US Pat. No. 9,376,676

METHOD OF BREAKING DOWN BIOLOGICAL MATERIAL

Agency for Science, Techn...

1. A method of breaking down biological material, the method comprising:
providing a sample into a channel disposed on a substrate, the sample comprising the biological material in a liquid;
providing a gas into the channel such that the gas forms an interface with the liquid; and
exciting a transducer attached to the substrate to generate and apply acoustic waves in a plurality of sequential bursts to
the interface to break down the biological material.

US Pat. No. 9,586,884

METAL-DOPED HYDROXYAPATITE CATALYST

Agency for Science, Techn...

1. A method for converting an alcohol to an aldehyde, the method comprising:
contacting an alcohol with a doped hydroxyapatite as a catalyst to form an aldehyde,
wherein the doped hydroxyapatite has been doped with a dopant selected from the group consisting of a metal, a metal oxide,
and mixtures thereof, wherein the metal is a transition metal selected from the group consisting of group 5 transition metals,
group 11 transition metals, and chromium.

US Pat. No. 9,321,630

SENSOR WITH VACUUM-SEALED CAVITY

PGS Geophysical AS, Oslo...

1. An apparatus, comprising:
a substrate that includes a vacuum-sealed cavity;
a support structure situated on the substrate; and
an acoustic pressure sensor situated on the support structure;
wherein the support structure includes:
a first dielectric layer situated on the substrate;
a silicon layer situated on the first dielectric layer; and
a second dielectric layer situated on the silicon layer.

US Pat. No. 9,506,946

FULLY DIFFERENTIAL CAPACITIVE ARCHITECTURE FOR MEMS ACCELEROMETER

PGS Geophysical AS, Oslo...

1. A method, comprising:
towing a streamer behind a survey vessel in a body of water, wherein the streamer includes an accelerometer;
detecting, by at least four capacitors within the accelerometer, a change in acceleration of the accelerometer, wherein:
the four capacitors include a first capacitor and a second capacitor on a first side of a proof mass and a third capacitor
and a fourth capacitor on a second side of the proof mass, and each of the four capacitors includes a respective pair of electrodes;
and

in response to the proof mass moving in a selected direction, a capacitance of the first and second capacitors is operable
to increase, and a capacitance of the third and fourth capacitors is operable to decrease; and

determining an acceleration of the accelerometer based at least in part on the detecting.

US Pat. No. 9,107,617

OBTAINING DATA FOR AUTOMATIC GLAUCOMA SCREENING, AND SCREENING AND DIAGNOSTIC TECHNIQUES AND SYSTEMS USING THE DATA

Agency for Science, Techn...

1. A method of identifying an optic cup in a fundus image, the method comprising:
performing a plurality of optic cup identification algorithms to obtain respective preliminary estimates of a position of
the optic cup;

estimating a centre of the optic cup;
for each of a number of angular positions about the centre of the optic cup combining the estimates of the position of the
optic cup to form an improved estimate of the position of the optic cup, by a fusion algorithm dependent upon the angular
position.

US Pat. No. 9,423,395

FLUORESCENT CELL CYCLE PROBE HAVING M-PHASE SPECIFICITY

National University of Si...

1. A compound having the structure of Formula (I) or a pharmaceutically acceptable salt thereof:
wherein:
R1 is (C6-C10)aryl or (C3-C12)heteroaryl, optionally substituted at any position with one or more substituents independently selected from (C1-C 10)alkyl, —O(C1-C6)alkyl, (C2-C6)alkenyl, (C6-C10)aryl, —O(C6-C10)aryl, —S(C1-C10)alkyl, —O(benzyl), (C3-C8)heteroaryl, halo, hydroxyl, —NR3R4, nitro or —O(C2-C6)alkenyl;

further wherein each —O(C1-C6)alkyl, (C2-C6)alkenyl, —O(C6-C10)aryl, —O(benzyl) or (C3-C8)heteroaryl is optionally substituted at any position with one or more substituents independently selected from halo, (C6-C10)aryl, (C1-C10)alkyl or —O(C1-C 6)alkyl;

R2 is (C1-C6)alkyl or (C3-C8)cycloalkyl, optionally and independently substituted with one or more substituents selected from —NR5R6, hydroxyl, halo or —O(C1-C6)alkyl; and

R3, R4, R5, and R6, if present, are independently selected from H, (C1-C 6)alkyl, (C6-C10)aryl, (C1-C6)hydroxyalkyl, or are taken together to form a (C3-C 7)heterocycle.

US Pat. No. 9,220,264

MULTIMERIC FORMS OF ANTIMICROBIAL PEPTIDES

Singapore Health Services...

1. A composition or a combination comprising at least one multimer comprising the formula (U)2KK, wherein U comprises SEQ ID NO: 2-53 or 57-59; and at least one other active pharmaceutical ingredient.

US Pat. No. 9,481,827

CORE-SHELL NANOPARTICLE AND METHOD OF GENERATING AN OPTICAL SIGNAL USING THE SAME

Agency for Science, Techn...

1. A core-shell nanoparticle having a core comprising a metal fluoride doped with a first sensitizer and a shell surrounding
the core, wherein the shell comprises
a) a first layer comprising the metal fluoride doped with a second sensitizer and a first activator, and
b) a second layer comprising the metal fluoride doped with a third sensitizer and a second activator,wherein the first activator and the second activator are different, and each is independently selected from the group consisting
of Tm3+, Ho3+, and combinations thereof.

US Pat. No. 9,267,949

ALKYLAMINO BODIPY DYES AS SELECTIVE FLUORESCENT PROBES FOR PROTEINS AND MOUSE EMBRYONIC STEM CELLS

National University of Si...

1. A compound represented by structural Formula (I) or pharmaceutically acceptable salts thereof:

wherein:
Ar is

each R is independently selected from H, OH, halogen, nitro, amino, (C1-C6)alkyl, (C?O)(C1-C6)alkyl, (C?O)H, (C?O)O(C1-C6)alkyl, NH(C?O)(C1-C6)alkyl, OCF3, CH?CH(C0-C6)alkyl aryl, O(C2-C6)alkenyl, (C0-C6)alkylCH?O, O(C1-C6)alkyl, S(C1-C6)alkyl, S(C1-C6)haloalkyl, O(C1-C6)haloalkyl, OCHF2, O(C1-C6)alkylamino, (C6-C10)aryl, (C5-C10)heteroaryl, (C5-C10)heterocyclyl, (C1-C6)alkyl aryl, O(C0-C6)alkyl aryl, O(CH2)mCHCH2 or 2-5-membered polycyclyl ring fused to Ar, creating a polycyclic ring system, wherein each 2-5-membered polycycle optionally
and independently contains 1-2 ring heteroatoms selected from oxygen, nitrogen and sulfur;

n is 1, 2, 3 or 4;
m is 0, 1, 2, 3 or 4;
wherein, when n is 2 or greater, the R substituents may be optionally taken together to form a fused polycyclic aromatic ring
system;

and wherein each R is optionally substituted with 1-4 R2 substituents independently selected from:

H, (C1-C6)alkyl, halo(C1-C6)alkyl, hydroxy(C1-C6)alkyl, (C6-C10)aryl, halo(C6-C10)aryl, hydroxy(C6-C10)aryl, O(C1-C6)alkyl, O(C1-C6)haloalkyl, (C3-C8)cycloalkyl, halo(C6-C10)aryl(C1-C6)alkoxy, halogen, amino, (C1-C6)alkoxy(C6-C10)aryl(C1-C6)alkoxy, nitro, hydroxy, (C0-C6)alkyl(C6-C10)aryl(C0-C6)alkoxy, (C5-C10)heterocycle, OCF3, O(C1-C6)alkylamino, (C6-C10)aryl(C2-C6)alkenyl, (C2-C6)alkenyl(C1-C6)alkoxy, (C1-C6)sulfoxy, (C?O)O(C1-C6)alkyl or N(CH3)(C1-C6)OH;

R1 is H, C?O(C0-C6)haloalkyl, C?O(C0-C6)alkyl, C?O(C0-C6)alkylene or C?O(C6-C10)aryl.

US Pat. No. 9,169,223

FUNCTIONALISED ANTIFOULING COMPOUNDS AND USE THEREOF

Agency for Science, Techn...

1. A compound of formula (I?) or a salt thereof:

wherein
R2 is


wherein each of RA1, RA2, RA3, RA4 and RA5 is independently selected from OH, RS1OH, ORS2, RS1ORS2, OC(O)H, OC(O)RS2, RS1OC(O)H, RS1OC(O)RS2, C(O)OH, C(O)ORS2, RS1C(O)OH, RS1C(O)ORS2, ORS1OH, ORS1ORS2, ORS1OC(O)H, ORS1OC(O)RS2, ORS1C(O)OH, ORS1C(O)ORS2, H and RS2,

wherein, if present, each Rs1 is independently optionally substituted C1 to C5 alkylene, and

wherein, if present, each RS2 is independently selected from optionally substituted C1 to C5 alkyl, C2 to C5 alkenyl and C1 to C5 alkylsilyl-C1 to C5 alkylene, with the proviso that at least one of RA1, RA2, RA3, RA4 and RA5 is not H or RS2, and

R1 is selected from an unsubstituted saturated C3 to C5 alkyl and an unsubstituted C3 to C10 alkenyl; and

R3 and R4 together with the nitrogen atom to which they are attached form an optionally substituted 6-membered heterocycle having the
structure:


wherein R5 and R6 are independently selected from hydroxyl, optionally substituted C1 to C6 alkyl, optionally substituted phenyl and H.

US Pat. No. 9,423,396

BODIPY STRUCTURE FLUORESCENCE PROBES FOR DIVERSE BIOLOGICAL APPLICATIONS

National University of Si...

1. A compound represented by structural Formula (I) or pharmaceutically acceptable salts thereof:
wherein:
R1 is hydrogen or -COR3;

R2 is (C6-C16)aryl, (C3-C10)heteroaryl, (C1-C6)alkyl, (C1-C6)cycloalkyl, (C2-C6)alkenyl, or C?CH;

R2 is optionally substituted with 1-5 substituents independently selected from (C1-C6)alkyl, halogen, amino, cyano, —COOH, halo(C1-C6)alkyl, hydroxy(C0-C6)alkyl, (C6-C10)aryl, (C3-C10)heteroaryl, halo(C6-C10)aryl, hydroxy(C6-C10)aryl, (C1-C6)alkoxy, halo(C1-C6)alkoxy, (C6-C16)aryloxy, (C3-C8)cycloalkyl, halo(C6-C10)aryl(C1-C6)alkoxy, (C1-C6)alkoxy(C6-C10)aryl(C1-C6)alkoxy, nitro, (C0-C6)alkyl(C6-C10)aryl(C0-C6)alkoxy, (C5-C10)heterocycle, —OCHF2, —OCF3, —SCF3, —OBn, cyano(C1-C6)alkylene, (C1-C6)alkoxyamino, (C6-C10)aryl(C2-C6)alkenyl, (C2-C6)alkenyl(C1-C6)alkoxy, (C2-C6)alkenyl, (C2-C6)alkenyl(C6-C10)aryl, —N((C0-C6)alkyl)((C1-C6)alkyl), —N((C1-C6)alkyleneOH)((C1-C6)alkyleneOH), —N((C0-C6)alkyl)((C1-C6)alkyleneOH), —N((C1-C6)alkyleneOCO(C1-C6)alkyl)((C1-C6)alkyleneOCO(C1-C6)alkyl), —NCO(C1-C6)alkyl, —NPh2, —OPh(halogen)0-3, —OPhO(C1-C6)alkyl, —OPhO(C1-C6)alkyl, —OCO(C1-C6)alkyl, —OCO(C1-C6)alkoxy, —O(C1-C6)alkyl(C6-C10)aryl, —O(C2-C6)alkenyl, —O(C2-C6)alkyleneN(CH3)2, (C0-C6)alkylCOO(C1-C6)alkyl, —B(OH)2 or —S(C1-C6)alkyl;

and wherein any of the substituents selected from (C1-C6)alkyl, (C1-C6)alkoxy, (C6-C10)aryl, (C6-C16)aryloxy or (C5-C10)heteroaryl is further optionally substituted with 1-4 substituents selected from halogen, (C1-C6)alkyl, halo(C1-C6)alkyl, amino, nitro, cyano, hydroxy(C0-C6)alkyl, (C1-C6)alkoxy, —COO(C0-C6)alkyl, or —CHO; and

R3 is (C1-C15)alkyl, (C2-C15)alkenyl, (C2-C15)alkynyl, (C6-C10)aryl or (C5-C10)heteroaryl, wherein R3 is optionally substituted with 1-4 substituents independently selected from halogen, amino, cyano or hydroxyl.

US Pat. No. 9,329,339

PLASMONIC DETECTOR AND METHOD FOR MANUFACTURING THE SAME

AGENCY FOR SCIENCE, TECHN...

1. A plasmonic detector comprising:
two nanoscale metallic rods coupled to a bias voltage;
a nanoscale cavity formed between adjacent ends of the two nanoscale metallic rods; and
an absorption material disposed in the nanoscale cavity for converting an electromagnetic field to an electric current for
outputting via the nanoscale metallic rods.

US Pat. No. 9,240,362

LAYER ARRANGEMENT AND A WAFER LEVEL PACKAGE COMPRISING THE LAYER ARRANGEMENT

Agency for Science, Techn...

1. A layer arrangement comprising:
a getter layer provided on a support substrate; and
a sacrificial layer disposed substantially over the getter layer;
wherein the sacrificial layer has a negative Gibbs free energy of formation of oxide higher than the getter layer.

US Pat. No. 9,201,014

DEVELOPMENT OF PHOTOSTABLE NEAR-IR CYANINE DYES FOR IN VIVO IMAGING

National University of Si...

1. A compound represented by the following structural formula:
wherein X is iodo.

US Pat. No. 9,058,934

METHOD OF FORMING A VDF OLIGOMER OR CO-OLIGOMER FILM ON A SUBSTRATE AND AN ELECTRICAL DEVICE COMPRISING THE VDF OLIGOMER OR CO-OLIGOMER FILM ON THE SUBSTRATE

Agency for Science, Techn...

1. A method of forming a VDF oligomer or co-oligomer film on a substrate, the method comprising:
forming a VDF oligomer or co-oligomer precursor solution;
depositing the VDF oligomer or co-oligomer precursor solution onto the substrate to form a preliminary VDF oligomer or co-oligomer
film on the substrate; and

applying uniaxial pressure on the preliminary VDF oligomer or co-oligomer film and the substrate at an elevated temperature
in the range of 80° C.-135° C. to form the VDF oligomer or co-oligomer film on the substrate.

US Pat. No. 10,045,343

DIGITAL AUTO FREQUENCY CONTROL FOR A GENERAL PURPOSE IF SUBSYSTEM WITH MULTI-MODULATION SCHEMES

Agency for Science, Techn...

1. A method for automatic frequency control (AFC) without bit timing recovery comprising: normalizing each sample of binary elements of a received signal to an input amplitude of the each sample by bit shifting the each sample of the binary elements or by truncating the each sample of the binary elements to enhance a dynamic range of the binary elements; and calculating a frequency discrimination for the each sample of the binary elements and a moving average of the binary elements of the received signal in an adaptive control loop until the AFC converges, wherein the adaptive control loop tracks loop gain by: utilizing multiple estimations of a carrier frequency offset (CFO) estimation, adjusting the loop gain in response to the estimated CFO, and repeating the estimating and adjusting steps until accurate correction is achieved.

US Pat. No. 9,327,303

MICROFLUIDIC DROPLET GENERATOR

Agency for Science, Techn...

1. A microfluidic droplet generator device comprising:
a substrate;
a microfluidic channel formed in the substrate;
a fluid outlet in fluid communication with the microfluidic channel;
a mechanical element configured such that vibration of the mechanical element causes droplet dispensing from the fluid outlet;
and

a medium member disposed to isolate the mechanical element from direct contact with a dispensing fluid,
wherein the medium member comprises a fluid medium;
a vibrational element coupled to the mechanical element for vibrating the mechanical element; and
wherein the mechanical element is associated with the microfluidic channel.

US Pat. No. 9,169,171

AROMATIZATION OF METHANE WITH COMBINATION OF CATALYSTS

Agency for Science, Techn...

1. A method comprising:
contacting a heated reaction gas comprising methane with a first catalyst and a second catalyst to catalyze production of
an aromatic hydrocarbon,

wherein said first catalyst is more active than said second catalyst for catalyzing aromatization of methane, and said second
catalyst is more active than said first catalyst for catalyzing aromatization of ethane, and

wherein said heated reaction gas initially contacts said first catalyst before contacting said second catalyst, wherein said
first catalyst is a MCM-22 zeolite modified by molybdenum, and said second catalyst is a ZSM-5 zeolite modified by molybdenum,
and wherein said aromatic hydrocarbon comprises benzene.

US Pat. No. 9,513,294

MEGASTOKES AMINO-TRIAZOLYL-BODIPY COMPOUNDS AND APPLICATIONS TO LIVE NEURON STAINING AND HUMAN SERUM ALBUMIN FA1 DRUG SITE PROBING

National University of Si...

1. A compound having the structure of Formula (I) or a pharmaceutically acceptable salt thereof:

wherein:
R1 is H or CO(C1-C6)alkyl, wherein CO(C1-C6)alkyl is optionally substituted at any position with 1-3 substituents selected from halogen, hydroxyl, O-acetyl, NH-acetyl,
or —NH2;

R2 and R3 are each, independently, H, (C1-C10)alkyl, (C6-C10)aryl(C0-C6)alkyl, (C3-C10)heteroaryl, (C3-C8)cycloalkyl, (C2-C10)alkynyl or (C2-C10)alkenyl;

wherein (C1-C10)alkyl, (C6-C10)aryl(C0-C6)alkyl, (C3-C10)heteroaryl, (C3-C8)cycloalkyl, (C2-C10)alkynyl and (C2-C10)alkenyl are optionally substituted at any position with 1-5 substituents selected from (C1-C6)alkyl, (C1-C6)alkoxy, NH2, —NH(C1-C6 alkyl), —NH(CO)(C1-C6 alkyl), —NH(CO)(C1-C6 haloalkyl), —NH(CO)(C1-C6 alkoxy), —NH(CO)(C1-C6 haloalkoxy), —NH(CO)(C2-C6 alkenyl), —Si(C1-C6 alkyl), —SO2(C1-C6 alkyl), —SH, —B(OH)2, —OTosyl, —CO(C1-C6 alkoxyl), —COH, —COOH, —CO(C1-C6 alkyl) or halogen;

or R2 and R3 are taken together to form a ring, wherein the ring is optionally substituted with 1-5 additional substituents selected from
halogen or (C1-C6)alkyl; and

R4 is (C1-C10)alkyl, (C3-C8)cycloalkyl, (C6-C10)aryl, (C2-C10)alkenyl, (C2-C10)alkynyl, or (C3-C10)heteroaryl, further wherein R4 is optionally substituted at any position with 1-5 substituents selected from (C1-C10)alkyl, (C2-C10)alkenyl, (C2-C10)alkynyl, (C3-C8)cycloalkyl, (C1-C6)alkoxy, (C6-C10)aryloxy, (C6-C10)aryl, amino, —NH(CO)(C1-C6 alkyl), —NH(CO)(C2-C6 alkenyl), —NH(CO)(C2-C6 alkynyl), —NH(CO)(C1-C6 haloalkyl), halo, OCF3, CF3, hydroxyl, or a halogen radioisotope.

US Pat. No. 9,172,351

PIEZOELECTRIC RESONATOR HAVING ELECTRODE FINGERS WITH ELECTRODE PATCHES

Agency for Science, Techn...

12. A piezoelectric resonator, comprising:
a piezoelectric substrate;
a first electrode comprising a first plurality of electrode fingers;
a second electrode comprising a second plurality of electrode fingers, wherein the first electrode and the second electrode
are disposed over a first surface of the piezoelectric substrate; and

a third electrode disposed over a second surface of the piezoelectric substrate, wherein the third electrode is a contiguous
electrode layer covering the second surface of the piezoelectric substrate,

wherein the first plurality of electrode fingers and the second plurality of electrode fingers are interdigitated, and
wherein electrode patches are arranged along the first plurality of electrode fingers and the second plurality of electrode
fingers according to a two-dimensional lattice.

US Pat. No. 9,334,324

PODOCALYXIN-LIKE-PROTEIN-1 BINDING ANTIBODY MOLECULE

Agency for Science, Techn...


wherein the dimerization domain is selected from a helix-turn-helix (HTH) motif, a coiled-coil motif, or an EF hand motif;
and wherein the antibody molecule is a cytotoxic antibody molecule.

US Pat. No. 9,236,078

RECORDING MEDIUM FOR HEAT-ASSISTED-MAGNETIC-RECORDING (HAMR) AND METHOD FOR MANUFACTURING THE SAME

Agency for Science Techno...

1. A method for manufacturing a recording medium for heat-assisted-magnetic-recording (HAMR), the method comprising:
forming an underlayer on a substrate, the underlayer comprising a precursor material, wherein the precursor material comprises
a copper nitride-based material or a nitride-based copper alloy;

epitaxially depositing an interlayer on the underlayer;
forming a recording layer over the interlayer; and
decomposing the precursor material to a converted material having a thermal conductivity that is higher than a thermal conductivity
of the recording layer.

US Pat. No. 9,166,568

LOW POWER HIGH RESOLUTION SENSOR INTERFACE

Agency for Science, Techn...

1. A sensor interface circuit for resolving sensor signals from a plurality of sensors into a digital sensor signal, the sensor
interface circuit comprising:
a relaxation oscillator for receiving and pre-processing the sensor signals to generate an analog sensor signal, the relaxation
oscillator comprising one or more dynamic circuits; and

a monitoring module for receiving the analog sensor signal and generating the digital sensor signal in response thereto, the
monitoring module comprising:

a fixed frequency generation device for generating a clock signal having a fixed frequency of clock pulses; and
a variable window frequency counting device for determining a number of clock pulses within a variable counting window.
US Pat. No. 9,297,813

TARGETING METABOLIC ENZYMES IN HUMAN CANCER

Agency for Science, Techn...

1. A method for inhibiting cell proliferation of human lung cancer cells or human colon cancer cells in vivo, comprising contacting
the human lung cancer cells or the human colon cancer cells in vivo with an inhibitor of glycine dehydrogenase (GLDC) expression
or activity, wherein the GLDC has a nucleic acid sequence set forth in SEQ ID NO: 1 or an amino acid sequence set forth in
SEQ ID NO: 2, wherein the inhibitor is in an amount effective for inhibiting cell proliferation of the human lung cancer cells
or the human colon cancer cells, and wherein the GLDC inhibitor comprises a small interfering RNA that comprises a nucleotide
sequence selected from the group consisting of SEQ ID NO: 3, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8 and SEQ ID NO: 9.

US Pat. No. 9,215,876

1,3,6-DIOXAZOCAN-2-ONES AND ANTIMICROBIAL CATIONIC POLYCARBONATES THEREFROM

International Business Ma...

1. A compound of formula (1):
wherein
ring positions are numbered 1 to 8,
each R? is hydrogen, and* —CH2-Y? is selected from the group consisting of methyl, ethyl, propyl, butyl, benzyl, and substituted benzyl.
US Pat. No. 9,334,500

METHODS AND PHARMACEUTICAL COMPOSITIONS FOR TREATING CANCER

Agency for Science, Techn...

1. A method of treating cancer comprising administering an ubiquitin associated and SH3 domain containing B (UBASH3B) antagonist
oligonucleotide to a cancer patient, wherein said UBASH3B antagonist oligonucleotide is selected from the group consisting
of an UBASH3B shRNA comprising a sequence selected from the group consisting of 5?-GCTCAGAATCATTTAGCATAT-3? (SEQ ID NO: 41)
and 5?-GCGTTCAGACTGCACATAATA-3? (SEQ ID NO: 42) and an UBASH3B siRNA comprising a sequence selected from the group consisting
of 5?-CCGGCUUAUUUGAGUGGAC-3? (SEQ ID NO: 1), 5?-CCUCAUAAGAAGCAGCUAC-3? (SEQ ID NO: 2), and 5?-GCACUGCAACUGAGAAAUU-3? (SEQ
ID NO: 3), and wherein said cancer is selected from the group consisting of breast cancer, prostate cancer, lung cancer and
brain cancer.

US Pat. No. 9,072,729

METHOD FOR TREATING FIBROSIS AND CANCER WITH IMIDAZOLIUM AND IMIDAZOLINIUM COMPOUNDS

Agency for Science, Techn...

1. A method for treating cancer selected from the group consisting of brain cancer, bone cancer, skin cancer, gallbladder
cancer, laryngeal cancer, oral cancer, pleural mesothelioma, testicular cancer, uterine cancer, thyroid cancer, hepatocellular
carcinoma and glioma in a subject in need of such cancer treatment, the method comprising administering an effective amount
of an anti-cancer agent to the subject, the anti-cancer agent being:
(a) an oligomer or polymer comprising three or more compounds of general formula I connected together, general formula I being
defined as:


wherein:
the dashed line is absent or is present as a bond to form a second bond between the carbon to which R1 and R3 are attached and the carbon to which R2 and R4 are attached;

R1:

(i) is H, straight or branched C1-C6 alkyl, straight or branched C2-C6 alkenyl, straight or branched C2-C6 alkynyl, C6-C10 aryl;

(ii) together with R2 and their ring atoms form a 6- to 10-membered fused saturated, unsaturated or aromatic ring system;

(iii) together with R5 and their ring atoms form a 5- to 10-membered fused saturated, unsaturated or aromatic ring system when R2 is as defined above in (i); or

(iv) together with R5 and their ring atoms form a 5- to 10-membered fused saturated, unsaturated or aromatic ring system, when R2 and R6 together with their ring atoms also form a 5- to 10-membered fused saturated, unsaturated or aromatic ring system;

R2:

(i) is H, straight or branched C1-C6 alkyl, straight or branched C2-C6 alkenyl, straight or branched C2-C6 alkynyl, C6-C10 aryl;

(ii) together with R1 and their ring atoms form a 6- to 10-membered fused saturated, unsaturated or aromatic ring system;

(iii) together with R6 and their ring atoms form a 5- to 10-membered fused saturated, unsaturated or aromatic ring system when R1 is as defined above in (i); or

(iv) together with R6 and their ring atoms form a 5- to 10-membered fused saturated, unsaturated or aromatic ring system, when R1 and R5 together with their ring atoms also form a 5- to 10-membered fused saturated, unsaturated or aromatic ring system;

R3 is H, or, when R1 and R2 together with their ring atoms form a 6- to 10-membered fused aromatic ring system or when the dashed line is present as a
bond, R3 is absent;

R4 is H, or, when R1 and R2 together with their ring atoms form a 6- to 10-membered fused aromatic ring system or when the dashed line is present as a
bond, R4 is absent;

R5 is:

(i) as defined above for R1; or

(ii) straight or branched C1-C6 alkyl, straight or branched C2-C6 alkenyl, straight or branched C2-C6 alkynyl, C3-C18 cycloalkyl including fused cycloalkyl ring systems, C6-C10 aryl, C6-C10 aryl-C1-C6 alkyl, C6-C10 aryl-C2-C6 alkenyl, or C6-C10 aryl-C2-C6 alkynyl, C1-C6 alkyl-C6-C10 aryl, C2-C6 alkenyl-C6-C10 aryl, or C2-C6 alkynyl-C6-C10 aryl;

R6 is:

(i) as defined above for R2; or

(ii) straight or branched C1-C6 alkyl, straight or branched C2-C6 alkenyl, straight or branched C2-C6 alkynyl, C3-C18 cycloalkyl including fused cycloalkyl ring systems, C6-C10 aryl, C6-C10 aryl-C1-C6 alkyl, C6-C10 aryl-C2-C6 alkenyl, or C6-C10 aryl-C2-C6 alkynyl, C1-C6 alkyl-C6-C10 aryl, C2-C6 alkenyl-C6-C10 aryl, or C2-C6 alkynyl-C6-C10 aryl;

R7 is H, C1-C6 alkyl, phenyl, substituted C1-C6 alkyl or halo;

in which any of R1 to R7, where applicable, optionally has one or more carbon atoms replaced with a heteroatom selected from N, O, S and P and is
optionally substituted with one or more of straight or branched C1-C6 alkyl, straight or branched C2-C6 alkenyl, straight or branched C2-C6 alkynyl, C3-C18 cycloalkyl including fused cycloalkyl ring systems, C6-C10 aryl, fluoro, tri-fluoro-methyl, cyanato, isocyanato, carboxyl, C1-C6 acyloxy, C1-C6 acyl, carbonyl, amino, acetyl, acetoxy, oxo, nitro, hydroxyl, C1-C6 alkylcarboxy, C1-C6 alkoxy, C2-C6 alkenoxy, C2-C6 alkynoxy; and

in which one of the ring carbon atom to which R1 and R3 are attached and the ring carbon to which R2 and R4 are attached is optionally replaced with a nitrogen atom;

or any pharmaceutically acceptable salt of the oligomer or polymer of the compound; or
b) 1,3-di-tert-butylimidazolinium, 1,3-bis(1-adamantyl)imidazolium, 1,3-bis(2,4,6-trimethylphenyl)-imidazolinium, 1,3-bis(2,6-diisopropyl-phenyl)-imidazolinium,
1-(1-adamantyl)-3-(2,4,6-trimethylphenyl)-4,5-dihydroimidazolium, 2-benzylimidazo[1,5-a]quinolinium, 1,3-bis(1-adamantyl)-benzimidazolium,
1,3-diisopropylimidazolinium, diisopropylphenyl)-5-methylimidazo[1,5-a]pyridinium, 1-(2,6-diisopropylphenyl)-3-(2,4,6-trimethylphenyl)-imidazolinium,
2-mesityl-5-methylimidazo[1,5-a]pyridinium, 2-mesityl-2,5,6,7-tetrahydropyrrolo[2,1-c][1,2,4]triazol-4-ium, 1,3-bis(1-adamantyl)imidazolinium,
6,7-dihydro-2-pentafluorophenyl-5H-pyrrolo[2,1-c]-1,2,4-trizolium, 1-methyl-3-(2-hydroxylethyl)-imidazolium, 1-methyl-3-(4-isocynatobenzyl)-imidazolium,
1-methyl-3-(4-acetate-benzyl)-imidazolium, 1-methyl-3-(2,2-dimethoxylethyl)-imidazolium, 1-(2,4,6-trimethylphenyl)-3-(4-acetate-benzyl)-imidazolium,
1-benzyl-3-(4-acetate-benzyl)-2-methyl-imidazolium, 1-benzyl-3-(2,2-dimethoxylethyl)-2-methyl-imidazolium, 1-benzyl-3-(4-acetatebenzyl)-5-phenyl-imidazolium,
1-benzyl-3-(4-methylbenzyl)-5-phenylimidazolium, 1-benzyl-3-(3-hydroxyl-propyl)-imidazolium, 1-benzyl-3-(4-acetatebenzyl)-imidazolium,
1-(4-cyanatobenzyl)-3-methyl-imidazolium, 1-(4-carboxybenzyl)-3-methyl-imidazolium, 1,3-Bis(2,6-diisopropylphenyl)imidazolium
or 1,3-Di-tert-butylimidazolium, or any dimer thereof; or any pharmaceutically acceptable salt thereof; or

c) 2,6-di-(3-benzyl-imidazolium)-pyridine, 2,2?-di-(3-benzyl-imidazolium)-1,1?-binaphthalene, (1,2-4,5-diimidazolium)-N,N?,N?,N??-tetrabenzyl-benzene,
1,3,5-tris-(4-methyl-imiazolium)-linked cyclophane or 1,3-dibenzyl-2-(1,3-dibenzyl-1H-imidazol-2(3H)-ylidene)-2,3-dihydro-1H-imidazole;
or any pharmaceutically acceptable salt thereof.

US Pat. No. 9,058,885

MAGNETORESISTIVE DEVICE AND A WRITING METHOD FOR A MAGNETORESISTIVE DEVICE

Agency for Science, Techn...

1. A magnetoresistive device comprising:
a fixed magnetic layer structure having a fixed magnetization orientation;
a first free magnetic layer structure having a variable magnetization orientation; and
a second free magnetic layer structure having a variable magnetization orientation,
wherein the fixed magnetic layer structure is arranged in between the first free magnetic layer structure and the second free
magnetic layer structure,

wherein the magnetization orientation of the first free magnetic layer structure is variable in response to a first electrical
signal of a first polarity and the magnetization orientation of the second free magnetic layer structure is at least substantially
non-variable in response to the first electrical signal, wherein the magnetization orientation of the first free magnetic
layer structure is variable from a first direction to a second direction different from the first direction in response to
the first electrical signal having a first magnitude, and the magnetization orientation of the first free magnetic layer structure
is variable from the second direction to the first direction in response to the first electrical signal having a second magnitude
different from the first magnitude, and

wherein the magnetization orientation of the second free magnetic layer structure is variable in response to a second electrical
signal of a second polarity and the magnetization orientation of the first free magnetic layer structure is at least substantially
non-variable in response to the second electrical signal, wherein the second polarity is opposite to the first polarity.

US Pat. No. 9,439,886

METHODS FOR PRODUCING CROSSLINKED FLAVONOID HYDROGELS

Agency for Science, Techn...

1. A method for producing a hydrogel comprising conjugates of a hydrogel-forming agent and a flavonoid, the method comprising:
combining the conjugates in a solution, in the absence of an exogenously added peroxide and in the absence of a peroxidase;
and

controlling the gelation rate of the hydrogel by modifying the pH of the solution to be in the range of from 6 to 8.
US Pat. No. 9,205,106

THERAPEUTIC BONE GROWTH AND REGENERATION

Agency for Science, Techn...

1. A method of treating a bone fracture in a human subject, the method comprising administering a therapeutically effective
amount of heparan sulfate directly to a fracture site of said subject to treat said bone fracture, wherein the heparan sulfate
is HS-2 obtainable from embryonic neuroepithelium and wherein following digestion with heparin lyases I, II and III, the HS-2
has a disaccharide composition comprising:
Disaccharide Percentage
?HexUA-GlcNAc 44.8±5%
?HexUA-GlcNSO3 21.5±5%

?HexUA-GlcNAc(6S) 8.0±5%
?HexUA(2S)-GlcNAc 2.4±5%
?HexUA-GlcNSO3(6S) 4.0±5%

?HexUA(2S)-GlcNSO3 12.4±5%

?HexUA(2S)-GlcNAc(6S) 0.2±5%
?HexUA(2S)-GlcNSO3(6S) 4.1±5%

Unknown 2.4±5%and wherein the method results in an increase in in vivo bone formation as compared to in the absence of the heparan sulphate.

US Pat. No. 9,190,560

METHOD OF FORMING A LIGHT EMITTING DIODE STRUCTURE AND A LIGHT DIODE STRUCTURE

Agency for Science Techno...

1. A method of forming a vertical III-nitride based light emitting diode structure, the method comprising,
forming a III-nitride based light emitting structure on a silicon-on-insulator (SOI) substrate;
forming a metal-based electrode structure on the III-nitride based light emitting structure; and
removing the SOI substrate by a layer transfer process such that the metal-based electrode structure functions as a metal-based
substrate of the light emitting structure;

wherein the method further comprises creating an inhomogeneous Group III metal content in the III-nitride based light emitting
structure for modulating emission spectra of the light emitting diode structure by patterning a buried oxide layer of the
SOI substrate.

US Pat. No. 9,171,370

METHOD, AN APPARATUS AND A COMPUTER PROGRAM PRODUCT FOR DEINTERLACING AN IMAGE HAVING A PLURALITY OF PIXELS

Agency for Science, Techn...

1. A method for deinterlacing an image having a plurality of pixels, the method comprising:
calculating a difference between a first pixel of the image and each pixel of at least one pixel pair, each pixel pair comprising
one pixel being positioned above the first pixel and another pixel being positioned below the first pixel; and

deinterlacing the first pixel only if at least one difference corresponding to a pixel pair exceeds a predefined threshold,
wherein the at least one pixel pair comprises a plurality of pixel pairs, the plurality of pixel pairs having a predefined
order, and the method being performed in respect of each pixel pair sequentially and in accordance with the predefined order.

US Pat. No. 9,125,788

SYSTEM AND METHOD FOR MOTOR LEARNING

AGENCY FOR SCIENCE TECHNO...

1. A method of motor learning comprising the steps of:
providing a brain-robot interface and a robotic device, the brain-robot interface comprising a neural signal acquisition device;
detecting a user's motor intent using the neural signal acquisition device;
using a processing unit:
obtaining a first score based on the detected motor intent; and
calculating a second score based on the first score and a threshold score value for the motor intent, including adjusting
the threshold score value for the motor intent by extracting a value from an obtained learning curve that maps a relative
performance index to a relative target threshold value variation to quantify an amount of threshold score value adjustment;
and

using the robotic device to give robotic assistance to the user for executing a motor task associated with the motor intent
based on the second score.

US Pat. No. 9,473,730

METHOD AND SYSTEM FOR PERSONALIZED RECOMMENDATION MODELING

NBCUniversal Media, LLC, ...

1. A method for providing a personalized media content schedule for a user, the method comprising:
determining, in a processor of a computing device communicatively coupled to a display device, a plurality of units of available
media content from a plurality of content sources;

dynamically generating a schedule of recommended units of available media content from the plurality of units of available
media content, the schedule being customized for a user of the display device;

displaying to the user a graphical display of the schedule of recommended units of available media content, the display comprising
an ordered listing of a plurality of recommended units from the schedule of recommended units of available media content arranged
according to a relative predicted level of user interest in each of the plurality of units of available media content; and

tracking user interaction with the schedule of recommended available units of media content,
wherein the schedule of recommended available units of media content is customized for the user by generating a viewing profile
for the user based at least on a plurality of past instances of user behavior corresponding to units of media content previously
consumed by the user and mapped to the units of available media content,

further wherein the viewing profile is used to predict the relative level of user interest in each of the plurality of units
of the available media content by assigning weighted values to a plurality of extracted reasons contributing to the past instance
of user behavior, and identifying a past instance of user behavior with the greatest weighted sum of values.

US Pat. No. 9,333,257

FGFR1 ANTIBODIES AND TREATMENT OF CANCER

Agency for Science, Techn...

1. A method of treating a cancer in a subject in need of treatment, the method comprising administering an FGFR1 antibody
to the subject, wherein the FGFR1 antibody binds FGFR1 at an epitope consisting of an amino acid sequence having less than
20 amino acids and at least 8 contiguous amino acids of the amino acid sequence SSSEEKETDNTKPNR [SEQ ID NO:2], and wherein
cells in the cancer express FGFR1 on the cell surface.

US Pat. No. 9,305,372

METHOD AND DEVICE FOR IMAGE PROCESSING

Agency for Science, Techn...

1. A method for processing a first image based on a second image, each pixel in the first image having a plurality of color
components and having a corresponding pixel in the second image, wherein each value of a color component in the first image
corresponds to a value of a color component in the second image, the method comprising:
deciding, for each color component of a pixel in the first image, whether to modify the value of the color component dependent
on a predetermined criterion; and

determining a similarity index between the pixel in the first image and the corresponding pixel in the second image based
on, for each color component of the pixel, the value of the color component of the pixel, or if it is decided that the value
of the color component of the pixel is to be modified, the corresponding value of the color component in the second image,

wherein deciding whether to modify the value of the color component is dependent on a comparison of an exposure level of the
color component of the pixel in the first image with an exposure level of the color component of the corresponding pixel in
the second image, and

wherein the exposure level of the color component of the pixel in the first image represents a deviation of the value of the
color component of the pixel from a predetermined value, and the exposure level of the color component of the corresponding
pixel in the second image represents a deviation of the value of the color component of the corresponding pixel from the predetermined
value, wherein the predetermined value is a middle value of a value range of the first image and the second image.

US Pat. No. 9,267,029

NANO-COMPOSITE

Agency for Science, Techn...

1. A method of making a nano-composite having individual nano-sized silica particles dispersed in a polymer matrix which comprises
steps of:
providing a substantially homogeneous mixture which comprises silica precursors; a polymerizable resin; a coupling agent having
functional groups; a curing agent and an alkaline catalyst; and

hydrolyzing and condensing said silica precursors in said substantially homogeneous mixture, wherein the alkaline catalyst
is selected to initiate hydrolysis and condensation of the silica precursors to form the silica particles while simultaneously
functionalizing the formed silica particles with the functional groups of the coupling agent, said hydrolyzing, condensing
and functionalizing being undertaken under shear conditions and in the absence of an alcoholic solvent in said homogeneous
mixture to form individual nano-sized silica particles dispersed in said polymerizable resin.

US Pat. No. 9,155,814

NANOSTRUCTURED MATERIAL FORMULATED WITH BONE CEMENT FOR EFFECTIVE ANTIBIOTIC DELIVERY

AGENCY FOR SCIENCE, TECHN...

1. A bone cement, the bone cement comprising:
a polyacrylate; and
an active pharmaceutical ingredient, wherein the active pharmaceutical ingredient is an antibiotic and is disposed within
mesoporous silica nanoparticles;

wherein the mesoporous silica nanoparticle content is from 6 to about 10% w/w; and
wherein the mesoporous silica nanoparticles form a diffusion network.

US Pat. No. 9,352,283

TUBULAR FIBER MEMBRANE WITH NANOPOROUS SKIN

Agency for Science, Techn...

6. A cartridge comprising:
a body defining a fluid chamber;
a plurality of tubules including a tubule that further includes a tubular fiber membrane defining a lumen, said fiber membrane
comprising a nanoporous skin layer and a microporous lumen layer, said skin layer defining an outer surface of said fiber
membrane and said lumen layer defining a lumen surface of said fiber membrane, wherein pores in said skin layer have an average
pore size of less than about 7 nm, and pores in said lumen layer have an average pore size of from about 0.5 to about 3 ?m
mounted on said body and passing through said fluid chamber; and

a conduit in fluid communication with the tubules; and a conduit in fluid communication with said fluid chamber.

US Pat. No. 9,332,447

BASE STATION AND METHOD OF OPERATING THE SAME

Agency for Science, Techn...

1. A base station comprising:
a transceiver configured to communicate with another base station using a radio resource, wherein the radio resource is allocated
to the base station to serve communication devices located in a radio cell operated by the base station, wherein the base
station operates in a communication network and is configured to access a core network of the communication network through
the other base station, wherein the base station further comprises:

a controller configured to switch between a first mode and a second mode; and
wherein in the first mode, the radio resource is used by the base station to serve the communication devices; and
wherein in the second mode, the transceiver is configured to communicate with the other base station in order to access the
core network of the communication network, and

wherein the transceiver is configured to send to at least one of the communication devices or the other base station a control
message comprising information on when the base station operates in the first mode or on when the base station operates in
the second mode.

US Pat. No. 9,273,292

CHINESE HAMSTER OVARY CELL LINES

1. A CHO cell comprising a mutation in the GnT I gene selected from the following mutations at the specified position of a
GnT I nucleic acid sequence of GenBank Accession Number: AF343963: (a) a C to T transition at nucleic acid sequence position
1015; (b) a G to C transversion at nucleic acid sequence position 1300; (c) an A to C transversion at nucleic acid sequence
position 638; (d) a C to G transversion at nucleic acid sequence position 784; (e) a T to A transversion at nucleic acid sequence
position 811; (f) an insertion at nucleic acid sequence position 706 resulting in a frame shift from nucleic acid sequence
position 236 of the encoded amino acid sequence; (g) a G to A transition at nucleic acid sequence position 246; (h) a G to
A transition at nucleic acid sequence position 258; or (i) an A to T transversion at nucleic acid sequence position 859, in
which the CHO cell further comprises a nucleic acid encoding a protein of interest comprising a glycoprotein in an expression
vector and a nucleic acid encoding a functional GnT I sequence.

US Pat. No. 9,199,073

NERVE STUMP INTERFACE AND AXONAL REGENERATION SYSTEM FOR GENERATING AN ELECTRIC FIELD FOR PROMOTING AND GUIDING AXONAL REGENERATION

Agency for Science, Techn...

1. A nerve stump interface for generating an electric field for promoting and guiding axonal regeneration, the nerve stump
interface comprising
a sieve comprising a plurality of holes;
a strip coupled to the sieve;
a first electrode provided at one of the plurality of holes and a second electrode provided on the strip, the strip being
arranged to space the second electrode from the first electrode, the first electrode and the second electrode for generating
the electric field; and

at least one securing element provided on a side of the strip to allow that side of the strip to affix against an opposite
side of the strip.

US Pat. No. 9,345,012

COMMUNICATION DEVICES AND METHODS FOR PERFORMING COMMUNICATION

Agency for Science, Techn...

1. A method for performing direct mobile-to-mobile communication in a cellular mobile communication system, the cellular mobile
communication system comprising at least two mobile stations and a communication network for providing a communication connection
between the at least two mobile stations via at least one base station of the communication network, the method comprising:
associating a first mobile station and a second mobile station with the at least one base station;
performing neighbor discovery between the first mobile station and the second mobile station for reporting to the at least
one base station;

detecting the feasibility of direct communication between the first mobile station and the second mobile station;
establishing a direct communication link between the at least two mobile stations;
allocating identification for communication and flow, and resources for a flow, between the first mobile station and the second
mobile station;

synchronizing the flow between the first mobile station and the second mobile station; and
sending automatic repeat requests (ARQ) messages;
wherein synchronizing the flow between the first mobile station and the second mobile station comprises:
transmitting, from the first mobile station to the second mobile station, a first ranging code;
adjusting a timing on the second mobile station based on the first ranging code; and
transmitting, from the second mobile station to the first mobile station, an acknowledgement in the form of a second ranging
code.

US Pat. No. 9,284,404

ANTIMICROBIAL POLYMERS AND METHODS OF MANUFACTURE THEREOF

International Business Ma...

1. An aqueous micelle mixture, comprising:
about 5 to 500 micrograms/mL of a biodegradable cationic block copolymer, wherein the cationic block copolymer comprises i)
a hydrophilic block comprising first repeat units derived from a first cyclic carbonyl monomer by organocatalyzed ring-opening
polymerization, wherein the first cyclic carbonyl monomer is a cyclic carbonate and more than 0% of the first repeat units
comprise a side chain moiety comprising a positively charged quaternary amine group, ii) a hydrophobic block comprising second
repeat units derived from a second cyclic carbonyl monomer by organocatalyzed ring-opening polymerization, the second cyclic
carbonyl monomer selected from the group consisting of cyclic carbonate monomers, cyclic ester monomers, and combinations
thereof, iii) a chain fragment derived from an initiator for the ring opening polymerization, and iv) an optional endcap group;

wherein the aqueous micelle mixture induces lysis of a microbial cell membrane, and the cationic block copolymer biodegrades
60% within 180 days in accordance with ASTM D6400.

US Pat. No. 9,454,428

ERROR CORRECTION METHOD AND MODULE FOR NON-VOLATILE MEMORY

Agency for Science, Techn...

1. An error correction method for a non-volatile memory, the method comprising:
receiving a codeword read from the non-volatile memory;
computing a reliability information for each bit of the codeword received; and
performing a soft-decision decoding (SDD) technique to decode the received codeword,
wherein the SDD technique comprises:
forming a set of test patterns based on the reliability information; and
determining whether to perform a hard-decision decoding (HDD) of a test pattern in the set of test patterns based on a distance
between the test pattern and a candidate pattern.

US Pat. No. 9,399,044

ANTIMICROBIAL CATIONIC POLYAMINES

International Business Ma...

1. A method, comprising:
treating a medical condition caused by at least one bacterium by contacting the bacterium with a cationic polyamine, thereby
killing the bacterium, wherein the cationic polyamine has a polymer backbone comprising:

i) a positive-charged first ethylenimine unit of formula (2):
wherein X? is a negative-charged counterion bound by non-covalent association with the positive charged nitrogen labeled 1, and
ii) a non-charged second ethylenimine unit of formula (3):

wherein K? comprises at least one carbon;
and wherein
no backbone nitrogen of the cationic polyamine is present as a quaternary ammonium salt,
the cationic polyamine has a hemolysis HC20 value of greater than 1000 mg/L, and
the first ethylenimine unit and the second ethylenimine unit of the polymer backbone are directly and/or indirectly covalently
linked.

US Pat. No. 9,364,804

MICROFLUIDIC AGITATOR DEVICES AND METHODS FOR AGITATION OF A FLUID

Agency for Science, Techn...

1. A microfluidic agitator device comprising:
an air inlet;
an air outlet;
an elastic diaphragm provided between the air inlet and the air outlet and configured to oscillate with an oscillation frequency
if an airflow from the air inlet to the air outlet is provided;

a chamber coupled to the elastic diaphragm; and
a nozzle;
wherein a gap is provided between the nozzle and the elastic diaphragm, and
wherein the diaphragm is configured to be pushed back towards the nozzle due to an accelerated air flow and to be pushed away
from the nozzle when the gap is closed so that an oscillation of the diaphragm forms.

US Pat. No. 9,273,096

AMPHIPHILIC PEPTIDES COMPRISING THE FORMULA I: (X1Y1X2Y2)N, AND USES THEREOF

Agency for Science, Techn...

1. An amphiphilic peptide, wherein the peptide comprises:
(X1Y1X2Y2)n (Formula I), wherein

the C-terminal end of the peptide is amidated;
the N-terminal end of the peptide is not acetylated;
X1 and X2 is independently of each other a hydrophobic amino acid;

Y1 and Y2 is independently of each other a cationic amino acid; and

n is any number selected from the group consisting of 1.5, 2, 2.5, 3, 3.5, 4, 4.5, and 5; and
wherein when assembled, the peptide has ?-sheet structure.

US Pat. No. 9,329,415

METHOD FOR FORMING AN OPTICAL MODULATOR

Agency for Science, Techn...

1. A method for forming an optical modulator, the method comprising:
providing a substrate comprising a buried oxide layer;
implanting dopants of a first conductivity type into the substrate to form a first doped region;
implanting dopants of a second conductivity type into the substrate to form a second doped region;
wherein a portion of the second doped region is formed over and overlaps with a portion of the first doped region to form
a junction between the respective portions of the first doped region and the second doped region, wherein the respective portions
of the first doped region and the second doped region are in contact with each other,

wherein a remaining portion of the second doped region is located outside of the junction and formed over an intrinsic region
of the substrate, wherein a bottom surface of the remaining portion of the second doped region overlaps and is directly on
a top surface of the intrinsic region,

wherein the first doped region, the second doped region and the intrinsic region are formed over the buried oxide layer; and
wherein the intrinsic region is in between the remaining portion of the second doped region and the buried oxide layer; and
forming a ridge waveguide, wherein the ridge waveguide overlaps with at least a part of the junction.

US Pat. No. 9,087,975

RESISTIVE MEMORY ARRANGEMENT AND A METHOD OF FORMING THE SAME

Agency for Science, Techn...

1. A resistive memory arrangement comprising:
a nanowire having a longitudinal axis; and
a resistive memory cell comprising:
a resistive layer comprising a resistive changing material, wherein at least a section of the resistive layer is arranged
covering at least a portion of a surface of the nanowire, and wherein at least a portion of the resistive layer is arranged
around the longitudinal axis and at least substantially surrounding the nanowire; and

a conductive layer arranged on at least a part of the resistive layer, wherein at least a portion of the conductive layer
is arranged at least substantially surrounding the portion of the resistive layer;

wherein the nanowire and the conductive layer act as separate electrical contacts to allow a current flow between the nanowire
and the conductive layer through the resistive layer.

US Pat. No. 9,727,566

SELECTING ADAPTIVE SECONDARY CONTENT BASED ON A PROFILE OF PRIMARY CONTENT

NBCUniversal Media, LLC, ...

1. A content adaptation method for controlling a content selection system, the method comprising:
generating first metadata associated with a first time point of primary content and second metadata associated with a second
time point of primary content, wherein the first time point is before an insertion point for inserting secondary content and
the second time point is after the insertion point;

obtaining a primary metadata profile generated by a metadata generator based on the first metadata and the second metadata,
wherein the primary metadata profile is to be associated with the insertion point;

obtaining secondary metadata profiles generated by the metadata generator, each associated with corresponding secondary content
of a plurality of secondary content;

identifying one of the plurality of secondary content associated with a secondary metadata profile having a similarity value
closest to a desired value with the primary metadata profile associated with the primary content;

matching a selected secondary content with the insertion point of the primary content; and
outputting to a content distribution system information related to the matched selected secondary content for insertion into
the insertion point of the primary content.

US Pat. No. 9,188,710

LENS AND A METHOD OF FORMING THE SAME, A METHOD OF GENERATING A REFRACTIVE INDEX PROFILE FOR A LENS AND A PHOTONIC PACKAGE

Agency for Science, Techn...

1. A method of generating a refractive index profile for a lens comprising a refractive index profile configured such that
rays of light propagating in the lens form an at least substantially plane wavefront at an at least substantially vertical
plane of the lens, the method comprising:
dividing the lens into a plurality of layers, wherein a thickness of each layer of the plurality of layers is at least substantially
same; and

determining a refractive index of each layer of the plurality of layers, from a layer comprising a maximum refractive index
to a layer comprising a minimum refractive index.

US Pat. No. 9,467,697

METHOD AND APPARATUS FOR PACKETIZING DATA

Agency for Science, Techn...

1. A method for packetizing data representing a video sequence comprising a first frame and a second frame, wherein the data
comprises data from which the first frame is reconstructable and comprises data from which the second frame is reconstructable,
the method comprising:
determining for at least one first area of a plurality of first areas of the first frame a second area of a plurality of second
areas of the second frame such that for different first areas different second areas are determined and such that, for each
of the first areas, a measure of the distance between the second area determined for the first area and an area of the second
frame whose location within the second frame corresponds to the location of the first area is above a value,

wherein the value is a maximum value allowing that for at least one first area of the plurality of first areas of the first
frame a second area of the plurality of second areas of the second frame is determined such that for different first areas
different second areas are determined and such that, for each of the first areas, a measure of the distance between the second
area determined for the first area and an area of the second frame whose location within the second frame corresponds to the
location of the first area is above the value;

and grouping, for each of the first areas, data from which the first area is reconstructable and data from which the second
area determined for the first area is reconstructable into a packet,

wherein the second area of the plurality of second areas of the second frame determined for the first area of the plurality
of first areas of the first frame is determined based on an interleaving structure providing the maximum value, the interleaving
structure associating at least the second area with the first area.

US Pat. No. 9,682,100

CATIONIC POLYAMINES FOR TREATMENT OF VIRUSES

International Business Ma...

1. A method, comprising:
treating a virus with a cationic polyamine, the virus comprising DNA and/or RNA, the virus capable of causing a viral disease
in mammals, thereby forming a treated virus comprising the cationic polyamine bound by non-covalent interactions to the virus;

wherein:
i) the treated virus is less capable of entering a living mammalian cell and/or undergoing replication within a living mammalian
cell compared to the virus before said treating,

ii) the cationic polyamine comprises:
a plurality of non-charged N-acylated ethylenimine units of formula (1):

wherein each K? comprises at least one carbon and at least one alcohol hydroxyl group, and a plurality of positive-charged
secondary ethylenimine units of formula (3a):


wherein the starred bond of the nitrogen is linked to a carbon and X? is a negative-charged counterion bound by non-covalent association with the positive charged nitrogen, and

iii) the cationic polyamine comprises the N-acylated ethylenimine units and the secondary ethylenimine units arranged in a
random distribution and linked covalently head-to-tail, wherein nitrogen 1 of a given ethylenimine unit is linked to carbon
3 of a different ethylenimine unit,

wherein the virus is selected from the group consisting of dengue fever viruses, SARS corona viruses, Chikungunya viruses,
enteroviruses, influenza viruses, herpes simplex viruses, and combinations thereof.

US Pat. No. 9,316,654

TAZ/WWTR1 FOR DIAGNOSIS AND TREATMENT OF CANCER

1. A method for treating cancer, comprising:
detecting upregulation of expression, amount or activity of TAZ/WWTR1 in a cancer cell obtained from a subject as compared
to the expression, amount or activity of TAZ/WWTR1 in a control cell known to be non-cancerous, wherein said detecting comprises
contacting said cell with an antibody or antigen-binding fragment thereof that specifically binds TAZ/WWTR1; and

administering an anti-TAZ antibody agent to the subject that inhibits TAZ/WWTR1 expression or activity.

US Pat. No. 9,240,690

POWER TRANSFER DEVICE

Agency for Science, Techn...

15. A rectifier, comprising:
a first transistor, a second transistor, a third transistor and a fourth transistor each having a first terminal, a second
terminal and a control terminal;

a first comparator and a second comparator respectively having a first input terminal, a second input terminal, a third input
terminal, a fourth input terminal, a first output terminal and a second output terminal;

wherein the first input terminal of the first comparator is coupled to the first input terminal of the second comparator,
the second input terminal of the first comparator is coupled to the third input terminal of the second comparator, the third
input terminal of the first comparator is coupled to the second input terminal of the second comparator, and the fourth input
terminal of the first comparator is coupled to the fourth input terminal of the second comparator;

wherein the first terminal of the first transistor is coupled to the first terminal of the second transistor, the second terminal
of the first transistor is coupled to the second terminal of the third transistor, the second terminal of the second transistor
is coupled to the second terminal of the fourth transistor, and the first terminal of the third transistor is coupled to the
first terminal of the fourth transistor;

wherein the first comparator is configured to compare a first voltage applied to the first input terminal of the first comparator
and a second voltage applied to the second input terminal of the first comparator during a first operation cycle, and the
second comparator is configured to compare a first voltage applied to the first input terminal of the second comparator and
a second voltage applied to the second input terminal of the second comparator during a second operation cycle;

wherein when the second voltage is greater than the first voltage during the first operation cycle, the first comparator is
configured to output a first voltage signal at the first output terminal of the first comparator and a second voltage signal
at the second output terminal of the first comparator;

wherein when the second voltage is smaller than the first voltage during the first operation cycle, the first comparator is
configured to output the second voltage signal at the first output terminal of the first comparator and the first voltage
signal at the second output terminal of the first comparator;

wherein when the second voltage is greater than the first voltage during the second operation cycle, the second comparator
is configured to output a first voltage signal at the first output terminal of the second comparator and a second voltage
signal at the second output terminal of the second comparator;

wherein when the second voltage is smaller than the first voltage during the second operation cycle, the second comparator
is configured to output the second voltage signal at the first output terminal of the second comparator and the first voltage
signal at the second output terminal of the second comparator.

US Pat. No. 9,231,596

METHOD AND APPARATUS FOR A DUTY-CYCLED HARMONIC INJECTION LOCKED OSCILLATOR

Agency for Science, Techn...

1. A method for fixing the initial phase of a free-running oscillator comprising:
injecting an initial current pulse into the resonant LC tank of the free-running oscillator before oscillation build up in
the free-running oscillator, wherein the initial current pulse has a predetermined magnitude, wherein the initial phase of
the free-running oscillator is determined by the predetermined magnitude of the initial current pulse; and

locking the free-running oscillator in response to a relationship between the predetermined magnitude of the initial current
pulse and a phase of the free-running oscillator.

US Pat. No. 9,450,175

METHOD FOR PREPARING A LEAD-FREE PIEZOELECTRIC THIN FILM

Agency for Science, Techn...

1. A method for preparing a lead-free piezoelectric thin film comprising:
providing a precursor solution for use in preparing a lead-free piezoelectric thin film comprising: at least one alkali metal
ion; a polyamino carboxylic acid; and an alkanolamine;

depositing the precursor solution on a substrate to form a film; and
annealing the film.

US Pat. No. 9,393,535

MICROFLUIDIC MIXING APPARATUS AND METHOD

Agency for Science, Techn...

1. A microfluidic mixing device for mixing at least two fluids to form a mixed fluid comprising:
a first mixing chamber for receiving the fluids from at least a first and a second fluid paths;
a mixing zone upstream from the mixing chamber having the first and second fluid paths;
said first and second fluid paths overlapping at first and second discreet points so as to provide mutual fluid communication
between the first and second paths at said discreet points, wherein at least one of the first and second fluid paths includes
a primary channel and a plurality of divided channels dividing from the primary channel at a first node, and projecting to
a second node whereupon said plurality of channels are recombined, wherein a width of the mixing chamber adjacent to an inlet
of the first and second fluid paths entering the mixing chamber is equal to or greater than the sum of the widths of the channels
of the at least one of the first and second fluid paths immediately upstream of the mixing chamber, and wherein at least one
of said divided channels is of a greater flow capacity than at least one of said remaining divided channels.

US Pat. No. 9,233,393

PROCESS FOR CREATING LITHOGRAPHICALLY-DEFINED PLASMONIC STRUCTURES WITH ENHANCED Q FACTORS

Agency for Science, Techn...

1. A method for plasmonic structure manufacture comprising:
lithographically forming a plasmonic nanostructure on a substrate;
encapsulating the plasmonic nanostructure in high temperature resistant material;
annealing the plasmonic nanostructure; and
removing the high temperature resistant material to reveal the annealed plasmonic nanostructure,
wherein the lithographically forming comprises lithographically forming the plasmonic nanostructure using a lithographic method
selected from the group consisting of electron-beam lithography, nanoimprint lithography and photolithography, combined with
a metallization method selected from the group consisting of electron beam physical vapor deposition and evaporation deposition.

US Pat. No. 9,374,090

CIRCUIT ARRANGEMENT AND METHOD OF OPERATING THE SAME

Agency for Science, Techn...

1. A circuit arrangement comprising:
a level shifting stage configured to be coupled to a first reference voltage and a second reference voltage;
a first input electrode in electrical connection with the level shifting stage for coupling a first input voltage, the first
input voltage configured to switch between a first logic state and a second logic state;

a second input electrode in electrical connection with the level shifting stage for coupling a second input voltage, the second
input voltage configured to switch between the first logic state and the second logic state;

an output stage coupled to the level shifting stage, the output stage comprising an output node, the level shifting stage
configured to generate an output voltage above a predetermined output level at the output node due to the first reference
voltage when the first input voltage is in the first logic state and the second input voltage is in the second logic state;
and wherein the level shifting stage is further configured to generate the output voltage below the predetermined output level
at the output node due to the second reference voltage when the first input voltage is in the second logic state and the second
input voltage is in the first logic state;

a feedback circuit coupled to the output stage and the level shifting stage; and
a voltage stabilization circuit coupled to the level shifting stage;
wherein the level shifting stage comprises a switching mechanism configured to cause an internal current above a predetermined
current level to flow through the level shifting stage due to the first reference voltage and the second reference voltage
when the switching mechanism is activated, the switching mechanism further configured to at least reduce the internal current
flowing through the level shifting stage to below the predetermined current level when the switching mechanism is deactivated;

wherein the feedback circuit comprises a feedback mechanism configured to be deactivated when the output voltage is above
the predetermined output level, and the feedback mechanism is further configured to be activated when the output level is
below the predetermined output level;

wherein the switching mechanism is configured to be activated when the first input voltage is in the first logic state and
when the feedback mechanism is activated; and wherein the switching mechanism is further configured to be deactivated when
the first input voltage is in the first logic state and when the feedback mechanism is deactivated; and

wherein the voltage stabilization circuit is configured to maintain the output voltage at above the predetermined output level
when the internal current flowing through the level shifting stage is reduced.

US Pat. No. 9,102,920

METHOD OF EFFECTING DE-DIFFERENTIATION OF A CELL

Agency for Science, Techn...

1. A method of reprogramming a cell to produce a cell with pluripotency and self-renewing characteristics, the method comprising
increasing the amount or activity of an estrogen-related (Err) protein, or a functional fragments thereof, Oct4, Sox2, and
c-Myc in a cultured cell, wherein the cultured cell is a cultured somatic cell, a cultured precursor cell, or a cultured partially
differentiated stem cell and wherein the Err protein is one of an Esrrb protein and Esrrg protein.

US Pat. No. 9,051,418

GLUCOSE-PEG CONJUGATES FOR REDUCING GLUCOSE TRANSPORT INTO A CELL

Agency for Science, Techn...

1. A glucose-PEG conjugate comprising a moiety selected from the group consisting of:
wherein each n is independently from 2 to 500.

US Pat. No. 9,257,177

WRITE CONTROL CIRCUITS AND WRITE CONTROL METHODS

Agency for Science, Techn...

1. A write control circuit configured to control writing to a memory cell by applying a writing current to the memory cell,
the write control circuit comprising:
a current application circuit configured to apply the writing current to the memory cell;
a determination circuit configured to determine whether writing to the memory cell is finished;
a stop writing circuit configured to cut off the writing current from the memory cell if it is determined that writing to
the memory cell is finished; and

wherein the current application circuit is configured to apply the writing current to the memory cell for bipolar writing;
and

wherein the determination circuit is configured to determine whether writing to the memory cell is finished based on a source
line voltage of the memory cell.

US Pat. No. 9,165,932

MEMORY CELL AND METHOD OF MANUFACTURING A MEMORY CELL

Agency for Science, Techn...

1. A memory cell, comprising:
a substrate;
at least one first electrode disposed above the substrate;
at least one second electrode disposed above the at least one first electrode; and
a moveable electrode disposed between the at least one first electrode and the at least one second electrode;
wherein the moveable electrode is configured to move between the at least one first electrode and the at least one second
electrode;

wherein the moveable electrode comprises metal;
wherein the at least one first electrode comprises a gate electrode, and wherein the at least one second electrode comprises
a drain electrode and a source electrode.

US Pat. No. 9,109,087

LOW MOLECULAR WEIGHT BRANCHED POLYAMINES FOR DELIVERY OF BIOLOGICALLY ACTIVE MATERIALS

International Business Ma...

1. A branched polyamine, comprising:
about 8 to about 12 backbone tertiary amine groups, about 18 to about 24 backbone secondary amine groups, a positive number
n? greater than 0 of backbone terminating primary amine groups, and a positive number q greater than 0 of backbone terminating
carbamate groups of formula (2):


 wherein:
(n?+q) is a number equal to about 8 to about 12,
the starred bond of formula (2) is linked to a backbone nitrogen of the branched polyamine,
L? is a divalent linking group comprising 3 to 30 carbons, and
q/(n?+q)×100% equals about 9% to about 40%.

US Pat. No. 9,734,954

CONDUCTING POLYMER/GRAPHENE-BASED MATERIAL COMPOSITES, AND METHODS FOR PREPARING THE COMPOSITES

Nanyang Technological Uni...

1. A composite comprising a conducting polymer and a graphene-based material, the composite comprising
a) a graphene-based material doped with nitrogen or having a nitrogen-containing species selected from the group consisting
of an amine group, an amide group, and a nitrile group directly grafted to a graphitic carbon atom that forms part of a ring
structure of the graphene-based material, and

b) a coating consisting of the conducting polymer formed directly on a surface of the graphene-based material, wherein the
composite comprises 1 to 10 wt % of the conducting polymer.

US Pat. No. 9,343,128

MAGNETORESISTIVE DEVICE

Agency for Science, Techn...

1. A magnetoresistive device having a magnetic junction, the magnetic junction comprising:
a first magnetic layer structure having a magnetization orientation, the first magnetic layer structure comprising a first
sub-layer and a second sub-layer;

a second magnetic layer structure having a magnetization orientation that is fixed or that is able to oscillate; and
a free magnetic layer structure having a variable magnetization orientation;
wherein the second magnetic layer structure is arranged on top of the free magnetic layer structure;
wherein the free magnetic layer structure is arranged on top of the first magnetic layer structure, in between the first magnetic
layer structure and the second magnetic layer structure;

wherein the first sub-layer of the first magnetic layer structure, the second magnetic layer structure and the free magnetic
layer structure have perpendicular anisotropy;

wherein the second sub-layer of the first magnetic layer structure has in-plane anisotropy;
wherein a magnetization orientation of the first sub-layer of the first magnetic layer structure and the magnetization orientation
of the second magnetic layer structure are oriented in opposite directions;

wherein the magnetization orientation of the first sub-layer of the first magnetic layer structure is configured to oscillate
in a first direction in response to a current or a voltage applied across the magnetic junction so as to change the magnetization
orientation of the free magnetic layer structure; and

wherein the free magnetic layer structure is adapted to function as a memory storage layer.
US Pat. No. 9,278,993

CELL-TARGETING NANOPARTICLES AND USES THEREOF

Agency for Science, Techn...

1. A cell-targeting nanoparticle, wherein the cell-targeting nanoparticle comprises a quantum dot directly conjugated to at
least one cysteine-containing peptide, wherein the cysteine-containing peptide is selected from the group consisting of glutathione
(GSH), a GSH-containing peptide, and a peptide comprising a nuclear localization signal (NLS) sequence and a transporter sequence.

US Pat. No. 9,275,668

LIGHT COUPLING STRUCTURE, METHOD OF FORMING A LIGHT COUPLING STRUCTURE AND A MAGNETIC RECORDING HEAD

Agency for Science, Techn...

1. A light coupling structure, comprising:
a light coupling layer having a cavity;
a waveguide having a cladding layer and a core layer;
wherein the cladding layer of the waveguide is disposed in the cavity of the light coupling layer and the core layer of the
waveguide is disposed over the light coupling layer and the cladding layer of the waveguide;

wherein the light coupling layer is configured to receive light from a light source and couple the received light into the
core layer of the waveguide.

US Pat. No. 9,506,003

LUBRICANTS FOR MAGNETIC RECORDING MEDIA

Agency for Science, Techn...

1. A compound of formula (I)

wherein
n in formula (I) is 0, 1, 2, 3, or 4;
m in formula (I) is 0, 1, 2, 3, or 4;
each R?, when present, is a different or a same substituent selected from the group consisting of C1-C10 alkyl, C1-C10 alkoxy,
C1-C10 perfluorinated alkyl, C1-C10 perfluorinated alkoxy, and F;

each OArf is a different or a same fluorinated C6-C20 aryloxy group; and

Rf is selected from the group consisting of CF2CF2O(CF2CF2CF2O)rCF2CF2 wherein r is 2 to 30 and CF2(OCF2CF2)sO(CF2)t wherein s is 2 to 30 and t is 0, 1, 2, or 3.

US Pat. No. 9,499,601

MOLECULAR PROBE FOR SPHINGOLIPIDS

Agency for Science, Techn...

1. A probe comprising:
an isolated sphingolipid binding domain (SBD) polypeptide consisting of the sequence set forth in SEQ ID NO.: 1 and being
capable of binding to a sphingolipid; and

a moiety that is to be targeted to a sphingolipid and that is:
(i) a detectable label detectable within a living cell in a non-invasive manner which is selected from the group consisting
of a fluorescent group, a chemiluminescent group, a radioactive group, a photolabile fluorescent group, a protein cross-linker,
a paramagnetic group and a heavy metal complex; or

(ii) an antibody;the moiety being coupled to the SBD polypeptide via cysteine-[amino-ethoxy-ethoxy-acetyl]2 or [amino-ethoxy-ethoxy-acetyl]2.

US Pat. No. 9,362,916

CIRCUIT ARRANGEMENTS AND METHODS OF OPERATING THE SAME

Agency for Science, Techn...

1. A circuit arrangement comprising:
a level shifting stage coupled to a first reference voltage;
a first input electrode in electrical connection with the level shifting stage for coupling a first input voltage;
a second input electrode in electrical connection with the level shifting stage for coupling a second input voltage;
an output electrode in electrical connection with the level shifting stage for providing one of a first output voltage and
a second output voltage; and

a feedback circuit coupled with the level shifting stage, the output electrode and a second reference voltage;
wherein the first input voltage is configured to switch between a first logic state and a second logic state and the second
input voltage is configured to switch between the second logic state and the first logic state; and

wherein the level shifting stage is configured to generate the first output voltage when the first input voltage is in the
first logic state and the second input voltage is in the second logic state and the level shifting stage is configured to
generate the second output voltage when the first input voltage is in the second logic state and the second input voltage
is in the first logic state; and

wherein the feedback circuit is configured to maintain the first output voltage at the output electrode above a predetermined
level when the first input voltage is in the first logic state and the second input voltage is in the second logic state;

wherein the level shifting stage comprises a current mirror, the current mirror comprising:
a first set of sequentially coupled pull-up and pull-down sub-circuits; and
a second set of sequentially coupled pull-up and pull-down sub-circuits, the second set of sequentially coupled pull-up and
pull-down sub-circuits coupled to the first set of sequentially coupled pull-up and pull-down sub-circuits to form the current
mirror,

wherein the first set of sequentially coupled pull-up and pull-down sub-circuits comprises:
a first pull-up transistor having a control electrode, a first controlled electrode and a second controlled electrode; and
a first pull-down transistor having a control electrode, a first controlled electrode and a second controlled electrode;
wherein the first controlled electrode of the first pull-down transistor is coupled to the first controlled electrode of the
first pull-up transistor, and

wherein the control electrode of the first pull-up transistor is further coupled to the first controlled electrode of the
first pull-up transistor,

wherein the second set of sequentially coupled pull-up and pull-down sub-circuits comprises:
a second pull-up transistor having a control electrode, a first controlled electrode and a second controlled electrode;
a second pull-down transistor having a control electrode, a first controlled electrode and a second controlled electrode;
and

a current limiter sub-circuit having a first end and a second end;
wherein the first controlled electrode of the second pull-down transistor is coupled to the first end of the current limiter
sub-circuit and the first controlled electrode of the second pull-up transistor is coupled to the second end of the current
limiter sub-circuit,

wherein the feedback circuit is coupled directly to the second reference voltage, and
wherein the feedback circuit is coupled in series with the first pull-up transistor and the first pull-down transistor.

US Pat. No. 9,129,413

METHOD AND DEVICE FOR ALIGNING A PLURALITY OF DIGITAL PICTURES

Agency for Science, Techn...

1. A method for aligning a plurality of first digital pictures, each first digital picture comprising a plurality of pixels
wherein each pixel is associated with a pixel value, the method comprising:
generating, by a processor, a second digital picture for each first digital picture,
wherein generating the second digital picture for the first digital picture comprises determining, for each of a plurality
of pixels of the first digital picture, a number representing the pixel values of pixels in a neighborhood of the pixel relatively
to the pixel value of the pixel;

assigning, by a processor, the number as a pixel value to a pixel of the second digital picture corresponding to the pixel
of the first digital picture;

generating, by a processor, aligning parameters based on the plurality of second digital pictures; and
aligning, by a processor, the plurality of first digital pictures based on the aligning parameters;
wherein determining, for each of a plurality of pixels of the first digital picture, a number representing the pixel values
of pixels in the neighborhood of the pixel relatively to the pixel value of the pixel comprises

determining a relative value for each pixel of the pixels in the neighborhood of the pixel based on comparison of the pixel
value of the pixel and the pixel value of the pixel in the neighborhood of the pixel; and

determining the number representing the pixel values of the pixels in the neighborhood of the pixel relatively to the pixel
value of the pixel based on the determined relative values;

wherein determining a relative value for each pixel of the pixels in the neighborhood of the pixel based on comparison of
the pixel value of the pixel and the pixel value of the pixel in the neighborhood of the pixel comprises

determining a difference between the pixel value of the pixel and the pixel value of the pixel in the neighborhood of the
pixel; and

comparing the difference with a threshold value;
wherein the threshold value is determined based on a comparagram which is a two-dimensional joint histogram between a reference
first digital picture and a target first digital picture of a plurality of first digital pictures.

US Pat. No. 9,521,685

CIRCUIT ARRANGEMENT AND METHOD OF DETERMINING A PRIORITY OF PACKET SCHEDULING

Agency for Science, Techn...

1. A circuit arrangement for a wireless cellular network, the circuit arrangement comprising:
a determiner configured to determine a priority value of each packet of a plurality of packets based on at least a position
of a video frame in a group of pictures (GOP) and a type of the video frame, the video frame or a part thereof being contained
in the packet,

wherein the type of video frame comprises I frame data or P frame data; and
wherein the determiner is further configured to set the priority value of a packet including I frame data lower than the priority
value of at least one other packet including P frame data; and

a controller configured to control scheduling of the packet based on the determined priority value for a communication device
in a wireless cellular network.

US Pat. No. 9,498,494

GLYCOSAMINOGLYCANS

AGENCY FOR SCIENCE, TECHN...


US Pat. No. 9,434,614

PEROVSKITE-TYPE STRONTIUM TITANATE

Agency for Science, Techn...

1. A perovskite-type strontium titanate, wherein the strontium titanate is Y- and Ni-doped and has the general formula of
(SraYb)d(Ti1-cNic)O3, wherein a+b is greater than 1 and 0.8?a?1; 0
US Pat. No. 9,334,317

HEPATITIS B VIRUS SPECIFIC ANTIBODY AND USES THEREOF

AGENCY FOR SCIENCE, TECHN...

1. An isolated TCR-like antibody or fragment thereof, wherein the antibody or fragment thereof is specifically binding to
at least one HBV derived peptide, wherein the HBV derived peptide comprises HBe183-191 of SEQ ID NO: 24 and is part of a HLA-A2
peptide complex, the complex comprising the HBV derived peptide and a HLA-A2 molecule, wherein the antibody is selected form
the group consisting of:
a) an antibody produced by hybridoma cell line deposited with ATCC with accession number PTA-11068 and
b) an antibody comprising at least one light chain and at least one heavy chain, wherein the light chain comprises the amino
acid sequence of SEQ ID NO: 32, and the heavy chain comprises the amino acid sequence of SEQ ID NO: 33, wherein the antibody
is capable of distinguishing HBV-infected cells from uninfected cells.

US Pat. No. 9,150,829

CULTURE OF PLURIPOTENT AND MULTIPOTENT CELLS ON MICROCARRIERS

AGENCY FOR SCIENCE, TECHN...

1. A method of culturing human pluripotent cells in vitro, the method comprising:
(i) attaching human pluripotent cells to a plurality of uncoated microcarriers to form microcarrier-cell complexes, and
(ii) culturing the microcarrier-cell complexes in suspension culture in the presence of a ROCK inhibitor;
(iii) passaging the cultured cells from (ii), wherein cells after passaging are pluripotent, and
(iv) repeating steps (i)-(iii) through at least 7 passages; wherein human pluripotent cells are expanded between each passage;
and whereby stable, long-term culture and expansion of human pluripotent cells is achieved in suspension in vitro.

US Pat. No. 10,094,957

MOLECULAR TUNNEL JUNCTIONS AND THEIR USE AS SOURCES OF ELECTRONIC PLASMONS

National University of Si...

1. A method of producing electronic plasmons, the method comprising:providing a molecular tunnel junction,
applying a bias to the molecular tunnel junction to excite plasmons, and
detecting the plasmons thus produced,wherein the molecular tunnel junction contains a top metallic electrode formed of a eutectic metal alloy and a metal oxide, a bottom metallic electrode formed of a transition metal, and a self-assembled monolayer formed of a plurality of organic molecules disposed between the top metallic electrode and the bottom metallic electrode.

US Pat. No. 9,823,150

MICRO-MACHINED OPTICAL PRESSURE SENSORS

Agency for Science, Techn...

1. A micro-machined optical pressure sensor, comprising:
a diaphragm configured to deform when a force is applied thereto;
a sensing micro-ring spaced apart from the diaphragm by a gap, the gap being variable depending on the force applied on the
diaphragm; and

a reference micro-ring spaced apart from the sensing micro-ring, the reference micro-ring configured to produce a reference
resonance wavelength shift, the reference resonance wavelength shift indicative of the temperature of the micro-machined optical
pressure sensor;

wherein the sensing micro-ring is configured to produce a resonance wavelength shift when the gap is varied, the resonance
wavelength shift indicative of the force applied to the diaphragm,

wherein the reference micro-ring is configured to compensate a temperature-dependent resonance shift within the resonance
wavelength shift produced by the sensing micro-ring when the gap is varied.

US Pat. No. 9,501,823

METHODS AND SYSTEMS FOR CHARACTERIZING ANGLE CLOSURE GLAUCOMA FOR RISK ASSESSMENT OR SCREENING

Agency for Science, Techn...

1. A method for performance by a computer, for automatically processing an image including the junction between a cornea and
an iris, the method comprising:
defining a region of interest (ROI) in the image;
deriving an estimated position of said junction within the region of interest;
defining a second region of the image based on the estimated position of the junction;
extracting features of the second region of the image; and
inputting the extracted features to an adaptive model, the adaptive model outputting at least one variable characterizing
the junction;

wherein the estimated position of the junction is found by:
binarizing the ROI,
selecting a connected region of the binarized region of interest by a criterion which selects a connected region which has
said junction as one of its corners, and

deriving the estimated position of the junction from the connected region; and
wherein the connected region is selected by:
calculating a plurality of pixel numbers N and a plurality of center coordinates (Cx, Cy) of a plurality of connected regions
of the binarized ROI,

for each of the connected regions calculating a corresponding weight Nw from the plurality of pixel numbers and the plurality
of center coordinates, and

selecting the one of the connected regions of the ROI with the highest value of the weight Nw.

US Pat. No. 9,494,562

METHOD AND APPARATUS FOR DEFECT DETECTION IN COMPOSITE STRUCTURES

Agency for Science, Techn...

1. A method for non-destructive testing of a composite structure comprising:
providing a wideband chirp wave sonic signal to the composite structure for a predetermined time having a predetermined amplitude
and a predetermined range of frequencies as an excitation signal;

correlating a probed signal received from the composite structure with a library of predetermined probed signals, the library
of predetermined probe signals comprising probe signals received from a reference composite structure generated in response
to the wideband chirp wave sonic signal provided to the reference composite structure for the predetermined time having the
predetermined amplitude and the predetermined frequency, wherein the reference composite structure includes one or more predefined
defects; and

outputting a graphical representation of defects detected, wherein the graphical representation of the defects detected conveys
defect type information.

US Pat. No. 9,441,134

FLUORINATED CORE-SHELL-POLYMERS AND PROCESS FOR PREPARING SAME

AGENCY FOR SCIENCE, TECHN...

1. A process for preparing fluorinated core-shell polymer particles in which the core is a non-fluorinated polymer and the
shell is derived from at least 50% by weight of fluorinated monomers, comprising the steps of
(1) synthesizing a core polymer latex by aqueous emulsion polymerization of non-fluorinated monomers forming the core polymer,
(2) adding the shell-forming fluorinated monomers or mixtures of at least 50% by weight of fluorinated monomers with non-fluorinated
monomers to the core polymer latex of step 1) and allowing for at least one hour of equilibration time in which essentially
no polymerization of the shell monomers occurs,

(3) reacting the shell-forming monomers in the mixture from step 2) to form the core-shell polymer particles,
wherein the process steps 1) to 3) are carried out under mechanical stirring in the absence of surfactants, emulsifiers, emulsifying
monomers and mixtures thereof.

US Pat. No. 9,399,611

METHOD OF ACETALIZING AN ALDEHYDE

Agency for Science, Techn...

1. A method of acetalizing an aldehyde comprising reacting said aldehyde with an alcohol in the presence of a polymeric catalyst
to form an acetal,
wherein the polymeric catalyst comprises monomers that are capable of participating in double hydrogen bonding with said aldehyde
and is a mesoporous poly-melamine-formaldehyde.

US Pat. No. 9,174,268

METHOD AND APPARATUS FOR FORGING

Agency for Science, Techn...

1. A method of forming an article having an article feature, the method comprising:
(a) locating at least one pin at a first position relative to a die cavity;
(b) inserting into the die cavity a molten material to be used to form the article;
(c) moving at least one punch relative to the die cavity to contact the molten material to form the article; and
(d) moving the at least one pin to a second position relative to the die cavity, the movement of the at least one pin being
prior to solidification of the molten material,

wherein the movement of the at least one pin is a consequence of the movement of the at least one punch; and
wherein the at least one punch contacts the at least one pin prior to the at least one punch contacting the molten material.

US Pat. No. 9,147,087

METHOD OF ACCESSING A DATA STORAGE DEVICE

Agency for Science, Techn...

1. A method of accessing a data storage device, the method comprising:
transforming a first key to obtain a second key; assigning the second key to a logical unit of data of the data storage device;
using the second key to read data from the data storage device or to write data to the data storage device;
transforming a third key to obtain a fourth key; assigning the fourth key to the logical unit of data of the data storage
device;

determining whether the data storage device is a conventional data storage device of or a full disk encryption data storage
device;

and if it determined that the data storage device is a conventional data storage device, using the fourth key to encrypt and
decrypt the data from the data storage device;

wherein the first key is a replaceable key and the third key is a cryptographic key which remains unchanged.
US Pat. No. 9,481,758

POROUS POLYISOCYANURATES HAVING RIGID LINKER GROUPS

1. A polyisocyanurate comprising isocyanurate rings linked by rigid linker groups coupled to the nitrogen atoms of said rings,
said linker groups being aromatic or heteroaromatic or both and said polyisocyanurate being microporous or mesoporous or both
microporous and mesoporous, additionally comprising a metal species on the walls of the pores and/or as nanoparticles located
in the pores wherein the metal species is catalytic for a Suzuki coupling reaction.
US Pat. No. 9,458,431

MICROCARRIERS FOR STEM CELL CULTURE

Agency for Science, Techn...

1. A method of propagating stem cells in suspension culture in vitro, the method comprising:
(i) attaching stem cells to a plurality of microcarriers to form microcarrier-stem cell complexes, wherein the surface of
the microcarriers is coupled to poly-L-lysine and is coated in laminin or vitronectin;

(ii) prior to agitation, culturing the microcarrier-stem cell complexes under static culture conditions, such that stem cell-microcarrier
aggregates are formed; and

iii) culturing the microcarrier-stem cell complexes in suspension culture, wherein the suspension culture is subject to at
least 24 hours continuous agitation, wherein the number of stem cells in the culture is thereby expanded,

wherein stem cells in the culture after step (iii) are pluripotent or multipotent.

US Pat. No. 9,425,341

P-I-N PHOTODIODE WITH DOPANT DIFFUSION BARRIER LAYER

Agency for Science, Techn...

1. A p-i-n photodetector comprising:
a dopant diffusion barrier layer disposed within an active light absorbing region of the p-i-n photodetector, wherein the
dopant diffusion barrier layer has a thickness less than 5 nm;

a first semiconductor layer having a region doped to a first polarity;
a second semiconductor layer having a region doped to a second polarity, the second polarity being opposite to the first polarity,
wherein the dopant diffusion barrier layer is disposed between the first semiconductor layer and the second semiconductor
layer for reducing doping of the first polarity into the region between the dopant diffusion barrier layer and the second
semiconductor layer, and

wherein the region doped to the first polarity of the first semiconductor layer has a higher doped portion and wherein the
region doped to the second polarity of the second semiconductor layer has a higher doped portion, so that the higher doped
portion of the second polarity and the higher doped portion of the first polarity form a pn junction of the p-i-n photodetector.

US Pat. No. 9,373,804

OPTOELECTRONIC DEVICE COMPRISING A HYBRID MOLYBDENUM (VI) OXIDE FILM

Agency for Science, Techn...

1. An optoelectronic device comprising a hybrid molybdenum (VI) oxide (MoO3) film coated substrate formed by coating a substrate with an ink to form a film and annealing the film, wherein the ink comprises
an ammonium molybdate, at least one inorganic salt different from ammonium molybdate, and a solvent or a solvent mixture,
wherein the hybrid MoO3 film comprises MoO3 and the at least one inorganic salt.

US Pat. No. 10,116,286

REFERENCE CLOCK SIGNAL GENERATORS AND METHODS FOR GENERATING A REFERENCE CLOCK SIGNAL

Agency for Science, Techn...

1. A method for generating a reference clock signal, the method comprising:discharging a capacitive element to a discharged state, when a reset signal has a predetermined reset state;
charging the capacitive element from the discharged state to a first voltage, when a charge signal has a predetermined charge state;
comparing the first voltage to a zero voltage, when a compare signal has a predetermined compare state;
generating a second voltage based on the comparing of the first voltage to the zero voltage;
generating a clock signal based on the second voltage, using an oscillator; and
generating each of the reset signal, the charge signal and the compare signal, based on the clock signal.
US Pat. No. 9,517,252

P53 ACTIVATING PEPTIDES

Agency for Science, Techn...


(b) is a variant of a peptide as defined in (a) above; or
(c) is a derivative of a peptide as defined in (a) or (b) above.
US Pat. No. 9,308,217

TARGETING GLIOMA STEM CELLS BY SEQUENCE-SPECIFIC FUNCTIONAL INHIBITION OF PRO-SURVIVAL ONCOMIR-138

Agency for Science, Techn...

1. A pharmaceutical composition, comprising an oligonucleotide targeting miR-138, wherein the oligonucleotide comprises the
nucleotide sequence of 5?-GAGCTGGTATTGTGAATCAAGCAGCTTCCTGTCAGCGGCCTGATTCACA ACACCAGCTTTTTT3? (SEQ ID NO:2).

US Pat. No. 9,226,899

PARTICULATE HYALURONIC ACID AND FLAVONOID FORMULATIONS FOR CELLULAR DELIVERY OF BIOACTIVE AGENTS

Agency for Science, Techn...

1. A method for delivery of a bioactive agent to a cell, the method comprising contacting the cell with a suspension of immiscible
particles in an aqueous solution, wherein the particles comprising an agglomeration of:
a bioactive agent; and
a plurality of conjugates of a hyaluronic acid and a flavonoid;
the particles having a hydrated interior and having an average diameter of from about 15 nm to about 300 nm, the bioactive
agent being releasably retained in the particles by the flavonoid.

US Pat. No. 9,134,553

OPTICAL MODULATOR AND METHOD FOR MANUFACTURING THE SAME

Agency for Science, Techn...

1. An optical modulator, comprising:
a first waveguide,
a second waveguide,
a modulating portion connected between the first waveguide and the second waveguide, the modulating portion being configured
to receive an input signal from the first waveguide, to modulate the input signal and to supply a corresponding modulated
input signal as an output signal to the second waveguide,

wherein the modulating portion comprises:
a semiconductor substrate, one end thereof being coupled to the first waveguide, and a corresponding opposite end thereof
being coupled to the second waveguide,

a Germanium rib provided on the semiconductor substrate such that the input signal propagates through the Germanium rib along
a longitudinal axis thereof, and

a first electrode and a second electrode respectively provided on the semiconductor substrate, wherein the Germanium rib is
provided between the first electrode and the second electrode, and wherein the first electrode and the second electrode are
configured to apply an electrical field to the Germanium rib in order to modulate the input signal propagating through the
Germanium rib;

wherein the semiconductor substrate comprises silicon.

US Pat. No. 9,110,314

OPTICAL MODULATOR AND A METHOD OF FORMING THE SAME

Agency for Science, Techn...

1. An optical modulator, comprising:
a depletion region comprising a junction between a first conductivity type portion and a second conductivity type portion,
the first conductivity type portion and the second conductivity type portion being in contact with each other;

a first intrinsic region; and
a second intrinsic region; and
wherein the depletion region is disposed between the first intrinsic region and the second intrinsic region, and in contact
with the first intrinsic region and the second intrinsic region,

wherein the first intrinsic region is in contact with the first conductivity type portion,
wherein the first intrinsic region comprises dopants of a first conductivity type and dopants of a second conductivity type,
wherein a concentration of the dopants of the first conductivity type is higher than a concentration of the dopants of the
second conductivity type,

wherein the second intrinsic region is in contact with the second conductivity type portion,
wherein the second intrinsic region comprises dopants of the first conductivity type and dopants of the second conductivity
type, wherein a concentration of the dopants of the second conductivity type is higher than a concentration of the dopants
of the first conductivity type, and

wherein the first conductivity type and the second conductivity type are opposite conductivity types.
US Pat. No. 9,107,905

MODULATORS OF CANDIDA HYPHAL MORPHOGENESIS AND USES THEREOF

Agency for Science, Techn...

1. A method of determining the extent of Candida hyphal growth in a body fluid sample obtained from a patient having a Candida infection, comprising the step of measuring the amount of muramyl-L-alanine and/or compounds that include muramyl-L-alanine
in their core structure in the body fluid sample.

US Pat. No. 9,081,138

WAVEGUIDE STRUCTURE

Agency for Science, Techn...

1. A waveguide structure comprising:
a silicon-on-insulator layer; and
a semiconductor waveguide disposed on the silicon-on-insulator layer, wherein the semiconductor waveguide comprises a tapering
region, and wherein the semiconductor waveguide further comprises:

a first cladding comprising a first conductivity type material;
a second cladding comprising a second conductivity type material; and
a core disposed in between the first cladding and the second cladding; and
wherein each of the core and the first cladding comprises the tapering region;
wherein the respective tapering regions of each of the core and the first cladding are configured to at least substantially
overlap with each other, and

wherein the second cladding is disposed between the core and the silicon-on-insulator layer, the second cladding comprising:
a first tapering region configured to at least substantially overlap with the respective tapering regions of each of the core
and the first cladding; and

a second tapering region following the first tapering region,
wherein the second tapering region has a width that is wider than a width of the first tapering region,
wherein the first tapering region and the second tapering region are configured to taper in a direction at least substantially
the same as the respective tapering regions of each of the core and the first cladding along a longitudinal direction of the
semiconductor waveguide; and

wherein a tapering angle of the second tapering region defined relative to the longitudinal direction of the semiconductor
waveguide is larger than a tapering angle of the first tapering region defined relative to the longitudinal direction of the
semiconductor waveguide, and

wherein the silicon-on-insulator layer comprises a tapering portion configured to at least substantially overlap with the
tapering region, and wherein the tapering portion is configured to taper in a direction at least substantially the same as
the tapering region along a longitudinal direction of the semiconductor waveguide.

US Pat. No. 9,083,052

NANOCOMPOSITES

Agency for Science, Techn...

1. A nanocomposite particle comprising:
a nanoparticle having a surface comprising a silver salt, and
at least one region of a first noble metal on said surface;
said nanocomposite particle additionally comprising at least one region of a second noble metal on said surface, said second
noble metal being different to the first noble metal.

US Pat. No. 10,035,990

SPECIFIC INTERNALIZATION OF NANOPARTICLES INTO PROTEIN CAGES

Agency for Science, Techn...

1. A method for internalization of nanoparticles into protein cages comprising the following steps:(i) modifying a protein cage at predefined locations with one or more residues of histidines to provide accessible histidine residues displayed on an interior surface of the protein cage;
(ii) functionalizing nanoparticles to be able to bind the one or more residues of histidines; and
(iii) introducing the nanoparticles through holes in the protein cage; wherein the protein cage is made from dihydrolipoyl acetyltransferase.

US Pat. No. 9,976,113

METHODS, APPARATUSES, AND SYSTEMS FOR CELL AND TISSUE CULTURE

Agency for Science, Techn...

1. A cell culture apparatus for culturing cells, the apparatus comprising:at least one chamber for containing and growing the cells therein; and
a set of removable members, each of the removable members of said set providing a surface for cell adhesion and having a different stiffness relative to other removable members of the set, the stiffness of each removable member of said set being selected to induce cell growth that is different from other removable members within the set,
wherein the at least one chamber being adapted to connect with at least one removable member of the set of removable members,
wherein at least one removable member of the set of removable members is removably connected to the at least one chamber, and
wherein the at least one chamber comprises at least one containment layer for containing cells within the chamber during cell culture, the containment layer disposed between the interior of the chamber and the surface for cell adhesion of the removable member connected to the chamber.

US Pat. No. 9,622,476

1,3,6-DIOXAZOCAN-2-ONES AND ANTIMICROBIAL CATIONIC POLYCARBONATES THEREFROM

International Business Ma...

1. A cationic polymer of formula (6):
I?-[Q?-E?]n?  (6),
wherein
n? is a positive integer greater than or equal to 1,
each Q? is an independent divalent polymer chain,
I? has a valency of n?, I? comprises 1 or more carbons, and I? comprises n? heteroatoms independently selected from the group
consisting of oxygen, nitrogen, and sulfur, wherein each of the heteroatoms is linked to a respective Q? terminal backbone
carbonyl group,

each E? is a monovalent end group selected from the group consisting of hydrogen and moieties comprising 1 to 50 carbons,
wherein each E? is linked to a respective Q? terminal backbone oxygen,

each Q? comprises a cationic repeat unit of formula (7):
wherein
each R? is hydrogen,
R? is a group comprising 1 or more carbons, wherein one carbon of R? is bonded to the positive charged nitrogen,
*—CH2—Y? is a monovalent radical selected from the group consisting of methyl, ethyl, propyl, butyl, benzyl, and substituted benzyl,

X? is a negative-charged counterion.

US Pat. No. 9,508,140

QUANTIFYING CURVATURE OF BIOLOGICAL STRUCTURES FROM IMAGING DATA

Agency for Science, Techn...

1. A computer-implemented method of obtaining data characterizing a biological structure having a periodic structure, the
method employing a plurality of three-dimensional input meshes which represent an instantaneous shape of the biological structure
at successive respective times within a cycle of periodic motion, the method comprising:
using the input meshes to form a set of three-dimensional morphed meshes, the morphed meshes having respective shapes which
are the shapes of corresponding ones of the input meshes, wherein the operation of forming the morphed meshes comprises:

designating one of the input meshes, or a template mesh which is a geometric primitive, as a generic mesh, and
for each of undesignated input meshes, forming a corresponding one of the morphed meshes by deforming the generic mesh to
the shape of the respective one of the undesignated input meshes,

wherein the morphed meshes have the same number of vertices as the generic mesh such that each vertex of each of the morphed
meshes has a corresponding vertex in each of the other morphed meshes; and

performing three-dimensional shape analysis comprising,
for each of the morphed meshes, obtaining a curvedness value at each of a plurality of corresponding locations comprising
corresponding vertices in the morphed meshes, and

producing a value indicative of a change of curvedness per time unit using the curvedness values of the morphed meshes corresponding
to the successive respective times,

wherein the method further comprises restoring the shapes of the plurality input meshes to correct motion artifacts prior
to forming the morphed meshes.

US Pat. No. 9,357,772

ANTIMICROBIAL CATIONIC POLYCARBONATES

International Business Ma...

1. An antimicrobial cationic polymer of formula (12):
Zc—Pb—C—Pb—Zc  (12),

wherein
C? is a C2-C15 divalent linking group joining polymer chains Pb, wherein C? comprises i) a first heteroatom linked to a first polymer chain Pb, wherein the first heteroatom is selected from the group consisting of nitrogen, oxygen, and sulfur, and ii) a second heteroatom
linked to a second polymer chain Pb, wherein the second heteroatom is selected from the group consisting of nitrogen, oxygen, and sulfur,

each Zc is an independent monovalent end group selected from the group consisting of hydrogen and C1-C15 moieties,

each polymer chain Pb consists essentially of cationic carbonate repeat units, wherein i) the cationic polymer comprises a total of 5 to about 45
cationic carbonate repeat units, ii) each of the cationic carbonate repeat units comprises a) a backbone portion of the polymer
chain comprising an aliphatic carbonate group, and b) a cationic side chain linked to the backbone portion, and iii) the cationic
side chain comprises a positive-charged heteroatom Q? of a quaternary ammonium group and/or quaternary phosphonium group,

about 25% to 100% of all the cationic carbonate repeat units of the cationic polymer, designated first cationic carbonate
repeat units, having a structure selected from the group consisting of


and combinations thereof, wherein X? is a negative-charged ion, and

0% to about 75% of the cationic carbonate repeat units of the cationic polymer, designated second cationic carbonate repeat
units, have a cationic side chain comprising 6 to 9 carbons.

US Pat. No. 9,228,977

CONTACTLESS CONDUCTIVITY DETECTOR

Agency for Science, Techn...

1. A portable electrophoretic capacitive coupled contactless conductivity detection (C4D) system for electrophoresis analysis on a microfluidic chip having a channel defined by channel walls, the system comprising:
(i) a housing, including a fluidic compartment having a chip stage for receiving the microfluidic chip;
(ii) a cartridge detection cell releasably attached to the housing, releasable attachment of the cartridge cell to the housing
causing electrical contact between the cartridge cell and the housing, the cartridge cell comprising:

first and second emitting electrodes and
first and second receiving electrodes; and
wherein the first emitting electrode and the first receiving electrode are configured to be positioned adjacent to a first
channel wall of said channel walls of the microfluidic chip, and

the second emitting electrode and the second receiving electrode are configured to be positioned adjacent to a second channel
wall of said channel walls of the microfluidic chip, the second channel wall being opposite the first channel wall;

wherein the cartridge cell is releasably attached to an electronic circuit of the housing via a plurality of self latching
connectors.

US Pat. No. 9,120,193

APPARATUS AND METHOD FOR POLISHING AN EDGE OF AN ARTICLE USING MAGNETORHEOLOGICAL (MR) FLUID

Agency for Science, Techn...

15. A method for polishing an edge of an article, the method comprising:
providing at least one carrier including:
first and second opposing surfaces defining a groove, the first and second opposing surfaces being spaced apart in a first
direction to receive the edge; and

a magnetic field generator configured to provide a magnetic field in the groove to stiffen magnetorheological (MR) fluid disposed
in the groove to provide at least one polishing zone;

receiving the edge in the polishing zone; and
driving a relative motion between the at least one carrier and the edge in a second direction substantially transverse to
the first direction, wherein the relative motion further comprises a reciprocating motion.

US Pat. No. 9,627,633

PERYLENE FUNCTIONALIZED PORPHYRIN DYES FOR DYE-SENSITIZED SOLAR CELLS

Agency for Science, Techn...

1. A dye-sensitized solar cell comprising a dye molecule of Formula (I):

wherein:
M is zinc, cobalt, nickel, iron, or copper;
each of L1 and L2 is a linker and is independently selected from the group consisting of a direct bond and an ethynylene group;

each of R1, R2, R3, R4, R5, R6, R7, R8 is independently selected from the group consisting of hydrogen, halogen, C1-30 alkyl, and C6-C20 aryl;

each of R9 and R10 is independently a substituted or unsubstituted phenyl, or a substituted or unsubstituted benzyl;

AG is an anchor group for attachment to a substrate; and
Pery is a perylene-based moiety of Formula (II):

wherein:
each of R11 and R12 is independently a substituted or unsubstituted phenyl, or a substituted or unsubstituted benzyl.

US Pat. No. 9,510,121

TRANSDUCER AND METHOD OF CONTROLLING THE SAME

Agency for Science, Techn...

1. A transducer, comprising:
a substrate; and
a diaphragm suspended from the substrate, wherein the diaphragm is displaceable in response to an acoustic signal impinging
on the diaphragm,

wherein the transducer is configured,
in a first mode of operation, to determine a direction of the acoustic signal based on a first displacement of the diaphragm
in the first mode of operation, and to decide to accept or reject the acoustic signal based on at least one predetermined
parameter and the determined direction of the acoustic signal, wherein the at least one predetermined parameter comprises
a directivity pattern of the transducer and a predetermined angle of incidence threshold value for the acoustic signal, and

in a second mode of operation, to sense the acoustic signal based on a second displacement of the diaphragm in the second
mode of operation if the acoustic signal is accepted in the first mode of operation, thereby retrieving encoded information
in the acoustic signal.

US Pat. No. 9,506,823

BONDING STRESS TESTING ARRANGEMENT AND METHOD OF DETERMINING STRESS

Agency for Science, Techn...

1. A bonding stress testing arrangement, comprising:
at least one bond pad;
a sensor assembly comprising any one of a first sensor arrangement and a combination of the first sensor arrangement and a
second sensor arrangement;

wherein the first sensor arrangement is adapted to measure an average stress on a portion of a bonding area under the at least
one bond pad, and the second sensor arrangement is adapted to determine stress distribution over a portion or an entire of
the bonding area under the at least one bond pad;

wherein the first sensor arrangement comprises a plurality of sensors disposed on a portion of the bond pad;
wherein the plurality of sensors of the first sensor arrangement comprises sensors of a first polarity and sensors of a second
polarity disposed on the portion of the bond pad and are arranged such that a sensor of the first polarity is placed adjacent
to a sensor of the second polarity and the sensor of the second polarity is placed adjacent to a further sensor of the first
polarity;

wherein the first polarity comprises n-type conductivity and the second polarity comprises p-type conductivity, or the first
polarity comprises p-type conductivity and the second polarity comprises n-type conductivity.

US Pat. No. 9,506,110

PROCESSING OF AMPLIFIED DNA FRAGMENTS FOR SEQUENCING

Agency for Science, Techn...

1. A method of trimming nucleic acid fragments for sequencing comprising the steps of:
(a) amplifying a nucleic acid fragment with a primer comprising a sequence substantially complementary to a target sequence
and a first recognition site for a restriction enzyme;

(b) digesting the amplified nucleic acid fragment with a first restriction enzyme to remove the primer of the nucleic acid
fragment thereby exposing the target sequence;

(c) ligating the target sequence with an adaptor comprising a second recognition site for a restriction enzyme, thereby producing
a ligated sequence; and

(d) digesting the ligated sequence with a second restriction enzyme at the ligated sequence for further trimming the nucleic
acid fragment for sequencing.

US Pat. No. 9,441,032

BINDING MOLECULES AGAINST CHIKUNGUNYA VIRUS AND USES THEREOF

Agency for Science, Techn...

1. An isolated antibody or antigen binding fragment thereof, wherein said antibody or antigen binding fragment thereof comprises
a heavy chain amino acid sequence that comprises the CDRH1 depicted as SEQ ID NO: 30, the CDRH2 depicted as SEQ ID NO: 32,
and the CDRH3 depicted as SEQ ID NO: 34, and a light chain amino acid sequence that comprises the CDRL1 depicted as SEQ ID
NO: 36, the CDRL2 depicted as SEQ ID NO: 38, and the CDRL3 depicted as SEQ ID NO: 40, wherein said antibody or antigen binding
fragment thereof comprises a variant Fc region that has been molecularly engineered by the alteration of one or more amino
acids relative to naturally occurring Fc regions.

US Pat. No. 9,362,126

PROCESS FOR MAKING A PATTERNED METAL OXIDE STRUCTURE

AGENCY FOR SCIENCE, TECHN...

1. A process for making a patterned metal oxide structure comprising the steps of:
(a) polymerizing a resist mixture, while in contact with a mold having imprint forming patterns thereon, to thereby form an
imprint structure comprising a polymerized organometallic compound, said resist mixture comprising at least one olefinic polymerizable
compound and a polymerizable organometallic compound having at least one carboxylate of Formula 1:


wherein
n is 1-12; and
each R is independently selected from the group consisting of hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, cycloakenyl,
aryl, and aralkyl; and

(b) heating said imprint structure to remove organic material and thereby form said patterned metal oxide structure.

US Pat. No. 9,335,263

OPTICAL CIRCUIT FOR SENSING A BIOLOGICAL ENTITY IN A FLUID AND METHOD OF CONFIGURING THE SAME

Agency for Science, Techn...

1. An optical circuit for sensing a biological entity in a fluid, comprising:
a sensing arrangement comprising:
a reference arm having a reference waveguide;
a sensing arm having a waveguide;
a sensing window extending across the reference arm and the sensing arm; and
a further sensing arrangement coupled to the sensing arrangement, the further sensing arrangement comprising:
a reference arm having a reference waveguide; and
a sensing arm having a waveguide;
wherein lengths of the reference waveguide and the waveguide of the sensing arrangement are configured in accordance with
a temperature dependency reduction criterion, and

wherein the further sensing arrangement is covered with a cladding layer.

US Pat. No. 9,204,322

COMMUNICATION DEVICES AND METHODS FOR PERFORMING COMMUNICATION

Agency for Science, Techn...

1. An infrastructure station in a cellular mobile communication system, the infrastructure station comprising:
an infrastructure station core configured to provide infrastructure station functionality to a plurality of dependent stations;
a topographer configured to discover a network topology and designate a failover topology from the network topology for use
in the event that the infrastructure station fails thereby no longer being capable of providing infrastructure station functionality
to the plurality of dependent stations, the failover topology comprising failover stations; and

a synchronizer configured to periodically provide timing estimates of dependent stations to failover stations such that network
reentry after infrastructure station failure is shorter than normal network entry;

wherein the infrastructure station is configured to process a SBC-REQ message from a dependent station when a dependent station
performs network entry and requests infrastructure station functionality from the infrastructure station, the SBC-REQ message
indicating that the dependent station is capable of being a failover station.

US Pat. No. 9,157,861

SENSOR AND METHOD OF DETECTING A TARGET ANALYTE

Agency for Science, Techn...

1. A sensor, comprising:
a substrate;
a layer comprising a plurality of through holes, wherein the layer is disposed above the substrate;
a first element configured to detect a target analyte; and
a second element that can produce a detectable signal;
wherein the first element and the second element are configured to couple the target analyte between the first element and
the second element,

the first element is disposed adjacent to the layer, and
the first element and the second element are arranged within the through holes of the layer.
US Pat. No. 9,145,546

METHODS OF PROLIFERATING STEM CELLS

Agency for Science, Techn...

1. An in vitro culture of mesenchymal stem cells, the cell culture comprising:
(i) an isolated CD34+ fraction of multipotent human mesenchymal stem cells (hMSCs) expressing STRO-1 and having an ability
to generate cartilage, bone, muscle, tendon, ligament and fat, and

(ii) a cell culture medium comprising isolated heparin sulfate 2 (HS2) at a concentration that ranges between about 6.4 ng/ml
to 20 ?g/ml culture media, wherein hMSCs cultured in contact with HS2 for a given period of time undergo more population doubling
than hMSCs without HS2.

US Pat. No. 9,945,968

FORCE FEEDBACK ELECTRODES IN MEMS ACCELEROMETER

PGS Geophysical AS, Oslo...

1. A method, comprising:towing a streamer behind a survey vessel in a body of water, wherein the streamer includes an accelerometer, the accelerometer including:
a proof mass;
a first plurality of sense electrodes disposed on a first side of the proof mass;
a second plurality of sense electrodes disposed on a second, opposite side of the proof mass;
wherein, in response to the proof mass moving in a particular direction along an axis perpendicular to the first and second sides of the proof mass, an electrical characteristic associated with the first plurality of sense electrodes is configured to increase, and a corresponding electrical characteristic associated with the second plurality of sense electrodes is configured to decrease;
detecting the electrical characteristics associated with the first and second pluralities of sense electrodes;
applying a feedback force to the proof mass via at least one feedback capacitor, wherein the feedback force is based on the detected electrical characteristics; and
determining an acceleration of the accelerometer based on the feedback force.
US Pat. No. 9,539,222

METHODS TO INHIBIT INTRACELLULAR GROWTH OF BACTERIA AND TO TREAT BACTERIA-MEDIATED DISEASES

Agency for Science, Techn...

1. A method of preventing, treating or inhibiting mycobacterial infections, the method comprising administering at least one
of the compounds selected from the group consisting of:
N,N-dimethyl imidodicarbonimidic diamide hydrochloride (Metformin);
3,5,4?-trihydroxy-trans-stilbene (Resveratrol);
methyl 2,6-dimethyl-5-nitro-4-[2-(trifluoromethyl)phenyl]-1,4-dihydropyridine-3-carboxylate (Bay K8644);
2,5-Dimethyl-4-[2-(phenylmethyl)benzoyl]-1H-pyrrole-3-carboxylic acid methyl ester (FPL 64176);
2?,5?-Dideoxyadenosine;
4-[4-(4-chlorophenyl)-4-hydroxypiperidin-1-yl]-N,N-dimethyl-2,2-diphenylbutanamide hydrochloride (Loperamide);
(5R,6S,8S)-Hexyl 6-hydroxy-5-methyl-13-oxo-6,7,8,13,14,15-hexahydro-5H-16-oxa-4b,8a,14-triaza-5,8-methanodibenzo[b,h]cycloocta[jkl]cyclopenta[e]-as-indacene-6-carboxylate
(KT 5720);

N-(dicyclopropylmethyl)-4,5-dihydro-1,3-oxazol-2-amine (Rilmenidine);
3-(2-methoxyethyl) 5-propan-2-yl 2,6-dimethyl-4-(3-nitrophenyl)-1,4-dihydropyridine-3,5-dicarboxylate (Nimodipine);
(RS)-ethyl methyl 2,6-dimethyl-4-(3-nitrophenyl)-1,4-dihydropyridine-3,5-dicarboxylate (Nitrendipine);
(2-{4-[(2-butyl-1-benzofuran-3-yl)carbonyl]-2,6-diiodophenoxy}ethyl)diethylamine (Amiodarone); and
[(2R,3S,4R,5R)-5-(4-Carbamoyl-5-aminoimidazol-1-yl)-3,4-dihydroxyoxolan-2-yl]methyl dihydrogen phosphate (AICAR), to a patient
in need thereof, wherein the method further comprises administration of an anti-tuberculosis drug, wherein the anti-tuberculosis
drug is selected from the group consisting of isoniazid, pyrazinamide, rifampicin, ethionamide, rifabutin, amikacin, ethambutol,
PA824, bedaquiline, streptomycin, kanamycin, and fluoroquinolone antibiotic or a combination thereof.

US Pat. No. 9,505,612

METHOD FOR THIN FILM ENCAPSULATION (TFE) OF A MICROELECTROMECHANICAL SYSTEM (MEMS) DEVICE AND THE MEMS DEVICE ENCAPSULATED THEREOF

Agency for Science, Techn...

1. A method for thin film encapsulation (TFE) of a microelectromechanical system (MEMS) device, comprising:
providing a silicon-on-insulator (SOI) substrate comprising a silicon substrate layer, an insulator layer and a silicon layer;
forming a MEMS device in the silicon layer of the SOI substrate;
forming one or more etching channels adjacent to the MEMS device;
then providing one or more cavities below the MEMS device; and
then forming one or more cavities above the MEMS device,wherein forming the one or more etching channels comprises forming one or more sidewall etching channels in the substrate
by partially etching the silicon layer at a periphery of the MEMS device.

US Pat. No. 9,445,716

OBTAINING DATA FOR AUTOMATIC GLAUCOMA SCREENING, AND SCREENING AND DIAGNOSTIC TECHNIQUES AND SYSTEMS USING THE DATA

Agency for Science, Techn...

1. A method of processing a non-stereo fundus image to identify whether a plurality of glaucoma indicators are present, the
method comprising:
performing a texture analysis by extracting numerical parameters from the fundus image;
determining whether the numerical parameters meet a quality criterion; and
only if the determination indicates that the numerical parameters meet the quality criterion, analyzing the fundus image by
a plurality of image processing algorithms to determine whether the glaucoma indicators are present.

US Pat. No. 9,419,412

INTEGRATED LASER AND METHOD OF FABRICATION THEREOF

Agency for Science, Techn...

1. An integrated laser, comprising:
a semiconductor waveguide having a first section, a second section and a third section;
an active region formed on the third section of the semiconductor waveguide, the active region configured for generating light;
and

a coupler formed on the second section of the semiconductor waveguide, the coupler configured for coupling said light between
the semiconductor waveguide and the active region,

wherein the first section comprises a multi-branch splitter having a ring structure formed between two branches of the multi-branch
splitter for emission wavelength control of the integrated laser.

US Pat. No. 9,359,452

ISOLATION AND CHARACTERISATION OF HEPARAN SULPHATES AND THEIR USE IN PHARMACEUTICAL COMPOSITIONS, METHODS OF TREATMENT AND STEM CELL CULTURE MEDIA SUITABLE FOR CONDITIONS ASSOCIATED WITH BONE REPAIR

Agency for Science, Techn...

1. A method of treating a bone fracture in a patient, the method comprising administration of a therapeutically effective
amount of male mouse liver heparan sulphate (MML HS) to the patient wherein the MML HS has N-sulfation of between about 14%
and about 22%.
US Pat. No. 9,309,314

POLYPEPTIDES, NUCLEIC ACIDS AND USES THEREOF

1. An ELABELA polypeptide fragment comprising a sequence CXXXRCXXXHSRVPFP (SEQ ID NO: 1), wherein X is an/any amino acid residue,
said polypeptide fragment further comprising a label, wherein an intramolecular covalent bond is present between the cysteine
residues at positions 1 and 6 of SEQ ID NO: 1, and wherein the polypeptide fragment maintains self-renewal, pluripotency,
or both of a stem cell.

US Pat. No. 9,211,176

ADHESIVE STRUCTURE WITH STIFF PROTRUSIONS ON ADHESIVE SURFACE

ETHICON ENDO-SURGERY, INC...

1. A method of forming a laminate of a surgical mesh having first and second surfaces, and an adhesive structure having adhesive
and non-adhesive surfaces, comprising:
a) providing a first solvent-dissolvable mold including indentations;
b) providing a first meltable polymer having a Young's modulus of greater than 17 MPa to the first mold under conditions sufficient
to permit filling the indentations of the first mold by the first polymer, said first polymer being non-dissolvable by the
solvent;

c) treating the first mold and first polymer of step b) to an extent sufficient to solidify the first polymer;
d) laminating a surgical mesh, also non-dissolvable by said solvent, to an exposed surface of said first meltable polymer
at the top of said first mold; and

e) exposing the first mold, first polymer and surgical mesh to the solvent under mold-dissolving conditions to dissolve said
first mold.

US Pat. No. 9,120,841

AMPHIPHILIC LINEAR PEPTIDEPEPTOID AND HYDROGEL COMPRISING THE SAME

Agency for Science, Techn...

1. A hydrogel comprising at least one amphiphilic peptide and/or peptoid capable of self-assembling into three-dimensional
macromolecular nanofibrous networks, which entrap water and form a hydrogel, the amphiphilic peptide and/or peptoid comprising
an amphiphilic sequence consisting of:
a hydrophobic sequence stretch of n aliphatic L or D amino acids, wherein n is an integer from 2 to 6, and
a hydrophilic sequence stretch linked to the hydrophobic sequence stretch and having a polar moiety which is acidic, neutral
or basic, the polar moiety comprising m adjacent hydrophilic L or D amino acids, wherein m is an integer from 1 to 2,

wherein the amphiphilic peptide and/or peptoid has a C-terminus and an N-terminus, wherein the N-terminus is protected by
an N-terminal protecting group, or wherein N-terminus is protected by an N-terminal protecting group and the C-terminus is
protected by a C-terminal protecting group.

US Pat. No. 9,115,340

MICROFLUIDIC CONTINUOUS FLOW DEVICE

1. A microfluidic continuous flow device comprising:
a channel comprising (i) a compartment which is defined by partitioning elements and (ii) a space outside said compartment;
wherein through passages which are formed between said partitioning elements are dimensioned to retain a biological material
and a sustained release composition within said compartment, wherein the biological material is optionally a cellular biological
material and wherein said sustained release composition is adapted to release at least one substance which supports cultivation
of said biological material;

wherein said channel has (i?) a first inlet to said compartment for introducing said biological material into said compartment,
(ii?) a second inlet for introducing a cultivation medium into said space of said channel outside of said compartment, and
(iii?) an outlet;

wherein said second inlet and said outlet are arranged to allow a flow of said cultivation medium through said channel; and
wherein said partitioning elements are pillars; and
wherein a side of said compartment facing said space is defined by the partitioning elements and another side of said compartment
is defined by a circumferential wall of said channel.

US Pat. No. 9,067,084

AMPHIPHILIC LINEAR PEPTIDE/PEPTOID AND HYDROGEL COMPRISING THE SAME

AGENCY FOR SCIENCE, TECHN...

1. An amphiphilic peptide and/or peptoid capable of forming a hydrogel, the amphiphilic peptide and/or peptoid comprising
an amphiphilic sequence consisting of:
a hydrophobic sequence stretch of n non repetitive aliphatic amino acids, such that two aliphatic amino acids coupled to each
other are always different from one another, wherein n is an integer from 4 to 6, wherein all or a portion of the aliphatic
amino acids of the hydrophobic sequence stretch are arranged in an order of decreasing amino acid size in the direction from
N- to C-terminus of the amphiphilic peptide and/or peptoid, wherein the size of the aliphatic amino acids is defined as I=L>V>A>G,
and

a polar moiety linked to said hydrophobic sequence stretch which is acidic, neutral or basic, said polar moiety consisting
of m adjacent hydrophilic amino acid, wherein m is 1,

wherein said hydrophobic sequence stretch comprises and/or forms the N-terminus of the amphiphilic peptide and/or peptoid
and said polar moiety consists of one amino acid positioned at the C-terminus of the amphiphilic peptide and/or peptoid,

and wherein the N-terminus of the amphiphilic sequence carries a protecting group.

US Pat. No. 9,955,687

POLYMERIC FILM SURFACE

AGENCY FOR SCIENCE, TECHN...

1. A polymeric film, comprising:a surface,
wherein the surface of the polymeric film comprises an array of patterned structures,
wherein topographies of the array of patterned structures are selected and arranged so that when the surface of the polymeric film is rinsed and/or dipped in a fluid, the array of patterned structures induces a turbulent fluid flow and removes biological material thereon, and
wherein when a predetermined space or a predetermined width of the topographies of the polymeric film is larger than a diameter or dimension of the biological material, the rinsed and/or dipped surface of the polymeric film is characterized such that it exhibits a reduced attachment of the biological material.

US Pat. No. 9,672,226

METHOD TO IDENTIFY AN OBJECT AND A SYSTEM FOR DOING THE SAME

Agency for Science, Techn...

1. A method to identify an object comprising:
receiving an image, the image having an object in front of a background;
segmenting the image into a segmented image using a segmentation technique, the segmented image having a foreground component
showing at least a part of the object and a background component showing at least a part of the background; determining at
least one property of the foreground component of the segmented image; and

matching the at least one property of the foreground component with a database of identified objects having the corresponding
at least one property to identify the object;

wherein determining the at least one property of the foreground component comprises:
identifying a contour of the foreground component;
identifying a plurality of points along the contour of the foreground component;
selecting a shape out a plurality of predefined shapes based on the plurality of points, wherein the at least one property
of the foreground component comprises the shape selected based on the plurality of points; and

reducing the plurality of points identified comprising:
selecting a point;
identifying a first neighboring point nearest the selected point;
identifying a second neighboring point the second next nearest the selected point;
determining an angle between a first line drawn between the selected point and the first neighboring point and a second line
drawn between the selected point and the second neighbouring point; and

removing the selected point if the angle exceeds a predetermined value.

US Pat. No. 9,631,050

ANTIMICROBIAL CATIONIC POLYCARBONATES

International Business Ma...

1. An antimicrobial cationic polymer of formula (12):
Zc—Pb—C?—Pb—Zc  (12),

wherein
C? is a C2-C15 divalent linking group joining polymer chains Pb, wherein C? comprises i) a first heteroatom linked to a first polymer chain Pb, wherein the first heteroatom is selected from the group consisting of nitrogen, oxygen, and sulfur, and ii) a second heteroatom
linked to a second polymer chain Pb, wherein the second heteroatom is selected from the group consisting of nitrogen, oxygen, and sulfur,

each Zc is an independent monovalent end group selected from the group consisting of hydrogen and C1-C15 moieties,

each polymer chain Pb consists essentially of cationic carbonate repeat units, wherein i) the cationic polymer comprises a total of 5 to about 45
cationic carbonate repeat units, ii) each of the cationic carbonate repeat units comprises a) a backbone portion of the polymer
chain comprising an aliphatic carbonate group, and b) a cationic side chain linked to the backbone portion, and iii) the cationic
side chain comprises a positive-charged heteroatom Q? of a quaternary ammonium group and/or quaternary phosphonium group,

about 25% to 100% of all the cationic carbonate repeat units of the cationic polymer, designated first cationic carbonate
repeat units, have a structure selected from the group consisting of


and combinations thereof, wherein X? is a negative-charged ion, and

0% to about 75% of the cationic carbonate repeat units of the cationic polymer, designated second cationic carbonate repeat
units, have a cationic side chain comprising 6 to 9 carbons.

US Pat. No. 9,580,513

VHZ FOR DIAGNOSIS AND TREATMENT OF CANCERS

1. A method of treatment of a metastatic cancer in which VHZ is overexpressed in a subject, said method comprising administering
an anti-VHZ antibody or a fragment thereof that binds to a VHZ polypeptide comprising the amino acid sequence of SEQ ID NO:
2 to the subject, wherein said anti-VHZ antibody or fragment thereof:
comprises VH domain comprising the amino acid sequence of SEQ ID NO: 4 and a VL domain comprising the amino acid sequence of SEQ ID NO: 5; and

inhibits tumor formation by VHZ expressing human tumor cells in a nude mouse model.

US Pat. No. 9,487,724

LUBRICANTS FOR MAGNETIC RECORDING MEDIA

Agency for Science, Techn...

1. A compound of formula (I)

wherein
n is 1 to 6;
Rf is selected from the group consisting of CF2CF2O(CF2CF2CF2O)mCF2CF2 wherein m is 2 to 30 and CF2(OCF2CF2)rO(CF2)s wherein r is 2 to 30 and s is 0, 1, 2, or 3.

US Pat. No. 9,354,283

SENSOR AND METHOD OF CONTROLLING THE SAME

Agency for Science, Techn...

1. A sensor for determining a property of a magnetic field, the sensor comprising:
a substrate;
a beam suspended from the substrate; and
a plurality of conductive lines arranged on the beam, wherein the plurality of conductive lines are arranged at least substantially
parallel to a longitudinal axis of the beam,

wherein the substrate comprises a first edge portion and a second edge portion, the first edge portion and the second edge
portion arranged adjacent opposite sides of the beam,

wherein the plurality of conductive lines form part of a continuous line arrangement, the continuous line arrangement being
wound around the beam, the first edge portion and the second edge portion such that the plurality of conductive lines are
connected to each other in series to conduct a same current in series through the plurality of conductive lines,

wherein the beam is adapted to be displaced in response to the same current flowing through the plurality of conductive lines,
and a magnetic field interacting with the beam, and

wherein the sensor is configured to determine the property of the magnetic field based on the displacement of the beam.
US Pat. No. 9,321,845

ANTIBODIES BINDING TO AN INTRACELLULAR PRL-1 OR PRL-3 POLYPEPTIDE

AGENCY FOR SCIENCE, TECHN...

1. A method of treatment comprising administering a therapeutically effective amount of an antibody selected from the group
consisting of:
(a) an antibody which binds to PRL-1 comprising a heavy chain variable region sequence comprising SEQ ID NO: 2 and a light
chain variable region sequence comprising SEQ ID NO: 4

(b) an antigen binding fragment of (a);or a pharmaceutical composition comprising such an antibody to an individual suffering from a PRL-1-expressing cancer.

US Pat. No. 9,166,167

P-TYPE MATERIALS AND ORGANIC ELECTRONIC DEVICES

Agency for Science, Techn...

1. A compound of formula I:
wherein
Y is P, S or Se;
each R? and R? is independently H or a hydrocarbon optionally containing one or more heteroatoms in the backbone;
each Ar1 and Ar2 is independently arylene, heteroarylene, —CH?CH—, —C?C—, —CH?N—, —N?N— or —N?P—, any of which may be optionally substituted;

each Ar3 is independently one of the following A1 to A3, A8, A9, A11, A13 A17 and A19 to A22 groups:


each of R1, R2, R3 and R4 a hydrogen; straight or branched alkyl or heteroalkyl having from 1 to 40 backbone atoms; or aryl or heteroaryl having from
5 to 40 backbone atoms, any of which may be optionally substituted with one or more F, Cl, CN, CO2H, SO3H or NO2 groups;

X is O, S or Se;
each a and b is an integer from 0 to 20;
each c and m is an integer from 1 to 20; and
n is an integer from 2 to 5000.

US Pat. No. 9,148,323

TRANSMITTER

Agency for Science, Techn...

1. A transmitter comprising:
a frequency shift keying (FSK) circuit; and
a phase shift keying (PSK) circuit coupled in series to the FSK circuit;
wherein the FSK circuit is configured, in a first mode of operation, to provide a FSK modulated signal to the PSK circuit,
and, in a second mode of operation, to provide a fixed frequency signal to the PSK circuit, and

wherein the PSK circuit is configured, in the first mode of operation, to transmit the FSK modulated signal, and, in the second
mode of operation, to provide a PSK modulated signal based on the fixed frequency signal received from the FSK circuit,

wherein the FSK circuit comprises:
an oscillator coupled to the PSK circuit, wherein the oscillator is configured for injection-locking of a frequency of the
FSK modulated signal or the fixed frequency signal to a frequency of an injection signal to be inputted into the oscillator;
and

a finite impulse response (FIR) filter configured to generate the injection signal, the injection signal having a frequency
that depends on input signals to the FIR filter.

US Pat. No. 9,123,884

MAGNETORESISTIVE DEVICE AND A WRITING METHOD FOR A MAGNETORESISTIVE DEVICE

Agency for Science, Techn...

1. A magnetoresistive device, comprising:
at least two ferromagnetic soft layers;
wherein the at least two ferromagnetic soft layers have different ranges of magnetization switching frequencies.
US Pat. No. 9,089,628

BIODEGRADABLE AND BIOCOMPATIBLE SHAPE MEMORY POLYMERS

Agency for Science, Techn...

1. A shape memory block copolymer comprising:
at least one switching segment having a Ttrans from 10 to 70° C.; and

at least one soft segment comprising a poly(dimethylsiloxane) (PDMS);
wherein the copolymer has a molecular weight, Mw, of about 50,000 g/mol to about 1,000,000 g/mol, wherein the switching segments and soft segments are randomly arranged in
the copolymer, wherein at least one of the switching segments is linked to at least one of the soft segments by at least one
linkage, wherein the copolymer transforms from a first shape to a second shape by application of a first stimulus and the
copolymer transforms back to the first shape from the second shape by application of a second stimulus, and wherein the copolymer
has a response time of less than 10 seconds, wherein the response time is the time for the copolymer to transform back to
the first shape from the second shape after application of the second stimulus using a sample pre-stretched to 200% strain
and having dimensions of 0.4 mm×3 mm×10 mm.

US Pat. No. 9,084,735

SELF-ASSEMBLING BIS-UREA COMPOUNDS FOR DRUG DELIVERY

International Business Ma...

1. A drug composition, comprising:
a solvent; and
a drug complex dispersed in the solvent, the drug complex comprising a drug selected from the group consisting of anionic
forms of antimicrobial drugs, anionic forms of non-steroidal anti-inflammatory drugs (NSAIDs), and combinations thereof, the
drug bound by non-covalent interactions to a fiber, wherein i) the fiber has an average diameter of 4 nm to 10 nm, ii) the
fiber has an aspect ratio of 100:1 or more, iii) the fiber comprises 3 or more self-assembled molecules of a bis-urea compound
bound by non-covalent interactions, and iv) the bis-urea compound has a structure according to formula (1):

wherein
a? is 0 or 1,
each W? is an independent monovalent radical comprising a cationic group, wherein W? comprises 2 to about 25 carbons, and
each Z? is an independent monovalent radical selected from the group consisting of hydrogen, halides, and functional groups
comprising 1 to about 6 carbons.

US Pat. No. 10,141,837

DEVICE AND METHOD FOR ENERGY HARVESTING USING A SELF-OSCILLATING POWER-ON-RESET START-UP CIRCUIT WITH AUTO-DISABLING FUNCTION

Agency for Science, Techn...

1. A device for energy harvesting, comprising:a start-up circuit including a power-on reset circuit for generating a sequence of pulses to control self-oscillation of the start-up circuit, an auxiliary voltage boost circuit coupled to the power-on reset circuit and an input of the start-up circuit for boosting an input voltage of the start-up circuit, and a feedback loop including an energy source, the auxiliary voltage boost circuit and the power-on reset circuit such that the start-up circuit generates the sequence of pulses for self-oscillation through the feedback loop for initial boosting of the input voltage from the energy source;
a main boost circuit for boosting the input voltage during a steady state phase;
a clock generator circuit for generating clock signals which control voltage boosting of the main boost circuit during the steady state phase; and
a switching circuit coupled to the start-up circuit, the main boost circuit and the clock generator circuit for switching powering of the clock generator circuit between the start-up circuit and the main boost circuit such that the clock generator circuit is powered by only one of the start-up circuit and the main boost circuit at any point in time.

US Pat. No. 9,809,639

PURIFICATION OF BIOLOGICAL PRODUCTS BY CONSTRAINED COHYDRATION CHROMATOGRAPHY

AGENCY FOR SCIENCE, TECHN...

1. A method for purification of a hydrated target species of biological origin in a sample comprising the steps of contacting
the sample with a hydrated surface of an undissolved material and contacting the sample with a constraining agent in an amount
sufficient to cause more than 50% to substantially all of the target species to be retained at the hydrated surface of the
undissolved material, wherein
(i) the undissolved material comprises particles,
(ii) a surface of the particles includes charged moieties,
(iii) the target species is retained exclusively by constrained cohydration under conditions providing a substantial absence
of a direct chemical interaction between the target species and the hydrated surface, and

(iv) the conditions that provide the substantial absence of a direct chemical interaction comprise pH, conductivity and salt
concentration of buffers delivered to a column of the particles, wherein said conditions discourage direct interaction between
the hydrated target species and the charged moieties, and wherein the particles are optionally a convective chromatography
material.

US Pat. No. 9,614,599

METHOD FOR DETERMINING PRECODING MATRIXES FOR COMMUNICATION AND A SYSTEM THEREFROM

Agency for Science, Techn...

1. A method for determining precoding matrixes for a communication of a first base station and a second base station with
a first mobile station and a second mobile station, the communication comprising:
a first signal channel between the first base station and the first mobile station, a second signal channel between the first
base station and the second mobile station, a third signal channel between the second base station and the first mobile station,
and a fourth signal channel between the second base station and the second mobile station, the method comprising:

determining a first sub-set of a set of precoding matrixes based on a predetermined consideration of a signal to noise ratio
(SNR) between the first and second base stations and the first and second mobile stations, the set of precoding matrixes comprising
a first precoding matrix for the first signal channel, a second precoding matrix for the second signal channel, a third precoding
matrix for the third signal channel and a fourth precoding matrix for the fourth signal channel; and

generating a second sub-set of the set of precoding matrixes based on the first sub-set of the set of precoding matrixes determined
such that the first and second sub-sets satisfy a predetermined condition for interference alignment at the first and second
mobile stations,

wherein the predetermined consideration of SNR comprises a consideration of a first SNR at the first mobile station and a
second SNR at the second mobile station in determining the first sub-set for optimizing the first sub-set with respect the
first SNR at the first mobile station and the second SNR at the second mobile station.

US Pat. No. 9,492,952

SUPER-HYDROPHILIC STRUCTURES

ENDO-SURGERY, INC., Cinc...

1. A polydioxanone film comprising polydioxanone pillars having circular cross-sections integrally molded with and extending
from the surface of at least one side of said film, said pillars having diameters from about 0.2 ?m to about 3 ?m, and heights
of from about 2 ?m to about 20 ?m from the surface of the film, wherein the polydioxanone pillars demonstrate super-hydrophilicity.

US Pat. No. 9,307,444

SIGNALING DATA COMPRESSION/DECOMPRESSION DEVICES AND METHODS FOR WIRELESS COMMUNICATION NETWORKS

Agency for Science, Techn...

1. A compression device comprising:
a subset determination circuit configured to determine a subset of a traffic indication map, the traffic indication map comprising
a plurality of bits, each bit indicating whether data to be transmitted to a respective pre-determined radio communication
terminal is present in an access point;

a pre-determined bit value determination circuit configured to determine whether the subset comprises a bit of a pre-determined
bit value; and

a compressed string generation circuit configured to insert, if the subset comprises a bit of the pre-determined bit value,
into a compressed string the subset and an indicator indicating that the subset comprises a bit of the pre-determined bit
value, and further configured to insert, if the subset does not comprise a bit of the pre-determined bit value, into the compressed
string an indicator indicating that the subset does not comprise a bit of the pre-determined bit value,

wherein the compression device is further configured to perform compression of the indicators using the subset determination
circuit, the pre-determined bit value determination circuit, and the compressed string generation circuit.

US Pat. No. 9,210,643

COMMUNICATION TERMINAL AND METHOD FOR PERFORMING COMMUNICATION

Agency for Science, Techn...

1. A method for enabling a forwarding to network operation in a cellular mobile communication system, the cellular mobile
communication system comprising a plurality of mobile stations and at least one base station, the method comprising:
reporting forwarding capability of a first mobile station of the plurality of mobile stations with the at least one base station;
discovering neighboring mobile stations to the first mobile station;
selecting a second mobile station from the neighboring mobile stations and establishing a forwarding link between the first
mobile station and the second mobile station;

allocating radio resources for the forwarding link between the first mobile station and the second mobile station; and
synchronizing the forwarding link between the first mobile station and the second mobile station wherein synchronizing the
forwarding link between the first mobile station and the second mobile station comprises:

transmitting, from the first mobile station to the second mobile station, a first ranging code;
estimating, by the second mobile station, a time offset from the first ranging code; and
adjusting, by the second mobile station, a receiving time of the second mobile station based on the time offset.

US Pat. No. 9,202,979

VERTICAL LIGHT EMITTING DIODE WITH PHOTONIC NANOSTRUCTURES AND METHOD OF FABRICATION THEREOF

Agency for Science, Techn...

1. A method of fabricating a vertical light emitting diode comprising:
forming a light emitting diode structure including:
forming a first material layer of a first conductivity type;
forming a second material layer of a second conductivity type;
forming a light emitting layer between the first material layer and the second material layer; and
forming a plurality of generally ordered photonic nanostructures at a surface of the first material layer through which light
generated from the light emitting layer is emitted for enhancing light extraction efficiency of the vertical light emitting
diode,

wherein said forming a plurality of generally ordered photonic nanostructures comprises forming a self-assembled template
comprising generally ordered nanoparticles on said surface of the first material layer to function as a mask for forming the
photonic nanostructures at said surface of the first material layer.

US Pat. No. 9,155,707

CORE-SHELL MICROSPHERES

Agency for Science, Techn...

1. A substance comprising a plurality of microparticles, said microparticles comprising:
a core comprising a first polymer; and
a shell surrounding said core and comprising the first polymer and a second polymer, said second polymer being less rapidly
degradable than the first polymer, wherein the first polymer forms a plurality of continuous pathways through the shell.

US Pat. No. 9,087,936

SEMICONDUCTOR PHOTOMULTIPLIER DEVICE

Agency for Science, Techn...

1. A semiconductor photomultiplier device comprising:
a substrate having a front side and a back side;
a common electrode of a first conductivity type adjacent to the back side;
a cell comprising an active region of a second conductivity type adjacent to the front side; and
a contact region of the second conductivity type adjacent to the front side, the contact region being spaced apart from the
active region by a separation region,

wherein the separation region defines a resistor between the active region and the contact region to allow a current to flow
between the active region and the contact region through the separation region.

US Pat. No. 9,083,437

FRONT-END TRANSCEIVER

Agency for Science, Techn...

1. A front-end transceiver, comprising:
a receiver path, comprising:
a first receiver frequency converter configured to convert a received signal with a receiver frequency into a first receiver
intermediate signal with a first receiver intermediate frequency;

a receiver direct conversion stage coupled to the first receiver frequency converter so as to receive the first receiver intermediate
signal; and

an oscillator signal generator respectively coupled to the first receiver frequency converter and to the receiver direct conversion
stage so as to provide a first oscillator signal with a first oscillator frequency to the first receiver frequency converter
and a first stabilizing signal with a first stabilizing frequency to the receiver direct conversion stage;

wherein the first receiver frequency converter is configured so that the first receiver intermediate frequency of the first
receiver intermediate signal comprises a value of which is determined based on a deviation between the receiver frequency
of the received signal and the first oscillator frequency of the first oscillator signal;

wherein the oscillator signal generator is configured to provide the first oscillator signal with the first oscillator frequency
of 24 GHz or 36 GHz; and wherein the receiver frequency of the received signal is 60 GHz.

US Pat. No. 9,048,987

JOINT DETECTOR/ DECODER DEVICES AND JOINT DETECTION/ DECODING METHODS

Agency for Science, Techn...

1. A joint detector/decoder device comprising:
an input circuit configured to receive an input signal;
a survivor splitting circuit configured to produce a plurality of survivors of a next instance based on at least one survivor
of a previous instance and based on the input signal;

a survivor discarding circuit configured to discard survivors based on a set of predetermined criteria;
wherein each survivor has an associated bit sequence; and
wherein the set of predetermined criteria comprises a parity check based on whether the survivor's bit pattern satisfies one
or more checks of a parity check matrix.

US Pat. No. 9,854,806

ANTIMICROBIAL GUANIDINIUM AND THIOURONIUM FUNCTIONALIZED POLYMERS

International Business Ma...

1. An antimicrobial cationic polymer, comprising a cationic subunit of formula (A-1):
wherein
atoms 1-6 are backbone atoms of the cationic polymer,
m is 1 or 2,
n is 0 or 1, wherein when m is 2, n is 0,
each R? is an independent monovalent radical selected from the group consisting of hydrogen and alkyl groups comprising 1
to 6 carbons,

R? is a monovalent radical selected from the group consisting of hydrogen and alkyl groups comprising 1 to 6 carbons, and
each Q? is an independent group comprising a guanidinium and/or isothiouronium group.
US Pat. No. 9,555,163

CROSSLINKED PEPTIDE HYDROGELS

AGENCY FOR SCIENCE, TECHN...

1. A method of preparing a hydrogel, the method comprising the step of dissolving amphiphilic peptides and/or peptoids having
the general formula:
Zp—(X)n—(Y)m-AAthiol-Z?q,

wherein
Z is an N-terminal protecting group,
X is, at each occurrence, independently selected from an aliphatic amino acid,
Y is, at each occurrence, independently selected from a hydrophilic amino acid,
AAthiol is an amino acid comprising a thiol group,

Z? is a C-terminal protecting group,
n is an integer selected from 2 to 6,
m is selected from 0, 1 and 2,
and p and q are independently selected from 0 and 1, in an aqueous solution,
wherein said aqueous solution comprises an oxidizing agent or
wherein said method further comprises the step of exposing the ready-made hydrogel to a solution of an oxidizing agent.

US Pat. No. 9,538,934

BRAIN-COMPUTER INTERFACE SYSTEM AND METHOD

AGENCY FOR SCIENCE, TECHN...

1. A method of training a classification algorithm for a Brain Computer Interface (BCI), the method comprising the steps of:
dividing an Electroencephalography (EEG) signal into a plurality of time segments,
for each time segment, dividing a corresponding EEG signal portion into a plurality of frequency bands;
for each frequency band, computing a spatial filtering projection matrix based on a Common Spatial Pattern (CSP) algorithm
and a corresponding feature, and computing mutual information of each corresponding feature with respect to one or more motor
imagery classes;

for each time segment, summing the mutual information of all the corresponding features with respect to the respective classes;
selecting the corresponding features of each time segment with a maximum sum of mutual information for one class for training
classifiers of the classification algorithm; and

storing the selected corresponding features of the time segments in a computer system of the BCI,
wherein said BCI is configured to determine motor imagery of a person by using said stored selected corresponding features
in motor imagery detection.

US Pat. No. 9,511,146

VITAMIN FUNCTIONALIZED GEL-FORMING BLOCK COPOLYMERS FOR BIOMEDICAL APPLICATIONS

International Business Ma...

1. An aqueous solution for killing a microbe, comprising:
about 0.0001 wt. % to about 10 wt. % of an antimicrobial cationic polycarbonate (first drug); and
about 0.0001 wt. % to about 10 wt. % of an antimicrobial compound (second drug); wherein
weight percent (wt. %) is based on total weight of the aqueous solution,
the first drug and the second drug are associated by noncovalent interactions in the aqueous solution, and
the antimicrobial cationic polycarbonate comprises a vitamin-bearing subunit having a structure in accordance with formula
(2):

wherein
the carbonate backbone atoms are numbered 1 to 6,
Ld is a single bond or a divalent linking group comprising 1 to about 15 carbons,

V? is a moiety comprising a covalently bound form of a vitamin,
each R? is an independent monovalent radical selected from the group consisting of hydrogen, halogens, methyl, and ethyl,
R? is a monovalent radical selected from the group consisting of hydrogen and alkyl groups comprising 1 to 6 carbons,
t is a positive integer having a value of 0 to 2,
t? is a positive integer having a value of 0 to 2, and
t and t? cannot both be zero.

US Pat. No. 9,493,348

NANOPARTICULATE ENCAPSULATION BARRIER STACK

Agency for Science, Techn...

1. An encapsulation barrier stack for encapsulating at least one of a moisture and oxygen sensitive article, comprising:
a multilayer film to be arranged on a substrate, the multilayer film having at least one barrier layer having at least one
of low moisture and low oxygen permeability, and

at least one sealing layer arranged to be in contact with a surface of the at least one barrier layer, for plugging at least
one defect present in the barrier layer, wherein the at least one sealing layer comprises reactive nanoparticles interacting
by way of chemical reaction with at least one of moisture and oxygen to retard the permeation of the at least one of moisture
and oxygen through the at least one defect present in the barrier layer, wherein the nanoparticles present in the at least
one sealing layer plug the at least one defect present in the at least one barrier layer, wherein the nanoparticles have different
at least one of shapes and sizes for controlling the sealing and plugging of the at least one defect, wherein the barrier
layer comprises a material selected from indium tin oxide (ITO), TiAlN, SiO2, SiC, Si3N4, TiO2, HfO2, Y2O3, Ta2O5, and Al2O3 and wherein a permeation rate of the barrier stack having the at least one sealing layer on the surface of the at least one
barrier layer is 10?3 g/m2/day or less.

US Pat. No. 9,425,905

RECEIVER FOR BODY CHANNEL COMMUNICATION AND A METHOD OF OPERATING A RECEIVER THEREFROM

Agency for Science, Techn...

1. A receiver for body channel communication comprising:
an electrode configured to receive an incoming signal transmitted as a multi-level transmission signal from a transmitter
through a body channel;

a differentiator configured to obtain a time derivative of the incoming signal; and
an analog to digital converter configured to generate a multi-level representation signal representing the multi-level transmission
signal based on the time derivative, wherein the analog to digital converter is a multi-level detector configured to generate
a plurality of digital words by comparing each of the plurality of data transitions to a plurality of thresholds in generating
the multi-level representation signal.

US Pat. No. 9,249,383

APPARATUS FOR CULTURING ANCHORAGE DEPENDENT CELLS

1. An apparatus (1) for culturing anchorage-dependent cells, the apparatus (1) comprising a housing (2) with an inlet (4) and an outlet (5), and a plurality of culture plates (6) stacked within the housing (2),
wherein the housing (2) has a circumferential wall (7), a base (8) and a top wall (9), the base (8) comprising the inlet (4) and the top wall (9) comprising the outlet (5),

wherein the circumferential wall (7) of the housing (2) defines a longitudinal axis of the housing (2) and an inner cross section in a plane perpendicular to the longitudinal axis,

wherein the inner cross section defined by the circumferential wall (7) of the housing (2) has a shape and dimensions that are at least essentially uniform along the longitudinal axis,

wherein the culture plates (6) are arranged at least essentially parallel to each other, each culture plate (6) being mounted and sealed to the circumferential wall (7) of the housing (2) and being arranged at a distance from an adjacent culture plate (6),

wherein each culture plate (6) is mounted and sealed to the circumferential wall (7) of the housing (2) by means of a sleeve (17) of the culture plate (6), the sleeve (17) defining the circumference of the culture plate (6) and defining an annular stacking protrusion (21), the annular stacking protrusion (21) projecting along the longitudinal axis of the housing (2);

wherein each culture plate (6) of the plurality of culture plates has an upper portion (19) and a lower portion (18) spaced from the upper portion (19), the upper portion (19), the lower portion (18) and sleeve (17) define an interior compartment of the cultural plate culture plate (6), wherein the interior compartment is adapted to allow an anchorage substrate (35) to be deposited onto at least one of the upper portion (19) or the lower portion (18) between the upper portion (19) and the lower portion (18),

wherein the upper portion (19) and the lower portion (18) each comprises an aperture,

wherein each culture plate (6) has a through hole (14), formed by aligning the apertures of the upper portion (19) and lower portion (18) to be opposite each other, such that the inlet (4) and the outlet (5) of the housing (2) are in fluid communication,

wherein the through hole (14) of each culture plate (6) is positioned at an outer end of the culture plate (6), proximate the circumferential wall (7) of the housing (2), wherein the through holes (14) of adjacent culture plates (6) are distally positioned in the plane defined by the at least essentially parallel arrangement of the culture plates;

wherein the culture plate (6) is adapted to provide fluid flow into the interior compartment via an entrance only at one end of the culture plate (6) and fluid flow out of the interior compartment via an exit only at about the same end.

US Pat. No. 9,234,004

ANTIMICROBIAL PEPTIDES

Agency for Science, Techn...

1. A peptide consisting of a general formula selected from the group consisting of

wherein
X is, at each occurrence, independently selected from the group consisting of leucine (L), isoleucine (I), valine (V) and
phenylalanine (F);

Y is, at each occurrence, independently selected from the group consisting of lysine (K) and arginine (R);
Z is selected from the group consisting of cysteine (C) and methionine (M);
n is an integer number between 2 and 4; and
m is, at each occurrence, independently selected from 0 and 1, and
wherein each C-terminus of said peptide is amidated.

US Pat. No. 9,149,719

DEVICE AND METHOD FOR GENERATING A REPRESENTATION OF A SUBJECT'S ATTENTION LEVEL

AGENCY FOR SCIENCE, TECHN...

16. A method for generating a representation of a subject's attention level, the method comprising the steps of:
using a computing system:
measuring brain signals from the subject;
extracting temporal features from the brain signals;
classifying the extracted temporal features using a classifier to give a score x1;

extracting spectral-spatial features from the brain signals;
selecting spectral-spatial features containing discriminative information between concentration and non-concentration states
from the set of extracted spectral-spatial features;

classifying the selected spectral-spatial features using a classifier to give a score x2;

combining the scores x1 and x2 to give a single score; and

presenting said single score to the subject.

US Pat. No. 9,915,670

METHOD OF DETECTING HYDROGEN PEROXIDE

Nanyang Technological Uni...

1. A method of detecting one or more analytes comprising hydrogen peroxide using surface enhanced Raman spectroscopy (SERS),
the method comprising
a) providing a SERS-active substrate having at least one metal carbonyl cluster compound attached thereon;
b) contacting the one or more analytes with the SERS-active substrate; and
c) detecting changes in surface enhanced Raman signal from the at least one metal carbonyl cluster compound as an indication
of the presence of the one or more analytes comprising hydrogen peroxide.

US Pat. No. 9,858,678

METHOD AND SYSTEM FOR HUMAN MOTION RECOGNITION

Agency for Science, Techn...

1. A method for human motion recognition comprising:
decomposing a video sequence into a plurality of atomic actions;
extracting features from each of the plurality of atomic actions, the features comprising at least a motion feature and a
shape feature; and

performing motion recognition for each of the plurality of atomic actions in response to the features, wherein the step of
performing motion recognition for each of the plurality of atomic actions comprises performing motion recognition for each
of the plurality of atomic actions by convolving histograms of the features of each of the plurality of atomic actions.

US Pat. No. 9,493,424

ANTIFUNGAL COMPOUND

Agency for Science, Techn...

1. A method of treating or preventing a fungal infection caused by Aspergillus niger, comprising the step of administering an antifungal amount of a compound to a patient in need thereof, said compound having
the general formula (I):

wherein:
R1 and R2 are each independently selected from aryl, arylalkyl, alkylarylalkyl, alkylaryl, alkyl, cycloalkyl, alkenyl or alkynyl,

said aryl, arylalkyl, alkylarylalkyl or alkylaryl being optionally substituted by alkyl, alkenyl or alkynyl;
each R3 is independently selected from hydrogen, alkyl, alkenyl, alkynyl, aryl, cycloalkyl, heteroaryl, or heterocyclyl;

R4 is selected from hydrogen or aryl, said aryl being optionally substituted by alkyl, alkenyl or alkynyl;

is either a single bond or a double bond;
q is an integer selected from 0 to 3;
m is an integer selected from 0 to 3;
p is an integer selected from 2 to 50; and
X? is a counterion.

US Pat. No. 9,489,950

METHOD AND SYSTEM FOR DUAL SCORING FOR TEXT-DEPENDENT SPEAKER VERIFICATION

Agency for Science, Techn...

1. A speaker verification method comprising:
receiving an utterance from a speaker by an audio receiving device;
determining a text-independent speaker verification score in response to the utterance using a processor coupled to the audio
receiving device to determine the text-independent speaker verification score in response to a speaker-dependent text-independent
Gaussian Mixture Model (GMM) of the utterance;

determining a text-dependent speaker verification score in response to the utterance using the processor to determine the
text-dependent speaker verification score in response to a continuous density Hidden Markov Model (HMM) of the utterance aligned
by a Viterbi decoding;

determining a Universal Background Model (UBM)-independent speaker-dependent normalized score in response to a relationship
between the text-dependent speaker verification score and the text-independent speaker verification score using the processor,
the relationship being based on a difference between the text-dependent speaker verification score and the text-independent
speaker verification score; and

determining speaker verification in response to the UBM-independent speaker-normalized score.

US Pat. No. 9,357,938

METHOD AND SYSTEM FOR MOTOR REHABILITATION

Agency for Science, Techn...

1. A method of calibrating a motor imagery detection module, the method comprising,
acquiring Electroencephalography (EEG) data from a subject;
decomposing the acquired EEG data into a plurality of frequency and time segment components;
computing a projection matrix for spatial filtering for each of the plurality of frequency and time segment components;
selecting classification features from the plurality of frequency and time segment components; and
calibrating the motor imagery detection module using the selected classification features,
wherein the feature selection comprises using a multi-modal model for an idle state ?n of the subject including M sub-classes ?j, j=1, . . . , M.

US Pat. No. 9,248,200

METHOD OF DELIVERING AN ANTI-CANCER AGENT TO A CELL

Agency for Science, Techn...

1. A micellar nanocomplex comprising:
trastuzumab; and
a conjugate of:
(i) aldehyde-terminated polyethylene glycol; and
(ii) a flavonoid that is either monomeric (?)-epigallocatechin gallate or oligomeric (?)-epigallocatechin gallate,the micellar nanocomplex having the polethylene glycol conjugated at the C6 and/or the C8 position of the A ring of the flavonoid
by attachment of the polyethylene glycol via reaction of the free aldehyde group with the C6 and/or C8 position of the A ring
of the flavonoid, and exhibiting an anti-cancer effect on a cell as a result of a synergistic effect between the anti-cancer
effect of the trastuzumab and the anti-cancer effect of the flavonoid,wherein when the flavonoid is monomeric (?)-epigallocatechin gallate, the micellar nanocomplex further comprises non-conjugated
oligomeric (?)-epigallocatechin gallate in an inner core of the micellar nanocomplex,wherein the trastuzumab is complexed with either the conjugated or non-conjugated oligomeric (?)-epigallocatechin gallate,
whichever is present.
US Pat. No. 9,175,278

METHOD OF PRODUCING RECOMBINANT PROTEINS WITH MANNOSE-TERMINATED N-GLYCANS

Agency for Science, Techn...

1. A method of expressing a recombinant protein comprising mannose-terminated N-glycans from a host cell, the method comprising:
(a) introducing a nucleic acid encoding a recombinant protein into a host cell comprising a mutation in the GnT I gene leading
to loss of GnT I function, the host cell is a Chinese Hamster Ovary (CHO) cell selected with Ricinus communis agglutinin I (RCA-I) or a descendent thereof; and

(b) expressing the recombinant protein from the host cell, in which the expressed recombinant protein comprises mannose-terminated
N-glycans structure

in which the method does not include a step of introducing functional GnT I into the host cell.

US Pat. No. 9,139,924

SYSTEMS AND PROCESSES FOR FORMING MOLDS SUCH AS NICKEL MOLDS

Agency for Science, Techn...

1. A method comprising:
selecting a metal and a corresponding etchant such that said etchant selectively etches said metal over nickel;
sputtering said metal onto a surface of a template having nano-structures to form a sacrificial layer covering said nano-structures;
electroplating nickel onto said sacrificial layer to form a nickel mold, leaving a portion of said sacrificial layer exposed;
and

contacting said sacrificial layer with said etchant through said exposed portion of said sacrificial layer to etch away said
sacrificial layer until said nickel mold is separated from said template, said nickel mold having a front side having nano-structures
and a back side opposite said front side; and

replicating said nickel mold by electroplating to produce a replicate mold having nano-structures that match said nano-structures
on said template, wherein said replicating comprises:

placing said nickel mold in an opening of a metal base sized to receive said nickel mold, wherein a conductive film is sandwiched
between said nickel mold and said metal base; and

electroplating nickel onto said nickel mold and said metal base to form said replicate mold, wherein said replicate mold is
larger than said nickel mold.

US Pat. No. 9,062,160

CATALYST-FREE METHODS OF FORMING POLYURETHANES FROM PENTAFLUOROPHENYL CARBONATES

International Business Ma...

1. A method, comprising:
forming an initial emulsion by combining with agitation i) a first mixture comprising a first monomer and a water immiscible
organic solvent with ii) a second mixture comprising water and a surfactant, wherein the first monomer comprises two or more
pentafluorophenyl carbonate (PFPC) groups having the structure


combining with agitation the initial emulsion and a third mixture, the third mixture comprising water and a second monomer,
thereby forming a second emulsion that includes the first monomer and the second monomer, wherein the second monomer comprises
two or more nucleophilic amine groups, and each of the two or more nucleophilic amine groups is capable of reacting with a
respective PFPC group of the first monomer to form a respective carbamate group; and

allowing the first monomer and the second monomer of the second emulsion to react by interfacial polymerization, thereby forming
a polyurethane, wherein the polyurethane has a number average molecular weight (Mn) of about 30000 to about 80000.

US Pat. No. 9,054,694

CIRCUIT ARRANGEMENTS AND METHODS OF OPERATING THE SAME

Agency for Science, Techn...

1. A circuit arrangement comprising:
a level shifting stage configured to be coupled to a first reference voltage, the level shifting stage having an output node;
a first input electrode in electrical connection with the level shifting stage for coupling a first input voltage;
a second input electrode in electrical connection with the level shifting stage for coupling a second input voltage;
a load having a first end and a second end, the first end coupled to the level shifting stage and the second end for coupling
to a second reference voltage;

a bypass circuit element connected in parallel to the load, the by pass circuit element having a first end and a second end,
the first end coupled to the level shifting stage and a second end for coupling to the second reference voltage;

wherein the first input voltage is configured to switch between a first logic state and a second logic state and the second
input voltage is configured to switch between the second logic state and the first logic state;

wherein the level shifting stage is configured to generate a first output voltage at the output node when the first input
voltage is in the first logic state and the second input voltage is in the second logic state and the level shifting stage
is configured to generate a second output voltage at the output node when the first input voltage is in the second logic state
and the second input voltage is in the first logic state;

wherein the bypass circuit element is configured to allow current to flow through upon application of an external voltage
for bypassing the load;

wherein the level shifting stage comprises a first set of sequentially coupled pull-up and pull-down sub-circuits cross-coupled
to a second set of sequentially coupled pull-up and pull-down sub-circuits to generate a positive feedback loop;

wherein the first set of sequentially coupled pull-up and pull-down sub-circuits comprises a first pull-up transistor comprising
a control electrode, a first controlled electrode and a second controlled electrode; and a first pull-down transistor comprising
a control electrode, a first controlled electrode and a second controlled electrode;

wherein the first pull-up transistor is sequentially coupled to the first pull-down transistor by coupling the first controlled
electrode of the first pull-up transistor to the first controlled electrode of the first pull-down transistor; and

wherein the circuit arrangement further comprises a delay balancer sub-circuit coupled in parallel to the first pull-down
transistor.

US Pat. No. 10,071,115

METHOD OF PROMOTING WOUND HEALING

Agency for Science, Techn...

1. A pharmaceutical composition comprisinga) a miR-198 inhibitor and TGF-?1; or
b) a miR-198 inhibitor and a follistatin-like-1 polypeptide; or
c) a follistatin-like-1 (FSTL) polypeptide and TGF-P?1; or
d) a miR-198 inhibitor and TGF-?1 and a follistatin-like-1 (FSTL) polypeptide.

US Pat. No. 9,627,621

POLYMERIC SEMICONDUCTORS, DEVICES, AND RELATED METHODS

Agency for Science, Techn...

16. A process for forming the electronic device of claim 14, comprising:
dissolving said polymer in a solution;
applying said solution to a substrate; and
drying said solution to form a solid layer comprising said polymer.

US Pat. No. 9,581,807

SUPPLY INDEPENDENT AND PROGRAMMABLE NON-RESONANT MEMS DRIVER

Agency for Science, Techn...

1. A motor driver circuit for a Micro-electro-mechanical systems (MEMS) micro-mirror device, the motor driver circuit comprising:
a non-inverting buffer circuit;
an inverting buffer circuit; and
a scalar circuit, the scalar circuit comprising a Supply Tracked Common Mode Voltage (VCMSC) generation circuit,
wherein the VCMSC voltage is generated by the VCMSC generation circuit in response to a control supply voltage and a driver
supply voltage provided to the VCMSC generation circuit, and

wherein the non-inverting buffer circuit, the inverting buffer circuit, and the scalar circuit are configured, together with
the VCMSC generation circuit, to provide a common mode voltage to a motor in response to a VCMSC voltage generated by the
VCMSC generation circuit, the VCMSC generation circuit automatically tracking the common mode voltage independent of at least
one of variations in supply voltage to the scalar circuit and variations to the scalar gain of the scalar circuit to provide
the common mode voltage having linear direct current (DC) current-voltage characteristics to the motor for driving the motor.

US Pat. No. 9,348,832

METHOD AND DEVICE FOR REASSEMBLING A DATA FILE

Agency for Science, Techn...

1. A method for reassembling a data file from a starting file fragment and a plurality of file fragments stored on a digital
storage device, the method comprising:
determining, from the plurality of file fragments, one or more matched file fragments which match the starting file fragment
based on a first predetermined criterion;

associating the one or more matched file fragments with the starting file fragment;
determining one or more candidate data files based on the one or more matched file fragments;
checking if more than one file fragments have been determined to match the starting file fragment based on the first predetermined
criterion;

selecting a candidate data file from the candidate data files determined for the matched file fragments as the reassembled
data file based on a second predetermined criterion, if more than one matched file fragments have been determined to match
the starting file fragment based on the first predetermined criterion;

wherein determining the matched file fragments comprises determining a weight for each file fragment and selecting one or
more file fragments which match the starting fragment based on the weight of each file fragment, the weight representing a
degree of matching between the file fragment and the starting file fragment; and modifying the weights of the matched file
fragments based on the number of file fragments determined to match the starting file fragment, if more than one file fragments
have been determined to match the starting file fragment; and

determining a file fragment which matches the starting file fragment based on the modified weights and the weights of the
remaining file fragments.

US Pat. No. 9,237,560

CYCLIC PREFIX SCHEMES

AGENCY FOR SCIENCE, TECHN...

1. A method of estimating channel state information for a wireless communication channel comprising a source, a relay station
having multiple antennae and a destination, the method comprising the steps of:
a first of the antennae of the relay station receiving a first training signal from the source;
a second of the antennae of the relay station receiving a second training signal from the source;
the relay station:
(i) encoding the first training signal and the second training signal with space-time encoding to form multiple Alamouti-coded
relay training signals; and

(ii) transmitting the multiple Alamouti-coded relay training signals in at least one symbol interval; and
the destination receiving the relay training signals and from the Alamouti-coded relay training signals estimating the channel
state information, wherein the Alamouti-coded relay training signals are also used for performing carrier frequency offset
(CFO) compensation at the destination.