination when the sub-last bit is arithmetically decoded;
performing arithmetic decoding termination as second termination when it is determined that the current block is at the end
of the slice; and

performing arithmetic decoding on an end-of-slice flag indicating whether or not the current block is at the end of the slice,
the end-of-slice flag being different from the sub-last flag,

wherein, when the first termination is performed, same processing as the second termination is performed,
wherein, in the determining of whether or not the current block is at an end of a slice, it is determined that the current
block is at the end of the slice when the end-of-slice flag on which arithmetic decoding has been performed indicates a predetermined
value of 1, and

wherein a value of 1 is restored by the arithmetic decoding of the sub-last bit.

US Pat. No. 9,180,105

CDC7 KINASE INHIBITORS AND USES THEREOF

Sloan-Kettering Institute...

1. A method for treating cancer in a human subject in need thereof, comprising administering to the human subject a therapeutically
effective amount of a compound of the Formula (II):
or a pharmaceutically acceptable salt thereof,
wherein the cancer is lung cancer, ovarian cancer, thyroid cancer, or melanoma.

US Pat. No. 9,590,118

WAFER WITH SOI STRUCTURE HAVING A BURIED INSULATING MULTILAYER STRUCTURE AND SEMICONDUCTOR DEVICE STRUCTURE

GLOBALFOUNDRIES Inc., Gr...

1. A semiconductor device structure, comprising:
an SOI substrate comprising a semiconductor base substrate material, a buried insulating structure formed on said base substrate
material, and a semiconductor film formed on said buried insulating structure, wherein said buried insulating structure comprises
a multilayer stack having a nitride layer interposed between two oxide layers;

a semiconductor device formed in and above an active region of said SOI substrate, comprising:
a gate structure;
raised source/drain regions located at opposing sides of said gate structure; and
a silicide contact region defined in said base substrate material below said semiconductor device;
a nitride material layer disposed above said semiconductor device and at least a portion of said silicide contact region,
a contact dielectric disposed above said nitride material layer, and
a back bias contact at least partially disposed in said contact dielectric and being electrically connected to said silicide
contact region.

US Pat. No. 9,410,827

MEASUREMENT USING A CALIBRATION PATTERN

Pixameter Corp., Los Gat...

1. A method for making a measurement comprising:
(a) capturing a digital image, the captured digital image including a calibration pattern, the calibration pattern being square
in shape, the calibration pattern including displayed encoded information arranged in a two dimensional pattern, the displayed
encoded information directly providing calibration information about the calibration pattern that can be used directly in
a calibration process;

(b) reading the displayed encoded information to obtain the calibration information about the calibration pattern, where said
displayed encoded information includes (1) a first square non-solid box at a first corner of said calibration pattern with
a first solid box located within said first square non-solid box, (2) a second square non-solid box at a second corner of
said calibration pattern with a second solid box located within said second square non-solid box, (3) a third square non-solid
box at a third corner of said calibration pattern with a third solid box located within said third square non-solid box, where
said displayed encoded information arranged in said two dimensional pattern relates to a size calibration information of said
calibration target, where said displayed encoded information arranged in said two dimensional pattern also relates to a geometrical
calibration information of said calibration pattern based upon said first, second, and third square non-solid boxes; and,

(c) utilizing said size calibration information and said geometrical calibration information about the calibration pattern
to make a calibrated measurement.

US Pat. No. 9,361,912

HIGH MOMENT SIDE SHIELD DESIGN FOR AREA DENSITY IMPROVEMENT OF PERPENDICULAR MAGNETIC RECORDING (PMR) WRITER

Headway Technologies, Inc...

1. A perpendicular magnetic recording (PMR) writer, comprising:
(a) a main pole with a leading side and a trailing side, the leading side adjoins a lead gap at an air bearing surface (ABS)
and the trailing side adjoins a write gap at the ABS;

(b) a side gap which contacts a side of the main pole formed between the trailing side and leading side on each side of a
center plane that bisects the main pole in a direction orthogonal to the ABS;

(c) a lead gap that is connected to an end of each side gap and contacts the leading side of the main pole; and
(d) a side shield and leading shield structure comprising:
(1) a hot seed layer made of a 19-24 kilogauss (kG) magnetic material having a side that faces the main pole wherein a first
portion thereof adjoins the lead gap and a second portion contacts the side gap on each side of the center plane; and

(2) a first magnetic layer made of a 10-16 kG magnetic material that adjoins the first portion on a side thereof which faces
away from the main pole and together with the hot seed layer first portion forms a composite leading shield; and

(3) a second magnetic layer made of a 10-16 kG magnetic material that adjoins each second portion on a side thereof that faces
away from the main pole and with the hot seed layer second portion forms a composite side shield.

US Pat. No. 9,217,527

NO-SKIVE HYDRAULIC HOSE COUPLING WITH IMPROVED HOSE RETENTION AND SEALING

Caterpillar Inc., Peoria...

1. A hydraulic hose and coupling assembly, comprising:
a hydraulic hose having an inner elastomeric liner, a reinforcing layer comprised of a plurality of metallic wires surrounding
the inner elastomeric liner, and an outer elastomeric cover surrounding the metallic reinforcing layer; and

a coupling secured to the hydraulic hose in a no-skive arrangement and having a proximal end adjacent to an opening of the
hydraulic hose and a distal end further removed from the hydraulic hose opening than the proximal end, the coupling including:

an inner stem inserted into the hose and in engagement with the inner elastomeric liner, the inner stem having an inner diameter,
a first end and a second end, the first end free of the hose and the second end disposed inside the hose, the inner stem including
a plurality of radially inwardly directed recesses, a radially outwardly directed serration, and a plurality of straight cylindrical
outer surfaces positioned within an outer ferrule, wherein each of the straight cylindrical outer surfaces that are positioned
within the outer ferrule are oriented parallel to a longitudinal axis of the inner stem and are disposed before or after each
of the recesses positioned within the outer ferrule; and

the outer ferrule surrounding the outer elastomeric cover, the outer ferrule including a plurality of radially inwardly extending
barbs disposed in first, second, third and fourth circumferential rows, the fourth row of barbs disposed to extend toward
and align with a first of the plurality of straight cylindrical outer surfaces of the inner stem, the third row of the barbs
disposed to extend toward and align with a second of the plurality of straight cylindrical outer surfaces of the inner stem,
the second straight cylindrical outer surface flanked by at least two of the recesses, wherein one of the rows of barbs is
disposed to extend toward and align with the serration,

wherein the rows of barbs and the inner stem define a plurality of hose retention and sealing zones, the plurality of hose
retention and sealing zones each having a Menor Factor, the Menor Factor in each zone decreasing from the proximal end toward
the distal end,

wherein the Menor Factor is the mathematical equation
FM=WD/LC+(BH)(TW)+½ZL
wherein FM equals the Menor Factor;

WD equals wire deflection;

LC equals liner compression;

BH equals barb height;

TW equals tip width; and

ZL equals zone length.

US Pat. No. 9,469,640

COMPOUNDS AND METHODS FOR KINASE MODULATION, AND INDICATIONS THEREFOR

Plexxikon Inc., Berkeley...

1. A compound of formula (Ia):

or a pharmaceutically acceptable salt thereof,
wherein:
L1 is a bond or —N(H)C(O)—;

each R1 is optionally substituted lower alkyl or optionally substituted heteroaryl;

R2 is hydrogen or halogen;

R4 is hydrogen;

R3 is optionally substituted lower alkyl or optionally substituted aryl;

m is 0, 1, 2, 3, 4, or 5; and
Ar is a monocyclic heteroaryl containing 5 to 6 atoms wherein at least one atom is nitrogen.

US Pat. No. 9,055,877

SYSTEM AND METHOD FOR RECONSTRUCTING CARDIAC ACTIVATION INFORMATION

The Regents of the Univer...

1. A method of processing cardiac activation information, the method comprising:
accessing a first cardiac signal and a second cardiac signal obtained from a patient;
processing the first cardiac signal and the second cardiac signal to identify a point of change in the first cardiac signal
at which a derivative of the first cardiac signal diverges with respect to a derivative of the second cardiac signal; and

assigning an activation onset time in the first cardiac signal at the point of change to define a cardiac activation.

US Pat. No. 9,186,208

SYSTEMS FOR ENDOMETRIAL ABLATION

MINERVA SURGICAL, INC., ...

1. A system for endometrial ablation comprising:
an elongated shaft with a working end having an axis and comprising a compliant energy-delivery surface actuatable by an interior
expandable-contractable frame, wherein said compliant energy-delivery surface comprises a dielectric;

the surface expandable to a selected planar triangular shape configured for deployment to engage the walls of a patient's
uterine cavity;

wherein the selected shape has an axial length ranging at least between 4.5 cm and 6.5 cm.

US Pat. No. 9,266,836

PRMT5 INHIBITORS AND USES THEREOF

Epizyme, Inc., Cambridge...

1. A compound of Formula (I):

or a pharmaceutically acceptable salt thereof,
wherein:
represents a single or double bond;
R1 is hydrogen, Rz, or —C(O)Rz, wherein Rz is optionally substituted C1-6 alkyl;

X is a bond, —O—, —N(R)—, —CR4R5—, —O—CR4R5, —N(R)—CR4R5—, —O—CR4R5—O—, —N(R)—CR4R5—O, —N(R)—CR4R5—N(R)—, —O—CR4R5—N(R)—, —CR4R5—O—, —CR4R5—N(R)—, —O—CR4R5—CR6R7—, —N(R)—CR4R5—CR6R7—, —CR6R7—CR4R5—O—, —CR6R7—CR4R5—N(R)—, or —CR6R7—CR4R5—;

each R is independently hydrogen or optionally substituted C1-6 aliphatic;

R2 and R3 are independently selected from the group consisting of hydrogen, halo, —CN, —NO2, optionally substituted aliphatic, optionally substituted carbocyclyl, optionally substituted phenyl, optionally substituted
heterocyclyl, optionally substituted heteroaryl, —ORA, —N(RB)2, —SRA, —C(?O)RA, —C(O)ORA, —C(O)SRA, —C(O)N(RB)2, —C(O)N(RB)N(RB)2, —OC(O)RA, —OC(O)N(RB)2, —NRBC(O)RA, —NRBC(O)N(RB)2, —NRBC(O)N(RB)N(RB)2, —NRBC(O)ORA, —SC(O)RA, —C(?NRB)RA, —C(?NNRB)RA, —C(?NORA)RA, —C(?NRB)N(RB)2, —NRBC(?NRB)RB, —C(?S)RA, —C(?S)N(RB)2, —NRBC(?S)RA, —S(O)RA, —OS(O)2RA, —SO2RA, —NRBSO2RA, and —SO2N(RB)2; or R2 and R3 are taken together with their intervening atoms to form an optionally substituted carbocyclic or heterocyclic ring;

R4 and R5 are independently selected from the group consisting of hydrogen, halo, —CN, —NO2, optionally substituted aliphatic, optionally substituted carbocyclyl, optionally substituted phenyl, optionally substituted
heterocyclyl, optionally substituted heteroaryl, —ORA, —N(RB)2, —SRA, —C(?O)RA, —C(O)ORA, —C(O)SRA, —C(O)N(RB)2, —C(O)N(RB)N(RB)2, —OC(O)RA, —OC(O)N(RB)2, —NRBC(O)RA, —NRBC(O)N(RB)2, —NRBC(O)N(RB)N(RB)2, —NRBC(O)ORA, —SC(O)RA, —C(?NRB)RA, —C(?NNRB)RA, —C(?NORA)RA, —C(?NRB)N(RB)2, —NRBC(?NRB)RB, —C(?S)RA, —C(?S)N(RB)2, —NRBC(?S)RA, —S(O)RA, —OS(O)2RA, —SO2RA, —NRBSO2RA, and —SO2N(RB)2; or R4 and R5 are taken together with their intervening atoms to form an optionally substituted carbocyclic or heterocyclic ring;

R6 and R7 are independently selected from the group consisting of hydrogen, halo, —CN, —NO2, optionally substituted aliphatic, optionally substituted carbocyclyl, optionally substituted phenyl, optionally substituted
heterocyclyl, optionally substituted heteroaryl, —ORA, —N(RB)2, —SRA, —C(?O)RA, —C(O)ORA, —C(O)SRA, —C(O)N(RB)2, —C(O)N(RB)N(RB)2, —OC(O)RA, —OC(O)N(RB)2, —NRBC(O)RA, —NRBC(O)N(RB)2, —NRBC(O)N(RB)N(RB)2, —NRBC(O)ORA, —SC(O)RA, —C(?NRB)RA, —C(?NNRB)RA, —C(?NORA)RA, —C(?NRB)N(RB)2, —NRBC(?NRB)RB, —C(?S)RA, —C(?S)N(RB)2, —NRBC(?S)RA, —S(O)RA, —OS(O)2RA, —SO2RA, —NRBSO2RA, and —SO2N(RB)2; or R6 and R7 are taken together with their intervening atoms to form an optionally substituted carbocyclic or heterocyclic ring;

each RA is independently selected from the group consisting of hydrogen, optionally substituted aliphatic, optionally substituted
carbocyclyl, optionally substituted heterocyclyl, optionally substituted aryl, and optionally substituted heteroaryl;

each RB is independently selected from the group consisting of hydrogen, optionally substituted aliphatic, optionally substituted
carbocyclyl, optionally substituted heterocyclyl, optionally substituted aryl, and optionally substituted heteroaryl, or two
RB groups are taken together with their intervening atoms to form an optionally substituted heterocyclic ring;

R8, R9, R10, and R11 are independently hydrogen, halo, or optionally substituted aliphatic;

Cy is a monocyclic or bicyclic carbocyclic group or a monocyclic or bicyclic aryl group, substituted with 0, 1, 2, 3, or 4
Ry groups;

each Ry is independently selected from the group consisting of halo, —CN, —NO2, optionally substituted aliphatic, optionally substituted carbocyclyl, optionally substituted aryl, optionally substituted
heterocyclyl, optionally substituted heteroaryl, —ORA, —N(RB)2, —SRA, —C(?O)RA, —C(O)ORA, —C(O)SRA, —C(O)N(RB)2, —C(O)N(RB)N(RB)2, —OC(O)RA, —OC(O)N(RB)2, —NRBC(O)RA, —NRBC(O)N(RB)2, —NRBC(O)N(RB)N(RB)2, —NRBC(O)ORA, —SC(O)RA, —C(?NRB)RA, —C(?NNRB)RA, —C(?NORA)RA, —C(?NRB)N(RB)2, —NRBC(?NRB)RB, —C(?S)RA, —C(?S)N(RB)2, —NRBC(?S)RA, —S(O)RA, —OS(O)2RA, —SO2RA, —NRBSO2RA, and —SO2N(RB)2; or an Ry group may be optionally taken together with R2 or R3 to form an optionally substituted 5- to 6-membered carbocyclic or heterocyclic ring fused to Cy;

each Rx is independently selected from the group consisting of halo, —CN, optionally substituted aliphatic, —OR?, and —N(R?)2;

R? is hydrogen or optionally substituted aliphatic;
each R? is independently hydrogen or optionally substituted aliphatic, or two R? are taken together with their intervening
atoms to form an optionally substituted heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen,
and sulfur; and

n is 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10, as valency permits;
wherein each instance of aliphatic is independently an alkyl, alkenyl, alkynyl, cycloalkyl, or cycloalkenyl group.

US Pat. No. 9,265,468

FLUOROSCOPY-BASED SURGICAL DEVICE TRACKING METHOD

BRONCUS MEDICAL, INC., M...

1. A method for tracking a surgical device in a body organ of a subject during a surgical procedure, wherein the body organ
is a non-rigid body organ that changes shape as a result of varying patient body posture or position thereby defining an anatomy
of unknown shape, the body organ comprising at least one body lumen, and said surgical device comprising a distal section
having at least one reference mark which is visible under fluoroscopy, the method comprising the steps of:
a) receiving a 3D image data set of the body organ and computing a 3D model of the body organ;
b) performing a pre-tracking registration prior to tracking the surgical device during the surgical procedure thereby registering
an image derived from the 3D model of the body organ with a real-time fluoroscopy image; wherein the pre-tracking registration
comprises the following steps:

receiving a pre-tracking position from a sensor indicating the position of a fluoroscopy unit;
receiving a pre-tracking fluoroscopy image corresponding to the pre-tracking position;
registering the pre-tracking fluoroscopy image with a pre-tracking image derived from the 3D model of the body organ; and
recording the pre-tracking position;
c) advancing the distal section of the surgical device outside of the at least one body lumen and into the anatomy of unknown
shape;

d) receiving a real-time fluoroscopy image showing the reference mark of the surgical device outside of the at least one body
lumen and in the anatomy of unknown shape; and

e) computing a 3D location of the surgical device in the 3D model based on a shape or pattern of the reference mark outside
the at least one body lumen and within the anatomy of unknown shape and visible in the fluoroscopy image of step (d).

US Pat. No. 9,588,587

SYSTEMS AND METHODS FOR GENERATING CUSTOMIZED HAPTIC BOUNDARIES

MAKO Surgical Corp., For...

1. A method for customizing a haptic boundary based on a patient-specific anatomy, comprising:
obtaining a standard haptic boundary based on a geometry of a virtual implant model to be implanted on the anatomy;
identifying a reference feature associated with the virtual implant model;
determining an intersection between the identified reference feature and a virtual model associated with an anatomy of the
patient;

identifying an anatomic perimeter at the intersection between the identified reference feature and the virtual model of the
anatomy;

determining an anatomic feature on the virtual model of the anatomy from the intersection of the reference feature and the
virtual model of the anatomy; and

modifying the standard haptic boundary based on at least one anatomic feature to generate a customized haptic boundary.

US Pat. No. 9,587,446

SUBSEA REMOVABLE FLEX JOINT LAYDOWN TOOL

CHEVRON U.S.A. INC., San...

1. A flex joint laydown tool, comprising:
a body comprising:
a first portion; and
a second portion hingedly coupled to the first portion;
at least one flex joint coupling feature disposed on the first portion and the second portion at a proximal end of the body,
wherein the at least one flex joint coupling feature is configured to couple to at least one first laydown tool coupling feature
of a flex joint, wherein the at least one flex joint coupling feature applies pre-tensioning to the flex joint to protect
the flex joint from bending while the first portion and the second portion are coupled to the flex joint;

a riser coupling feature disposed on an inner surface of the first portion and the second portion toward a distal end of the
body, wherein the riser coupling feature is configured to couple with a second laydown tool coupling feature of a riser; and

at least one third laydown tool coupling feature movably coupled to the first portion of the body, wherein the at least one
third laydown tool coupling feature couples to the second portion when the body is in a closed position, wherein the at least
one third laydown tool coupling feature decouples from the second portion of the body to allow the body to move from the closed
position to an open position.

US Pat. No. 9,482,180

THRUST REVERSER SYSTEM

The Boeing Company, Chic...

1. An apparatus comprising:
a sleeve configured to move between a first position and a second position, wherein the sleeve exposes a cascade when in the
second position;

at least one linear electric motor directly connected to the sleeve and configured to move the sleeve between the first position
and the second position, wherein the at least one linear electric motor comprises: a coil system disposed within a base connected
to an engine structure, a member connected to the sleeve, and a magnet system connected to the member and configured to interact
with the coil system to linearly move the member relative to the base to cause the sleeve to move between the first position
and the second position;

a controller configured to control operation of the at least one linear electric motor to move the sleeve between the first
position and the second position; and

a load cell, disposed within the base, configured to send load information to the controller, wherein the controller is further
configured to use the load information to maintain a desired load on the at least one linear electric motor.

US Pat. No. 9,465,529

PLATFORM-INDEPENDENT ENVIRONMENTS FOR CUSTOMIZING USER INTERFACES OF NATIVE APPLICATIONS FOR PORTABLE ELECTRONIC DEVICES

INTUIT INC., Mountain Vi...

1. A computer-implemented method for providing a user interface of a native application for a portable electronic device,
comprising:
providing an environment for customizing the user interface using one or more custom views, wherein the one or more custom
views comprise a set of user-interface components, a layout of the user-interface components, and a configuration of a user-interface
component from the set of user-interface components; and

enabling, via a rendering apparatus within the native application, use of the one or more custom views with the native application
through the environment independently of a platform of the native application.

US Pat. No. 9,088,248

AMPLIFIER AND MOBILE COMMUNICATION DEVICE

Intel Mobile Communicatio...

1. An amplifier comprising:
an amplifier input for receiving an input signal;
an amplifier output for providing an output signal;
a first lower active sub cell and a second lower active sub cell, each comprising an input terminal and an output terminal,
wherein the input terminals of the lower active sub cells are connected to the amplifier input and the output terminals of
the lower active sub cells are not shorted;

a first upper active sub cell and a second upper active sub cell, each comprising a biasing terminal, an input terminal and
an output terminal, wherein the input terminals and the output terminals of the upper active sub cells are coupled between
the output terminals of the lower active sub cells and the amplifier output;

a bias controller configured to provide a first biasing signal to the biasing terminal of the first upper active sub cell
and a second biasing signal to the biasing terminal of the second upper active sub cell in dependence on an output power of
the output signal; and

a coupling impedance which is connected between the output terminals of the lower active sub cells.

US Pat. No. 9,138,154

APPARATUS AND METHOD FOR MEASURING INTRACRANIAL PRESSURE

HEADSENSE MEDICAL LTD., ...

1. An apparatus for measuring intracranial pressure comprising:
a transmitter arranged to transmit a first acoustic signal through a first cranial point;
a receiver arranged to receive a second acoustic signal from a second cranial point, the second acoustic signal comprising:
the first acoustic signal after having travelled from the first cranial point to the second cranial point; and
a third acoustic signal representing particular frequencies of intracranial processes, and
a control circuitry,
wherein said control circuitry is arranged to:
extract from said received second acoustic signal a first set of frequency components, said first set of frequency components
associated with said transmitted first acoustic signal;

extract from said received second acoustic signal a second set of frequency components, said second set of frequency components
associated with the third acoustic signal;

determine intracranial pressure responsive to said extracted first set of frequency components and said extracted second set
of frequency components;

output said determined intracranial pressure;
calculate a mean of peak to peak values of said extracted first set of frequency components;
calculate a mean of standard deviations of a plurality of predetermined portions of said extracted first set of frequency
components;

calculate an average of said calculated first frequency component set peak to peak value mean and said calculated first frequency
component set standard deviation mean;

determine a severity index responsive to said calculated average; and
output an indicator of said determined severity index.

US Pat. No. 9,069,060

CIRCUIT ARCHITECTURE FOR OPTICAL RECEIVER WITH INCREASED DYNAMIC RANGE

Google Inc., Mountain Vi...

1. A circuit comprising:
at least one photosensor, each photosensor comprising an input that is configured to receive an optical signal;
a respective diode coupled to each photosensor, each respective diode comprising an input that is coupled to an output of
the coupled photosensor;

a multiplexer comprising an input that is coupled to the output of each of the at least one photosensor; and
an amplifier comprising an input that is coupled to the output of the multiplexer.

US Pat. No. 9,584,164

DIGITAL INTENSIVE HYBRID ADC/FILTER FOR LNA-FREE ADAPTIVE RADIO FRONT-ENDS

Intel Corporation, Santa...

1. A mixer-first receiver device of a mobile device comprising:
an antenna port configured to receive an analog signal;
a radio-frequency (RF)-frontend coupled to the antenna port and comprising a low noise amplifier free mixer-first front end
configured to selectively filter the analog signal for a bandwidth selection; and

a digital baseband interface coupled to the RF-frontend;wherein the RF-frontend comprises:
a coarse grain component, configured to generate a coarse grain frequency quantization for processing the analog signal to
a digital signal, comprising:

a mixer component, coupled to the antenna port, configured to down-convert the analog signal to a baseband signal and provide
the baseband signal to a signal path; and

a hybrid analog-to-digital converter (ADC) filtering component, coupled to the mixer component via the signal path, comprising
a plurality of switching capacitor arrays having switching capacitor banks configured to adaptively generate a discrete-time
filtering operation of the baseband signal and concurrently generate a conversion of the baseband signal to the digital signal
in a same clock period, based on one or more criteria.

US Pat. No. 9,510,150

INTEGRATING POSITION INFORMATION INTO A HANDHELD TOOL

Trimble Navigation Limite...

1. A method of integrating position information, the method comprising:
determining position data of an object, the position data indicating a location of the object;
recording, in an information management system, the position data of the object;
receiving an indication that the object has been embedded in a structure;
after receiving the indication that the object has been embedded, tagging the object, in the information management system,
as being embedded;

communicating the position data of the embedded object from the information management system to a handheld tool at the worksite;
and

at the worksite, on a display of the handheld tool, electronically displaying:
a real-time image of the structure embedding the object, and
an indication of the communicated position data of the embedded object on the real-time image.

US Pat. No. 9,434,736

COMPOUNDS, COMPOSITIONS AND METHODS OF AGELASTATIN ALKALOIDS

Massachusetts Institute o...

1. A method comprising:
administering to a subject in need thereof a therapeutically effective amount of a compound of formula I:
or a pharmaceutically acceptable salt thereof,
wherein:
R1 is —H or —CH3;

R2 is —OH or —OCH3;

R3 is —H or —OH; and

R4 is —H when R1 is H, or —Br when R1 is —CH3; and

wherein said method treats blood cancer, inhibits growth of blood cancer cells, inhibits proliferation of blood cancer cells,
promotes apoptosis of blood cancer cells, arrests cell cycle in blood cancer cells, or induces arrest in G2/M phase in blood
cancer cells, or any combination thereof.

US Pat. No. 9,396,350

OBJECT-BASED COMMANDS WITH ACCESS CONTROL IDENTIFIERS

Seagate Technology LLC, ...

1. The apparatus comprising:
a processor configured to:
store data as objects, each object including:
a tracking indicator to identify the object;
a data field with a variable size to store user data;
a current access tag metadata field to regulate access to an object;
receive a command including:
an operation directed to an object; and
a specified tracking indicator identifying the object;
an access control identifier used to determine whether to perform the operation, the access control identifier including a
present access tag value corresponding to the current access tag metadata field of the object, and an updated access tag value
to update the current access tag metadata field after modifying the object; compare the present access tag value against the
current access tag metadata field to regulate access to the data by multiple clients to keep the data synchronized;

execute the command when the present access tag value matches the current access tag metadata field; and
change the current access tag metadata field to the updated access tag value after executing the command.

US Pat. No. 9,373,485

APPARATUS AND METHOD FOR IMPROVED DARKSPACE GAP DESIGN IN RF SPUTTERING CHAMBER

Applied Materials, Inc., ...

1. A method for manufacturing a target assembly for use in an RF sputtering chamber comprising:
providing a backing plate having a back surface, a front peripheral face defining an inner peripheral edge and a recessed
area having a shape bounded by the inner peripheral edge;

providing a target having substantially the same shape as the recessed area, the target having an inner surface, a sputterable
target surface and an outer peripheral edge; and

joining the inner surface of the target to the inner peripheral face of the backing plate so that the sputterable target surface
is substantially coplanar with the outer peripheral face, and after joining a vertical darkspace gap comprising a vertical
space is formed between the outer peripheral edge of the target and the inner peripheral edge of the recessed area of the
backing plate.

US Pat. No. 9,219,830

METHODS AND SYSTEMS FOR PAGE AND SPREAD ARRANGEMENT IN PHOTO-BASED PROJECTS

Interactive Memories, Inc...

1. A method of creating a printable product, the method offered by a user device in a client-server environment, the method
comprising:
providing an interface to allow a user to select a plurality of photos at a photo editing area of said user device;
receiving an upload of said plurality of photos from said user device to a server, said server comprising a data repository
for storing said plurality of photos and an engine for analyzing said plurality of photos;

creating an automatic grid preview of a plurality of spreads, each spread comprising one or more photos of said printable
product at said user device, each spread consisting of two opposing pages of the printable product, and wherein said grid
preview is rendered by said server onto said user device;

offering to said user an option of re-arrangement for manually re-arranging said plurality of spreads and said plurality of
photos, wherein each spread or each photo is offered for re-arrangement, wherein a manual re-arrangement over-rides contents
of said grid preview, wherein each spread or each photo is re-arranged by at least dragging at said grid preview a photo from
a first spread to outside of said first spread, and dropping said photo between said first spread and a second spread, wherein
said dropping automatically creates a new third spread comprising two opposing pages and said photo, said new third spread
located between said first spread and said second spread;

sending to a printer an order to print said printable product; and
printing said printable product on paper, wherein after said printable product is printed it becomes a delivery item on behalf
of said user who placed said print order.

US Pat. No. 9,590,850

DISCOVERY OF CONNECTIVITY AND COMPATIBILITY IN A COMMUNICATION NETWORK

Cisco Technology, Inc., ...

1. An apparatus configured for operation in a first network comprising an overlay network for communication among a plurality
of client nodes, the apparatus comprising:
an interface configured to communicate with a node in a second network comprising an underlying network for communication
among a plurality of server nodes, said interface connecting said overlay network to said underlying network;

a processor configured to identify at the apparatus, said interface as a spare interface and advertise said spare interface
to one or more of said client nodes in said overlay network when said spare interface is not in use for communication between
said overlay network and said underlying network, wherein advertising said spare interface comprises transmitting connectivity
information associated with said underlying network and server or client compatibility information for said spare interface
for auto-discovery of said spare interface by said client nodes or a management node; and

memory for storing said connectivity and compatibility information;
wherein said spare interface comprises an interface available to accommodate new services within said overlay network, and
wherein advertisement of said spare interface is used to identify a compatible spare interface in said overlay network and
direct traffic over a network path containing said spare interface.

US Pat. No. 9,563,386

INFORMATION PROCESSING APPARATUS, CONTROL METHOD, AND STORAGE MEDIUM

Canon Kabushiki Kaisha, ...

1. An information processing apparatus comprising:
one or more processors; and
one or more computer-readable media storing instructions that, when executed by the one or more processors, cause the information
processing apparatus to perform operations comprising:

acquiring printer information from a printer;
displaying, by being called from a first print setting screen offered by an operating system, a second print setting screen
offered by a device application based on the printer information, wherein the first print setting screen includes a plurality
of selectable options for a print setting; and

in a case where the first print setting screen is called from the second print setting screen, transmitting, as a response,
capability information based on the printer information, the capability information including information related to an additional
selectable option for the print setting, the additional selectable option different from each of the plurality of selectable
options,

wherein the additional selectable option for the print setting is added to the first print setting screen when the first print
setting screen is displayed based on the capability information transmitted in the transmitting as the response.

US Pat. No. 9,486,774

SYSTEM AND PROCESS FOR THERMOCHEMICAL TREATMENT OF MATTER CONTAINING ORGANIC COMPOUNDS

Institut de recherche et ...

10. A process for the thermochemical treatment of a matter containing organic compounds comprising step a):
a) performing a thermal treatment of said matter in a system according to claim 1, at a residence time of said matter in said thermochemical reaction chamber of about 0.5 seconds to about 10 seconds, and
a feed rate of said matter in said thermochemical reaction chamber of about 0.5 kg/h to about 1.5 kg/h to obtain said solid
separated from said vapor.

US Pat. No. 9,480,647

SINGLE SERVE BEVERAGE POD CONTAINING CANNABIS

CannTrust Inc., Vaughan,...

1. A method of preparing a single-serve container configured for receipt in a single-serve brewing machine, the method comprising:
processing cannabis by pulverizing the cannabis to a particle size that is less than a threshold and by heating the cannabis at a sufficient temperature and for a sufficient time period to decarboxylate the cannabis, the threshold being one millimeter or less than one millimeter;

adding the processed cannabis to the single-serve container;

adding, to the single-serve container, an effective amount of a lipid-rich food-based extraction agent, wherein the extraction
agent is in the form of a powder, is solid at room temperature and provides at least 0.9 grams of fat in the container; and

sealing the single-serve container.

US Pat. No. 9,074,027

DIP-FORMED SYNTHETIC POLYISOPRENE LATEX ARTICLES WITH IMPROVED INTRAPARTICLE AND INTERPARTICLE CROSSLINKS

Ansell Healthcare Product...

1. A synthetic, dip-formed polyisoprene elastomeric condom comprising:
synthetic polyisoprene particles, said synthetic polyisoprene particles bonded to each other through intra-polyisoprene particle
crosslinks and inter-polyisoprene particle crosslinks;

wherein the intra-polyisoprene particle crosslinks and the inter-polyisoprene particle crosslinks are such that the molecular
weight is less than about 8000 g/mol between the crosslinks.

US Pat. No. 9,058,471

AUTHORIZATION SYSTEM FOR HETEROGENEOUS ENTERPRISE ENVIRONMENTS

Oracle International Corp...

1. A computer-implemented method comprising:
storing, in a policy store that is stored within a computer-readable storage memory and utilized by a plurality of applications
in an enterprise, a first authorization policy that specifies features that are used within a first type of authorization
environment;

storing, in the policy store, a second authorization policy that specifies features that are used within a second type of
authorization environment that differs from the first type of authorization environment;

determining that the first authorization policy and the second authorization policy in the policy store are relevant to a
request from an application of the plurality of applications;

performing a union of the first authorization policy, configured for use within the first type of authorization environment,
and the second authorization policy, configured for use within the second type of authorization environment, wherein the second
type of authorization environment is an Oracle Access Manager (OAM) environment, in response to the determining, wherein the
first authorization policy specifies features of a role-based access control (RBAC) model including a role category to which
multiple roles belong, and wherein the second authorization policy specifies features of a discretionary access control (DAC)
model;

evaluating the union of the first policy and the second policy within a policy engine that evaluates both features that are
used within the first type of authorization environment and features that are used within the second type of authorization
environment wherein evaluating the features that are used within the first type of authorization policy comprises determining
whether an access-requesting subject is associated with a particular role that belongs to the role category; and

granting access to at least one resource within the enterprise based on a result of the evaluating.

US Pat. No. 9,620,200

RETENTION VOLTAGES FOR INTEGRATED CIRCUITS

ARM Limited, Cambridge (...

1. An integrated circuit, comprising:
functional circuitry configured to store one or more data bits; and
retention mode circuitry coupled to the functional circuitry and configured to provide a plurality of retention voltages to
the functional circuitry, wherein the retention mode circuitry comprises:

a first circuitry configured to provide a first retention voltage to the functional circuitry, wherein the first circuitry
comprises:

a first diode device; and
a first transistor device, a second diode device, or combinations thereof; and
a second circuitry configured to provide a second retention voltage to the functional circuitry, wherein the second circuitry
comprises a plurality of second transistor devices;

wherein the functional circuitry is configured to be held in a data retention mode when the first retention voltage or the
second retention voltage is provided to the functional circuitry.

US Pat. No. 9,493,560

DUAL VARIABLE DOMAIN IMMUNOGLOBULINS AND USES THEREOF

AbbVie Inc., North Chica...

1. A method for treating a subject for a disease or a disorder in which the activity of IL-17 is detrimental, comprising administering
to the subject a binding protein comprising first and second polypeptide chains, each independently comprising VD1-(X1)n-VD2-C-(X2)n,
wherein
VD1 is a first variable domain;
VD2 is a second variable domain;
C is a constant domain;
X1 is a linker;
X2 is an Fc region;
n is 0 or 1;wherein the VD1 domains on the first and second polypeptide chains form a first functional target binding site and the VD2
domains on the first and second polypeptide chains form a second functional target binding site,
(a) wherein the binding protein is capable of binding IL-17, and wherein the variable domains that form a functional target
binding site for IL-17 comprise CDRs 1-3 from SEQ ID NO: 40 and CDRs 1-3 from SEQ ID NO: 41;

(b) wherein the binding protein is also capable of binding IL-1? or TNF?; and
(c) wherein the disease or disorder is selected from the group consisting of rheumatoid arthritis, osteoarthritis, juvenile
chronic arthritis, septic arthritis, Lyme arthritis, psoriatic arthritis, reactive arthritis, spondyloarthropathy, spondilitis
anklyosans, systemic lupus erythematosus, Crohn's disease, ulcerative colitis, inflammatory bowel disease, psoriasis, sarcoidosis,
uveitis, atopic eczema, scleroderma, and amyotrophic lateral sclerosis.

US Pat. No. 9,434,425

TRACK JOINT ASSEMBLIES

Caterpillar Inc., Peoria...

1. A track joint assembly, comprising:
a first link having a first bore;
a second link having a second bore;
a bushing including:
a first axial end portion having a first outer surface configured to engage with the first bore; and
a second axial end portion having a second outer surface configured to engage with the second bore; and
a seal assembly positioned at an axial end of the first axial end portion, and contacting the first link at a seal-link interface.

US Pat. No. 9,183,247

SELECTION AND DELIVERY OF INVITATIONAL CONTENT BASED ON PREDICTION OF USER INTEREST

Apple Inc., Cupertino, C...

1. A computer-implemented method, comprising:
identifying, via a processor, events completed via a device associated with a user;
based on the events, identifying, via the processor, a sequence of events completed by the device;
comparing, via the processor, the sequence of events completed at the device with predefined sequences of events which result
in respective conversion actions to identify partial sequences of events from the predefined sequences of events corresponding
to at least a portion of the sequence of events completed at the device;

computing, via the processor, scores for the partial sequences of events, each of the scores indicating a proximity of a respective
one of the partial sequences of events to a completion of a conversion action from the respective conversion actions; and

selecting, via the processor, invitational content to deliver to the device based on a highest score from the scores for the
partial sequences of events.

US Pat. No. 9,141,276

INTEGRATED INTERFACE FOR MOBILE DEVICE

iControl Networks, Inc., ...

1. A security system comprising:
a monitoring system that is configured to monitor a premise, the monitoring system including a sensor that is installed at
the premise, the sensor being adapted to sense a status of the premise; and

a mobile device that is provided separately from the monitoring system by a company that is different than a company that
provides the monitoring system, the mobile device including applications that, when run on the mobile device, perform operations
comprising:

performing a synchronization to associate the mobile device with the monitoring system;
based on the synchronization, receiving by the mobile device one or more data communications descriptive of sensor events
detected by the monitoring system at the premise;

displaying, on a display of the mobile device, a status interface area that includes status information related to the monitoring
system based on the received one or more data communications;

displaying, on the display of the mobile device, a control interface area that enables a user to provide user input to control
the monitoring system;

receiving user input defining a control operation for the monitoring system based on the control interface area; and
based on the received user input and the synchronization, sending one or more control communications that cause the monitoring
system to perform the control operation defined by the received user input.

US Pat. No. 9,076,442

METHOD AND APPARATUS FOR ENCODING A SPEECH SIGNAL

LG Electronics Inc., Seo...

1. A method of encoding a speech signal, the method comprising:
obtaining, with a speech encoding apparatus, a linear prediction filter coefficient of a current frame from an input signal
using linear prediction;

obtaining, with the speech encoding apparatus, a quantized spectrum candidate vector of the current frame corresponding to
the linear prediction filter coefficient of the current frame based on first best information;

interpolating, with the speech encoding apparatus, the quantized spectrum candidate vector of the current frame and a quantized
spectrum vector of a previous frame;

generating, with the speech encoding apparatus, weighted input signal using the quantized spectrum candidate vector; and
obtaining, with the speech encoding apparatus, adaptive codebook candidate based on the weighted input signal and second best
information,

wherein the first best information is information about a number of codebook indexes extracted in frame units,
wherein the second best information is information about a number of the adaptive codebook candidate acquired in frame units.

US Pat. No. 9,591,021

ZERO DAY THREAT DETECTION USING HOST APPLICATION/PROGRAM TO USER AGENT MAPPING

McAfee, Inc., Santa Clar...

1. A non-transitory machine readable medium, on which are stored instructions, comprising instructions that when executed
cause a machine to:
intercept by a first device a request for data from a second device by an application, wherein the request identifies a user
agent; and

generate an indication responsive to a determination that a predetermined threshold number of different user agents has been
identified in requests from the application,

wherein the predetermined threshold number is application-specific.

US Pat. No. 9,442,850

EFFICIENT DIRECTORY REFRESH OPERATIONS IN WIDE AREA FILE SYSTEMS

Blue Coat Systems, Inc., ...

7. An apparatus comprising
one or more network interfaces;
a memory;
one or more processors;
computer-readable instructions stored in the memory operable to cause the one or more processors to:
maintain, in a local cache, a cached version of directory contents information of a remote file server; wherein the directory
contents information comprises access control information for one or more files and folders;

in a full directory refresh mode,
request directory contents information of a first folder from the remote file server including access control information;
synchronize the directory contents information received from the remote file server, including the access control information,
with the local cache;

in a partial directory refresh mode,
request directory contents information of a first folder from the remote file server excluding access control information;
synchronize the directory contents information received from the remote file server with the local cache; and
determine whether to enter the partial directory refresh mode or a full directory refresh mode for a given file folder:
in response to a request from a client application for an object within the given file folder; and
based at least upon a plurality of requests since a last full directory refresh for the given file folder.

US Pat. No. 9,603,862

ACTIVATION AND ACTIVATORS OF SIRT5

CORNELL UNIVERSITY, Itha...

1. A method of increasing a deacetylase activity of SIRT5, wherein the method comprises contacting SIRT5 with an agent that
binds SIRT5 and reduces the Km of SIRT5 for a substrate, thereby increasing the deacetylase activity of SIRT5,
wherein the agent is a compound of the formula (I):

wherein R1 and R2 are independently selected from the group consisting of hydrogen, optionally substituted acyl, optionally substituted acyloxy,
trialkylsilyl, optionally substituted alkyl, optionally substituted alkylaryl, phosphate, diphosphate, and triphosphate,

R3 is hydrogen and R4 is hydroxyl, R3 and R4 are fluoro, or R3 is hydrogen and R4 is chloro,

R5, R7, R8, and R9 are independently selected from the group consisting of hydrogen, optionally substituted alkyl, optionally substituted alkenyl,
optionally substituted alkynyl, optionally substituted cycloalkyl, optionally substituted cycloalkylalkyl, optionally substituted
aryl, optionally substituted arylalkyl, F, Cl, Br, I, CF3, optionally substituted alkoxy, optionally substituted aryl, NO2, optionally substituted alkylthio, optionally substituted amino, optionally substituted acylamino, optionally substituted
arylamino, optionally substituted acylthio, optionally substituted acyl, optionally substituted acyloxy, hydroxy, mercapto,
and optionally substituted thioamido, or any of R5 and R6 taken together, R6 and R7 taken together, R7 and R8 taken together, or R8 and R9 taken together, form a 5- or 6-membered saturated or unsaturated ring,

R6 is COR10 or B(OR11)2,

R10 is selected from the group consisting of hydrogen, hydroxy, alkoxy, and aryloxy, and

R11 is hydrogen or C1-C6 alkyl.

US Pat. No. 9,157,058

METHOD AND APPARATUS FOR GROWING MICROBIAL CULTURES THAT REQUIRE GASEOUS ELECTRON DONORS, ELECTRON ACCEPTORS, CARBON SOURCES, OR OTHER NUTRIENTS

Kiverdi, Inc., Berkeley,...

18. A method for growth and maintenance of oxyhydrogen microorganisms and/or bioprocesses using one or more gases as electron
donors, and/or electron acceptors, and/or carbon sources, and/or other nutrients, comprising:
introducing a culture of oxyhydrogen microorganisms and/or extracts of microorganisms into an environment suitable for growing
or maintaining the culture and/or extracts, wherein the culture of oxyhydrogen microorganisms or extract of oxyhydrogen microorganisms
is contained in the liquid phase of an apparatus according to claim 1;

introducing an inorganic or organic carbon compound into the environment so that oxyhydrogen microorganisms and/or extracts
utilize the carbon compound as a carbon source for growth, biosynthesis, or fermentation, or otherwise convert the carbon
source to at least one other organic carbon compound, wherein the biological utilization and/or conversion of the carbon source
by the microorganisms and/or extracts involves at least one of:

uptake of a carbon source utilized by the microorganisms and/or extracts from a gaseous phase; and/or
provision of a gaseous electron donor for the purpose of generating intracellular reducing equivalents or intracellular energy;
and/or

provision of some other nutrient that occurs as a gaseous phase under room temperature and atmospheric pressure; wherein
at least one of the gaseous carbon source, electron donor, electron acceptor, or nutrient is generated chemically and/or thermochemically
and/or electrochemically and/or is taken or derived from an industrial, agricultural, forestry, mining, oil and gas drilling,
or municipal waste stream or pollutant and/or is a gas that naturally occurs or occurs as a pollutant in the earth's atmosphere.

US Pat. No. 9,583,135

LASER MODE HOPPING DETECTION METHOD AND APPARATUS FOR A HEAT-ASSISTED MAGNETIC RECORDING DEVICE

SEAGATE TECHNOLOGY LLC, ...

1. A method, comprising:
performing, using a heat-assisted magnetic recording head, multiple sequential writes to a recording medium;
recording a metric of write performance for each of the writes;
calculating fluctuations in the metric;
detecting whether the head has a laser mode hopping (LMH) problem using the metric fluctuations; and
categorizing a severity of the LMH problem.

US Pat. No. 9,483,340

ESTIMATING BIT ERROR RATE

Juniper Networks, Inc., ...

1. A device, comprising:
one or more processors to:
obtain a first bit error count that identifies a quantity of bit errors that occur in an interval of a bit stream;
determine that the first bit error count indicates that an error burst has occurred,
the first bit error count indicating that an error burst has occurred when the first bit error count identifies a plurality
of bit errors;

determine an estimated bit error rate (BER) for the bit stream based on one or more burst check bit error counts,
the one or more burst check bit error counts being obtained after the first bit error count is obtained and before an amount
of time associated with the interval has elapsed, and

the one or more burst check bit error counts being obtained based on the first bit error count indicating that the error burst
has occurred, and

the one or more burst check bit error counts identifying a quantity of bit errors that occur in a burst check interval after
the first bit error count is obtained; and

selectively perform an action based on whether the estimated BER satisfies a threshold.

US Pat. No. 9,303,963

MECHANICAL BROADHEAD

Nex Gen Crossbows, Inc., ...

7. A mechanical broadhead for an arrow shaft comprising
an elongated body having a leading end and a trailing end, terminating in a threaded rod at the trailing end and defining
a plurality of longitudinally extending slots substantially parallel to longitudinal axis of the elongated body but offset
therefrom;

a faceted penetrating tip mounted to the elongated body at the leading end;
a cutting blade pivotably mounted to the elongated body in each said longitudinally extending slot and pivotable from a folded
position to an extended position; and

an elastomeric retainer engaging each cutting blade and urging the cutting blade into the longitudinally extending slot;
each cutting blade having a minor cutting edge, a major cutting edge, and a grab hook at the distal end of the minor cutting
edge; the major cutting edge being received within the longitudinally extending slot when the cutting blade is in the folded
position and the minor cutting edge together with the major cutting edge defining an acute angle therebetween and wherein
each said cutting blade has a pointed, sharp-edged configuration and comprises a deltoid head portion and a stem portion unitary
with the head portion.

US Pat. No. 9,136,266

GATE OXIDE QUALITY FOR COMPLEX MOSFET DEVICES

GLOBALFOUNDRIES Inc., Gr...

1. A method of forming a semiconductor device, comprising:
forming a silicon germanium layer on a surface of a semiconductor substrate, the silicon germanium layer having an upper surface;
forming at least one insulating material layer on an entire upper surface of said silicon germanium layer;
thereafter performing an annealing process;
removing said at least one insulating material layer for exposing the entire upper surface of said silicon germanium layer;
and

forming a gate dielectric material layer on said exposed the entire upper surface of said silicon germanium layer.

US Pat. No. 9,123,661

SILICON CONTAINING CONFINEMENT RING FOR PLASMA PROCESSING APPARATUS AND METHOD OF FORMING THEREOF

LAM RESEARCH CORPORATION,...

1. A method of forming a silicon containing confinement ring for a plasma processing apparatus useful for processing a semiconductor
substrate, the method comprising:
inserting silicon containing vanes into grooves formed in a grooved surface of an annular carbon template wherein the grooved
surface of the annular carbon template includes an upwardly projecting step at an inner perimeter thereof wherein each groove
extends from the inner perimeter to an outer perimeter of the grooved surface;

surrounding the step of the grooved surface with an annular carbon member wherein the annular carbon member covers an upper
surface of each silicon containing vane in each respective groove;

depositing silicon containing material on the annular carbon template, the annular carbon member, and exposed portions of
each silicon containing vane thereby forming a silicon containing shell of a predetermined thickness;

removing a portion of the silicon containing shell; and
removing the annular carbon template and the annular carbon member from the silicon containing shell leaving a silicon containing
confinement ring wherein the silicon containing vanes are supported by the silicon containing shell of the silicon containing
confinement ring.

US Pat. No. 9,582,620

METHOD AND SYSTEM FOR AUTOMATED REFINED EXCLUSION OF ENTITIES FROM A METRIC DRIVEN VERIFICATION ANALYSIS SCORE

CADENCE DESIGN SYSTEMS, I...

1. A method for exclusion of entities from a coverage score, the method comprising:
using a processor,
receiving from a user via an input device, a selection of an entity for exclusion in a device under test (DUT) model, the
DUT model including entities of one or a plurality of coverage metric-driven entity types;

identifying in the DUT model entities of a same coverage metric driven entity type of said one or a plurality of coverage
metric driven entity types that are logically linked to the user selected entity;

excluding all instances of the selected entity and all instances of the identified entities that are logically linked to the
selected entity in the DUT model; and

calculating a coverage score on the DUT model with the excluded instances of the selected and identified entities.
US Pat. No. 9,359,609

METHODS FOR TREATMENT OF ALPORT SYNDROME

Regulus Therapeutics Inc....

1. A method of treating Alport Syndrome comprising administering to a subject having or suspected of having Alport Syndrome
a pharmaceutical composition comprising a therapeutically effective amount of a modified oligonucleotide consisting of 19
linked nucleosides and having the structure 5?-AECSATCSAGTCSTGAUSAAGCSTAE-3? (SEQ ID NO: 3), where nucleosides not followed by a subscript are ?-D-deoxyribonucleosides; nucleosides followed by a
subscript “E” are 2?-MOE nucleosides; nucleosides followed by a subscript “S” are S-cEt nucleosides, and each internucleoside
linkage is a phosphorothioate internucleoside linkage.

US Pat. No. 9,072,748

BCL-2-SELECTIVE APOPTOSIS-INDUCING AGENTS FOR THE TREATMENT OF CANCER AND IMMUNE DISEASES

AbbVie Inc., North Chica...

1. A compound having formula II
or a therapeutically acceptable salt thereof,wherein
R100 is absent;

n is 0;
A1 is N or C(A2);

one or two or three or each of A2, B1, D1 and E1 are independently selected R1, OR1, SR1, SO2R1, NHC(O)R1, NHR1, N(R1)2, or —C(O)NHR17, and the remainder are independently selected H, F, Cl, Br, or I;

Y1 is H, CN, NO2, F, Cl, Br, I, CF3, R17, NHC(O)R17, or C(O)NH2;

R1 is R2, R3, R4 or R5;

R2 is phenyl;

R3 is heteroaryl;

R4 is cycloalkyl, cycloalkenyl, heterocycloalkyl or heterocycloalkenyl, each of which is unfused or fused with R4A; R4A is cycloalkane;

R5 is alkyl, or alkynyl, each of which is unsubstituted or substituted with one or two or three independently selected R6, R7, OR7, SR7, SO2R7, N(R7)2, OH, CN, CF3, F, Cl, Br or I substituents;

R6 is C2-C5-spiroalkyl;

R7 is R8, R9, R10 or R11;

R8 is phenyl which is unfused or fused with R8A;

R8A is heterocycloalkane;

R9 is heteroaryl;

R10 is C3-C10-cycloalkyl, having one or two CH2 moieties unreplaced or replaced with independently selected O, S(O), SO2 or NH and one or two CH moieties unreplaced or replaced with N;

R11 is alkyl, which is unsubstituted or substituted with one or two or three independently selected OR12, F, Cl, Br or I substituents;

R12 is R16;

R16 is alkyl;

R17 is R19 or R21;

R19 is heteroaryl which is unfused or fused with arene, heteroarene or R19A; R19A is cycloalkane, cycloalkene, heterocycloalkane or heterocycloalkene;

R21 is alkynyl;

R30 is cycloalkyl, having two CH2 moieties unreplaced or replaced with NH;

R37 is R38, R39 or R40, each of which is substituted with F, CI, Br, I, NHR41, or R41;

R38 is phenyl;

R39 is heteroaryl;

R40 is C3-C8-cycloalkyl or C4-C8-cycloalkenyl, each having one or two CH2 moieties unreplaced or replaced with independently selected O, C(O), CNOH, CNOCH3, S, S(O), SO2 or NH;

R41 is R42, R43, or R44;

R42 is phenyl;

R43 is heteroaryl;

R44 is C3-C9-cycloalkyl or C4-C7-cycloalkenyl, each having one or two CH2 moieties unreplaced or replaced with independently selected NH and one or two CH moieties unreplaced or replaced with N, and
each of which is unfused or fused with R44A; R44A is cycloalkane;

wherein moieties represented by R2, R3, R4, R4A, R6, R8, R8A, R9, R10, R19, R30, R38, R39, R40, R42, R43, R44, and R44A are independently unsubstituted, further unsubstituted, substituted or further substituted with one or two or three or four
or five independently selected R50, OR50, SR50, S(O)R50, SO2R50, C(O)R50, CO(O)R50, NH2, NHR50, C(O)NH2, C(O)N(R50)2, SO2N, OH, (O), CN, CF3, OCF3, Cl, Br or I substituents;

R50 is R51, R52, R53 or R54;

R51 is phenyl which is unfused or fused with arene, heteroarene or R51B; R51B is heterocycloalkane;

R52 is heteroaryl;

R53 is C3-C6-cycloalkyl, having one or two CH2 moieties unreplaced or replaced with independently selected O, and one or two CH moieties unreplaced or replaced with N;

R54 is alkyl, which is unsubstituted or substituted with one or two or three independently selected R55, OR55, N(R55)2, OH, CN, F, Cl, Br or I substituents; and

R55 is alkyl or phenyl;

wherein the alkyl is unsubstituted or substituted with OCH3.

US Pat. No. 9,483,477

AUTOMATED DATA INTAKE SYSTEM

SAS Institute Inc., Cary...

1. A non-transitory computer-readable medium having stored thereon computer-readable instructions that when executed by a
computing device control the computing device to:
automatically read a registry file,
wherein the registry file includes a plurality of filename parameters,
wherein each filename parameter of the plurality of filename parameters identifies a matching filename pattern,
wherein an extract script indicator and a read file indicator are associated with each filename parameter,
wherein the extract script indicator indicates an extract script for a file having a filename that matches the matching filename
pattern,

wherein the read file indicator indicates how to read the file having the filename that matches the matching filename pattern;
automatically determine whether unprocessed source data is stored in a predefined directory;
based upon determining that unprocessed source data is stored in the predefined directory,
automatically select a source file from the unprocessed source data;
automatically select one parameter of the plurality of filename parameters read from the registry file by matching a filename
of the selected source file to the matching filename pattern of the one parameter;

determine whether the selected source file is expected based on a time parameter read from the registry file in association
with the selected one parameter;

based upon determining that the selected source file is not expected based on the time parameter, update an error status file
to include a first error message;

automatically select the extract script based on the extract script indicator associated with the selected one parameter;
automatically read data from the selected source file using the selected extract script and using the read file indicator
associated with the selected one parameter; and

automatically output the read data to a different file than the source file;
determine whether a trigger file for the selected source file is stored in the predefined directory; and
based upon determining that the trigger file for the selected source file is stored in the predefined directory,
read the trigger file to define a data integrity test value for the selected source file;
perform an integrity test by comparing the defined data integrity test value to a test value determined from the read data;
determine whether the performed integrity test fails; and
based upon determining that the performed integrity test fails, update the error status file to include a second error message.

US Pat. No. 9,061,274

METHOD AND APPARATUS FOR TESTING A CATALYST MATERIAL

Catagen Limited, Belfast...

1. A method of ageing a catalyst material comprising:
(a) providing a gaseous stream comprising a background gas mix;
(b) adding at least one pure hydrocarbon gas and an oxygen-containing gas to the gaseous stream to provide a combined stream;
(c) passing the combined stream through the catalyst material; and
(d) re-circulating greater than or equal to 50% by volume of an exit stream from the catalyst material into the gaseous stream:
(e) providing in (b) a balanced mix of said at least one pure hydrocarbon gas and an oxygen-containing gas to maintain the
concentrations of the gases of said background gas mix in the re-circulated exit stream; and

(f) heating said gaseous stream without combustion.
US Pat. No. 9,441,225

COMPOSITIONS AND METHODS FOR INHIBITING EXPRESSION OF FACTOR V

Alnylam Pharmaceuticals, ...

1. An isolated double-stranded ribonucleic acid (dsRNA) compound comprising a sense strand and an antisense strand, wherein
the nucleotide sequence of the sense strand comprises the nucleotide sequence of SEQ ID NO: 3 and the nucleotide sequence
of the antisense strand comprises the nucleotide sequence of SEQ ID NO: 4, respectively.

US Pat. No. 9,179,978

ORGANIZER FOR SURGICAL TOOLS AND ITEMS USED DURING SURGERY

Lawrence M. Richman, Los...

1. An organizer for holding surgical instruments comprising:
a tray having an upper surface;
a plurality of indentations in the tray forming instrument wells having a shape corresponding to the outer shape of surgical
instruments;

each instrument well configured to have a depth corresponding to the height of a stack of a predetermined number of such instruments,
at least one instrument well being deeper than at least one other instrument well;

wherein the depth of each instrument well holds a predetermined number of a particular tool, the organizer further comprising
at least one first locking bar at the upper surface of the tray and mounted for movement between a first position covering
a portion of a first instrument well to a second position uncovering the first instrument well, the first instrument well
having at least one shoulder extending away from the first instrument well, the shoulder being positioned a distance below
the upper surface of the tray such that the first locking bar is aligned with the upper surface when the first instrument
well contains the predetermined number of a particular tool, the first locking bar being out of alignment with the upper surface
when the first instrument well contains fewer or more than the predetermined number of a particular tool; and

wherein the first locking bar is pivotably mounted on a pin, the first locking bar having a short section extending from the
pin and a longer section opposite the short section, the pin acting as a fulcrum and projecting the short section of the first
locking bar above the pin when the first locking bar is returned to first position and its corresponding instrument well contains
fewer than the predetermined number of a particular tool.

US Pat. No. 9,135,290

ANALYZING TIME VARIATIONS IN A DATA SET

BeyondCore, Inc., San Ma...

1. A method for identifying causes of time variations in a data set for a process, the method comprising a computer system
automatically performing the following:
processing a data set containing observations of the process taken at different times, the observations expressed as values
for a plurality of variables and for the outcome, wherein processing the data set determines behaviors for different variable
combinations at different times with respect to the outcome, the variable combinations defined by values for one or more of
the variables;

estimating time variations in the contributions of the variable combinations to the outcome, based on time variations in the
behaviors of variable combinations and also based on time variations in populations of the variable combinations; and

reporting time variations based on the estimated time variations for the variable combinations.

US Pat. No. 9,091,463

PULSE TUBE REFRIGERATOR WITH TUNABLE INERTANCE TUBE

The United States of Amer...

1. A tunable pulse tube refrigerator for cryogenic cooling, comprising:
a pulse tube having a cold end and a hot end, for containing a working fluid;
a cold heat exchanger for accepting heat from an external heat source, being in fluid communication with the cold end;
a hot heat exchanger for rejecting heat from the pulse tube refrigerator, being in fluid communication with the hot end;
a pressure wave generator for generating pressure waves in the working fluid;
an inertance tube and a fluid reservoir for causing a phase shift between pressure waves and mass flow in the working fluid,
with the inertance tube having a proximal end for fluidly communicating with the hot heat exchanger and including an aperture
being in a state comprised of either a closed state or an open state, with the open state being for fluidly communicating
the inertance tube with the fluid reservoir;

the inertance tube being coiled in a spiral around an axis; and
a bypass mechanism comprised of a plurality of elongated curved tubes, which are also wound around the axis and are rotatable
about the axis, for sliding over different sections of the inertance tube, respectively, when the curved tubes are rotated
about the axis relative to the inertance tube, for changing the state of the aperture, whereby

the inertance tube has an effective length which can be changed, to thereby change an inertance value which is a function
of the effective length.

US Pat. No. 9,492,392

TAMPER RESISTANT DOSAGE FORMS

PURDUE PHARMA L.P., Stam...

1. A cured shaped pharmaceutical tablet comprising:
(1) at least a first compression shaped and then air cured matrix, wherein said curing is without compression, by heated air
having a temperature of at least about 62° C. for a duration of at least about 5 minutes, said matrix comprising oxycodone
or a pharmaceutically acceptable salt thereof in combination with at least one high molecular weight polyethylene oxide having,
based on rheological measurements, an approximate molecular weight selected from the group consisting of 4,000,000, 7,000,000,
and a combination thereof, and optionally further comprising at least one low molecular weight polyethylene oxide having,
based on rheological measurements, an approximate molecular weight of less than 1,000,000;

(2) optionally a second air cured matrix comprising oxycodone or a pharmaceutically acceptable salt thereof in combination
with at least one low molecular weight polyethylene oxide having, based on rheological measurements, an approximate molecular
weight of less than 1,000,000; and

(3) optionally a coating,wherein, in said tablet:
(i) said oxycodone or pharmaceutically acceptable salt thereof is provided in a dose selected from the group consisting of
10 mg, 15 mg, 20 mg, and 30 mg;

the total combined weight of said low molecular weight polyethylene oxide, if present, and said high molecular weight polyethylene
oxide is at least 79% by weight of the total weight of said tablet, excluding the weight of any coatings; and

said low molecular weight polyethylene oxide, if present, is at least 10% by weight of the total weight of said tablet, excluding
the weight of any coatings; or

(ii) said oxycodone or pharmaceutically acceptable salt thereof is provided in a dose selected from the group consisting of
40 mg, 60 mg, and 80 mg;

the total combined weight of said low molecular weight polyethylene oxide, if present, and said high molecular weight polyethylene
oxide is at least 65% by weight of the total weight of said tablet, excluding the weight of any coatings; and

said low molecular weight polyethylene oxide, if present, is at least 10% by weight of the total weight of said tablet, excluding
the weight of any coatings; and

said tablet provides a dosage form for twice-daily extended release administration of oxycodone or pharmaceutically acceptable
salt thereof.

US Pat. No. 9,470,806

PIEZOELECTRIC ACCELEROMETER

PGS Geophysical AS, Oslo...

1. An accelerometer comprising:
a first piezoelectric element having a first polarization, the first piezoelectric element defines an upper surface;
a second piezoelectric element having a second polarization, the second piezoelectric element defines a lower surface parallel
to the upper surface of the first piezoelectric element, and the first polarization aligned with the second polarization;

a first mounting plate that defines a first aperture;the first and second piezoelectric elements extending through the first aperture such that the first mounting plate transects
the first and second piezoelectric elements, the piezoelectric elements define a first cantilever portion on a first side
of the first mounting plate, and the piezoelectric elements define a second cantilever portion on a second side of the first
mounting plate opposite the first side;
wherein the first mounting plate defines a periphery comprising:
a first arcuate curve portion;
a second arcuate curve portion disposed on opposite first arcuate curve portion;
a first chord connecting a first end of the first arcuate curve portion with a first end of the second arcuate curve portion;
and

a second chord connecting a second end of the first arcuate curve portion with a second end of the second arcuate curve portion.
US Pat. No. 9,585,908

COLLYRIUM COMPOSITION AND METHOD OF USING SAME

Chromaceutical Advanced T...

1. A method comprising:
applying a protective or decontaminating collyrium composition to a fluid, structure or tissue selected from the group consisting
of ocular fluid, eye surfaces, periocular tissues, and contact lenses;

said composition comprising a compound selected from the group consisting of hydroxocobalamin, hydroxo(aquo)cobalamin or a
mixture of hydroxocobalamin and hydroxo(aquo)cobalamin;

wherein said protective or decontaminating collyrium composition deactivates or substantially deactivates or facilitates removal
of irritant gases or reactive pollutant combustion gases for individuals in need thereof.

US Pat. No. 9,580,533

MODIFIED POLYETHYLENE COMPOSITIONS

ExxonMobil Chemical Paten...

1. A branched polyethylene modifier consisting of:
at least 80 mol % ethylene;
a 1-octene comonomer; and
a polyene consisting of 1,9-decadiene,
wherein said branched polyethylene modifier: a) has a g?vis of less than 0.90; b) is essentially gel free; c) has an Mw of 150,000 g/mol or more; d) has an Mw/Mn of 5.0 or more; and
a melt index (ASTM D1238 at 190° C. and 2.16 kg) of 5 dg/min or less.

US Pat. No. 9,320,843

DEVICE AND METHOD FOR MONITORING AN EXTRACORPOREAL BLOOD CIRCUIT FOR THE DETECTION OF AIR BUBBLES

Fresenius Medical Care De...

1. A device for monitoring an extracorporeal blood circuit in which a blood pump is disposed to convey blood, comprising:
an apparatus adapted to detect an occurrence of air bubbles in blood that flows in the extracorporeal blood circuit,
an apparatus adapted to measure a negative pressure in the extracorporeal blood circuit upstream of the blood pump, and
a processing unit programmed to deduce a first defective condition when the apparatus adapted to detect the occurrence of
air bubbles in the extracorporeal blood circuit detects air bubbles and the measured negative pressure is above a predetermined
limit value for the negative pressure, and/or a second defective condition when the apparatus adapted to detect the occurrence
of air bubbles in the extracorporeal blood circuit detects air bubbles and the measured negative pressure is below the predetermined
limit value for the negative pressure,

wherein the first defective condition differs from the second defective condition.

US Pat. No. 10,555,202

METHODS, SYSTEMS, AND COMPUTER READABLE MEDIA FOR MONITORING INTERNET OF THINGS (IOT) DEVICE STATE THROUGH SERVICE CAPABILITY EXPOSURE FUNCTION (SCEF)

Oracle International Corp...

1. A method for monitoring Internet of things (IoT) device state, the method comprising:in a service capability exposure function (SCEF) implemented using at least one processor:
providing a common interface for receiving subscription requests from IoT application servers (ASs) or service capability servers (SCSs) for monitoring state of IoT devices of plural different generation networks;
maintaining, in the SCEF, a database of identifiers of IoT devices of a first-generation network;
providing, in the SCEF, an interface to a subscriber data repository node of the first-generation network;
receiving, via the common interface, a subscription request for subscribing to receive state information regarding an IoT device;
performing a lookup in the database and identifying the subscription request as being associated with an IoT device registered in the first-generation network; and
transmitting, via the interface to the first-generation network, a message to the subscriber data repository node for receiving state information regarding the IoT device.

US Pat. No. 9,588,006

SYSTEMS AND METHODS FOR PRESSURE SENSOR CALIBRATION

InvenSense, Inc., San Jo...

1. A method for calibrating a pressure sensor associated with a mobile device comprising:
determining location information for the mobile device;
receiving reference pressure information from an external source based at least in part on the determined location information;
measuring pressure with the pressure sensor; and
calibrating the pressure sensor using the measured pressure and the reference pressure information; wherein the reference
pressure information and the measured pressure correspond to different time periods.

US Pat. No. 9,589,776

RUGGEDIZED ADVANCED IDENTIFICATION MASS SPECTROMETER

SRI International, Menlo...

1. A dual-ionization mass spectrometer, comprising:
a first mass spectrometer module forming a hard ionization mass spectrometer;
a second mass spectrometer module forming a soft ionization mass spectrometer;
a vacuum ultraviolet light source positioned between the first and second mass spectrometers;
a housing encompassing first and second sets of plates and the light source; and
an inlet positioned to receive a sample of an analyte and provide it to at least one of the first and second modules.

US Pat. No. 9,356,184

SHINGLED SOLAR CELL MODULE

SunPower Corporation, Sa...

1. A method comprising:
providing a silicon solar cell wafer;
scribing one or more scribe lines on the silicon solar cell wafer to define a plurality of rectangular solar cell regions;
applying an electrically conductive adhesive bonding material to portions of a top surface of the solar cell wafer;
supporting a bottom surface of the solar cell wafer on a moving perforated belt and transporting the solar cell wafer with
the perforated belt over a curved portion of a vacuum manifold;

applying a vacuum from the vacuum manifold through the perforated belt to the bottom surface of the solar cell wafer to flex
the solar cell wafer against the curved portion of the vacuum manifold and thereby cleave the solar cell wafer along the scribe
lines to provide a plurality of rectangular solar cell strips each corresponding to one of the rectangular solar cell regions
and each comprising a portion of the electrically conductive adhesive bonding material disposed on its top surface adjacent
a long side;

arranging the plurality of rectangular silicon solar cell strips in line with long sides of adjacent rectangular silicon solar
cell strips overlapping in a shingled manner with a portion of the electrically conductive adhesive bonding material disposed
in between; and

curing the electrically conductive bonding material, thereby bonding adjacent overlapping rectangular silicon solar cell strips
to each other and electrically connecting them in series.